The invariant chain (Ii) shows promiscuous binding to a great variety of MHC class II allotypes. In contrast, the affinities of the Ii-derived fragments, class II-associated Ii peptides, show large differences in binding to class II allotypes. The promiscuous association of Ii to all class II polypeptides therefore requires an additional contact site to stabilize the interaction to the polymorphic class II cleft. We constructed recombinant molecules containing the class II binding site of Ii (CBS) and tested their association with HLA-DR dimers. The CBS fused to the transferrin receptor mediates binding of transferrin receptor-CBS to class II dimers. Within the CBS, deletion of a sequence N-terminal to the groove-binding motif abolished binding of Ii to DR. A promiscuous class II binding site was identified by reinsertion of the N-terminal residues, amino acids 81–87, of Ii into an Ii mutant that lacks the groove-binding segment. DR allotype-dependent association of Ii was achieved by insertion of antigenic sequences. The promiscuous association, in contrast to the class II allotype-dependent binding of Ii, is important to prevent interaction of class II dimers to nascent polypeptides in the endoplasmic reticulum.

The first indication that the invariant chain (Ii)3 plays a functional role in Ag processing was obtained with Ii-deficient APCs (1). Analysis of Ii-deficient and Ii31/Ii41 transgenic mice supported this observation and, in addition, revealed the importance of Ii for the development of CD4+ T cells (2, 3, 4, 5, 6). In recent years, several molecular functions of Ii have been identified. A major function of Ii is the targeting of MHC class II dimers to the endocytic pathway (7, 8, 9). On this route, Ii degradation controls the acquisition of peptides by class II molecules in specialized loading compartments (reviewed in 10 . In addition, association of class II molecules with Ii supports the assembly of MHC class II polypeptides in the endoplasmic reticulum and is essential for certain allotypes to form functional αβ dimers (2, 11, 12). Peptide-free class II molecules are stabilized by association with Ii, and aggregation is prevented (13, 14, 15, 16). A segment encoded by exon 3 of the Ii gene is indispensable for the formation of the MHC class II/Ii complex (17, 18, 19). Fragments of processed Ii are called class II-associated Ii peptides (CLIP), the sequences of which are encoded by exon 3. The sequence of CLIP is contained in the class II binding site (CBS) of Ii. CLIP were found associated with various MHC class II allotypes (reviewed in 20 . The x-ray crystal structure of CLIP bound to HLA-DR3 revealed that a number of residues in the sequence 91–99 (groove binding site) interact with specific pockets of the MHC class II peptide-binding groove, whereas the N terminus of the Ii fragment is disordered in the crystal (21). Studies on proteolytic fragments of Ii suggest that the CBS also binds to the Ag-binding groove of class II dimers and that CLIP is a naturally occurring degradation intermediate (22, 23, 24, 25). The affinities of CLIP for different MHC allotypes can vary over several orders of magnitude (26). This could indicate that the affinity of CLIP regulates the binding of antigenic peptides. Release of CLIP from MHC class II dimers for which it has a high affinity requires the accessory molecule HLA-DM (27, 28, 29). Allotypes showing a high off rate for CLIP apparently do not depend on the catalytic function of DM for dissociation, although the acquisition of antigenic peptides might be facilitated by DM (30, 31, 32). In these cases, the acidic conditions in the MHC class II loading compartments might be sufficient for dissociation. The strong binding of Ii to different class II allo- and isotypes even across species barriers suggests a highly conserved interaction between Ii and class II dimers (33). Thus, it is conceivable that contacts adjacent to the polymorphic class II groove are responsible for stabilizing the binding of Ii to MHC class II molecules.

Here, we demonstrate both allotype-dependent and promiscuous binding of rIi polypeptides mediated by different Ii sequences to MHC class II dimers. A membrane proximal region of Ii mediates binding to three DR allotypes, whereas the groove-binding segment of Ii replaced by an antigenic sequence leads to allotype-dependent association of class II dimers.

DNAs for transferrin receptor (TFR), rIi, and DR chains were expressed under SV40 promoter control in the pcEXV3 or pSV51 expression vector (7, 34). For construction of TFR-CBS, bp 237–416 of the murine Ii31 cDNA, encoding Ii amino acids (aa) 80–139, was excised by AluI digestion. Maintaining the reading frame, this Ii fragment was inserted into the Eco47III restriction site at the 585-bp position of the human TFR cDNA.

For construction of the deletion mutant ΔIi80-93, bp 233 to 272 of the human Ii33 cDNA (pSV51-huIi) was removed by digestion with FspI, followed by religation. In ΔIi105-157, the segment bp 309 to 465 was excised using NcoI. The cDNA/genomic DNA fusion construct for ΔIi81-127 has been described previously (17). QASLALSYRLNMFTP is a peptide derived from the major outer membrane protein of Chlamydia trachomatis (MOMP). The aa 81–87 (PKSAKPV) of Ii were designated the promiscuous binding site (PBSite). To obtain rIi MOMP, rIi spacer 1, rIi PBSite, and rIi spacer 2, the aa shown in Figure 1 were introduced in ΔIi81-127. For construction of rIi MOMP and rIi PBSite, the two oligonucleotides 5′AGCTTCAAGCAAGTTTGGCTCTCTCTTACAGACTGAATATGTTCACTCCCA and 5′AGCTTCCGAAATCTGCCAAACCTGTGCTGCAGA were hybridized with their complementary strands, thereby generating HindIII overlaps, and ligated into the HindIII restriction site of ΔIi81-127 (at position bp 4717 of the genomic sequence; Fig. 2). Due to the cloning procedure, there is an additional C-terminal KL and LQKL that connects MOMP and Ii aa 81–87, respectively, to Ii aa 128. In the constructs rIi spacer 1 and rIi spacer 2, the oligonucleotides coding for MOMP and for PBSite were inserted in the inverse orientation, thereby encoding a nonrelated sequence with the same number of aa. Oligonucleotides encoding aa 17–31 of the influenza virus matrix protein (MAT) sequence were introduced into genomic Ii DNA. The small fragment between the restriction sites HindIII (bp 4717 in exon 2) and NcoI (bp 4945 in exon 3) was replaced by the oligonucleotides AGCTTTCGGGCCCGCTGAAGGCGGAGATCG/ACGCAGCGCCTCGAGGACGTGTC. This resulted in replacement of aa 81–101 of Ii by MAT aa 17–31, with alanine or threonine at residue 89 of rIiMAT.

