Downregulation of NFAT3 Due to Lack of T-Box Transcription Factor TBX5 Is Crucial for Cytokine Expression in T Cells

The NFAT family transcription factors consist of five members (NFAT1 to NFAT5) involved in the inducible expression of numerous genes associated with immune responses as well as other biological activities (1–3). NFAT1 to NFAT4 are dephosphorylated by a Ca²⁺-dependent serine/threonine phosphatase (calcineurin), and translocate into the nucleus where they bind target DNA sequences. Immunosuppressive drugs such as tacrolimus (FK506) and cyclosporin A inhibit the function of these NFATs to the same degree through inhibition of calcineurin activity (4–6).

In contrast to the functional similarity among the members of the NFAT family, differences in the physiological role of each NFAT protein have been demonstrated using a variety of transgenic and knockout mice (1–3). This contradiction can be explained, at least in part, by the fact that NFATs display distinct organ- or cell-specific expression patterns (7). NFAT2 mRNA is expressed in almost all tissues, though its expression is slightly higher in PBLs and placenta. NFAT1 is also detectable at a low level in several different tissues and is strongly expressed in skeletal muscle. NFAT4 expression is highly detectable in skeletal muscle and thymus (7). In addition, Lyakh et al. (8) demonstrated that these three members of the NFAT family were highly expressed in T cells. On the other hand, the major tissues in which NFAT3 is expressed are outside the immune system (7, 8). NFAT3 is highly expressed in the placenta, lung, kidney, testis, and ovary. In contrast, NFAT3 is hardly detectable in the spleen, thymus, and PBLs (7). Accordingly, the characteristic phenotype in the immune system is not reported in NFAT3-deficient mice. NFAT3 is involved in cardiac development as well as neuronal survival (9–12). Transgenic mice that express an activated form of NFAT3 in the heart develop cardiac hypertrophy and heart failure (9). Mice with disruption of both the NFAT3 and NFAT4 genes demonstrate embryonic lethality after embryonic day 10.5 and have thin ventricles, pericardial effusion, and a reduction in ventricular myocyte proliferation (10). Genetic knockdown of NFAT3 by RNA interference (RNAi) leads to increased apoptosis of primary granule neurons (11). However, the reason and the mechanisms for the nonexpression of NFAT3 in immune cells have not been clarified.

In order to investigate the physiological significance of the specific deficiency of NFAT3 in T cells, we comparatively examined the effects of NFAT1 and NFAT3 on cytokine synthesis in human peripheral CD4⁺ T cells as well as in a Jurkat T cell line in which NFAT3 is endogenously expressed, using overexpression and knockdown systems as well as NFAT1/NFAT3 chimeric molecules. The molecular mechanisms underlying the specific downregulation of NFAT3 in T cells were also investigated.

For the application of RNA interference technology, double-strand Stealth RNAi oligos designed using RNAi designer software (https://rnaidesigner.thermofisher.com/rnaiexpress/) were synthesized by Thermo Fisher Scientific (Waltham, MA). The target sequences for NFAT1, NFAT2, NFAT3, and NFAT4 were 5′-AUGGAUUCUGGAGCCGAGUUUCUCC-3′, 5′-AAACUGGUUAUUGUUGUGGUACAGG-3′, 5′-UCAGUGGCACCAAGGUGUUGGAGAU-3′, and 5′-GCACAUGAAGAUGACCUACAGAUAA-3′, respectively. As the control, Stealth RNAi Negative Control Duplexes (Thermo Fisher Scientific) were used. An anti-Xpress Ab was purchased from Thermo Fisher Scientific, anti-NFAT1, anti-NFAT2, anti-NFAT3, anti-Actin, anti-TBX5, and anti-Nkx2.5 Abs from Santa Cruz Biotechnology (Santa Cruz, CA), anti-CD3 mAb from Janssen Pharmaceutical (Tokyo, Japan), and anti-CD28 mAb from BD Biosciences (Franklin Lakes, NJ). The anti-NFAT4 Ab is described elsewhere (13). All the other reagents were from Sigma-Aldrich (St. Louis, MO).

