IDO2 is one of two closely related tryptophan catabolizing enzymes induced under inflammatory conditions. In contrast to the immunoregulatory role defined for IDO1 in cancer models, IDO2 has a proinflammatory function in models of autoimmunity and contact hypersensitivity. In humans, two common single-nucleotide polymorphisms have been identified that severely impair IDO2 enzymatic function, such that <25% of individuals express IDO2 with full catalytic potential. This, together with IDO2’s relatively weak enzymatic activity, suggests that IDO2 may have a role outside of its function in tryptophan catabolism. To determine whether the enzymatic activity of IDO2 is required for its proinflammatory function, we used newly generated catalytically inactive IDO2 knock-in mice together with established models of contact hypersensitivity and autoimmune arthritis. Contact hypersensitivity was attenuated in catalytically inactive IDO2 knock-in mice. In contrast, induction of autoimmune arthritis was unaffected by the absence of IDO2 enzymatic activity. In pursuing this nonenzymatic IDO2 function, we identified GAPDH, Runx1, RANbp10, and Mgea5 as IDO2-binding proteins that do not interact with IDO1, implicating them as potential mediators of IDO2-specific function. Taken together, our findings identify a novel function for IDO2, independent of its tryptophan catabolizing activity, and suggest that this nonenzymatic function could involve multiple signaling pathways. These data show that the enzymatic activity of IDO2 is required only for some inflammatory immune responses and provide, to our knowledge, the first evidence of a nonenzymatic role for IDO2 in mediating autoimmune disease.

This article is featured in Top Reads, p.

Two tryptophan (Trp) catabolizing enzymes, IDO1 and IDO2, have unexpected connections to immunity. While extensive research has focused on the role of IDO1 in T cell suppression and cancer development (13), IDO2 has been found to have an alternative, proinflammatory role in immune responses. Previous work established that IDO2 acts in B cells to promote inflammation in preclinical models of autoimmunity and contact hypersensitivity (CHS) (4, 5). However, the mechanistic and cellular relationships between tryptophan catabolism, IDO2, and disease remain unresolved.

Both IDO1 and IDO2, along with the enzyme tryptophan-2,3-dioxygenase, can catabolize the first and rate-limiting step in the breakdown of the amino acid l-Trp to N-formylkynurenine (kyn). In comparison with IDO1 and tryptophan-2,3-dioxygenase, however, IDO2 has relatively weak catalytic activity (6, 7). Indeed, IDO1 knockout (KO) mice, in which expression of the protein has been genetically disrupted, show a marked reduction in serum kyn, whereas IDO2 KO mice show no change in overall kyn levels, suggesting that IDO2 contributes little to the overall Trp catabolism, even in the context of inflammation (8). IDO2 may, in fact, catabolize some Trp derivatives such as 5-methoxytryptophan, with greater efficiency than Trp itself (9). The lack of association between IDO2 and overall kyn production suggests that IDO2 may be acting to catabolize Trp or Trp derivatives in only a small subset of cells or tissues, or that it may in fact have another, potentially nonenzymatic, role entirely. Nonenzymatic functions have been defined for IDO1, particularly via a TGF-β–mediated process, allowing a stable immune regulatory phenotype to be maintained in plasmacytoid dendritic cells. This process is mediated by phosphorylation of two ITIM motifs in IDO1, triggering downstream processes affecting protein stability and affecting the balance between canonical and noncanonical NF-κB signaling (1012).

There are two common Ido2 single-nucleotide polymorphisms (SNPs) found in the human population that severely impair enzymatic function (6). The first (rs10109853), an arginine to tryptophan mutation at amino acid position 248 in humans (position 235 in mice), is located at a position analogous to R231 in human IDO1 that is critical for dioxygenase activity and may be directly involved in substrate recognition through hydrophobic interactions (13). The second (rs4503083) is a nonsense mutation, changing a tyrosine to a stop codon at position 359 in humans (position 346 in mice), immediately prior to a conserved histidine residue known to be essential for catalytic activity in IDO1 (13, 14). Surprisingly, both inactivating polymorphisms are common in human populations, such that only ∼25% of normal individuals appear to have a homozygous wild-type (WT) configuration of the gene conferring full catalytic potential (6). Both of these SNPs have been examined in the context of human disease and have been associated with multiple myeloma, pancreatic cancer, and aspergillosis in susceptible patients but not with multiple sclerosis or Crohn’s disease (1521).

The prevalence of enzyme-inactivating IDO2 polymorphisms in the human population, together with the lack of effect of IDO2 deletion on serum kyn levels in mice, suggests that IDO2 may have functions outside of its catalytic activity. To directly examine the contribution of IDO2 enzyme activity to inflammatory immune responses, we generated IDO2 knock-in (KI) mice incorporating each of the two SNPs that catalytically impair IDO2 (R235W or Y346X). Given our previous findings defining the relationship between IDO2 and the inflammatory responses mediating autoimmune arthritis and CHS, we used these models to examine whether the enzymatic function of IDO2 was necessary for its proinflammatory effect.

KRN TCR transgenic C57BL/6 (22) and IDO2 deficient (IDO2 KO) (23) mice on a C57BL/6 background have been described. CRISPR/Cas9-based gene editing (performed by The Jackson Laboratory) was employed to introduce point mutations into the mouse Ido2 gene, which recapitulate the enzyme-inactivating C/T polymorphism at position 235 that introduces an R to W amino acid change in exon 8, and C/A polymorphism at position 346 that introduces a stop codon in exon 10. Sequences used for the CRISPR guides are as follows: Ido2ex8_sgRNA1, 5′-CTTACCCAGAGAGGAAGATC-3′; Ido2ex8_sgRNA2, 5′-GTCATCCGGATCTTCCTCTC-3′; Ido2ex8_sgRNA3, 5′-TCATCCGGATCTTCCTCTCT-3′; Ido2ex10_sgRNA1, 5′-ATCTGGCCACGACATTGATGTGG-3′; Ido2ex10_sgRNA2, 5′-CAGTTACCACATCAATGTCGTGG-3′. Two founder lines on a C57BL/6 background were established for each polymorphism. Point mutations were confirmed by sequencing of genomic DNA using the primers 5′-CATACGGAACGGATTAACAGC-3′ and 5′-TTTGCCCCTTTTGGATTTAAG-3′ for sequencing of the R235W polymorphism, and 5′-ATTTCCATGTGGAGCTATGACG-3′ and 5′-ACCACGTGGGTGAAGGATTG-3′ for the Y346X polymorphism. One founder line for each polymorphism was bred to homozygosity and expanded for further analysis.

Arthritic mice were generated by breeding KRN transgenic C57BL/6 mice expressing the I-Ag7 MHC class II molecule (KRN.g7). This process was repeated to generate arthritic mice homozygous for IDO2 KO, R235W, or Y346X. Homozygosity of the R235W and Y346X lines were confirmed by sequencing. KRN.g7 mice develop arthritis with similar kinetics as for the original K/BxN mice (24). Both male and female mice were used in all experiments. Control and experimental groups were bred in-house and cohoused (when possible) under specific pathogen-free conditions in the animal facility at the Lankenau Institute for Medical Research. Studies were performed in accordance with National Institutes of Health and Association for Assessment and Accreditation of Laboratory Animal Care guidelines with approval from the Lankenau Institute for Medical Research Institutional Animal Care and Use Committee.

CD4+ T cells from the spleens and lymph nodes (LNs) of IDO2 KO KRN TCR transgenic B6 mice were purified by positive selection with anti-CD4 mouse MACS microbeads (Miltenyi Biotec). The eluent was purified over a second column to achieve higher purity (∼90%). B cells from spleens of IDO2 WT, IDO2 KO, R235W, or Y346X I-Ag7/b mice were purified by anti-CD43 negative selection with MACS beads (Miltenyi Biotec). B cell purity was routinely ∼97%. Following purification, 3.5 × 105 CD4+ T cells and 1 × 106 B cells were adoptively transferred i.v. into TCRα KO IDO2 KO B6g7/b hosts. Arthritis was measured starting at the day of cell transfer, as described below. Mice were sacrificed after 2 wk.