FIGURE 1.

Amino acid sequences of the segment aa 70–140 of recombinant Ii. Single aa code is used. Inserted aa are shown in italics. Deleted sequences are indicated by dashes.

FIGURE 1.

Amino acid sequences of the segment aa 70–140 of recombinant Ii. Single aa code is used. Inserted aa are shown in italics. Deleted sequences are indicated by dashes.

Close modal
FIGURE 2.

Schematic representation of recombinant Ii constructs. The cDNA/genomic DNA fusion construct encoding the Ii deletion mutant ΔIi81-127 lacks exon 3 and part of exon 4. The deletion mutant was used for the generation of MOMP and PBSite derivatives. Restriction sites that were used for cloning procedures are indicated. Oligonucleotides encoding MOMP, PBSite (PBS), and unrelated sequences of the same length (spacer 1 and spacer 2) were cloned into the HindIII site. In the Ii DNA, a HindIII/NcoI fragment was replaced by sequences encoding MAT A or MAT T. In these mutants, the two N-linked glycan sites of Ii are preserved. The expressed rIi products are shown schematically. Exon boundaries are indicated by vertical lines. Inserted antigenic sequences are indicated in black and the spacer regions as strips. The transmembrane region is shown by diagonal strips. The positions of N-glycosylation sites are indicated by asterisks.

FIGURE 2.

Schematic representation of recombinant Ii constructs. The cDNA/genomic DNA fusion construct encoding the Ii deletion mutant ΔIi81-127 lacks exon 3 and part of exon 4. The deletion mutant was used for the generation of MOMP and PBSite derivatives. Restriction sites that were used for cloning procedures are indicated. Oligonucleotides encoding MOMP, PBSite (PBS), and unrelated sequences of the same length (spacer 1 and spacer 2) were cloned into the HindIII site. In the Ii DNA, a HindIII/NcoI fragment was replaced by sequences encoding MAT A or MAT T. In these mutants, the two N-linked glycan sites of Ii are preserved. The expressed rIi products are shown schematically. Exon boundaries are indicated by vertical lines. Inserted antigenic sequences are indicated in black and the spacer regions as strips. The transmembrane region is shown by diagonal strips. The positions of N-glycosylation sites are indicated by asterisks.

Close modal

COS1 (CRL-1650; American Type Culture Collection (ATCC), Rockville, MD) and COS7 (CRL-1651; ATCC) cells were cultivated in high glucose DMEM supplemented with 10% FCS, 100 μg/ml penicillin, 100 U/ml streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, and 2 mM l-glutamine. Transient transfections were performed by DEAE-mediated DNA transfer (10 μg DNA/3 × 106 COS1 cells; 24 h), electroporation (210 V/1.2 mF, 25 μg DNA/6 × 106 COS1 cells; 72 h), and liposome-aided transfer (1 μg DNA/5 × 105 COS7 cells; 48 h) as described (35, 36, 37).

After incubation of cells for 1 h at 37°C in methionine-free RPMI 1640, newly synthesized proteins were labeled for 10 min with 50 μCi [35S]methionine (Amersham, Braunschweig, Germany) in methionine-free RPMI (supplemented with 10% dialysed FCS, 1 mM sodium pyruvate, 2 mM glutamine, and 10 mM HEPES). The cells were lysed with 1% Nonidet P-40 in Tris-buffered saline in the presence of protease inhibitors (1 μM PMSF and 0.024 trypsin inhibitor units of aprotinin per ml). Lysates were precleared by a 2-h incubation with Sepharose CL4B. To reduce background in some experiments, the lysates were first adjusted to pH 5 by the addition of acetic acid. Acid-precipitated proteins were spun down by centrifugation. The supernatant was neutralized and further cleared by addition of Sepharose CL4B. mAbs used for immunoprecipitation were PA1 (αTFR, a gift from Dr. G. Moldenhauer, Heidelberg, Germany), P4H5 (α-Ii peptide RPMSMDNMLLGPVKNVTK; 38 , VicY1 (α-human Ii; 39 , In1 (α-murine Ii; 40 , ISCR3, and I251SB (α-HLA-DR chains; Refs. 41 and 42) For immunoprecipitation, mAbs were added to the cell lysates in the presence of 10 μl protein A-Sepharose CL4B. After overnight incubation, precipitates were washed three times in 0.25% Nonidet P-40 in Tris-buffered saline (pH 6.8).

Immunoprecipitates were boiled in reducing sample buffer for 4 min and analyzed on 10 to 15% SDS polyacrylamide gradient gels or 13% SDS polyacrylamide gels (17). For two-dimensional nonequilibrated pH gradient electrophoresis (NEPHGE), protein A-Sepharose pellets were incubated for 1 h at room temperature in NEPHGE sample buffer (9.5 M urea, 2% Nonidet P-40, 2% ampholines (pH 3.5–10), and 50 mM DTT), and the proteins were separated according to their charge using 4% polyacrylamide rod gels (first dimension). The rod gels were then incubated for 2 h in reducing sample buffer. In the second dimension, the proteins were separated according to molecular mass in 13% SDS-polyacrylamide gels.