The PCR fragment of cDNA encoding full-length human NFAT1 (aa 1–925), NFAT3 (1–902), and their chimeric molecules NFAT3/3/1 (NFAT3(1–685)/NFAT1(678–925)), NFAT3/1/1 (NFAT3(1–403)/NFAT1(395–925)), NFAT1/3/1 (NFAT1(1–394)/NFAT3(404–685)/NFAT1(678–925)), NFAT1/1/3 (NFAT1(1–677)/NFAT3(686–902)), NFAT1/3/3 (NFAT1(1–394)/NFAT3(404–902)), and NFAT3/1/3 (NFAT3(1–403)/NFAT1(395–677)/NFAT3(686–902)) or full-length human T-box transcription factor TBX5 (1–519) was subcloned in-frame into an appropriate site in the pEF6/His expression vector (Thermo Fisher Scientific) by which introduced cDNAs were translated as fusion proteins with an Xpress tag (Thermo Fisher Scientific). In some experiments, NFAT1, NFAT3, and TBX5 were subcloned into pMACS-k^k.II vector (Miltenyi Biotec, Bergisch Gladbach, Germany) in which the original SV40 promoter was replaced with CMV promoter or the human elongation factor 1 α promoter. As reporter constructs, the 5′-flanking regions of human NFAT1 (−2789 to +127 relative to the transcription initiation site) and NFAT3 (−2056, −518, −387, −345, −303, and −261 to +96) genes were cloned into the pGL3-basic firefly luciferase vector (Promega, Fitchburg, WI). Point mutations were introduced at −214 (A to G) and −234 (C to G) in the resulting NFAT3 (−387/+96) reporter vector. The GAPDH (−1111 to +315) gene was cloned into the Renilla luciferase vector (pRL-RSV) (Promega), and IL-2 (−418 to +2) was cloned into the pEGFP-1 vector (BD Biosciences). The 6× NFAT- and 3× AP-1-enhanced GFP (EGFP) reporter plasmids have been described previously (14). The correct sequences of all constructs were verified by sequencing.

With approval by the Ethical Review Committee of the Tokyo Metropolitan Institute of Medical Science (Tokyo, Japan), CD4⁺ T cells were prepared from the peripheral blood of healthy volunteers by positive selection using a magnetic cell sorting system (Miltenyi Biotec). The purity of resulting CD4⁺ cells was >95% as determined by flow cytometry. Then, various amounts of NFAT- or TBX5-expression pMACS-k^k.II vectors were transfected into the cells by electroporation using a Human T Cell Nucleofector kit (Lonza, Basel, Switzerland). The transfected cells were cultured in RPMI 1640 medium supplemented with 10% FBS, 2 mM l-glutamine, 1 mM sodium pyruvate, 10 mM HEPES, 1 × MEM nonessential amino acid solution, 100 U/ml penicillin G, and 100 U/ml streptomycin. After 48 h, the cells expressing the same levels of H-2K^k in NFAT- or TBX5-expression vector and control vector were processed for stimulation. Apoptotic transfected cells were identified by staining with propidium iodide (Sigma-Aldrich) and annexin-V (BioLegend, San Diego, CA).

SV40 T Ag–transfected human leukemic Jurkat T (Jurkat-TAg) cells and human aortic smooth muscle cells (ASMC) were grown in the same medium as described above. Cells in the logarithmic growth phase were transfected with various amounts of plasmid DNAs by electroporation in Jurkat-TAg cells as described previously (15) and by Lipofectamine 2000 (Thermo Fisher Scientific) in ASMC, according to the manufacturer’s instructions. In each experiment, cells in different groups were transfected with the same total amount of plasmid DNA by supplementing expression vector DNA with the proper amount of the corresponding empty vector. To introduce Stealth RNAi oligos into Jurkat-TAg cells, the same transfection was repeated after a 48 h interval. Western blot analysis against expressed and endogenous protein in whole cell lysates was performed as described previously (16).

For microarray analysis, total RNA was isolated from NFAT3-overexpressing or NFAT3-knockdown ASMC, using ReliaPrep RNA miniprep system (Promega). RNA quality was verified via microcapillary electrophoresis, using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Cy3-labeled cRNA was prepared using a Low Input Quick Amp Labeling Kit in accordance with the manufacturer’s protocol (Agilent Technologies). Samples were hybridized to the Human Gene Expression v2 Microarray (G4845A; Agilent Technologies), washed, and then scanned using a SureScan Microarray Scanner (Agilent Technologies). The microarray images were analyzed using the Feature Extraction software (Agilent Technologies). Data from each microarray analysis were normalized by global normalization. The Gene Expression Omnibus accession number for microarray data reported in this paper is GSE104661 https://www.ncbi.nlm.nih.gov/geo/.