The two rear ankles of KRN.g7, IDO2 KO KRN.g7, R235W KRN.g7, and Y346X KRN.g7 mice were measured starting at weaning (3 wk of age). Measurement of ankle thickness was made above the footpad axially across the ankle joint using a Fowler metric pocket thickness gauge. Ankle thickness was rounded off to the nearest 0.05 mm. At 6 wk of age, the rear paws were fixed in 10% buffered formalin for 48 h, decalcified in 14% EDTA for 2 wk, embedded in paraffin, sectioned, and stained with H&E. Histology sections were imaged using a Zeiss Axioplan microscope with a Zeiss Plan-Apochromat ×10/0.32 numerical aperture objective and Zeiss AxioCam HRC camera using AxioVision 4.7.1 software. The images were then processed using Adobe Photoshop CC software.

Anti–glucose-6-phosphate isomerase (GPI) Ab-secreting cells (ASCs) were measured by ELISPOT as described (25). Briefly, cells from the joint draining LNs (axillary, brachial, and popliteal LNs) from 6-wk-old KRN.g7, IDO2 KO KRN.g7, R235W KRN.g7, and Y346X KRN.g7 mice were plated at 4 × 105 cells per well and diluted serially 1:4 in Multiscreen-HA mixed cellulose ester membrane plates (Millipore) coated with histidine (His)-tagged GPI (10 μg/ml). The cells were incubated on the GPI-coated plates for 4 h at 37°C. The Ig secreted by the plated cells was detected by alkaline phosphatase–conjugated goat anti-mouse total Ig secondary Ab (SouthernBiotech) and visualized using NBT/BCIP (5-bromo-4-chloro-3-indolyl phosphate) substrate (Sigma).

IDO2 KO, R235W, Y346X, and WT BALB/c mice were sensitized with 3% oxazolone (Sigma) in 100% ethanol on their shaved abdomen (100 μl) and hind footpads (10 μl each) 5 d prior to the start of the experiment. Five days later, mice were elicited with 20 μl of 1% oxazolone in 100% ethanol, 10 μl on each side of the ears. After 24 h, ear thickness was measured using a dial gauge (Fowler), and harvested ears were fixed in 10% buffered formalin, embedded in paraffin, sectioned, and stained with H&E. Histology sections were imaged using a Zeiss Axioplan microscope with a Zeiss Plan-Apochromat ×10/0.32 numerical aperture objective and Zeiss AxioCam HRC camera using AxioVision 4.7.1 software. The images were then processed using Adobe Photoshop CC software. Trials performed in multiple mice were replicated at least three times.

A plasmid (pReceiver-M08) containing the open reading frame of murine IDO2 (mIDO2) under the control of the CMV promoter was purchased from GeneCopoeia (Mm32442-M08). A 98-bp fragment containing V5 and 6-His tags was inserted at the 3′ end of mIDO2, by insertion at the Not1 and Nhe1 sites in the pReceiver-M08 vector, to make WT mIDO2-V5His. Plasmids containing the R235W and Y346X polymorphisms were generated by site-directed mutagenesis of WT mIDO2-V5His using inverse PCR and In-Fusion cloning technology (Takara Bio) following the manufacturer’s instructions. Primers used for inverse PCR were as follows: R235W, 5′-GGTCATCTGGATCTTCCTCTCTGGGTGGA-3′ and 5′-AAGATCCAGATGACCGAGTAAAATATGTCTGGG-3′; Y346X, 5′- GCGCAGTTAACACATCAATGTCGTGGCCAG-3′ and 5′- ATGTGTTAACTGCGCAGCTCTC CCAG-3′. To express the tagged Y346X truncated protein, the 0.2-kb region between the new stop codon and the V5-His tag was removed. Correct mutations and tags were confirmed by sequencing. WT, R235W, and Y346X IDO2 protein and V5 tag expression were confirmed by transient transfection into human 293-T-REx cells, followed by Western blotting. Stable expression cell lines were generated by selection with 400 μg/ml G418. Single high-expressing lines were subcloned by sorting single cells on a BD FACSAria III cell sorter.

Yeast two-hybrid screening was performed by Hybrigenics Services (Paris, France) (http://www.hybrigenics-services.com). The coding sequence for the full length of Mus musculus–Ido2 (aa 1–405) (GenBank accession number gi: 170763487; https://www.ncbi.nlm.nih.gov/nuccore/170763487) was PCR amplified and cloned into pB27 as a C-terminal fusion to LexA (N-LexA-Ido2-C). The construct was checked by sequencing the entire insert and used as a bait to screen a random-primed mouse spleen cDNA library constructed into pP6. pB27 and pP6 derive from the original pBTM116 (26) and pGADGH (27) plasmids, respectively. Then, 77.2 million clones (7-fold the complexity of the library) were screened using a mating approach with YHGX13 (Y187 ade2-101::loxP-kanMX-loxP, matα) and L40ΔGal4 (mata) yeast strains as previously described (28). Thirty-seven His+ colonies were selected on a medium lacking tryptophan, leucine, and histidine. The prey fragments of the positive clones were amplified by PCR and sequenced at their 5′ and 3′ junctions. The resulting sequences were used to identify the corresponding interacting proteins in the GenBank database (National Center for Biotechnology Information) using a fully automated procedure. A confidence score (PBS, for Predicted Biological Score) was attributed to each interaction as previously described (29). The scores were divided into four categories, from A (highest confidence) to D (lowest confidence). The PBS scores have been shown to positively correlate with the biological significance of interactions (30, 31).

Livers were harvested from IDO2 KO, R235W, Y346X, or WT C57BL/6 mice. Human 293-T-REx cells stably transfected with V5-tagged IDO1 or IDO2 in a pcDNA4/TO vector (Invitrogen) were described previously (6). 293-T-REx cells expressing IDO1, WT IDO2, R235W IDO2, Y346X IDO2, or untransfected controls were transiently transfected with DDK/FLAG-tagged GAPDH, Runt-related transcription factor 1 (Runx1), RAN binding protein 10 (RANbp10), meningioma expressed Ag 5 (Mgea5) (Origene), or pyruvate kinase (PK) (32) (Addgene). IDO1 and WT IDO2 expression were induced with 2 μg/ml doxycycline for 48 h. Livers and transfected cells were lysed with radioimmunoprecipitation assay buffer (Pierce) or immunoprecipitation (IP) lysis buffer (Thermo Scientific). For co-IP, IDO2 was immunoprecipitated with an anti-V5 Ab (T-REx cells) or rabbit anti-IDO2 (liver lysates) and Dynabeads protein G IP kit (Thermo Scientific). For straight Western blots, whole-cell lysates were run without prior IP. Protein was fractioned using standard SDS-PAGE and blotted to Immobilon-NC membranes (Millipore, USA). After blocking, blots were incubated at 4°C overnight with HRP or unconjugated primary Abs. When needed, blots were then incubated 2 h with HRP-conjugated secondary Abs. Blots were developed with HYGLO Quick Spray chemiluminescent HRP reagent (Denville Scientific) and analyzed using a ChemiDoc system with Image Lab software (Bio-Rad). IP Abs to V5 (Invitrogen) or IDO2 (generated to peptide IDO2365378 by GenScript) and primary Abs to the following Ags were used: FLAG/DDK (BioLegend), V5 (Invitrogen), IDO2 (Santa Cruz), and α-tubulin (Bio-Rad). HRP-conjugated anti-mouse Igκ (Jackson ImmunoResearch) was used as a secondary Ab to detect α-tubulin.

Human 293-T-REx cells stably transfected with V5-tagged WT IDO2, R235W, or Y346X or untransfected controls (parental) were fixed in intracellular fixation buffer (Invitrogen), permeabilized with 0.2% Tween 20, and stained with anti–V5-FITC (Invitrogen). Samples were gated for live cells using forward and side scatter. The samples were acquired on a BD FACSCanto II flow cytometer using FACSDiva software and analyzed using FlowJo software.

