Previously, we analyzed the proximal IL-4 promoter in directing Th2-specific activity. An 800-base pair proximal promoter conferred some Th2-selective expression in transgenic mice. However, this region directed extremely low reporter mRNA levels relative to endogenous IL-4 mRNA, suggesting that full gene activity requires additional enhancer elements. Here, we analyzed large genomic IL-4 regions for enhancer activity and interaction with transcription factors. The proximal IL-4 promoter is only moderately augmented by GATA-3, but certain genomic regions significantly enhanced GATA-3 promoter transactivation. Some enhancing regions contained consensus GATA sites that bound Th2-specific complexes. However, retroviral transduction of GATA-3 into developing T cells induced IL-5 to full Th2 levels, but only partially restored IL-4 production. Thus, we propose that GATA-3 is permissive, but not sufficient, for full IL-4 enhancement and may act through GATA elements surrounding the IL-13/IL-4 gene locus.

Thelper type 2 cells selectively express IL-4, IL-13, and IL-5 (1, 2). The transcriptional basis for Th2 cytokine expression has been proposed to involve two Th2-specific transcription factors, c-Maf and GATA-3 (3, 4). GATA-3 is important for embryonic development and T cell development (5). GATA-3 deficiency is embryonically lethal, and GATA-3-deficient T cells do not complete normal thymocyte maturation (6). Recently GATA-3 was found to be selectively expressed in naive T cells and Th2 cells, but extinguished in Th1 cells (3, 7). Two recent studies analyzed GATA-3 in Th2 cytokine expression (3, 7). The first proposed that GATA-3 is necessary and sufficient for IL-4 production by CD4+ T cells (3). The second suggested, however, that GATA-3 acts directly to induce IL-5 promoter activity via a GATA element upstream of the CLEO element (7).

While previous studies of IL-4 gene regulation in T cells focused on the proximal 800 base pairs (8, 9, 10, 11, 12, 13, 14, 15), this promoter region is not sufficient to direct full IL-4 gene activity (16). The 800-bp promoter was able to direct some degree of Th2-selective expression in several transgenic reporter lines. However, the amount of reporter mRNA was virtually undetectable compared with the levels of endogenous IL-4 mRNA. Thus, other regulatory elements outside of the 800-bp proximal promoter are required to direct full IL-4 gene activity (16).

By scanning the IL-4/IL-13 locus, we identified several genomic regions having enhancer activity that increase IL-4 promoter transactivation by GATA-3. GATA elements from these regions bind Th2-specific complexes. Using retroviral transduction of GATA-3 into naive T cells, we show that GATA-3 induces IL-5 expression to levels equivalent with Th2 controls, but does not similarly restore full IL-4 expression. This suggests that GATA-3 is not sufficient for full IL-4 gene activity in Th2 cells, and in fact, may be one permissive factor required to enhance IL-4 expression through distal sites rather than acting exclusively within the IL-4 proximal promoter.

M12 cells were maintained in Iscove’s modified Dulbecco’s medium and Jurkat in RPMI 1640 supplemented as described (8). M12 cells (107) or 2 × 107 Jurkat cells were electroporated as described (8) with 20 μg/ml of the indicated reporter plasmid, 20 μg/ml of the expression plasmid, and 0.5 μg/ml pRL-CMV (Promega, Madison, WI) to monitor transfection efficiency. M12 cells were transfected as described (8), and Jukat cells were transfected at 300 V, 960 μF. Cells were harvested at 16 h and left unstimulated or stimulated with 50 ng/ml PMA and 1 μM ionomycin. Cells were lyzed at 4 h in 100 μl of 10 mM KH2PO4/500 mM NaCl/1 mM EDTA, pH 8, and lysates were assayed for firefly and renilla luciferase activities.

An 86-kb genomic P1 clone was identified as positive by PCR for IL-4 and IL-13 (Genome Systems, St. Louis, MO). The clone was sequenced (InCyte, Palo Alto, CA) at 12-fold redundancy to yield four contiguous DNA sequences. All BamHI fragments were subcloned upstream of the 800-bp IL-4 luciferase reporter construct (IL-4 Luc, here named −800 Luc).3 One 20-kb fragment was further subcloned as five BamHI/HindIII or HindIII fragments into −800 Luc (see Fig. 3). Restriction digest and Southern mapping confirmed the order and position of all fragments. Trimerized sites containing the IL-2 promoter NF-AT consensus (3×NFAT) and 202-bp IFN-γ promoter (IFN-γ Luc) were placed into the luciferase plasmid pBS-LUC (8).