At 48 h after the final transfection, cells were treated with 2.5 μg/ml of anti-CD3 mAb and 1 μg/ml of anti-CD28 mAb in the presence of 5 μg/ml of anti-mouse IgG crosslinking Ab (MP Biomedicals, Santa Ana, CA) or 5 nM PMA plus 1 μM ionomycin for 6 h at 37°C in the presence and absence of 2 μM monensin. Cytokine expression was analyzed by intracellular staining with anti–IL-2 (clone MQ1-17H12)-PE Ab (BD Biosciences) as described previously (14). In some experiments, stimulation was performed after purification of transfection-positive cells by positive selection using a magnetic cell sorting system with anti–H-2K^k microbeads (Miltenyi Biotech). Quantitative real-time RT-PCR for IL-2, TNF-α, IFN-γ, IL-3, IL-4, and GM-CSF was performed using Assay-on-Demand Gene Expression Products (TaqMan minor groove binder probes; Thermo Fisher Scientific) with an ABI PRISM 7900 sequence detection system (Thermo Fisher Scientific) as described previously (16). The expression levels of NFAT1, NFAT3, CASP1, CD163L1, EREG, KHDRBS3, GMPR, and TNFAIP2 in CD4⁺ T cells and ASMC with or without transfection of NFAT expression vectors and Stealth RNAi oligos were also determined. The mRNA abundance was normalized by GAPDH expression. IL-2 in the culture supernatants were measured by ELISA as described previously (17). Data are expressed as mean ± SEM of triplicate measurements.

After 16 h of stimulation, cytokine promoter-driven and transcription factor binding site–driven enhancer activity was assessed as the fluorescence of synthetic EGFP detected by flow cytometry as described previously (14, 16). NFAT1, NFAT3, and GAPDH promoter-driven enhancer activity was determined by Dual-Glo Luciferase Assay System (Promega) according to the manufacturer’s protocol. Data are expressed as mean ± SEM of four independently transfected experiments.

Jurkat-TAg cells transfected with Stealth RNAi oligo for NFAT3 and its control oligo were stimulated with 5 nM PMA and 1 μM ionomycin for 1 h. After the preparation of crude nuclear extracts, an electrophoresis mobility shift assay was performed using oligonucleotides corresponding to the NFAT site in the IL-2 promoter (5′-GGAGGAAAAACTGTTTCATACA-3′) as described previously (15).

A restriction endonuclease accessibility (REA) assay was performed according to the method of Guo et al. (18) with modifications. Briefly, 1 × 10⁶ cells were washed twice in cold PBS and resuspended in lysis buffer (60 mM KCl, 15 mM NaCl, 5 mM MgCl₂, 10 mM Tris-HCl [pH 7.5], 300 mM sucrose, and 0.625% Nonidet P-40) with freshly supplied protease inhibitors. After cells were lysed on ice for 10 min, nuclei were pelleted at 2000 rpm for 10 min at 4°C. Nuclei were then treated with varying amounts of HaeIII digestion buffer (50 mM NaCl, 10 mM Tris-HCl [pH 7.9], 10 mM MgCl₂, and 1 mM DTT) at 37°C for 24 h. The reactions were stopped by addition of EDTA to a final concentration of 10 mM. Proteinase K and SDS were added to final concentrations of 0.1 mg/ml and 1%, respectively, and the samples were incubated at 55°C for a minimum of 4 h. The samples were extracted once with saturated phenol and twice with phenol-chloroform. The DNA was then precipitated with ethanol. Purified DNA was subjected to quantitative real-time RT-PCR using TaqMan Genomic Assays (minor groove binder probes) with an ABI PRISM 7900 sequence detection system. The 5′- and 3′- primers and specific probe sets were used to detect the digestion of the NFAT3 gene for −2301 (5′-primer ⁻²³³³CCGCAACTACCCGCTGTT⁻²³¹⁶ and 3′-primer ⁻²²⁵⁸GGCAGAGAGATGGAACTTATGACTT⁻²²⁸² plus probe ⁻²³⁰⁸CTCCAACGCCAGGCCGA⁻²²⁹²), for −363 (5′-primer ⁻⁴²⁵GGTGCTATCTACACAGTCTTCAGAATT⁻³⁹⁹ and 3′-primer ⁻³²⁸ GGGTCCGAGAGCCTTAAAGG⁻³⁴⁷ plus probe ⁻³⁷⁹CCCAGGGTAGAGACGG⁻³⁶⁴), and for +879 (5′-primer ⁺⁸⁴⁸TCACCACAGCCCTGACG⁺⁸⁶⁴ and 3′-primer ⁺⁹¹²GGCAGGAGCCCCAGTTG⁺⁸⁹⁶ plus probe ⁺⁸⁶⁸CCCTCCCCTCTGGCCAC⁺⁸⁸⁴). The results were expressed as the relative amounts of intact DNA in comparison with enzyme nontreated control and were shown as mean ± SEM of triplicate measurements.