Human 293-T-REx cells were stably transfected with V5-tagged WT IDO2, R235W, or Y346X or untransfected controls (parental). Cells were cultured in IMDM with 10% FCS, 50 μM 2-ME, 2 mM GlutaMAX (Life Technologies), and 50 μg/ml gentamicin with the addition of 2 mM l-tryptophan, 10 μM hemin, and 4 mM 5-aminolevulinic acid. WT IDO2 expression in 293-T-REx cells was induced with 2 μg/ml doxycycline for 48 h. Harvested supernatants were analyzed for kynurenine levels using an Ehrlich’s assay, as described (33, 34). Briefly, 200 μl of culture supernatant was incubated with 50 μl of 50% TCA for 30 min at 56°C to hydrolyze kyn to kynurenine. After centrifugation at 16,000 rpm for 10 min, 100 μl of this supernatant was mixed with 100 μl of freshly prepared Ehrlich’s reagent [2% 4-(dimethylamino)benzaldehyde (w/v) in glacial acetic acid], incubated 5 min at room temperature, and read at 490 nm. Kynurenine levels were calculated by comparison with a standard curve.

Human 293-T-REx cells, stably transfected with V5-tagged WT IDO2, R235W, or Y346X or untransfected controls (parental), were cultured in IMDM with 10% FCS, 50 μM 2-ME, 2 mM GlutaMAX (Life Technologies), and 50 μg/ml gentamicin with the addition of 2 mM l-tryptophan, 10 μM hemin, and 4 mM 5-aminolevulinic acid. Lysates containing IDO2 proteins were generated by cytolysis by resuspension of cells in purified, nuclease-free water at a ratio of 1 × 107 cells/ml. Lysates were subjected to three freeze-thaw cycles and 30-s sonication to disrupt cell membranes, then spun at maximum speed for 10 min at 4°C immediately prior to use to remove cellular debris. Cell lysates were immunoblotted with anti-V5 Ab to normalize IDO2 levels. Equal amounts of IDO2 were then assayed for tryptophan catabolic activity directly from this cell lysate by means of an in vitro enzymatic reaction to convert tryptophan to kyn in a mixture containing a final concentration of 50 mM potassium phosphate (pH 6.5), 40 mM sodium l-ascorbate, 400 μg/ml catalase, 20 μM methylene blue, and 2 mM l-tryptophan for 1 h at 37°C. Products of this reaction were tested for kynurenine using the IDK kynurenine high-sensitive ELISA (Immundiagnostik). Kynurenine levels were calculated by comparison with a standard curve.

Human 293-T-REx cells stably transfected with V5-tagged WT R235W or Y346X IDO2 were cultured with 300 μg/ml cycloheximide (Sigma). Cells were harvested at 0, 3, 6, or 9 h and lysed with radioimmunoprecipitation assay buffer. Protein was fractionated using standard SDS-PAGE and blotted to Immobilon-NC membranes. After blocking, the blots were incubated with anti–V5-HRP (Invitrogen) and anti–GAPDH-rhodamine (Bio-Rad). Blots were developed with HYGLO Quick Spray chemiluminescent HRP reagent (Denville Scientific) and analyzed using a ChemiDoc system with Image Lab software (Bio-Rad).

Statistical significance was determined using one- or two-way ANOVA followed by comparison of means with Tukey post hoc multiple comparison correction, an unpaired Student t test, or the Mann–Whitney nonparametric test using GraphPad Prism software (GraphPad Software).

To determine whether the tryptophan catabolizing activity of IDO2 was necessary for its function, we generated two new lines of enzymatically inactive IDO2 KI mice. CRISPR/Cas9 was used to introduce point mutations into the mouse IDO2 gene to recapitulate the enzyme-inactivating C/T polymorphism at position 235 that introduces an R to W amino acid change in exon 8 (R235W, Fig. 1A) and C/A polymorphism at position 346 that introduces a stop codon in exon 10 (Y346X, Fig. 1B). Successful knock in of the Ido2 polymorphisms was confirmed by sequencing of genomic DNA (Fig. 1C, 1D).

To verify lack of enzymatic activity, WT, R235W, and Y346X mouse IDO2 V5-tagged constructs were stably transfected into 293-T-REx cells. IDO2 expression was measured by staining for the V5 tag by flow cytometry (Fig. 2A). R235W IDO2 expressed a similar level of IDO2 protein compared with WT IDO2; however, the level of Y346X IDO2 was significantly reduced compared with both WT and R235W IDO2 (Fig. 2A, 2B). To measure IDO2 enzymatic activity, the downstream catabolite kynurenine was measured in the supernatant using an Ehrlich’s assay. Although reduced compared with IDO1, WT IDO2 does exhibit tryptophan catabolizing activity (57) that can be enhanced by the addition of elevated concentrations of tryptophan, hemin, and 5-aminolevulinic acid (Ref. 35, Fig. 2C). In contrast, kynurenine was undetectable in cells expressing either the R235W or Y346X IDO2 polymorphism, even when normalized for IDO2 expression (Fig. 2B). Lack of tryptophan catabolizing activity of R235W and Y346X IDO2 enzymes was confirmed using an in vitro enzyme assay (Fig. 2D, 2E).

Previously, we showed that IDO2 played an important role in driving autoantibody production and joint inflammation in the KRN.g7 preclinical model of inflammatory arthritis (8). To determine whether the enzymatic activity of IDO2 was necessary for its proarthritic effect, we bred the R235W and Y346X IDO2 KI alleles onto the KRN.g7 model and compared them to KRN.g7 mice expressing WT or lacking IDO2 (IDO2 KO). KRN.g7 mice expressing WT IDO2 developed robust arthritis between 3 and 4 wk of age, whereas arthritis in IDO2 KO KRN.g7 mice was delayed in time of onset and reduced in overall severity (Ref. 8, Fig. 3A, 3B). R235W KRN.g7 mice developed robust arthritis, with timing and severity indistinguishable from KRN.g7 mice expressing WT IDO2. In contrast, joint inflammation in Y346X KRN.g7 mice was reduced, similar to that seen in IDO2 KO KRN.g7 mice (Fig. 3A, 3B). Histological analysis of ankles demonstrated extensive immune cell infiltration, synovial hyperplasia, and cartilage erosion in R235W and IDO2 WT KRN.g7 mice and reduced levels in Y346X and IDO2 KO KRN.g7 mice, confirming the clinical analysis of joint inflammation (Fig. 3C).

Using the T cell transfer model of arthritis and a cell “add-back” approach, we previously identified B cells as the critical IDO2-expressing cell mediating arthritis in the KRN.g7 model (4). To determine whether IDO2 in B cells mediated arthritis through this nonenzymatic mechanism, we again used this T cell transfer model of arthritis. Purified populations of B cells isolated from IDO2 WT, KO, R235W, or Y346X C57BL/6g7/b mice were adoptively transferred into TCRα KO IDO2 KO C57BL/6g7/b mice and arthritis was induced with IDO2 KO KRN T cells. Consistent with our findings in the spontaneous arthritis model, B cells from R235W mice induced robust arthritis, whereas B cells from Y346X mice induced only attenuated arthritis, similar to that generated by transfer of IDO2 WT and KO B cells, respectively (Fig. 3D). Taken together, these data demonstrate that IDO2’s enzymatic function is not required to drive B cell–mediated arthritis.

Arthritis in the KRN.g7 model is dependent on autoreactive B and T cell responses directed against the autoantigen GPI (36). Previous work from our laboratory demonstrated that GPI-specific B and T cell responses were reduced in IDO2 KO KRN.g7 mice (8). Subsequent studies using IDO1/2 double KO mice showed that the diminished autoreactive B cell responses were directly dependent on IDO2, whereas the effect on autoreactive T cell responses was an indirect effect of altered IDO1 expression in the IDO2 KO mice (5). To determine whether IDO2’s enzymatic function affects the autoreactive B cell response, the number of anti-GPI ASCs was evaluated (Fig. 3E). Large numbers of anti-GPI ASCs were found in R235W KRN.g7 mice. In contrast, Y346X mice produced reduced numbers of anti-GPI ASCs, similar to the level found in IDO2 KO mice. These data are consistent with the development of robust versus attenuated arthritis in R235W and Y346X KRN.g7 mice, respectively, and demonstrate that the autoreactive B cell response in KRN.g7 mice is not dependent on IDO2’s enzymatic activity.