In an attempt to localize contact sites of Ii that stabilize the interaction of the groove-binding segment to class II polypeptides, we inserted a sequence of Ii that contains the previously identified CBS to the luminal domain of another type II membrane protein, the TFR. The segment of the Ii cDNA encoding aa 80–139 was ligated into the TFR cDNA (Fig. 3,A). This Ii sequence contains the CBS (aa 81–109) and an adjacent stretch of 30 aa that provides an epitope recognized by the mAb P4H5. This recombinant TFR-CBS forms S-S-linked dimers, and its N-linked glycan side chains acquire Endo H resistance upon intracellular transport (G. Reuter and N. Koch, unpublished observations). To explore the binding properties of the recombinant TFR to HLA-DR molecules, various combinations of TFR-CBS, TFR, and Ii constructs were transiently coexpressed with DRα and -β cDNAs in COS cells (Fig. 3,B). Since some DR allotypes were reported to bind TFR-derived sequences, we used the DR3 allele, because no TFR peptides had been eluted from this allotype (43). Cells were radiolabeled, lysed, and immunoprecipitated with mAbs specific for DR, TFR, or Ii. The mAb against TFR immunoprecipitates TFR and TFR-CBS (Fig. 3 B). The 60-aa Ii segment increases the size of TFR-CBS compared with TFR. The Ii-specific mAb P4H5 does not bind to TFR, but immunoisolates TFR-CBS. This demonstrates that the Ii segment is positioned in a site accessible for the mAb P4H5. Immunoprecipitates of DR molecules reveal that large amounts of TFR-CBS, similar to the amounts of Ii in the first lane, are coisolated. Precipitation with Ii or TFR Abs do not exhibit class II bands, because the TFR-CBS is in large excess. This result is also obtained with wild-type Ii (data not shown).

FIGURE 3.

A chimeric TFR is coprecipitated with DR molecules. A, A DNA fragment encoding aa 80–139 of Ii was inserted into the cDNA of the human TFR. This sequence contains the CBS and the recognition site for mAb P4H5. A schematic presentation of the resulting TFR-CBS protein is shown. The segment containing the CBS is black, and diagonal strips label the transmembrane region. Asterisks indicate the positions of N-glycosylation sites. The Ii segment in TFR-CBS is 107 aa from the transmembrane domain, compared with 22 aa in Ii. B, COS1 cells were transiently transfected with DR3 cDNAs and with Ii, TFR, or TFR-CBS as indicated. Cells were biosynthetically labeled, lysed, and immunoprecipitated with mAbs shown below the lanes: DR (ISCR3 and I251SB), TFR (PA1), and Ii (P4H5). Precipitates were subjected to 10 to 15% gradient SDS-PAGE analysis under reducing conditions. The migration of a m.w. markers (Mr) is marked on the left in kDa. The positions of TFR-CBS, TFR, DRα, DRβ, and Ii are indicated on the right.

FIGURE 3.

A chimeric TFR is coprecipitated with DR molecules. A, A DNA fragment encoding aa 80–139 of Ii was inserted into the cDNA of the human TFR. This sequence contains the CBS and the recognition site for mAb P4H5. A schematic presentation of the resulting TFR-CBS protein is shown. The segment containing the CBS is black, and diagonal strips label the transmembrane region. Asterisks indicate the positions of N-glycosylation sites. The Ii segment in TFR-CBS is 107 aa from the transmembrane domain, compared with 22 aa in Ii. B, COS1 cells were transiently transfected with DR3 cDNAs and with Ii, TFR, or TFR-CBS as indicated. Cells were biosynthetically labeled, lysed, and immunoprecipitated with mAbs shown below the lanes: DR (ISCR3 and I251SB), TFR (PA1), and Ii (P4H5). Precipitates were subjected to 10 to 15% gradient SDS-PAGE analysis under reducing conditions. The migration of a m.w. markers (Mr) is marked on the left in kDa. The positions of TFR-CBS, TFR, DRα, DRβ, and Ii are indicated on the right.

Close modal

Coprecipitation of TFR-CBS with DR indicates that the Ii segment aa 80–139 endows class II binding properties. The rest of Ii appears to be dispensable for interaction to DR molecules. This demonstrates that the Ii segment aa 80–139 alone is sufficient for productive association with MHC class II molecules. The association may be due to the groove-binding sequence alone, or additional sequences may stabilize the Ii/class II groove interaction.

We studied whether the sequences flanking the groove-binding segment (aa 91–99) influence Ii/class II association. With two available restriction sites, sequences adjacent to the groove-binding segment of Ii were deleted (Fig. 4,A). In ΔIi80-93, the truncated anchor positions Met91 and Met93, in addition to the deleted aa 80–90, could impair binding to class II dimers. The deletion in ΔIi105-157 starts exactly beyond the sequence of CLIP (aa 81–104). ΔIi80-93 or ΔIi105-157 was coexpressed with DR cDNAs and immunoprecipitated with anti-Ii or anti-DR mAbs. Since ΔIi80-93 comigrates with the DR β-chain in one-dimensional SDS-PAGE, the immunoprecipitates were analyzed in two-dimensional NEPHGE/SDS-PAGE (Fig. 4,B). The anti-Ii immunoprecipitates show that the recombinant Ii and wild-type Ii are expressed at a high level. Class II is not detected because of the excess of Ii. DR precipitates reveal that wild-type Ii is coprecipitated (Fig. 4,B, top), whereas ΔIi80–93 is not detected in DR precipitates (Fig. 4,B, middle). This result was verified by endoglycosidase H digestion and one-dimensional separation of the immunoprecipitates, in which ΔIi80-93 and DRβ have different m.w.s according to the differing number of digested N-glycan side chains (data not shown). In contrast to the recombinant Ii lacking aa 80–93, the mutant ΔIi105-157 is coisolated with MHC class II molecules from cotransfectants (Fig. 4 B, bottom).

FIGURE 4.

