Certain sequences of nucleotides (CpG motifs) in bacterial DNA or synthetic oligonucleotides (CpG DNA) promote the production of proinflammatory cytokines, including TNF-α, IFN-γ, IL-6, and IL-12. Here we demonstrate that the immunosuppressant cyclosporin A (CsA) unexpectedly enhanced CpG DNA-induced IL-12 production in murine splenocytes. CsA did not inhibit CpG DNA-induced TNF-α or IL-6 production, but decreased the production of IFN-γ by CpG DNA. Upon examining mechanisms by which CsA increases IL-12 production, we found that CpG DNA can also induce IL-10 production in B cells and that this production was sensitive to CsA. IL-10 has anti-inflammatory effects and can reduce the production of IL-12. To determine the possible role of CsA-modulated IL-10 production in mediating the increased IL-12 levels, splenocytes from IL-10 gene-disrupted mice (IL-10 −/−) and splenocytes cultured in anti-IL-10 Ab were studied. CpG DNA-stimulated IL-10 (−/−) splenocytes demonstrated no increase in IL-12 levels in the presence of CsA. Anti-IL-10 Ab treatment of normal splenocytes increased the magnitude of CpG DNA-induced IL-12 production to that seen with CsA. These results suggest that CpG DNA induces CsA-sensitive IL-10 production in B cells and that IL-10 acts as a negative feedback regulator of CpG DNA-induced IL-12 production.

Bacterial DNA contains a greater frequency of unmethylated CpG dinucleotides than mammalian DNA (1, 2). These CpG dinucleotides, in particular base contexts (CpG motifs) in bacterial DNA and synthetic oligonucleotides (CpG DNA), promote B cell proliferation and Ig secretion (3). CpG DNA rescues primary spleen B cells from spontaneous apoptosis and WEHI-231 cells from activation-induced apoptosis (4, 5). CpG DNA induces the production of several proinflammatory cytokines, including TNF-α, IFN-γ, IL-6, and IL-12 (6, 7, 8, 9). CpG DNA also degrades IκB through a reactive oxygen species-sensitive pathway, leading to subsequent translocation of NF-κB to the nucleus (10). CpG DNA enhances the efficacy of mAb for cancer therapy (11), can prevent airway disease in a murine asthma model (12), and acts as a potent vaccine adjuvant for diverse Ags (13, 14, 15, 16, 17). While CpG DNA has these overwhelming beneficial effects, aberrant immune responses to CpG DNA may have relevance in the pathology of septic shock and autoimmune disease (18, 19).

Cyclosporin A (CsA)3 is a potent immunosuppressant first used clinically in transplantation and becoming more frequently used in the treatment of autoimmune diseases (20). The immune-suppressive effects of CsA have been attributed to binding of the drug to the intracellular protein cyclophilin, creating a complex that inhibits the phosphatase calcineurin. Blockade of calcineurin enzymatic activity prevents the translocation of NF-AT and subsequent transcription of IL-2 by T cells (21, 22). These observations have been extended to other cell types and other cytokines under different experimental conditions. Whereas TNF-α induction via CD40 or Ag receptor stimulation in B cells is inhibited by CsA (23, 24), TNF-α production in LPS-treated lymphocytes and monocytes is not suppressed by CsA (25). Furthermore, CsA can inhibit the production of IL-4, IL-5, IFN-γ, and TNF-α in human PBMCs stimulated with PMA and ionomycin (26).

To establish the role of CpG DNA in cytokine networks and in the course of experiments to evaluate the possible role of NF-AT in mediating the cytokine response to CpG DNA, we evaluated whether CsA can suppress CpG DNA-mediated proinflammatory cytokine production. These experiments were also undertaken to understand the possible effects of bacterial DNA on patients receiving immunosuppressive therapy. We anticipated that CsA would inhibit proinflammatory cytokine production, but found that CsA did not alter CpG DNA-induced production of TNF-α or IL-6 in murine splenocytes (Fig. 1, Aand B). Furthermore, CsA and CpG DNA appeared to synergistically increase IL-12 production. Conversely, CsA decreased CpG DNA-induced production of IL-10 and IFN-γ in primary splenocytes, and CsA failed to enhance CpG DNA-induced IL-12 production in mice genetically deficient in IL-10. T cell and macrophage depletion experiments suggest that the B cell is the cellular source of CsA-sensitive IL-10 production. These results suggest that CsA-mediated suppression of IL-10 production in B cells in response to CpG DNA leads to increased levels of IL-12.