The large autoantibody response and robust arthritis that developed in the R235W KRN.g7 mice demonstrated that the enzymatic activity of IDO2 was not required for its proarthritic effect. However, mice expressing the Y346X polymorphism developed reduced autoantibodies and attenuated arthritis more consistent with IDO2 genetic deficiency. One potential reason for this discrepancy is that the truncated protein may be unstable and rapidly degraded, as suggested by the reduced expression in our transfected cells (Fig. 2). Consistent with this, IDO2 protein was undetectable in liver tissue from Y346X mice. IDO2 protein was detectable in livers from R235W mice, although reduced compared with WT controls (Fig. 4A, 4B). To measure the relative stability of the full-length R235W and truncated Y346X IDO2 proteins compared with WT IDO2, we performed a cycloheximide chase assay using 293-T-REx cells stably transfected with WT, R235W, or Y346X IDO2. Cells were incubated with cycloheximide to inhibit protein synthesis, and the amount of IDO2 remaining at 3, 6, and 9 h was determined by Western blotting (Fig. 5A). During the first 3 h, WT and R235W IDO2 protein levels decreased ∼ 30%, but remained stable during the next 6 h (9 h total). In contrast, Y346X protein levels decreased by 80% at 3 h and >95% by 9 h (Fig. 5B). These data demonstrate that the truncated Y346X protein is rapidly degraded and, together with the lack of IDO2 protein in Y346X mice, suggest that the difference in arthritis severity between the R235W and Y346X mice can be explained by reduced stability of the Y346X protein.

The finding that IDO2’s enzymatic function was not involved in its proinflammatory role driving arthritis led us to ask whether IDO2’s enzymatic function was required to drive inflammation in any context. A second model where inflammation has been shown to be dependent on IDO2 is the CHS model (23). To determine whether IDO2 enzymatic function was required for CHS, we sensitized WT, IDO2 KO, R235W, and Y346X BALB/c mice with oxazolone on the footpads and abdomen, challenged them 5 d later with oxazolone on the ears, and then measured swelling after 24 h. Consistent with our previously published data, WT mice showed marked swelling, whereas the CHS response in IDO2 KO mice was significantly reduced (Ref. 23, Fig. 6). In contrast to their robust inflammatory response in the KRN.g7 arthritis model, R235W mice had a greatly diminished CHS inflammatory response, similar to the reduced response in IDO2 KO and Y346X mice (Fig. 6A). Histological analysis confirmed the minimal inflammatory cell infiltration and swelling in the ears from R235W, Y346X, and IDO2 KO mice compared with the robust infiltration of inflammatory cells and swelling seen in WT mice (Fig. 6B). Therefore, despite a clear nonenzymatic function for IDO2 in the KRN.g7 arthritis model, IDO2’s enzymatic activity does play an important role in mediating inflammation in the context of CHS.

Our data suggest that in addition to tryptophan catabolism, IDO2 also has a nonenzymatic function that mediates its proinflammatory activity in arthritis. As a first step to determine the molecular signaling pathway mediated by IDO2, we performed a yeast two-hybrid screen using full-length mouse IDO2 as bait to screen a random-primed mouse spleen cDNA library (Hybrigenics Services, Paris, France) to identify proteins that directly interact with IDO2 (28). From a total of 77.2 million interactions, 37 positive clones were isolated and sequenced to identify four unique proteins (Table I). To confirm the interaction between IDO2 and these candidate binding proteins, 293-T-REx cells stably expressing V5-tagged IDO2 were transfected with DDK/FLAG-tagged GAPDH (Fig. 7A), Runx1 (Fig. 7B), Mgea5 (Fig. 7C), RANbp10 (Fig. 7D), or PK as a negative control (Fig. 7E), and the interaction between IDO2 and each candidate protein was evaluated by IP/Western blotting using Abs to the V5 and FLAG tags. IDO2 coimmunoprecipitated with GAPDH, Runx1, RANbp10, and Mgea5, but not PK, providing an initial validation of the two-hybrid results (Fig. 7). Given the distinct roles of IDO2 and IDO1 in mediating autoreactive B cell responses and arthritis in the KRN model (5), we next determined whether any of these IDO2-interacting proteins also bound to IDO1. We hypothesized that proteins that bind to IDO2, but not IDO1, would be potential components of the nonenzymatic pathway that IDO2 uses to drive arthritis. To distinguish proteins that bind to IDO2 but not IDO1, we transfected the DDK/FLAG-tagged candidate proteins into 293-T-REx cells stably expressing IDO1 and repeated the co-IP experiment. Importantly, none of the IDO2-binding proteins bound to IDO1 (Fig. 7), identifying them as potential intermediators of IDO2 function.

Lastly, we determined whether the IDO2-interacting proteins bound to IDO2 expressing R235W or Y346X polymorphisms (Fig. 8). To do this, we transfected the DDK/FLAG-tagged candidate proteins into 293-T-REx cells stably expressing WT, R235W, or Y346X IDO2 and again repeated the co-IP experiment. The R235W polymorphism did not affect IDO2’s ability to bind to GAPDH and only moderately reduced its binding to Mgea5. In contrast, IDO2’s interactions with Runx1 and RANbp10 were more affected by the R235W polymorphism (Fig. 8). IDO2 expressing the Y346X polymorphism bound to Runx1 and RANbp10 with similar efficacy as for WT IDO2, whereas binding to GAPDH was moderately reduced and binding to Mgea5 was greatly reduced (Fig. 8). Taken together, these data show that all four identified IDO2 interacting proteins retain at least some binding to both R235W and Y346X IDO2, suggesting that the nonenzymatic function of IDO2 could involve multiple signaling pathways.

The IDO pathway has long been connected to inflammatory immunity; however, there has been debate in the literature about the relative importance of IDO2 to the autoimmune response (23, 24, 3741). IDO2 has greatly reduced tryptophan catabolic activity compared with IDO1. In addition, SNPs affecting tryptophan catalysis by IDO2 are extremely common, with only a minority of people carrying two copies of WT IDO2. This suggests one of two possibilities, either that IDO2 has limited relevance to disease or that the main role of IDO2 lies outside of its enzymatic function. In this study, using catalytically inactive IDO2 KI mice, we demonstrate that the enzymatic function of IDO2 is required to mediate some inflammatory immune responses. Importantly, to our knowledge, our findings also provide the first evidence of a novel nonenzymatic role for IDO2 in mediating inflammatory autoimmune disease.

Mice expressing enzyme-inactivating polymorphisms in IDO2 develop a reduced CHS response, similar to that seen in IDO2 KO mice. This suggests an important role for tryptophan catabolism in mediating inflammation in this model, although an additional effect of the R235W mutation on IDO2 conformation cannot be excluded. In contrast, the robust arthritis in KRN mice expressing the R235W polymorphism is indistinguishable from that in mice expressing WT IDO2, demonstrating that inflammatory autoimmunity can be generated in the absence of IDO2 catalytic activity. The differential requirement for IDO2 enzymatic function in CHS versus arthritis is reminiscent of the contrasting dependence on IDO1 expression in the two models. CHS responses are reduced in both IDO1 and IDO2 KO mice, suggesting a common, but nonredundant, requirement for tryptophan catabolism to mediate inflammatory immunity in this model (23). In contrast, joint inflammation in the KRN arthritis model is attenuated in IDO2 KO, but not IDO1 KO, mice, providing further support for a novel nonenzymatic role for IDO2 in mediating inflammatory autoimmunity (8).

IDO2-inactivating polymorphisms have been associated with some cancers and autoimmune/inflammatory conditions, suggesting that the nonenzymatic role identified in mouse models may also be relevant to human disease. Specifically, familial pancreatic cancer is positively associated with the Y359X (rs4503083) but not R248W (rs10109853) polymorphism (21). In Crohn’s disease, Y359X is associated with a reduced risk of disease, while R248W has no effect (17). In these cases, as we see in our KRN.g7 arthritis model, loss of catalytic activity alone (R/W) does not affect disease susceptibility compared with WT IDO2, whereas truncation associated with reduced protein stability (Y/X) does affect disease state, suggesting that full-length but catalytically inactive IDO2 has a relevant signaling role in these conditions. In contrast, both polymorphisms are associated with increased risk of aspergillosis in hematopoietic stem cell transfer recipients (18) and radiotherapy responsiveness in pancreatic cancer patients (19), and R/W is associated with susceptibility to multiple myeloma (20), signifying a potential role for IDO2 catalytic activity in these circumstances.