Deletion of aa 80–93 in Ii abrogates association with DR molecules. A, Ii deletion constructs were generated by digesting human Ii cDNA with restriction endonucleases FspI (ΔIi80-93) or NcoI (ΔIi105-157), followed by religation. The CBS-containing segment is shown in black, and the transmembrane region is marked by bars. Asterisks indicate the positions of N-glycosylation sites. B, Two-dimensional separation (NEPHGE/SDS-PAGE) of Ii (left) and DR (right) immunoprecipitates. COS1 cells were cotransfected with DR3 cDNAs and the human Ii cDNA (top), ΔIi80-93 (middle), or ΔIi105–157 (bottom). Cells were radiolabeled and lysed. DR was immunoprecipitated with mAbs ISCR3 and I251SB; mAb VicY1 was used for isolation of Ii. Positions of Ii derivatives are marked by arrowheads; DR chains are indicated by α and β, respectively. The position of ΔIi80-93 in the DR precipitates was determined by comparison with the Ii precipitates (left) and is indicated by an open circle.

FIGURE 4.

Deletion of aa 80–93 in Ii abrogates association with DR molecules. A, Ii deletion constructs were generated by digesting human Ii cDNA with restriction endonucleases FspI (ΔIi80-93) or NcoI (ΔIi105-157), followed by religation. The CBS-containing segment is shown in black, and the transmembrane region is marked by bars. Asterisks indicate the positions of N-glycosylation sites. B, Two-dimensional separation (NEPHGE/SDS-PAGE) of Ii (left) and DR (right) immunoprecipitates. COS1 cells were cotransfected with DR3 cDNAs and the human Ii cDNA (top), ΔIi80-93 (middle), or ΔIi105–157 (bottom). Cells were radiolabeled and lysed. DR was immunoprecipitated with mAbs ISCR3 and I251SB; mAb VicY1 was used for isolation of Ii. Positions of Ii derivatives are marked by arrowheads; DR chains are indicated by α and β, respectively. The position of ΔIi80-93 in the DR precipitates was determined by comparison with the Ii precipitates (left) and is indicated by an open circle.

Close modal

The lack of association of ΔIi80-93 to DR molecules could suggest that residues N-terminal to the groove-binding motif of Ii are important for the association with MHC class II molecules. We investigated whether in the absence of the groove-binding segment reintroduction of N-terminal residues would restore binding to class II. Fig. 2 shows a schematic representation of a recombinant Ii (rIi PBSite) in which aa 81–87 were introduced into ΔIi81-127. These two deletion constructs and DR cDNAs were coexpressed in COS cells. rIi PBSites was coprecipitated with DR1; while consistent with our previous results, ΔIi81-127 could not be coisolated (Fig. 5,A, left) (17). Ii immunoprecipitates show that the Ii derivatives were strongly expressed (Fig. 5 A, right). Ii precipitates usually do not show class II bands. To examine the specificity of aa 81–87 binding, a construct with an unrelated spacer sequence of the same length (rIi spacer 2) was generated. Transient expression with DR1 and immunoprecipitation with anti-DR Abs revealed that rIi spacer 2 did not bind to class II dimers, which supports the specific binding of rIi PBSite to DR molecules. This result indicates that aa 81–87 mediate binding of an Ii mutant, which lacks the groove-binding segment, to class II molecules.

FIGURE 5.

In the absence of the groove-binding segment of Ii, the sequence aa 81–87 restores binding to different DR allotypes. COS1 cells were transfected, radiolabeled, lysed, and immunoprecipitated with mAbs specific for DR (ISCR3 and I251SB) and against Ii (In1). DR (left) or Ii (right) immunoprecipitates from COS1 transfectants expressing various combinations of DR1 (A), DR3 (B), or DR4 (C) and Ii, ΔIi81-127, rIi PBSite, or rIi spacer 2 are shown. In lane φ, DR without Ii was transfected. Positions of the DR α- and β-chains and the Ii derivatives are indicated on the right. Migration of m.w. markers (Mr) is shown on the left.

FIGURE 5.

In the absence of the groove-binding segment of Ii, the sequence aa 81–87 restores binding to different DR allotypes. COS1 cells were transfected, radiolabeled, lysed, and immunoprecipitated with mAbs specific for DR (ISCR3 and I251SB) and against Ii (In1). DR (left) or Ii (right) immunoprecipitates from COS1 transfectants expressing various combinations of DR1 (A), DR3 (B), or DR4 (C) and Ii, ΔIi81-127, rIi PBSite, or rIi spacer 2 are shown. In lane φ, DR without Ii was transfected. Positions of the DR α- and β-chains and the Ii derivatives are indicated on the right. Migration of m.w. markers (Mr) is shown on the left.

Close modal

The important question now was whether rIi PBSite binds to other DR allotypes. rIi PBSite was coexpressed with DR3 or DR4 dimers. Class II immunoprecipitates show that rIi PBSite also associates with DR3 and DR4 molecules (Fig. 5, B and C). Again, ΔIi81-127 did not coprecipitate with DR. This result demonstrates promiscuous binding of rIi PBSite to three DR allotypes.

Ii thus appears to harbor a promiscuous allotype-independent site in addition to an allotype-dependent class II binding site. Allotype-dependent binding of CLIP has been demonstrated, but a basis for the allotype-independent binding of Ii has not been defined. To monitor DR allele-specific binding of Ii, we introduced antigenic sequences into ΔIi81-127. At first, we studied whether association of a rIi, with the groove-binding segment replaced by an antigenic sequence, to DR dimers is possible. The sequence of MOMP, QASLALSYRLNMFTP, binds to DR3 (44). ΔIi81-127 lacking the CBS was used to introduce the sequence of MOMP (compare Figs. 1 and 2). Coexpression of this chimeric Ii with DR3 molecules and subsequent immunoisolation of DR molecules show coisolation of rIi MOMP (Fig. 6). As a control, rIi spacer 1, with an unrelated sequence of the same length as MOMP, does not coprecipitate with DR3. Immunoprecipitation of Ii indicates equivalent expression of both rIi. Class II is not detected in the Ii precipitates.