FIGURE 1.

TNF-α, IL-6, and IL-12 production by CpG-DNA and CsA. A, BALB/c splenocytes (106 cells/ml) were treated with a synthetic CpG DNA (S-ODN) or a control non-CpG DNA (S-ODN) at 1 μM. The levels of TNF-α, IL-6, and IL-12 were analyzed by ELISA. CpG DNA, but not control non-CpG DNA, induced the production of TNF-α, IL-6, and IL-12. CsA showed no effect on TNF-α or IL-6 production, but increased the production of IL-12 by CpG DNA. B, Same experimental conditions, but stimulated with 10 μg/ml EC-DNA. Cytokine production by control CT-DNA was undetectable in all samples. Each experiment was performed at least three times with similar results. Error bars represent the SD.

FIGURE 1.

TNF-α, IL-6, and IL-12 production by CpG-DNA and CsA. A, BALB/c splenocytes (106 cells/ml) were treated with a synthetic CpG DNA (S-ODN) or a control non-CpG DNA (S-ODN) at 1 μM. The levels of TNF-α, IL-6, and IL-12 were analyzed by ELISA. CpG DNA, but not control non-CpG DNA, induced the production of TNF-α, IL-6, and IL-12. CsA showed no effect on TNF-α or IL-6 production, but increased the production of IL-12 by CpG DNA. B, Same experimental conditions, but stimulated with 10 μg/ml EC-DNA. Cytokine production by control CT-DNA was undetectable in all samples. Each experiment was performed at least three times with similar results. Error bars represent the SD.

Close modal

Spleen cells and splenic B cells (97% B220 positive) were prepared from BALB/c or DBA2 mice (5–10 wk old; The Jackson Laboratory, Bar Harbor, ME) as described previously (27, 28). Murine B lymphoma WEHI-231 cells and murine monocyte J774 cells were purchased from American Type Culture Collection (Manassas, VA). Splenocytes from IL-10−/−129/SvEv strains as well as 129/SvEv wild-type control littermates were courtesy of D. J. Berg. All cells were cultured at 37°C in a 5% CO2 humidified incubator and maintained in RPMI 1640 supplemented with 10% FCS, 1.5 mM l-glutamine, 50 μM 2-ME, 100 U/ml penicillin, and 100 pg/ml streptomycin.

Most experiments used nuclease-resistant phosphorothioate oligodeoxynucleotides (S-ODN) purchased from Oligos Etc. (Wilsonville, OR). Escherichia coli DNA with a phosphodiester DNA backbone (EC-DNA) and calf thymus DNA (CT-DNA) were purchased from Sigma (St. Louis, MO) and dissolved in TE. The LPS level in ODN was <2.5 ng/mg of ODN and 40 ng/mg of EC-DNA by Limulus assay (29).

Murine spleen cells, WEHI-231 cells, or J774 cells were cultured with CpG DNA (1826; TCCATGACGTTCCTGACGTT; S-ODN; 1 μM), non-CpG DNA (1911; TCCAGGACTTTCCTCAGGTT; S-ODN; 1 μM), EC-DNA (10 μg/ml), or CT-DNA (10 μg/ml) in the presence or the absence of CsA (10–250 ng/ml) for 6 to 48 h depending on the cytokine measured. The levels of cytokines in the culture supernatants were analyzed by ELISA for IL-6, IL-12, IFN-γ, or TNF-α as previously described (27) and for IL-10 according to the manufacturer’s instructions (PharMingen, San Diego, CA). CsA was used in varying concentrations from 10 to 250 ng/ml and was purchased from Sigma. In all experiments, CsA was dissolved in 50% ethanol, with the final volume never exceeding 0.05% of the culture. A vehicle and CsA control was run for each experiment. All experiments were performed at least three times.

Murine splenocytes (2 × 106 cells/ml) were cultured for 15 min in the presence or the absence of CsA (100 ng/ml). Cells were then stimulated by the addition of CpG DNA for 6 h. Cells were harvested, and total RNA was prepared using the RNAzol method according to the manufacturer’s protocol (Tel-Test, Friendswood, TX). Levels of mRNA of specific genes were analyzed by RPA as described previously (4). Equal amounts of RNA (3 μg/sample) were used for the RPA, and L32, a gene coding for a ribosomal protein, was used as an equal loading control.