The two IDO enzymes have been primarily studied in the context of their direct relationship to tryptophan catalysis, and several established connections between tryptophan, the IDO pathway, and immunity have been described. These include 1) sensing of Trp depletion as mediated by GCN2 (general control nonderepressible-2) activation to induce amino acid insufficiency signaling and alter levels of immune-modulating cytokines such as IL-6 (42, 43); 2) sensing of Trp depletion by mTOR suppression to block amino acid sufficiency signaling, resulting in subsequent downstream effects on autophagy (3, 44, 45); and 3) activation of the aryl hydrocarbon receptor by kynurenine and other Trp derivatives, which promotes the generation of T regulatory cells that suppress adaptive immunity (46). In addition, a non–tryptophan-associated function of IDO1 has been described involving the activation of the noncanonical NF-κB pathway and subsequent induction of TGF-β and type I IFNs, leading to suppression of T cell activation and development of regulatory T cells (11). Our data suggest that IDO2 is also likely involved in multiple molecular pathways, only some of which require enzymatic function. As such, the nonenzymatic functions of IDO2 must be directly examined when investigating the immunomodulatory properties of this protein.

Although our experiments in this study provide in vivo evidence for the nonenzymatic role of IDO2 in mediating autoimmune disease, the mechanism by which this occurs has yet to be elucidated. Given that IDO2 lacks the functional ITIM sites that are essential for IDO1’s nonenzymatic signaling, IDO2 is unlikely to share the mechanistic pathways identified for IDO1 (11, 47, 48). A yeast-2-hybrid screen identified four diverse proteins with the potential to bind IDO2, and which may be involved in immune signaling pathways. Although there is no previously established link to the IDO pathway for Runx1, GAPDH, RANbp10, or Mgea5, we found that each of the four successfully co-immunoprecipitates specifically with IDO2 but not IDO1. The RUNT-related transcription factor Runx1 has been implicated in lymphoid, myeloid, and megakaryocyte lineage maturation (49) and is genetically associated with autoimmunity in rheumatoid arthritis, systemic lupus erythematosus, and psoriasis (5052). GAPDH is a glycolytic enzyme expressed in all cells. In addition to its critical role in the glucose metabolism, GAPDH has been implicated in a diverse array of alternative functions, including oligomerization, posttranslational modification, and subcellular localization (53). GAPDH has also been reported to bind heme and may have heme sensing or chaperone functions (54), a role that could be investigated in the context of the heme binding properties of IDO2. Additionally, Abs against GAPDH have been associated with systemic lupus erythematosus (55, 56). RANbp10 is a small GTPase important in microtubule dynamics, particularly in platelets, and it may have a role in coupling membrane receptors to intracellular signaling pathways (57), although it has been little studied compared with other RAN binding proteins (58). Mgea5 encodes the protein O-GlcNAcase, which is involved in the posttranslational cycling of the O-linked β-N-acetyl-d-glucosamine (O-GlcNAc) monosaccharide moiety on proteins (59). O-GlcNAcylation has been implicated in both B and T cell activation and is associated with autoimmunity, particularly as a proinflammatory mediator of diabetes and insulin resistance (6063). There are hundreds of proteins subject to O-GlcNAc modification, with far-reaching implications for regulation of immunity, although no known direct links to IDO pathways. The wide range of protein functions associated with each of these IDO2 interacting proteins suggests that the nonenzymatic function of IDO2 may occur through multiple independent signaling pathways.

Comparison of the binding of GAPDH, Runx1, Mgea5, and RANbp10 between WT IDO2 and IDO2 expressing the R235W or Y346X polymorphisms provided further insight into the molecular basis of the interactions. Although both R235W and Y346X retained some binding to all four proteins, R235W interacted more strongly with GAPDH and Mgea5, whereas Y346X bound better to RANbp10 and Runx1. As the Y346X polymorphism truncates the IDO2 protein prior to the C terminus, this suggests that Mgea5 and GAPDH bind IDO2 near the C terminus and Runx1 and RANbp10 bind upstream of the truncation at position 346. Furthermore, the reduced binding of Runx1 and RANbp10 with R235W suggests that their interaction with IDO2 either occurs close to the catalytic site or is dependent on protein conformation that is disrupted by the R235W mutation. As the binding protein interactions were evaluated using transient transfections and an overexpression system, future experiments will be needed to explore how these potential IDO2 binding partners impact IDO2 function in vivo.

Approaches to therapeutically target the IDO pathway have historically been designed to inhibit catalytic activity. Preclinical and early clinical studies suggested that inhibitors of IDO1 enzymatic activity would provide a therapeutic benefit in cancer (6468), but similar approaches yielded conflicting results in models of autoimmunity (24, 38, 39, 69, 70). Our findings demonstrating that IDO2 enzyme function is not necessary for arthritis development in the KRN model suggest that effective therapeutic strategies for targeting IDO2 need to address its nonenzymatic signaling capability. Two such approaches, mAb- and small interfering RNA–based modalities, have been shown to be effective in ameliorating disease in the KRN model (71, 72).

In summary, our findings demonstrating that IDO2 enzyme function is not necessary for arthritis development but is required for a CHS response suggest that IDO2 has multifaceted, context-dependent roles in immunity. The discovery of a differential requirement for tryptophan catabolizing activity may help to clarify seemingly conflicting findings in the literature showing pro- versus anti-inflammatory roles for the IDO pathway in models of autoimmune disease. Given the reported nonenzymatic roles of IDO1 and the potential involvement of newly established IDO2 binding partners described in this study, future studies are warranted to determine the specific nonenzymatic pathway mediating IDO2’s function driving autoimmune disease.

This work was supported in part by the Giorgi Family Foundation (to L.M.-N.), the Zuckermann Autoimmune Disorder Research Fund (to L.M.-N.), and the National Cancer Institute of the National Institutes of Health under Award R01CA191191 (to G.C.P.).

Abbreviations used in this article

ASC

Ab-secreting cell

CHS

contact hypersensitivity

GPI

glucose-6-phosphate isomerase

IP

immunoprecipitation

KI

knock-in

KO

knockout

kyn

N-formylkynurenine

LN

lymph node

Mgea5

meningioma expressed antigen 5

mIDO2

murine IDO2

O-GlcNAc

O-linked β-N-acetyl-d-glucosamine

PK

pyruvate kinase

RANbp10

RAN binding protein 10

Runx1

Runt-related transcription factor 1

SNP

single-nucleotide polymorphism

WT

wild-type.