FIGURE 6.

Coisolation of rIi MOMP with DR3 molecules. COS7 cells were transiently transfected with vectors encoding DR3 and the indicated wild-type or mutant Ii. Radiolabeled DR (mAbs ISCR3 and I251SB) and Ii (mAb In1) immunoprecipitates were isolated and resolved by 13% SDS-PAGE. Molecular weight markers (Mr) are separated (left), and positions of DRα, DRβ, Ii, and rIi are marked by arrows (right). The increased mobility of rIi (21 kDa) is explained by the lack of two N-bound glycan site chains compared with the wild-type Ii (31 kDa).

FIGURE 6.

Coisolation of rIi MOMP with DR3 molecules. COS7 cells were transiently transfected with vectors encoding DR3 and the indicated wild-type or mutant Ii. Radiolabeled DR (mAbs ISCR3 and I251SB) and Ii (mAb In1) immunoprecipitates were isolated and resolved by 13% SDS-PAGE. Molecular weight markers (Mr) are separated (left), and positions of DRα, DRβ, Ii, and rIi are marked by arrows (right). The increased mobility of rIi (21 kDa) is explained by the lack of two N-bound glycan site chains compared with the wild-type Ii (31 kDa).

Close modal

To determine allotype-dependent binding, we introduced the sequence of MAT into Ii. MAT is a peptide comprising aa 17–31 of influenza virus matrix protein. The MAT peptide 17SGPLKAEIAQRLEDV31 has been shown to bind to DR1, while the A in position 25 replaced by a T leads to binding to DR4 (45). Both sequences were cloned into ΔIi81-101 (Figs. 1 and 2) and expressed in COS cells with either DR1 or DR4 (Fig. 7). Immunoprecipitation demonstrates that rIi MAT A is coprecipitated with DR1, whereas the mutation of Ala25 to Thr almost completely abrogates binding to DR1. Conversely, rIiMAT T binds to DR4, whereas rIi MAT A does not. This shows that the binding of the rIi MAT constructs is DR allele specific and that an allotype-independent binding sequence is missing in these constructs. The expression of the recombinant Ii is similar in all samples (Fig. 7, bottom). Class II is not visible in Ii precipitates.

FIGURE 7.

DR allotype-specific binding of rIi MAT. rIi were coexpressed with DR1 or DR4 molecules in COS7 cells. Analysis of radiolabeled immunoprecipitates was performed with mAbs ISCR3 and I251SB (DR) and In1 (Ii). The upper part exhibits DR immunoprecipitates, and in the lower part, Ii immunoprecipitates of the same cell lysates are shown. Molecular weight markers are separated on the left, and the positions of DRα, DRβ, and rIi are indicated on the right.

FIGURE 7.

DR allotype-specific binding of rIi MAT. rIi were coexpressed with DR1 or DR4 molecules in COS7 cells. Analysis of radiolabeled immunoprecipitates was performed with mAbs ISCR3 and I251SB (DR) and In1 (Ii). The upper part exhibits DR immunoprecipitates, and in the lower part, Ii immunoprecipitates of the same cell lysates are shown. Molecular weight markers are separated on the left, and the positions of DRα, DRβ, and rIi are indicated on the right.

Close modal

Several pieces of data indicate that Ii and CLIP bind with the same sequence to MHC class II dimers. The observation that both CLIP and an Ii degradation product containing the CBS can stimulate the same T cell clone argues that in the intact protein, Ii interacts with class II in much the same way as the peptide (25). However, the binding characteristics of CLIP and the CBS of Ii show one major difference. The strength of the interaction of CLIP with individual allotypes varies up to four orders of magnitude (26). Affinity measurements for the association of Ii with various MHC class II alleles are not available. However, if binding differences of this order existed, they should have been detected in biochemical studies of class II/Ii interaction. Thus, the nonameric complex of class II and Ii probably bears additional contact sites that stabilize the interaction between Ii and class II molecules. We report here that the sequence comprising aa 81–87 (PKSAKPV) is important for binding of a recombinant Ii protein to class II polypeptides. Despite the absence of the groove-binding segment, rIi PBSite shows promiscuous binding to three DR alleles. In particular, HLA-DR4, which possesses only moderate binding capacities for CLIP (22), binds efficiently to rIi PBSite. The PBSite of Ii may compensate for the allele-regulated interaction of aa 91–99 with polymorphic residues of the class II pockets. The proximity of the PBSite to the groove-binding motif could be of particular importance for stabilization of the class II cleft. A stabilizing effect of elongations of sequences accommodated within the class II groove has previously been shown for antigenic peptides. The elongation of synthetic HEL peptides at either end of the core region increases the stability of the class II/peptide complex, an N-terminal elongation being particularly effective (46).

Consistent with our findings, almost identical binding characteristics were found for the Ii76-91 peptide to four murine alleles, whereas the binding of CLIP differed according to the individual allotypes (47). These authors in addition reported that the groove-binding peptide inhibits binding of antigenic peptides. In contrast, the Ii76-91 peptide enhances binding of two different HEL peptides.

Peptides containing aa 81–87 of Ii possibly bind to the α1 domain of MHC class II dimers, as their binding site seems to overlap with the Staphylococcus enterotoxin B contact region (48, 49). The interactions of these Ii-derived peptides and of intact Ii with class II seem to involve the same class II domain, as the peptide binding can be inhibited by soluble Ii (49). Possible contact residues on the α1 domain were suggested to be Asp17, Glu21, and/or Asp35 of DR (48). These residues were proposed to interact with Lys83 and/or Lys86 of human Ii. These residues are highly conserved between mice and humans, and there are putative acidic counterparts for the lysine residues in the α1 domain of H2-A, H2-E, DR, DP, and DQ. The interaction of these class II residues with the lysine-rich PBSite could thus have a stabilizing effect on Ii binding irrespective of the class II allele. A binding domain containing residues 81–87 of Ii might not be formed by a peptide of the same sequence. This could explain why a strong binding of the free peptide to class II molecules was not observed (48). The aa 81–87 sequence could be part of a larger motif that is destroyed by Ii degradation.