FIGURE 3.

IL-13/IL-4 genomic regions with enhancer activity. A, Map of IL-13/IL-4 gene region. Gray boxes indicated the fragment cloned upstream of the −800 Luc reporter. GATA motifs (WGATAR) are indicated on the line below the map. B, Enhancer activity of genomic fragments. Jurkat cells were transfected with the indicated reporter construct and with either GFP-RV (open bars) or GATA-3-RV (closed bars). Data are presented as described in the legend to Figure 1. C, EMSA was done as described previously (8) and in Materials and Methods. The genomic location of EMSA probes 1 to 5 are indicated on the line below the GATA motifs. The Eα probe (8) was used to show uniformity of nuclear extract.

FIGURE 3.

IL-13/IL-4 genomic regions with enhancer activity. A, Map of IL-13/IL-4 gene region. Gray boxes indicated the fragment cloned upstream of the −800 Luc reporter. GATA motifs (WGATAR) are indicated on the line below the map. B, Enhancer activity of genomic fragments. Jurkat cells were transfected with the indicated reporter construct and with either GFP-RV (open bars) or GATA-3-RV (closed bars). Data are presented as described in the legend to Figure 1. C, EMSA was done as described previously (8) and in Materials and Methods. The genomic location of EMSA probes 1 to 5 are indicated on the line below the GATA motifs. The Eα probe (8) was used to show uniformity of nuclear extract.

Close modal

EMSAs were performed as described (8). Nuclear extract was incubated (6.6 μg) in a 10-μl reaction with 5 × 104 cpm of probe, 0.15 mg/ml BSA, 1 μg poly(dI:dC). After 30 min at 4 C, complexes were electrophoresed through 4.5% polyacrylamide at 4 C in 0.4× TBE for 4 h at 150 V. Fully annealed EMSA probes were as follows: probe 1, GAGAAATGATAAATGATAAGAAAAGTTGAAGAAC; probe 2, GTAACAGAGTGATAGGAGATAGATACAATCAGCC; probe 3, GGTGTAATAGATAATTGGAGCAGGCTGGCC; probe 4, CAACCCTACGCTGATAAGATTAGTCTGAAAG; probe 5, TGTGATAGAAACCCAGGAGGCCCAAAGGAGTGCT; and UTR, TGCATTGTTAGCATCTCTTGATAAACTTAATTGTCT.

The retroviral vector GFP-RV was made by placing the 600-bp EcoRI-NcoI EMCV IRES fragment from pCITE-1 (Novagen, Madison, WI) upstream of the 700-bp NcoI-EcoRI humanized green fluorescent protein (GFP) allele (hGFP-S65T; Clontech, Palo Alto, CA) in a trimolecular ligation into the EcoRI site of pBSSKII(−) (Stratagene, La Jolla, CA). The 1.3-kb XhoI/BamHI IRES-hGFP cassette was cut from pBSSKII(−) ligated into the XhoI/BamHI site of the MSCV2.2 retroviral vector, replacing the 1.3-kb phosphoglycerate kinase-neomycin cassette. A BglII/SalI GATA-3 cDNA PCR fragment was ligated into the unique BglII and XhoI sites of GFP-RV to produce GATA3-RV. Phoenix-Eco packaging cells (Dr. G. Nolan, Stanford, CA) were transfected according to Dr. Nolan’s online protocol (http://www-leland.standford.edu/group/nolan/NL-phnxr.html). DO11.10 T cells were activated as described and infected with retroviral supernatant on day 2. On day 7, infected T cells were purified by sorting for GFP expression to a purity of >95% GFP-positive following postsort analysis.

T cells (107) were stimulated under the indicated conditions, lysed in 30 μl of cell lysis buffer (5% SDS, 0.5 M Tris, pH 6.8, 0.5 mM EDTA, 1 mM DTT, 1 mM PMSF, 10 μg leupeptin) for 10 min at room temperature, and centrifuged at 100,000 × g for 10 min. Supernatants were resolved by SDS-PAGE, transferred to nitrocellulose (Bio-Rad, Hercules, CA), and probed with murine monoclonal anti-GATA3 (1:3000; Santa Cruz Biotechnology, Santa Cruz, CA) , Goat anti-mouse (1:2000; Santa Cruz Biotechnology) and developed by enhanced chemiluminescence (ECL; Amersham, Arlington Heights, IL).