1.
Banerjee
T.
,
J. B.
Duhadaway
,
P.
Gaspari
,
E.
Sutanto-Ward
,
D. H.
Munn
,
A. L.
Mellor
,
W. P.
Malachowski
,
G. C.
Prendergast
,
A. J.
Muller
.
2008
.
A key in vivo antitumor mechanism of action of natural product-based brassinins is inhibition of indoleamine 2,3-dioxygenase.
Oncogene
27
:
2851
2857
.
2.
Prendergast
G. C.
,
M. Y.
Chang
,
L.
Mandik-Nayak
,
R.
Metz
,
A. J.
Muller
.
2011
.
Indoleamine 2,3-dioxygenase as a modifier of pathogenic inflammation in cancer and other inflammation-associated diseases.
Curr. Med. Chem.
18
:
2257
2262
.
3.
Prendergast
G. C.
,
C.
Smith
,
S.
Thomas
,
L.
Mandik-Nayak
,
L.
Laury-Kleintop
,
R.
Metz
,
A. J.
Muller
.
2014
.
Indoleamine 2,3-dioxygenase pathways of pathogenic inflammation and immune escape in cancer.
Cancer Immunol. Immunother.
63
:
721
735
.
4.
Merlo
L. M.
,
J. B.
DuHadaway
,
S.
Grabler
,
G. C.
Prendergast
,
A. J.
Muller
,
L.
Mandik-Nayak
.
2016
.
IDO2 modulates T cell-dependent autoimmune responses through a B cell-intrinsic mechanism.
J. Immunol.
196
:
4487
4497
.
5.
Merlo
L. M. F.
,
J. B.
DuHadaway
,
J. D.
Montgomery
,
W. D.
Peng
,
P. J.
Murray
,
G. C.
Prendergast
,
A. J.
Caton
,
A. J.
Muller
,
L.
Mandik-Nayak
.
2020
.
Differential roles of IDO1 and IDO2 in T and B cell inflammatory immune responses.
Front. Immunol.
11
:
1861
.
6.
Metz
R.
,
J. B.
Duhadaway
,
U.
Kamasani
,
L.
Laury-Kleintop
,
A. J.
Muller
,
G. C.
Prendergast
.
2007
.
Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indoleamine 2,3-dioxygenase inhibitory compound d-1-methyl-tryptophan.
Cancer Res.
67
:
7082
7087
.
7.
Ball
H. J.
,
A.
Sanchez-Perez
,
S.
Weiser
,
C. J.
Austin
,
F.
Astelbauer
,
J.
Miu
,
J. A.
McQuillan
,
R.
Stocker
,
L. S.
Jermiin
,
N. H.
Hunt
.
2007
.
Characterization of an indoleamine 2,3-dioxygenase-like protein found in humans and mice.
Gene
396
:
203
213
.
8.
Merlo
L. M. F.
,
E.
Pigott
,
J. B.
DuHadaway
,
S.
Grabler
,
R.
Metz
,
G. C.
Prendergast
,
L.
Mandik-Nayak
.
2014
.
IDO2 is a critical mediator of autoantibody production and inflammatory pathogenesis in a mouse model of autoimmune arthritis.
J. Immunol.
192
:
2082
2090
.
9.
Pantouris
G.
,
M.
Serys
,
H. J.
Yuasa
,
H. J.
Ball
,
C. G.
Mowat
.
2014
.
Human indoleamine 2,3-dioxygenase-2 has substrate specificity and inhibition characteristics distinct from those of indoleamine 2,3-dioxygenase-1.
Amino Acids
46
:
2155
2163
.
10.
Pallotta
M. T.
,
C.
Orabona
,
R.
Bianchi
,
C.
Vacca
,
F.
Fallarino
,
M. L.
Belladonna
,
C.
Volpi
,
G.
Mondanelli
,
M.
Gargaro
,
M.
Allegrucci
, et al
2014
.
Forced IDO1 expression in dendritic cells restores immunoregulatory signalling in autoimmune diabetes.
J. Cell. Mol. Med.
18
:
2082
2091
.
11.
Pallotta
M. T.
,
C.
Orabona
,
C.
Volpi
,
C.
Vacca
,
M. L.
Belladonna
,
R.
Bianchi
,
G.
Servillo
,
C.
Brunacci
,
M.
Calvitti
,
S.
Bicciato
, et al
2011
.
Indoleamine 2,3-dioxygenase is a signaling protein in long-term tolerance by dendritic cells.
Nat. Immunol.
12
:
870
878
.
12.
Pallotta
M. T.
,
S.
Rossini
,
C.
Suvieri
,
A.
Coletti
,
C.
Orabona
,
A.
Macchiarulo
,
C.
Volpi
,
U.
Grohmann
.
2021
.
Indoleamine 2,3-dioxygenase 1 (IDO1): an up-to-date overview of an eclectic immunoregulatory enzyme.
FEBS J.
DOI: 10.1111/febs.16086.
13.
Sugimoto
H.
,
S.
Oda
,
T.
Otsuki
,
T.
Hino
,
T.
Yoshida
,
Y.
Shiro
.
2006
.
Crystal structure of human indoleamine 2,3-dioxygenase: catalytic mechanism of O2 incorporation by a heme-containing dioxygenase.
Proc. Natl. Acad. Sci. USA
103
:
2611
2616
.
14.
Littlejohn
T. K.
,
O.
Takikawa
,
R. J.
Truscott
,
M. J.
Walker
.
2003
.
Asp274 and his346 are essential for heme binding and catalytic function of human indoleamine 2,3-dioxygenase.
J. Biol. Chem.
278
:
29525
29531
.
15.
Agliardi
C.
,
F. R.
Guerini
,
M.
Zanzottera
,
M.
Rovaris
,
D.
Caputo
,
M.
Clerici
.
2017
.
Indoleamine-2,3-dioxygenase(IDO)2 polymorphisms are not associated with multiple sclerosis in Italians.
J. Neurol. Sci.
377
:
31
34
.
16.
Witkiewicz
A. K.
,
C. L.
Costantino
,
R.
Metz
,
A. J.
Muller
,
G. C.
Prendergast
,
C. J.
Yeo
,
J. R.
Brody
.
2009
.
Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target.
J. Am. Coll. Surg.
208
:
781
787
,
discussion 787–789
.
17.
Lee
A.
,
N.
Kanuri
,
Y.
Zhang
,
G. S.
Sayuk
,
E.
Li
,
M. A.
Ciorba
.
2014
.
IDO1 and IDO2 non-synonymous gene variants: correlation with Crohn’s disease risk and clinical phenotype. [Published erratum appears in 2015 PLoS One. 10: e0133098.]
PLoS One
9
:
e115848
.
18.
Napolioni
V.
,
M.
Pariano
,
M.
Borghi
,
V.
Oikonomou
,
C.
Galosi
,
A.
De Luca
,
C.
Stincardini
,
C.
Vacca
,
G.
Renga
,
V.
Lucidi
, et al
2019
.
Genetic polymorphisms affecting IDO1 or IDO2 activity differently associate with aspergillosis in humans.
Front. Immunol.
10
:
890
.
19.
Nevler
A.
,
A. J.
Muller
,
E.
Sutanto-Ward
,
J. B.
DuHadaway
,
K.
Nagatomo
,
E.
Londin
,
K.
O’Hayer
,
J. A.
Cozzitorto
,
H.
Lavu
,
T. P.
Yeo
, et al
2019
.
Host IDO2 gene status influences tumor progression and radiotherapy response in KRAS-driven sporadic pancreatic cancers.
Clin. Cancer Res.
25
:
724
734
.
20.
Kasamatsu
T.
,
N.
Hashimoto
,
N.
Sakaya
,
M.
Awata-Shiraiwa
,
R.
Ishihara
,
Y.
Murakami
,
Y.
Masuda
,
N.
Gotoh
,
K.
Nagai
,
T.
Oda
, et al
2021
.
IDO2 rs10109853 polymorphism affects the susceptibility to multiple myeloma.
Clin. Exp. Med.
21
:
323
329
.
21.
Nevler
A.
,
A. J.
Muller
,
J. A.
Cozzitorto
,
A.
Goetz
,
J. M.
Winter
,
T. P.
Yeo
,
H.
Lavu
,
C. J.
Yeo
,
G. C.
Prendergast
,
J. R.
Brody
.
2018
.
A sub-type of familial pancreatic cancer: evidence and implications of loss-of-function polymorphisms in indoleamine-2,3-dioxygenase-2.
J. Am. Coll. Surg.
226
:
596
603
.
22.
Kouskoff
V.
,
A. S.
Korganow
,
V.
Duchatelle
,
C.
Degott
,
C.
Benoist
,
D.
Mathis
.
1996
.
Organ-specific disease provoked by systemic autoimmunity.