Presumably, there are several contact sites of Ii and class II in the (αβIi)3 complex. A recombinant, soluble Ii lacking the N-terminal part up to aa 117 augmented antigenic peptide binding of DR dimers, suggesting that the C-terminal part of Ii also interacts with class II molecules (24). Recently, it was shown that the membrane-proximal region and the sequence from which CLIP is derived are extended in the Ii trimer (50). This open structure could allow binding to the class II groove. Our result that aa 80–139 of Ii fused into the TFR sequence 107 aa from the transmembrane domain permits binding to class II polypeptides suggests that this open structure is retained in the TFR-CBS. Presumably other sequences of Ii are not essential for class II interaction.

The interaction between class II and aa residues 81–87 of the CBS suggests how Ii release could be controlled. The acquisition of peptides by class II dimers is postponed until a final step of Ii degradation, when the CLIP sequence is proteolytically separated from the highly conserved 22 aa between the transmembrane domain and the CBS. The stepwise release of Ii from MHC class II molecules is initiated by cleavage at a position C-terminal to the groove-binding motif (51). The Ii fragment LIP is still associated with class II dimers (52) and might dissociate from the nonameric complex. The trimer could be more accessible to proteases and to HLA-DM than the nonamer (28). If LIP is not removed by DM, further cleavage at residues 80–87 and C-terminal trimming of the fragment yields CLIP bound to MHC class II dimers. This degradation step might impair interactions of the proline-lysine-rich motif of CLIP with class II polypeptides. The allotype-dependent binding of aa 91–99 then could determine whether accessory molecules such as HLA-DM are necessary for CLIP release.

The promiscuous binding of Ii to class II molecules may facilitate the assembly of the nonameric class II/Ii complex in the endoplasmic reticulum and could postpone the binding of antigenic sequences to MHC class II vesicles. In this compartment, CLIP governs the acquisition of peptides by class II dimers as has been demonstrated with H2-M-deficient mice (53, 54, 55). It remains to be shown whether CLIP modulates an immune response as a consequence of the MHC polymorphism.

Positioning of an antigenic sequence into Ii might be useful for raising cellular vaccines. A similar strategy recently was described (56). In this report, a T cell epitope from hemagglutinin was used for insertion into Ii beyond aa 90. This construct contains the PBSite that we identified. A transfectant containing this chimeric Ii was efficiently recognized by a hemagglutinin-specific T cell clone. By comparison, we introduced the antigenic sequence of MAT into an Ii deletion mutant that lacks the PBSite and obtained DR allotype-dependent binding of MAT to class II molecules. This result suggests binding of the recombinant MAT to the class II peptide-binding groove. Our finding that an Ii sequence adjacent to the groove-binding segment stabilizes binding of Ii to class II molecules is consistent with a recent publication (57). In this report, antigenic sequences introduced into Ii mediate resistance of the DR1/Ii complex to SDS treatment. This result is consistent with binding of the antigenic sequence into the peptide binding cleft of class II molecules.

We thank Drs. O. Bakke, J. Miller, and H. Ploegh for providing cDNAs and vectors; A. König for excellent technical assistance; and Drs. P. Gleeson, R. Lindner, F. Sanderson, and J. Trowsdale for critical discussions.

1

This work was supported by the Sonderforschungsbereich 284, Sonderforschungsbereich 502 and by the Graduiertenkolleg “Funktionelle Proteindomänen.” N.K. was supported on his sabbatical leave by a grant from the Volkswagenstiftung.

3

Abbreviations used in this paper: Ii, invariant chain; CLIP, class II-associated Ii peptides; CBS, class II binding site of Ii; PBSite, promiscuous binding site of Ii; aa, amino acids; TFR, transferrin receptor; MOMP, peptide from major outer membrane protein of C. trachomatis; MAT, peptide from influenza virus matrix protein; NEPHGE, nonequilibrated pH gradient electrophoresis.