We examined the effects of GATA-3 in both M12 and Jurkat cells for two different IL-4 promoters (−157 Luc and −800 Luc reporters). Using 20 μg of GATA3-RV expression plasmid (GATA3-RV), we observed ∼8- to 12-fold augmentation in M12 cells and only 4- to 6-fold in Jurkat cells for both reporters (Fig. 1). We observed a dose-dependent effect of GATA-3 expression for this augmentation (Fig. 1,B), because when using 5 μg rather than 20 μg of GATA3-RV, the augmentation was not significant. The level of augmentation seen in both M12 and Jurkat cells was significantly lower than previously reported for the IL-4 promoter (3) using the same M12 system. To determine whether the GATA-3 actions were specific to the IL-4 promoter, we examined four other cytokine reporters, as well as an NF-κB and an NF-AT reporter construct, for activation by GATA-3 (Fig. 2,A). The IL-2 reporter (8) was unaffected by GATA-3, while the IFN-β, NF-κB (17), and IFN-γ reporters were augmented twofold. As noted above, the −800 Luc reporter showed ∼6-fold activation by GATA-3, as did the trimerized NF-AT site reporter construct (Fig. 2 A).

FIGURE 1.

GATA-3 effects on IL-4 reporter activity. A, M12 cells were transfected with 20 μg of either −157 Luc or −800 Luc, and 20 μg of control (GFP-RV) or GATA-3 plasmid (GATA3-RV). Data are presented as the fold induction of luciferase activity relative to the GFP-RV, stimulated control (GFP-RV, closed bar). Activity (measured in relative light units (RLU)) for this condition was 55,000 RLU. B, Jurkat T cells were transfected as described in Materials and Methods, as indicated in A, using either 5 or 20 μg of the GATA3-RV as indicated. This experiment was repeated three times with similar results.

FIGURE 1.

GATA-3 effects on IL-4 reporter activity. A, M12 cells were transfected with 20 μg of either −157 Luc or −800 Luc, and 20 μg of control (GFP-RV) or GATA-3 plasmid (GATA3-RV). Data are presented as the fold induction of luciferase activity relative to the GFP-RV, stimulated control (GFP-RV, closed bar). Activity (measured in relative light units (RLU)) for this condition was 55,000 RLU. B, Jurkat T cells were transfected as described in Materials and Methods, as indicated in A, using either 5 or 20 μg of the GATA3-RV as indicated. This experiment was repeated three times with similar results.

Close modal
FIGURE 2.

GATA-3 augments diverse cytokine promoters. A, Jurkat cells were transfected as described in the legend to Figure 1 but with the indicated cytokine reporter plasmid. Data are presented as in Figure 1. B, IL-4 reporter constructs. GATA motif is indicated by closed oval, MARE (4) by open oval, three NF-AT sites by closed squares, and the TATA element by an open square. 5′ truncations to −353 (DM2) and −262 (DM3) and internal deletion replacing −288 to −262 with a SalI/XhoI junction (ID5) deleting the GATA motif have been described previously. The 157 Luc reporter has been previously described (3). C, Jurkat cells were transfected as described in A, with indicated reporter construct and control (GFP-RV) or GATA-3 plasmid (GATA3-RV). Data are presented as the fold induction over the stimulated GFP-RV control (GFP-RV, closed bar) for each reporter. This experiment was repeated three times with similar results.

FIGURE 2.

GATA-3 augments diverse cytokine promoters. A, Jurkat cells were transfected as described in the legend to Figure 1 but with the indicated cytokine reporter plasmid. Data are presented as in Figure 1. B, IL-4 reporter constructs. GATA motif is indicated by closed oval, MARE (4) by open oval, three NF-AT sites by closed squares, and the TATA element by an open square. 5′ truncations to −353 (DM2) and −262 (DM3) and internal deletion replacing −288 to −262 with a SalI/XhoI junction (ID5) deleting the GATA motif have been described previously. The 157 Luc reporter has been previously described (3). C, Jurkat cells were transfected as described in A, with indicated reporter construct and control (GFP-RV) or GATA-3 plasmid (GATA3-RV). Data are presented as the fold induction over the stimulated GFP-RV control (GFP-RV, closed bar) for each reporter. This experiment was repeated three times with similar results.