Cell
87
:
811
822
.
23.
Metz
R.
,
C.
Smith
,
J. B.
DuHadaway
,
P.
Chandler
,
B.
Baban
,
L. M. F.
Merlo
,
E.
Pigott
,
M. P.
Keough
,
S.
Rust
,
A. L.
Mellor
, et al
2014
.
IDO2 is critical for IDO1-mediated T-cell regulation and exerts a non-redundant function in inflammation.
Int. Immunol.
26
:
357
367
.
24.
Scott
G. N.
,
J.
DuHadaway
,
E.
Pigott
,
N.
Ridge
,
G. C.
Prendergast
,
A. J.
Muller
,
L.
Mandik-Nayak
.
2009
.
The immunoregulatory enzyme IDO paradoxically drives B cell-mediated autoimmunity.
J. Immunol.
182
:
7509
7517
.
25.
Mandik-Nayak
L.
,
B. T.
Wipke
,
F. F.
Shih
,
E. R.
Unanue
,
P. M.
Allen
.
2002
.
Despite ubiquitous autoantigen expression, arthritogenic autoantibody response initiates in the local lymph node.
Proc. Natl. Acad. Sci. USA
99
:
14368
14373
.
26.
Vojtek
A. B.
,
S. M.
Hollenberg
.
1995
.
Ras-Raf interaction: two-hybrid analysis.
Methods Enzymol.
255
:
331
342
.
27.
Bartel
P. L.
,
C.-T.
Cheien
,
R.
Sternglanz
,
S.
Fields
.
1993
.
Using the two-hybrid system to detect protein-protein interactions.
In
Cellular Interactions in Development: A Practical Approach.
D. A.
Hartley
.
Oxford University Press
,
Oxford, UK
, p.
153
179
.
28.
Fromont-Racine
M.
,
J. C.
Rain
,
P.
Legrain
.
1997
.
Toward a functional analysis of the yeast genome through exhaustive two-hybrid screens.
Nat. Genet.
16
:
277
282
.
29.
Formstecher
E.
,
S.
Aresta
,
V.
Collura
,
A.
Hamburger
,
A.
Meil
,
A.
Trehin
,
C.
Reverdy
,
V.
Betin
,
S.
Maire
,
C.
Brun
, et al
2005
.
Protein interaction mapping: a Drosophila case study.
Genome Res.
15
:
376
384
.
30.
Rain
J. C.
,
L.
Selig
,
H.
De Reuse
,
V.
Battaglia
,
C.
Reverdy
,
S.
Simon
,
G.
Lenzen
,
F.
Petel
,
J.
Wojcik
,
V.
Schächter
, et al
2001
.
The protein-protein interaction map of Helicobacter pylori.
Nature
409
:
211
215
.
31.
Wojcik
J.
,
I. G.
Boneca
,
P.
Legrain
.
2002
.
Prediction, assessment and validation of protein interaction maps in bacteria.
J. Mol. Biol.
323
:
763
770
.
32.
Christofk
H. R.
,
M. G.
Vander Heiden
,
M. H.
Harris
,
A.
Ramanathan
,
R. E.
Gerszten
,
R.
Wei
,
M. D.
Fleming
,
S. L.
Schreiber
,
L. C.
Cantley
.
2008
.
The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth.
Nature
452
:
230
233
.
33.
Littlejohn
T. K.
,
O.
Takikawa
,
D.
Skylas
,
J. F.
Jamie
,
M. J.
Walker
,
R. J.
Truscott
.
2000
.
Expression and purification of recombinant human indoleamine 2,3-dioxygenase.
Protein Expr. Purif.
19
:
22
29
.
34.
Flick
H. E.
,
J. M.
Lalonde
,
W. P.
Malachowski
,
A. J.
Muller
.
2013
.
The tumor-selective cytotoxic agent β-lapachone is a potent inhibitor of IDO1.
Int. J. Tryptophan Res.
6
:
35
45
.
35.
Winters
M.
,
J. B.
DuHadaway
,
K. N.
Pham
,
A.
Lewis-Ballester
,
S.
Badir
,
J.
Wai
,
E.
Sheikh
,
S. R.
Yeh
,
G. C.
Prendergast
,
A. J.
Muller
,
W. P.
Malachowski
.
2019
.
Diaryl hydroxylamines as pan or dual inhibitors of indoleamine 2,3-dioxygenase-1, indoleamine 2,3-dioxygenase-2 and tryptophan dioxygenase.
Eur. J. Med. Chem.
162
:
455
464
.
36.
Matsumoto
I.
,
A.
Staub
,
C.
Benoist
,
D.
Mathis
.
1999
.
Arthritis provoked by linked T and B cell recognition of a glycolytic enzyme.
Science
286
:
1732
1735
.
37.
Gurtner
G. J.
,
R. D.
Newberry
,
S. R.
Schloemann
,
K. G.
McDonald
,
W. F.
Stenson
.
2003
.
Inhibition of indoleamine 2,3-dioxygenase augments trinitrobenzene sulfonic acid colitis in mice.
Gastroenterology
125
:
1762
1773
.
38.
Sakurai
K.
,
J. P.
Zou
,
J. R.
Tschetter
,
J. M.
Ward
,
G. M.
Shearer
.
2002
.
Effect of indoleamine 2,3-dioxygenase on induction of experimental autoimmune encephalomyelitis.
J. Neuroimmunol.
129
:
186
196
.
39.
Szántó
S.
,
T.
Koreny
,
K.
Mikecz
,
T. T.
Glant
,
Z.
Szekanecz
,
J.
Varga
.
2007
.
Inhibition of indoleamine 2,3-dioxygenase-mediated tryptophan catabolism accelerates collagen-induced arthritis in mice.
Arthritis Res. Ther.
9
:
R50
.
40.
Xu
H.
,
T. B.
Oriss
,
M.
Fei
,
A. C.
Henry
,
B. N.
Melgert
,
L.
Chen
,
A. L.
Mellor
,
D. H.
Munn
,
C. G.
Irvin
,
P.
Ray
,
A.
Ray
.
2008
.
Indoleamine 2,3-dioxygenase in lung dendritic cells promotes Th2 responses and allergic inflammation.
Proc. Natl. Acad. Sci. USA
105
:
6690
6695
.
41.
von Bubnoff
D.
,
T.
Bieber
.
2012
.
The indoleamine 2,3-dioxygenase (IDO) pathway controls allergy.
Allergy
67
:
718
725
.
42.
Munn
D. H.
,
M. D.
Sharma
,
B.
Baban
,
H. P.
Harding
,
Y.
Zhang
,
D.
Ron
,
A. L.
Mellor
.
2005
.
GCN2 kinase in T cells mediates proliferative arrest and anergy induction in response to indoleamine 2,3-dioxygenase.
Immunity
22
:
633
642
.
43.
Dey
S.
,
A.
Mondal
,
J. B.
DuHadaway
,
E.
Sutanto-Ward
,
L. D.
Laury-Kleintop
,
S.
Thomas
,
G. C.
Prendergast
,
L.
Mandik-Nayak
,
A. J.
Muller
.
2021
.
IDO1 signaling through GCN2 in a subpopulation of Gr-1+ cells shifts the IFNγ/IL6 balance to promote neovascularization.
Cancer Immunol. Res.
9
:
514
528
.
44.
Wu
H.
,
J.
Gong
,
Y.
Liu
.
2018
.
Indoleamine 2,3-dioxygenase regulation of immune response (Review). [Review]
Mol. Med. Rep.
17
:
4867
4873
.
45.
Metz
R.
,
S.
Rust
,
J. B.
Duhadaway
,
M. R.
Mautino
,
D. H.
Munn
,
N. N.
Vahanian
,
C. J.
Link
,
G. C.
Prendergast
.
2012
.
IDO inhibits a tryptophan sufficiency signal that stimulates mTOR: a novel IDO effector pathway targeted by D-1-methyl-tryptophan.
OncoImmunology
1
:
1460
1468
.
46.
Platten
M.
,
N.
von Knebel Doeberitz
,
I.
Oezen
,
W.
Wick
,
K.
Ochs
.
2015
.
Cancer immunotherapy by targeting IDO1/TDO and their downstream effectors.
Front. Immunol.
5
:
673
.
47.
Albini
E.
,
V.
Rosini
,
M.
Gargaro
,
G.
Mondanelli
,
M. L.
Belladonna
,
M. T.
Pallotta
,
C.
Volpi
,
F.
Fallarino
,
A.
Macchiarulo
,
C.
Antognelli
, et al
2017
.
Distinct roles of immunoreceptor tyrosine-based motifs in immunosuppressive indoleamine 2,3-dioxygenase 1.
J. Cell. Mol. Med.
21
:
165
176
.
48.
Fallarino
F.
,
U.
Grohmann
,
P.
Puccetti
.