1
Stockinger, B., U. Pessara, R. H. Lin, J. Habicht, M. Grez, N. Koch.
1989
. A role of Ia-associated invariant chains in antigen processing and presentation.
Cell
56
:
683
2
Viville, S., J. Neefjes, V. Lotteau, A. Dierich, M. Lemeur, H. Ploegh, C. Benoist, D. Mathis.
1993
. Mice lacking the MHC class II-associated invariant chain.
Cell
72
:
635
3
Bikoff, E. K., L. Y. Huang, V. Episkopou, J. van Meerwijk, R. N. Germain, E. J. Robertson.
1993
. Defective major histocompatibility complex class II assembly, transport, peptide acquisition, and CD4+ T cell selection in mice lacking invariant chain expression.
J. Exp. Med.
177
:
1699
4
Naujokas, M. F., L. S. Arneson, B. Fineschi, M. E. Peterson, S. Sitterding, A. T. Hammond, C. Reilly, D. Lo, J. Miller.
1995
. Potent effects of low levels of MHC class II-associated invariant chain on CD4+ T cell development.
Immunity
3
:
359
5
Shachar, I., E. A. Elliott, B. Chasnoff, I. S. Grewal, R. A. Flavell.
1995
. Reconstitution of invariant chain function in transgenic mice in vivo by individual p31 and p41 isoforms.
Immunity
3
:
373
6
Takaesu, N. T., J. A. Lower, E. J. Robertson, E. K. Bikoff.
1995
. Major histocompatibility class II peptide occupancy, antigen presentation, and CD4+ T cell function in mice lacking the p41 isoform of invariant chain.
Immunity
3
:
385
7
Bakke, O., B. Dobberstein.
1990
. MHC class II-associated invariant chain contains a sorting signal for endosomal compartments.
Cell
63
:
707
8
Lotteau, V., L. Teyton, A. Pelereaux, T. Nilsson, L. Karlsson, S. L. Schmid, V. Quaranta, P. A. Peterson.
1990
. Intracellular transport of class II MHC molecules directed by invariant chain.
Nature
348
:
600
9
Lamb, C. A, J. W. Yewdell, J. R. Bennink, P. Cresswell.
1991
. Invariant chain targets HLA class II molecules to acidic endosomes containing internalized influenza virus.
Proc. Natl. Acad. Sci. USA
88
:
5998
10
Mellman, I., P. Pierre, S. Amigorena.
1995
. Lonely MHC molecules seeking immunogenic peptides for meaningful relationships.
Curr. Opin. Cell Biol.
7
:
564
11
Anderson, M. S., J. Miller.
1992
. Invariant chain can function as a chaperone protein for class II major histocompatibility complex molecules.
Proc. Natl. Acad. Sci. USA
89
:
2282
12
Bikoff, E. K., R. N. Germain, E. J. Robertson.
1995
. Allelic differences affecting invariant chain dependency of MHC class II subunit assembly.
Immunity
2
:
301
13
Schaiff, W. T., K. A. Hruska, D. W. McCourt, M. Green, B. D. Schwartz.
1992
. HLA-DR associates with specific stress proteins and is retained in the endoplasmic reticulum in invariant chain negative cells.
J. Exp. Med.
176
:
657
14
Germain, R. N., A. G. Rinker, Jr.
1993
. Peptide binding inhibits protein aggregation of invariant-chain free class II dimers and promotes surface expression of occupied molecules.
Nature
363
:
725
15
Bonnerot, C., M. S. Marks, P. Cosson, E. J. Robertson, E. K. Bikoff, R. N. Germain, J. S. Bonifacino.
1994
. Association with BiP and aggregation of class II MHC molecules synthesized in the absence of invariant chain.
EMBO J.
13
:
934
16
Elliott, E. A., J. R. Drake, S. Amigorena, J. Elsemore, P. Webster, I. Mellman, R. A. Flavell.
1994
. The invariant chain is required for intracellular transport and function of major histocompatibility complex class II molecules.
J. Exp. Med.
179
:
681
17
Freisewinkel, I. M., K. Schenck, N. Koch.
1993
. The segment of invariant chain that is critical for association with major histocompatibility complex class II molecules contains the sequence of a peptide eluted from class II polypeptides.
Proc. Natl. Acad. Sci. USA
90
:
9703
18
Bijlmakers, M-J., E. P. Benaroch, H. Ploegh.
1994
. Mapping functional regions in the lumenal domain of the class II-associated invariant chain.
J. Exp. Med.
180
:
623
19
Romagnoli, P., R. N. Germain.
1994
. The CLIP region of invariant chain plays a critical role in regulating major histocompatibility complex class II folding, transport, and peptide occupancy.
J. Exp. Med.
180
:
1107
20
Rammensee, H.-G., T. Friede, S. Stevanovic.
1995
. MHC ligands and peptide motifs: first listing.
Immunogenetics
41
:
178
21
Ghosh, P., M. Amaya, E. Mellins, D. C. Wiley.
1995
. The structure of an intermediate in class II MHC maturation: CLIP bound to HLA-DR3.
Nature
378
:
457
22
Avva, R. R., P. Cresswell.
1994
. In vivo and in vitro formation and dissociation of HLA-DR complexes with invariant chain-derived peptides.
Immunity
1
:
763
23
Riberdy, J. M., R. R. Avva, H. J. Geuze, P. Cresswell.
1994
. Transport and intracellular distribution of MHC class II molecules and associated invariant chain in normal and antigen-processing mutant cell lines.
J. Cell. Biol.
125
:
1225
24
Park, S.-J., S. Sadegh-Nasseri, D. C. Wiley.
1995
. Invariant chain made in Escherichia coli has an exposed N-terminal segment that blocks antigen binding to HLA-DR1 and a trimeric C-terminal segment that binds empty HLA-DR1.
Proc. Natl. Acad. Sci. USA
92
:
11289
25
Morkowski, S., A. W. Goldrath, S. Eastman, L. Ramachandra, D. C. Freed, P. Whiteley, A. Y. Rudensky.
1995
. T cell recognition of major histocompatibility complex class II complexes with invariant chain processing intermediates.
J. Exp. Med.
182
:
1403
26
Sette, A., S. Southwood, J. Miller, E. Appella.
1995
. Binding of major histocompatibility complex class II to the invariant chain-derived peptide, CLIP, is regulated by allelic polymorphism in class II.
J. Exp. Med.
181
:
677
27
Denzin, L. K., N. F. Robbins, C. Carboy-Newcomb, P. Cresswell.
1994
. Assembly and intracellular transport of HLA-DM and correction of the class II antigen processing defect in T2 cells.