Close modal

A single WGATAR motif resides at −274 to −269 in the IL-4 proximal promoter (Fig. 3,A, probe 4), which binds a Th2-specific complex that is shifted by the anti-GATA3 Ab HG3–31 (Fig. 3,C). To test the role of this element in augmenting the IL-4 promoter, we examined a series of promoter truncations and deletion constructs (Fig. 2,B). Removal of this GATA element, either by 5′ truncation (DM3) or internal deletion (ID5), reduced responsiveness to GATA3-RV only slightly (Fig. 2,C), suggesting that this single GATA element is not the only element required for enhancement of IL-4 reporter activity. A sequence between −112 to −107 which was recently suggested (7) to be a potential GATA site has already been shown by supershift analysis to interact with NF-Y (8) rather than GATA-3. A final GATA sequence is present at +19 to +24 of the 5′ untranslated IL-4 promoter region. However, this sequence does not interact with a complex characteristic of GATA-3, since it is not shifted by HG3-31 and is present in both Th1 and Th2 cells (Fig. 3,C). Also, removal of this GATA element from the context of the −157 Luc reporter only slightly reduced the degree of GATA-3 inducibility (Fig. 2 C).

In summary, while we confirm that GATA-3 augments IL-4 reporter activity, we observed substantially lower levels of transactivation than reported earlier. Our deletion/mutation analysis suggests that the consensus GATA elements present between −741 and +60 of the IL-4 promoter may not represent the relevant or only targets for this transactivation. In fact, a recent study showed that that GATA-3 and GATA-2 exhibit distinct DNA-binding properties from GATA-1 based on their unique N-terminal zinc finger domains, (18), suggesting that perhaps nonconsensus GATA elements may need examination in future studies.

Since the 800-bp promoter was insufficient to direct reporter expression in transgenic mice to the levels of endogenous IL-4 (16), we searched for enhancer activity within a 45-kb region spanning the IL-13 and IL-4 genes (Fig. 3,A). Several regions directly increased reporter activity of the −800 Luc reporter (Fig. 3,B, open bars). However, more significant increases were seen in response to transactivation by GATA-3 (Fig. 3,B, closed bars). The two most active fragments (A and B) contained sequences with consensus WGATAR motifs, both upstream and downstream of the IL-13 gene. Two other active fragments (C and D) however had no GATA motifs, suggesting that other factors might participate in their enhancer activity. Notably, the least active region was that immediately upstream of the IL-4 promoter (E). Several predicted GATA motifs from A and B bind Th2-specific complexes in EMSA (Fig. 3 C). Thus, the Th2-specific expression of GATA-3 could potentially influence IL-4/IL-13 gene expression as an enhancer binding factor that augments gene expression from sites at a distance from the promoter rather than acting exclusively within the promoter region.

We wished to test the role of GATA-3 in the context of normal CD4+ T helper development rather than in transformed cells. We used retrovirus to direct GATA-3 expression independently of its normal extinction during Th1 development (Fig. 4,A) to allow us to ascertain whether GATA-3 is necessary and sufficient for IL-4 gene expression in normal T cells. We infected GATA-3-expressing or control retrovirus into T cells and induced either Th1 or Th2 development (Fig. 4,B). GATA-3-transduced or control T cells were analyzed for effects on cytokine expression. Forced GATA-3 expression in Th2 cells did not increase IL-4 production, but nearly doubled IL-5 production (Fig. 4, C and D). However, GATA-3 expression in Th1 cells led to only a 30% restoration of IL-4 relative to the Th2 control level, but led to a full restoration of IL-5 production. Western analysis showed that the level of GATA-3 achieved by retroviral expression is equivalent to that of a Th2 control (Fig. 4 E), indicating that lowered cytokine levels of the transduced Th1 cells is not simply a result of lower GATA-3 levels. Thus, in the context of normally developing Th cells, GATA-3 appears to influence the expression of IL-5 more strongly than that of IL-4. GATA-3 appears to be sufficient to induce full IL-5 levels in T cells, even those treated to undergo Th1 development (by exposure to IL-12 and anti-IL-4 Ab). In contrast, GATA-3 was less potent in restoring IL-4 expression in T cells treated by IL-12.