2012
.
Indoleamine 2,3-dioxygenase: from catalyst to signaling function.
Eur. J. Immunol.
42
:
1932
1937
.
49.
Liu
X.
,
R. C.
Newton
,
S. M.
Friedman
,
P. A.
Scherle
.
2009
.
Indoleamine 2,3-dioxygenase, an emerging target for anti-cancer therapy.
Curr. Cancer Drug Targets
9
:
938
952
.
50.
Tokuhiro
S.
,
R.
Yamada
,
X.
Chang
,
A.
Suzuki
,
Y.
Kochi
,
T.
Sawada
,
M.
Suzuki
,
M.
Nagasaki
,
M.
Ohtsuki
,
M.
Ono
, et al
2003
.
An intronic SNP in a RUNX1 binding site of SLC22A4, encoding an organic cation transporter, is associated with rheumatoid arthritis.
Nat. Genet.
35
:
341
348
.
51.
Helms
C.
,
L.
Cao
,
J. G.
Krueger
,
E. M.
Wijsman
,
F.
Chamian
,
D.
Gordon
,
M.
Heffernan
,
J. A.
Daw
,
J.
Robarge
,
J.
Ott
, et al
2003
.
A putative RUNX1 binding site variant between SLC9A3R1 and NAT9 is associated with susceptibility to psoriasis.
Nat. Genet.
35
:
349
356
.
52.
Prokunina
L.
,
C.
Castillejo-López
,
F.
Oberg
,
I.
Gunnarsson
,
L.
Berg
,
V.
Magnusson
,
A. J.
Brookes
,
D.
Tentler
,
H.
Kristjansdóttir
,
G.
Gröndal
, et al
2002
.
A regulatory polymorphism in PDCD1 is associated with susceptibility to systemic lupus erythematosus in humans.
Nat. Genet.
32
:
666
669
.
53.
Tristan
C.
,
N.
Shahani
,
T. W.
Sedlak
,
A.
Sawa
.
2011
.
The diverse functions of GAPDH: views from different subcellular compartments.
Cell. Signal.
23
:
317
323
.
54.
Hannibal
L.
,
D.
Collins
,
J.
Brassard
,
R.
Chakravarti
,
R.
Vempati
,
P.
Dorlet
,
J.
Santolini
,
J. H.
Dawson
,
D. J.
Stuehr
.
2012
.
Heme binding properties of glyceraldehyde-3-phosphate dehydrogenase.
Biochemistry
51
:
8514
8529
.
55.
Sun
J.
,
X.
Li
,
H.
Zhou
,
X.
Liu
,
J.
Jia
,
Q.
Xie
,
S.
Peng
,
X.
Sun
,
Q.
Wang
,
L.
Yi
.
2019
.
Anti-GAPDH autoantibody is associated with increased disease activity and intracranial pressure in systemic lupus erythematosus.
J. Immunol. Res.
2019
:
7430780
.
56.
Takasaki
Y.
,
K.
Kaneda
,
M.
Matsushita
,
H.
Yamada
,
M.
Nawata
,
R.
Matsudaira
,
M.
Asano
,
R.
Mineki
,
N.
Shindo
,
H.
Hashimoto
.
2004
.
Glyceraldehyde 3-phosphate dehydrogenase is a novel autoantigen leading autoimmune responses to proliferating cell nuclear antigen multiprotein complexes in lupus patients.
Int. Immunol.
16
:
1295
1304
.
57.
Yudin
D.
,
M.
Fainzilber
.
2009
.
Ran on tracks—cytoplasmic roles for a nuclear regulator.
J. Cell Sci.
122
:
587
593
.
58.
Palmieri
D.
,
A.
Tessari
,
V.
Coppola
.
2018
.
Scorpins in the DNA damage response.
Int. J. Mol. Sci.
19
:
1794
.
59.
Nagel
A. K.
,
L. E.
Ball
.
2015
.
Intracellular protein O-GlcNAc modification integrates nutrient status with transcriptional and metabolic regulation.
Adv. Cancer Res.
126
:
137
166
.
60.
Wu
J. L.
,
M. F.
Chiang
,
P. H.
Hsu
,
D. Y.
Tsai
,
K. H.
Hung
,
Y. H.
Wang
,
T.
Angata
,
K. I.
Lin
.
2017
.
O-GlcNAcylation is required for B cell homeostasis and antibody responses.
Nat. Commun.
8
:
1854
.
61.
Golks
A.
,
T. T.
Tran
,
J. F.
Goetschy
,
D.
Guerini
.
2007
.
Requirement for O-linked N-acetylglucosaminyltransferase in lymphocytes activation.
EMBO J.
26
:
4368
4379
.
62.
Lund
P. J.
,
J. E.
Elias
,
M. M.
Davis
.
2016
.
Global analysis of O-GlcNAc glycoproteins in activated human T cells.
J. Immunol.
197
:
3086
3098
.
63.
Li
Y.
,
M.
Xie
,
L.
Men
,
J.
Du
.
2019
.
O-GlcNAcylation in immunity and inflammation: An intricate system (Review).
Int. J. Mol. Med.
44
:
363
374
.
64.
Soliman
H.
,
M.
Mediavilla-Varela
,
S.
Antonia
.
2010
.
Indoleamine 2,3-dioxygenase: is it an immune suppressor?
Cancer J.
16
:
354
359
.
65.
Soliman
H. H.
,
S.
Antonia
,
D.
Sullivan
,
N.
Vanahanian
,
C.
Link
.
2009
.
Overcoming tumor antigen anergy in human malignancies using the novel indoleamine 2,3-dioxygenase (IDO) enzyme inhibitor, 1-methyl-d-tryptophan (1MT).
J. Clin. Oncol.
27
(
15 Suppl
):
3004
.
66.
Soliman
H. H.
,
S. E.
Minton
,
H. S.
Han
,
R.
Ismail-Khan
,
A.
Mahipal
,
W.
Janssen
,
H.
Streicher
,
N. N.
Vahanian
,
C. J.
Link
,
W. J.
Ramsey
, et al
2013
.
A phase I study of ad.p53 DC vaccine in combination with indoximod in metastatic solid tumors.
J. Clin. Oncol.
31
(
15 Suppl
):
3069
.
67.
Soliman
H. H.
,
E.
Jackson
,
T.
Neuger
,
E. C.
Dees
,
R. D.
Harvey
,
H.
Han
,
R.
Ismail-Khan
,
S.
Minton
,
N. N.
Vahanian
,
C.
Link
, et al
2014
.
A first in man phase I trial of the oral immunomodulator, indoximod, combined with docetaxel in patients with metastatic solid tumors.
Oncotarget
5
:
8136
8146
.
68.
Yue
E. W.
,
R.
Sparks
,
P.
Polam
,
D.
Modi
,
B.
Douty
,
B.
Wayland
,
B.
Glass
,
A.
Takvorian
,
J.
Glenn
,
W.
Zhu
, et al
2017
.
INCB24360 (epacadostat), a highly potent and selective indoleamine-2,3-dioxygenase 1 (IDO1) inhibitor for immuno-oncology.
ACS Med. Chem. Lett.
8
:
486
491
.
69.
Criado
G.
,
E.
Simelyte
,
J. J.
Inglis
,
D.
Essex
,
R. O.
Williams
.
2009
.
Indoleamine 2,3 dioxygenase-mediated tryptophan catabolism regulates accumulation of Th1/Th17 cells in the joint in collagen-induced arthritis.
Arthritis Rheum.
60
:
1342
1351
.
70.
Ravishankar
B.
,
H.
Liu
,
R.
Shinde
,
P.
Chandler
,
B.
Baban
,
M.
Tanaka
,
D. H.
Munn
,
A. L.
Mellor
,
M. C.
Karlsson
,
T. L.
McGaha
.
2012
.
Tolerance to apoptotic cells is regulated by indoleamine 2,3-dioxygenase.
Proc. Natl. Acad. Sci. USA
109
:
3909
3914
.
71.
Merlo
L. M.
,
J.
Bowers
,
T.
Stefanoni
,
R.
Getts
,
L.
Mandik-Nayak
.
2020
.
B-cell-targeted 3DNA nanotherapy against indoleamine 2,3-dioxygenase 2 (IDO2) ameliorates autoimmune arthritis in a preclinical model.
Clin. Pathol.
13
:
2632010X20951812
.
72.
Merlo
L. M. F.
,
S.
Grabler
,
J. B.
DuHadaway
,
E.
Pigott
,
K.
Manley
,
G. C.
Prendergast
,
L. D.
Laury-Kleintop
,
L.
Mandik-Nayak
.
2017
.
Therapeutic antibody targeting of indoleamine-2,3-dioxygenase (IDO2) inhibits autoimmune arthritis.
Clin. Immunol.
179
:
8
16
.

The authors have no financial conflicts of interest.