Immunity
1
:
595
28
Denzin, L. K., P. Cresswell.
1995
. HLA-DM induces CLIP dissociation from MHC class II αβ dimers and facilitates peptide loading.
Cell
82
:
155
29
Sherman, M. A., D. A. Weber, P. E. Jensen.
1995
. DM enhances peptide binding to class II MHC by release of invariant chain-derived peptide.
Immunity
3
:
197
30
Malcherek, G., V. Gnau, G. Jung, H.-G. Rammensee, A. Melms.
1995
. Supermotifs enable natural invariant chain-derived peptides to interact with many major histocompatibility complex-class II molecules.
J. Exp. Med.
181
:
527
31
Stebbins, C. C., G. E. Loss, Jr, C. G. Elias, A. Chervonsky, A. J. Sant.
1995
. The requirement for DM in class II-restricted antigen presentation and SDS-stable dimer formation is allele and species dependent.
J. Exp. Med.
181
:
223
32
Roche, P. A..
1995
. HLA-DM: an in vivo facilitator of MHC class II peptide loading.
Immunity
3
:
259
33
Glimcher, L. H., B. S. Polla, A. Poljak, C. C. Morton, D. J. McKean.
1987
. Murine class II (Ia) molecules associate with human invariant chain.
J. Immunol.
138
:
1519
34
Okyama, H., P. Berg.
1983
. A cDNA cloning vector that permits expression of cDNA inserts in mammalian cells.
Mol. Cell. Biol.
3
:
280
35
Cullen, B. R..
1987
. Use of eukaryotic expression technology in the functional analysis of cloned genes.
Methods Enzymol.
152
:
684
36
Chu, G., H. Hayakawa, P. Berg.
1987
. Electroporation for the efficient transfection of mammalian cells with DNA.
Nucl. Acids Res.
15
:
1311
37
Rose, J. K., L. Bionocore, M. A. Whitt.
1991
. A new cationic liposome reagent mediating nearly quantitative transfection of animal cells.
Biotechniques
10
:
520
38
Mehringer, J. H., M. R. Harris, C. S. Kindle, D. W. McCourt, S. E. Cullen.
1991
. Characterization of fragments of the murine Ia-associated invariant chain.
J. Immunol.
146
:
920
39
Quaranta, V., O. Majdic, G. Stingl, K. Liszka, H. Honigsmann, W. Knapp.
1984
. A human Ia cytoplasmic determinant located on multiple forms of invariant chain.
J. Immunol.
132
:
1900
40
Koch, N., S. Koch, G. J. Hämmerling.
1982
. Ia-invariant chain detected on the lymphocyte surfaces by monoclonal antibody.
Nature
299
:
644
41
Watanabe, M., T. Suzuki, M. Taniguchi, N. Shinohara.
1983
. Monoclonal anti-Ia murine alloantibodies cross-reactive with the Ia-homologues of other species including human.
Transplantation
36
:
712
42
Pesando, J. M., L. Graf.
1986
. Differential expression of HLA-DR, -DQ, and -DP antigens on malignant B cells.
J. Immunol.
136
:
4311
43
Chicz, R. M., R. G. Urban, J. C. Gorga, D. A. A. Vignali, W. S. Lane, J. L. Strominger.
1993
. Specificity and promiscuity among naturally processed peptides bound to HLA-DR alleles.
J. Exp. Med.
178
:
27
44
Riberdy, J. M., P. Cresswell.
1992
. The antigen-processing mutant T2 suggests a role for MHC-linked genes in class II anigen presentation.
J. Immunol.
148
:
2586
45
Hammer, J., P. Valsasnini, K. Tolba, D. Bolin, J. Higelin, J. Takacs, F. Sinigaglia.
1993
. Promiscuous and allele-specific anchors in HLA-DR binding peptides.
Cell
74
:
197
46
Nelson, C. A., S. J. Petzold, E. R. Unanue.
1993
. Identification of two distinct properties of class II major histocompatibility complex-associated peptides.
Proc. Natl. Acad. Sci. USA
90
:
1227
47
Adams, S., R. E. Humphreys.
1995
. Invariant chain peptides enhancing or inhibiting the presentation of antigenic peptides by major histocompatibility complex class II molecules.
Eur. J. Immunol.
25
:
1693
48
Kropshofer, H., A. B. Vogt, G. J. Hämmerling.
1995
. Structural features of the invariant chain fragment CLIP controlling rapid release from HLA-DR molecules and inhibition of peptide binding.
Proc. Natl. Acad. Sci. USA
92
:
8313
49
Vogt, A. B., L. J. Stern, C. Amshoff, B. Dobberstein, G. J. Hämmerling, H. Kropshofer.
1995
. Interference of distinct invariant chain regions with superantigen contact area and antigenic peptide binding groove of HLA-DR.
J. Immunol.
155
:
4757
50
Jasanoff, A., S-J. Park, D. C. Wiley.
1995
. Direct observation of disordered regions in the major histocompatibility complex class II-associated invariant chain.
Proc. Natl. Acad. Sci. USA
92
:
9904
51
Blum, J. S., P. Cresswell.
1988
. Role for intracellular proteases in the processing and transport of class II HLA antigens.
Proc. Natl. Acad. Sci. USA
85
:
3975
52
Newcomb, J. R., P. Cresswell.
1993
. Structural analysis of proteolytic products of MHC class II-invariant chain complexes generated in vivo.
J. Immunol.
151
:
4153
53
Miyazaki, T., P. Wolf, S. Tourne, C. Waltzinger, A. Dierich, N. Barois, H. Ploegh, C. Benoist, D. Mathis.
1996
. Mice lacking H2-M complexes, enigmatic elements of the MHC class II peptide-loading pathway.
Cell
84
:
531
54
Martin, W. D., G. G. Hicks, S. K. Mendiratta, H. I. Leva, H. E. Ruley, L. Van Kaer.
1996
. H2-M mutant mice are defective in the peptide loading of class II molecules, antigen presentation, and T cell repertoire selection.
Cell
84
:
543
55
Fung-Leung, W.-P., C. D. Surh, M. Liljedahl, J. Pang, D. Leturcq, P. A. Peterson, S. R. Webb, L. Karlsson.
1996
. Antigen presentation and T cell development in H2-M-deficient mice.
Science
271
:
1278
56
van Bergen, J., S. P. Schoenberger, F. Verreck, R. Amons, R. Offringa, F. Koning.
1997
. Efficient loading of HLA-DR with a T helper epitope by genetic exchange of CLIP.
Proc. Natl. Acad. Sci. USA
94
:
7499
57
Stimptner, P., P. Benaroch.
1997
. Interaction of MHC class II molecules with the invariant chain: role of the invariant chain (81–90) region.
EMBO J.
16
:
5807