All experimental data are presented as mean ± SEM. Statistical analysis was performed by Student t test and one-way ANOVA with Dunnett test. A p value < 0.05 was considered to indicate statistical significance.

In order to evaluate the effect of NFAT3 in cytokine synthesis by T cells, its expression vector coexpressing H-2K^k was transfected into human peripheral CD4⁺ T cells. As shown in Fig. 1A, 30–50% of resulting cells were recognized to be transfection-positive by H-2K^k expression, and the transfection levels were not significantly different among control vector- and NFAT3-transfected cells. Activation-induced IL-2 production was observed both in H-2K^k–positive and H-2K^k–negative fractions of control vector-transfected cells. A similar level of IL-2 production was seen in the H-2K^k–negative fraction of NFAT3-transfected cells, though it was clearly diminished in the H-2K^k–positive fraction (Fig. 1A). The transfection-positive fraction was purified and stimulated through the TCR and a costimulatory molecule. The inducible IL-2 and TNF-α mRNA expression in CD4⁺ T cells was strongly diminished by NFAT3 (Fig. 1B). Western blot analysis confirmed that NFAT3 was overexpressed in the transfection-positive population (Fig. 1B). NFAT3 did not induce apoptosis in T cells (Supplemental Fig. 1). These findings suggested that NFAT3 played a negative role in transactivation of the IL-2 gene in human CD4⁺ T cells.

Next, the effects of NFAT1 and NFAT3 on the expression of several cytokines were analyzed. As shown in Fig. 1C, Jurkat-TAg cells expressed TNF-α, IFN-γ, IL-3, IL-4, and GM-CSF along with IL-2 in response to stimulation with PMA and ionomycin. Introduction of NFAT1 upregulated the expression of these cytokines, whereas NFAT3 downregulated it, suggesting that the negative effect of NFAT3 was not restricted to IL-2 but was exerted on various T cell cytokines.

NFAT3 was rarely expressed in peripheral CD4⁺ T cells, though it was weakly expressed in Jurkat-TAg cells and was detectable by Western blot (Fig. 2A, Supplemental Fig. 2). Therefore, the roles of endogenously expressed NFAT3 in cytokine expression were next examined by RNAi technology. Stimulation-induced mRNA expression and protein production of IL-2 by Jurkat-TAg cells were diminished by introduction of Stealth RNAi oligos against NFAT1, NFAT2, and NFAT4 (Fig. 2B), along with selective downregulation of their protein expression in the cells (Fig. 2A). On the other hand, knockdown of NFAT3 augmented the expression and production of IL-2. These findings were consistent with the results obtained by overexpression studies (Fig. 1) and suggested that NFAT3 would obstruct cytokine expression if it was endogenously expressed in T cells.