FIGURE 4.

GATA-3 fully restores production of IL-5 but not IL-4. A, Control and GATA-3-expressing retroviral vectors. B, Expression of GFP in populations of TCR-transgenic cells infected with control (GFP-RV) or GATA-3-expressing retrovirus (GATA3-RV). T cells were activated using OVA/APCs and induced for Th2 development in the presence of IL-4 (100 U/ml) and anti-IL-12 (10 μg/ml TOSH mAb) (20) or for Th1 development with IL-12 (10 U/ml) and 11B11 (10 μg/ml) (21). GFP-positive cells were sorted and expanded for 7 days under the initial conditions, then analyzed by FACS for expression of the TCR clonotype (KJ1-26) and GFP. C and D, T cells infected with control retrovirus (open bars) or GATA-3 expressing retrovirus (black bars) induced to Th1 or Th2 conditions were harvested from cultures described in B and restimulated at 1.25 × 105 T cells/ml with OVA/APCs and 48-h supernatants harvested and analyzed for IL-4 (C) and IL-5 (D) production by ELISA. E, T cells (107) as described above in B were analyzed by Western blotting using HG3-31 (1:3000) for GATA-3 expression. The data presented are from 1 of 11 similar experiments.

FIGURE 4.

GATA-3 fully restores production of IL-5 but not IL-4. A, Control and GATA-3-expressing retroviral vectors. B, Expression of GFP in populations of TCR-transgenic cells infected with control (GFP-RV) or GATA-3-expressing retrovirus (GATA3-RV). T cells were activated using OVA/APCs and induced for Th2 development in the presence of IL-4 (100 U/ml) and anti-IL-12 (10 μg/ml TOSH mAb) (20) or for Th1 development with IL-12 (10 U/ml) and 11B11 (10 μg/ml) (21). GFP-positive cells were sorted and expanded for 7 days under the initial conditions, then analyzed by FACS for expression of the TCR clonotype (KJ1-26) and GFP. C and D, T cells infected with control retrovirus (open bars) or GATA-3 expressing retrovirus (black bars) induced to Th1 or Th2 conditions were harvested from cultures described in B and restimulated at 1.25 × 105 T cells/ml with OVA/APCs and 48-h supernatants harvested and analyzed for IL-4 (C) and IL-5 (D) production by ELISA. E, T cells (107) as described above in B were analyzed by Western blotting using HG3-31 (1:3000) for GATA-3 expression. The data presented are from 1 of 11 similar experiments.

Close modal

We suggest that the IL-4 promoter is weakly transactivated by GATA-3 directly, but in the context of certain regions of the IL-13/IL-4 locus, becomes highly GATA-3 responsive. This model is similar to the mechanism whereby β-globin gene expression is controlled by GATA-1 through actions at hypersensitive site 4 (19). However, GATA-3 is unlikely to act alone in controlling induction of the IL-4/IL-13 locus, since retroviral expression of GATA-3 into already differentiated Th1 cells does not lead to IL-4 expression (data not shown). Finally, GATA-3 could augment IL-4 expression as an enhancer-binding factor, but our results show that in T cells, GATA-3 alone does not fully restore IL-4 expression.

We thank Nils Jacobson for IFN-γ Luc, Doug Engel for R/m-GATA3, Richard Flavell for the −157 Luc reporter, and David Baltimore for the IFN-β and NF-κB reporters.

1

This work was supported by National Institutes of Health Grants AI34580 and HL56419. K.M.M. is an Associate Investigator of the Howard Hughes Medical Institute.

3

Abbreviations used in this paper: −800 Luc, 800-bp IL-4 luciferase reporter construct; EMSA, electrophoretic mobility shift assay; NF-AT, NF of activated T cells; EMCV, encephalomyocarditis virus; IRES, internal ribosomal entry sequence; GFP, green fluorescent protein; RV, retrovirus.