To investigate the mechanisms by which NFAT1 and NFAT3 differentially affect cytokine expression, a promoter reporter assay was performed. Consistent with the results of mRNA expression studies as shown in Figs. 1 and 2, inducible IL-2 promoter activity was enhanced and suppressed by NFAT1 and NFAT3, respectively (Fig. 3A). Furthermore, a difference between NFAT1 and NFAT3 in the effect on NFAT reporter activity was also observed, whereas neither NFAT1 nor NFAT3 affected AP-1 activity. Protein binding ability of the NFAT site in the IL-2 promoter was only weakly enhanced by the introduction of small interfering RNA of NFAT (siNFAT)3, suggesting that NFAT3, which is normally involved in that binding complex, was replaced with other NFATs (Supplemental Fig. 3). These findings suggested that the distinct effects of NFAT1 and NFAT3 on IL-2 and probably other cytokine expression were due, at least in part, to the effects on the corresponding NFAT-binding region in the respective promoters of the cytokine genes.

NFAT is composed of an N-terminal transactivation domain (TAD) (TAD1), followed by a Ca²⁺-regulatory domain (CRD), DNA-binding domain (DBD), and C-terminal TAD (TAD2). In order to identify the region responsible for NFAT3-mediated suppression of cytokine genes, several NFAT chimeras in which functional domains were exchanged between NFAT1 and NFAT3 were used (Fig. 3B). As shown in Fig. 3C, TAD1-CRD/DBD/TAD2 chimeras, NFAT1/1/3, NFAT3/1/1, and NFAT1/3/1 substantially augmented NFAT activity, whereas the effects of NFAT1/3/3 and NFAT 3/1/3 were weaker. Only NFAT3/3/1 showed preservation of the suppressive effect of the whole NFAT3 on NFAT activity. These findings suggested that the sequence of NFAT3 critical for its negative function was located within TAD1-CRD/DBD.

Our present findings demonstrating the suppressive role of NFAT3 in T cells raised the possibility that this cell type has obtained its specific cytokine-producing activity via downregulation of NFAT3 expression. However, the regulatory mechanism by which NFAT3 expression is specifically deficient in T cells has not been elucidated.

Among several human primary cell lines, we found that ASMC highly expressed NFAT3. The expression of NFAT1 but not NFAT3 was detectable in CD4⁺ T cells at the protein level (Fig. 4A) as well as the mRNA level (Fig. 4B). In contrast, ASMC expressed a significant amount of NFAT3 but not NFAT1 (Fig. 4A, 4B).

Although many NFAT-regulated genes have been identified in immune cells, the target genes of NFAT3 in ASMC are unknown. Therefore, microarray analysis was performed in ASMC upon overexpression and knockdown of NFAT3. As shown in Supplemental Fig. 4A, 18 genes downregulated by NFAT3 knockdown and upregulated by NFAT3 overexpression were identified. Among them, significant upregulation of CASP1, CD163L1, EREG, KHDRBS3, GMPR, and TNFAIP2 in NFAT3-overexpressed ASMC was confirmed on quantitative real-time RT-PCR analysis (Fig. 4C). Although KHDRBS3 expression was not affected, the downregulation of the other five genes on NFAT3 knockdown was confirmed (Supplemental Fig. 4B). In contrast with the competitive effects of NFAT3 against other NFATs in T cells, overexpression of NFAT1 or NFAT4 failed to affect NFAT3-regulated genes in ASMC.

Like many other proteins, it is expected that the expression of NFAT3 is determined by the context of chromatin surrounding the NFAT3 gene. Therefore, accessibility of the NFAT3 gene in CD4⁺ T cells and ASMC was comparatively analyzed by REA assay. After treatment of nuclear preparations with HaeIII, DNA was purified, and the resulting intact DNA at HaeIII recognition sites in the distal (−2301) and proximal (−363) promoter and in the first intron (+879) of the NFAT3 gene was determined by real-time PCR. As shown in Fig. 5A, accessibility of HaeIII to the NFAT3 promoter, especially its proximal region, was greater in ASMC than in CD4⁺ T cells. Interestingly, HaeIII accessibility to the first intron was equivalent in both cell types. These results suggested that the selective deficiency of NFAT3 expression in T cells was determined, at least in part, by the lower chromatin accessibility in the NFAT3 gene.

Comparison of the promoter/enhancer activity of the NFAT1 and NFAT3 genes in NFAT3-less T cells and NFAT3-expressing ASMC was performed. Consistent with the results of protein and mRNA expression, the promoter activity of NFAT3 was highly inducible in ASMC but not in CD4⁺ T cells, whereas reciprocal results were obtained using the NFAT1 promoter (Fig. 5B). A serial deletion mutation analysis revealed that the essential transcriptional machinery was located among ∼400 bp of the promoter region in the NFAT3 gene (Fig. 5C). We found two transcription factor binding elements, T-box factor binding element (TBE) and NK-2 transcription factor–related locus 5 (Nkx2.5) binding element (NKE), side-by-side within this region (Fig. 5D). Moreover, the expression of TBE-binding TBX5, as well as NKE-binding Nkx2.5, was higher in ASMC than CD4⁺ T cells (Fig. 5E, Supplemental Fig. 2). Therefore, the contribution of these elements on the ∼400 bp NFAT3 promoter activity was further examined by introducing point mutations (Fig. 5D). The NFAT3 promoter activity in ASMC was diminished and unaffected by mutating TBE and NKE elements, respectively (Fig. 5F). In addition, its activity was augmented by the overexpression of TBX5 (Fig. 5G) in Jurkat-TAg cells.

TBX5 is restrictedly expressed in the cardiovascular system. We examined the effect of ectopic expression of TBX5 in CD4⁺ T cells. In transfection-positive cells purified using coexpressed H-2K^k (Fig. 6A) NFAT3 expression was augmented by introduction of TBX5. Reciprocally, TBX5 suppressed stimulation-induced IL-2 expression in T cells (Fig. 6B). These findings suggested that the higher NFAT3 expression in ASMC than CD4⁺ T cells was mediated, at least in part, by selectively expressed TBX5.

It has been demonstrated that NFAT family proteins behave as transcription activators for a series of cytokines, especially in T cells. However, the contribution of NFAT3 to T cell function has not been fully elucidated. It has been shown that NFAT3 expression was found at significant levels in several organs but little or none has been detected in spleen, thymus, or peripheral lymphocytes, including T cells (7, 8). In addition, no significant phenotype in the immune system has been reported in NFAT3-transgenic and NFAT3-knockout mice. We demonstrated that NFAT3 played a suppressive role in cytokine expression when it was expressed in human T cells, suggesting that T cells have obtained their characteristic cytokine-producing activity by losing the expression of a suppressive type of the NFAT family member, NFAT3. Furthermore, this study revealed that the inhibition of NFAT3 expression in CD4⁺ T cells happened largely via TBX5 deficiency-mediated downregulation of NFAT3 promoter/enhancer activity.

The expression of proteins, including NFAT, is regulated in an organ- or cell-specific manner. NFAT3 is hardly detectable in lymphoid tissues and cells (7), though the mechanism of cell-specific regulation of this NFAT has not been defined. Our findings clearly demonstrated that the relative low expression of NFAT3 in CD4⁺ T cells compared with that in ASMC is largely due to a difference in its promoter/enhancer activity. The regulatory mechanisms of NFAT proteins except NFAT2 have rarely been investigated. Even though the expression of NFATs is generally constitutive, NFAT2 expression, at least in T cells, is greatly induced upon stimulation (8, 19, 20). Zhou et al. (21) as well as Chuvpilo et al. (22) analyzed the role of the 5′-flanking region of the NFAT2 gene and identified multiple binding sites for transcription factors, including the consensus NFAT sequence within it. However, the transcription factors responsible for activation of the promoter of other NFATs, including NFAT3, have not been identified. Herein, we discovered a new NFAT-regulating transcription factor, TBX5. TBX5 plays important roles in cardiac function, including chamber formation, septation, and cardiomyocyte differentiation (23). Therefore, NFAT3-mediated regulation of cardiac development (9, 10, 12) might be regulated by TBX5.

The cell-specific expression of NFAT3 was mediated not only by the promoter activity but also by the modification of the chromatin structure in the NFAT3 gene. Thus, the proximal region (∼400 bp) of the NFAT3 promoter in ASMC was more hypersensitive than that in CD4⁺ T cells. In the case of the NFAT2 gene, Chuvpilo et al. (22) demonstrated that inducible expression of NFAT2 in T cells was regulated by generation of the DNase I hypersensitive site and by hypomethylation of the NFAT2 promoter. As the epigenetic modification of the gene, including acetylation and/or methylation of histones and/or DNA, affects the transcriptional activity, further investigation is required to elucidate additional details of these modifications in the NFAT3 gene.