1
Seder, R. A., W. E. Paul.
1994
. Acquisition of lymphokine-producing phenotype by CD4+ T cells.
Annu. Rev. Immunol.
12
:
635
2
Abbas, A. K., K. M. Murphy, A. Sher.
1996
. Functional diversity of T helper lymphocytes.
Nature
383
:
787
3
Zheng, W., R. A. Flavell.
1997
. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells.
Cell
89
:
587
4
Ho, I. C., M. R. Hodge, J. W. Rooney, L. H. Glimcher.
1996
. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4.
Cell
85
:
973
5
Pandolfi, P. P., M. E. Roth, A. Karis, M. W. Leonard, E. Dzierzak, F. G. Grosveld, J. D. Engel, M. H. Lindenbaum.
1995
. Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis.
Nat. Genet.
11
:
40
6
Ting, C. N., M. C. Olson, K. P. Barton, J. M. Leiden.
1996
. Transcription factor GATA-3 is required for development of the T-cell lineage.
Nature
384
:
474
7
Zhang, D. H., L. Cohn, P. Ray, K. Bottomly, A. Ray.
1997
. Transcription factor GATA-3 is differentially expressed in murine Th1 and Th2 cells and controls Th2-specific expression of the interleukin-5 gene.
J. Biol. Chem.
272
:
21597
8
Szabo, S. J., J. S. Gold, T. L. Murphy, K. M. Murphy.
1993
. Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc.
Mol. Cell. Biol.
13
:
4793
9
Bruhn, K. W., K. Nelms, J. L. Boulay, W. E. Paul, M. J. Lenardo.
1993
. Molecular dissection of the mouse interleukin-4 promoter.
Proc. Natl. Acad. Sci. USA
90
:
9707
10
Hodge, M. R., J. W. Rooney, L. H. Glimcher.
1995
. The proximal promoter of the IL-4 gene is composed of multiple essential regulatory sites that bind at least two distinct factors.
J. Immunol.
154
:
6397
11
Rooney, J. W., M. R. Hodge, P. G. McCaffrey, A. Rao, L. H. Glimcher.
1994
. A common factor regulates both Th1- and Th2-specific cytokine gene expression.
EMBO J.
13
:
625
12
Li-Weber, M., A. Eder, H. Krafft-Czepa, P. H. Krammer.
1992
. T cell-specific negative regulation of transcription of the human cytokine IL-4.
J. Immunol.
148
:
1913
13
Li-Weber, M., H. Krafft, P. H. Krammer.
1993
. A novel enhancer element in the human IL-4 promoter is suppressed by a position-independent silencer.
J. Immunol.
151
:
1371
14
Henkel, G., M. A. Brown.
1994
. PU. 1 and GATA: components of a mast cell-specific interleukin 4 intronic enhancer.
Proc. Natl. Acad. Sci. USA
91
:
7737
15
Henkel, G., D. L. Weiss, R. McCoy, T. Deloughery, D. Tara, M. A. Brown.
1992
. A DNase I-hypersensitive site in the second intron of the murine IL-4 gene defines a mast cell-specific enhancer.
J. Immunol.
149
:
3239
16
Wenner, C. A., S. J. Szabo, K. M. Murphy.
1997
. Identification of IL-4 promoter elements conferring Th2-restricted expression during T helper cell subset development.
J. Immunol.
158
:
765
17
Fujita, T., G. P. Nolan, S. Ghosh, D. Baltimore.
1998
. Independent modes of transcriptional activation by the p50 and p65 subunits of NF-κB.
Genes Dev.
6
:
775
18
Pedone, P. V., J. G. Omichinski, P. Nony, C. Trainor, A. M. Gronenborn, G. M. Clore, G. Felsenfeld.
1997
. The N-terminal fingers of chicken GATA-2 and GATA-3 are independent sequence-specific DNA binding domains.
EMBO J.
16
:
2874
19
Stamatoyannopoulos, J. A., A. Goodwin, T. Joyce, C. H. Lowrey.
1995
. NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human β-globin locus control region.
EMBO J.
14
:
106
20
Tripp, C. S., M. K. Gately, J. Hakimi, P. Ling, E. R. Unanue.
1994
. Neutralization of IL-12 decreases resistance to Listeria in SCID and C.B-17 mice: reversal by IFN-γ.
J. Immunol.
152
:
1883
21
Ohara, J., W. E. Paul.
1985
. Production of a monoclonal antibody to and molecular characterization of B-cell stimulatory factor-1.
Nature
315
:
333