Probably because of the lack of expression in T cells, the contribution of NFAT3 to T cell cytokine synthesis has rarely been examined. Only Hoey et al. (7) demonstrated enhancement of IL-2 promoter activity in Jurkat cells by overexpression of NFAT3. NFAT3 also augmented NFAT/AP-1 binding site in the IL-2 promoter-derived activity in the hepatoma cell line HepG2, and in COS cells (7). The reason for the apparent contradictory findings in the current and previous studies is unknown. However, there were some inadequacies of the experimental conditions under which a positive effect of NFAT3 on IL-2 promoter activity was demonstrated by Hoey et al. (7). Thus, the authors expressed the results of the reporter assay after standardization by β-galactosidase activity derived from a cotransfected respiratory syncytial virus (RSV) promoter-driven β-galactosidase expression vector. During the development of a reporter assay system, we found that NFATs affected the promoter activity of a variety of viruses, including RSV (O. Kaminuma and N. Kitamura, unpublished observations). Therefore, the results of the reporter assay standardized by RSV-β-galactosidase activity may not represent the specific effects of NFATs on the corresponding cytokine promoter. To solve this problem, we calculated the data of fluorescence-based reporter assay in NFAT expression vector-transfected cells from at least four independent experiments without cotransfection of a standardization construct. Relative reliability of our results are further supported by the findings that the expression of endogenous cytokines, including IL-2, was suppressed by NFAT3 in human CD4⁺ T cells as well as Jurkat cells, and, in contrast, the knockdown of endogenously expressed NFAT3 resulted in upregulation of IL-2 expression.

The region of NFAT3 responsible for its inhibitory effect was broadly mapped in TAD1-CRD/DBD domains. NFAT was associated with its recognition DNA sequences by DBD. Even though the amino acid sequence of this domain is relatively conserved in the NFAT family (66–73% amino acid homology among NFAT1 to NFAT4), NFAT proteins potentially differ in their ability to recognize their corresponding sequences. Thus, Hoey et al. (7) demonstrated, employing an electrophoresis mobility shift assay, that NFAT1 had the highest affinity for the distal NFAT site in the IL-2 promoter, whereas NFAT2 and NFAT3 bound weakly to this site, and NFAT4 binding was not detected. In contrast with results showing the competition between NFAT3 and other NFATs to induce cytokine expression in T cells, NFAT3-regulated genes in ASMC were not affected by NFAT1 and NFAT4. Therefore, differences in promoter-binding activity and accompanying activators between NFAT3 and other NFATs and/or between cytokine promoters in T cells and NFAT3-regulated gene promoters in ASMC were suggested. Although they also found that these NFATs bound to this site with similar affinity in the presence of a coactivator protein AP-1 (7), a difference in DNA-binding activity may participate in the functional contrast between NFAT3 and other NFATs.

NFAT is activated through dephosphorylation of several phosphoserine residues located in the CRD domain by the phosphatase calcineurin. This domain is also a target of a variety of protein kinases. The MAPK group (ERK, JNK, and p38 kinase), glycogen synthase kinase 3β, casein kinase 1α, protein kinase A, and dual-specificity, tyrosine-phosphorylation regulated kinases have been shown to phosphorylate NFAT (24–31). Yang et al. (32) demonstrated the differential sensitivity of NFAT proteins to MAP kinases. Activated JNK1 highly phosphorylated NFAT4 and minimally phosphorylated NFAT3. In contrast, NFAT3 but not NFAT4 phosphorylation was enhanced by p38 kinase (32). Furthermore, we previously demonstrated a difference in calcineurin-binding activity among NFAT proteins (33). These differences in the association with phosphatase/kinases may also be involved in the mechanisms by which NFAT3 acts as a competitor against other NFATs.

In conclusion, NFAT3, whose expression was downregulated mainly at the promoter activation level by the lack of TBX5, suppressed cytokine expression when it was expressed in T cells. Our present findings suggest the possibility that T cells have developed cytokine-producing ability as their characteristic feature by losing the expression of inhibitory NFAT3.

We thank Dr. N. Arai, Dr. K. Arai, and Dr. S. Miyatake for providing human NFAT cDNAs, and M. Suzuki and Y. Fujiishi for technical assistance.

The authors have no financial conflicts of interest.