To assess the effect of CsA on CpG DNA-induced cytokine production, spleen cells were treated with CpG DNA (1 μM), non-CpG DNA (1 μM), EC-DNA (10 μg/ml), or CT-DNA (10 μg/ml) with or without CsA (250 ng/ml) for 6 h (TNF-α) or for 24 h (IL-6 and IL-12). As previously reported, CpG DNA (CpG oligonucleotide and EC-DNA) strongly induced the production of TNF-α, IL-6, and IL-12, while control non-CpG DNA (non-CpG ODN and calf thymus DNA) failed to induce cytokine secretion (6, 8). Addition of CsA dramatically enhanced the production of IL-12, but failed to show any effect on TNF-α and IL-6 production (Fig. 1). The effect of CsA on CpG DNA-induced IL-12 production was dose dependent (Fig. 2).

FIGURE 2.

Effect of CsA on IL-12 production by bacterial DNA and CpG DNA. BALB/c splenocytes were treated with increasing doses of CsA and then stimulated with medium, CpG DNA (1 μM, S-ODN), EC-DNA (10 μg/ml), non-CpG DNA (1 μM; S-ODN), or CT-DNA (10 μg/ml). IL-12 production was measured by ELISA. The production of IL-12 in response to CpG DNA was increased in a dose-dependent manner by CsA. Non-CpG DNA and CT-DNA did not induce IL-12 production i neither the presence or the absence of CsA. Each experiment was performed at least three times with similar results. Error bars represent the SD.

FIGURE 2.

Effect of CsA on IL-12 production by bacterial DNA and CpG DNA. BALB/c splenocytes were treated with increasing doses of CsA and then stimulated with medium, CpG DNA (1 μM, S-ODN), EC-DNA (10 μg/ml), non-CpG DNA (1 μM; S-ODN), or CT-DNA (10 μg/ml). IL-12 production was measured by ELISA. The production of IL-12 in response to CpG DNA was increased in a dose-dependent manner by CsA. Non-CpG DNA and CT-DNA did not induce IL-12 production i neither the presence or the absence of CsA. Each experiment was performed at least three times with similar results. Error bars represent the SD.

Close modal

Since CsA is a known immune suppressor, the induction of IL-12 in CpG-treated cells was initially surprising. However, results from our laboratory and others have demonstrated that IL-10 has a regulatory role in IL-12 production (30, 31, 32). Conversely, the observed increases in IL-12 production may be stimulated by a positive feedback loop by CpG DNA-induced IFN-γ (6, 33). Therefore, we tested whether CsA enhances IL-12 secretion by modulation of either IL-10 or IFN-γ production. Various concentrations of CsA were added to spleen cells 15 min before addition of CpG DNA or non-CpG DNA. Levels of IL-10 and IFN-γ in culture supernatants were measured by ELISA. As demonstrated in Figure 3, A and B, IL-10 and IFN-γ production by CpG DNA were partially inhibited in a dose-dependent manner. Our results for CsA-induced IFN-γ suppression are in accordance with those of previous studies using other stimuli (26, 34). The suppression of IFN-γ levels also suggests that IFN-γ is neither acting through positive feedback mechanisms nor inhibiting IL-10 production to increase IL-12 production. This raised the possibility that CsA induces increased IL-12 production by directly preventing IL-10 production in response to CpG DNA.

FIGURE 3.

CpG DNA-induced IL-10 and IFN-γ production is suppressed by CsA. IL-10 and IFN-γ production in CpG DNA (S-ODN)-stimulated splenocytes in the presence of various doses of CsA was measured by ELISA. CsA decreased IL-10 and IFN-γ production in response to CpG DNA in a dose-dependent manner. Each experiment was performed at least three times with similar results. Error bars represent the SD.

FIGURE 3.

CpG DNA-induced IL-10 and IFN-γ production is suppressed by CsA. IL-10 and IFN-γ production in CpG DNA (S-ODN)-stimulated splenocytes in the presence of various doses of CsA was measured by ELISA. CsA decreased IL-10 and IFN-γ production in response to CpG DNA in a dose-dependent manner. Each experiment was performed at least three times with similar results. Error bars represent the SD.

Close modal

To further elucidate the role of IL-10 in the CsA-mediated increase in CpG DNA-induced IL-12 production, we performed experiments using IL-10α Ab and IL-10 gene-disrupted mice (IL-10−/−). Inhibition by IL-10α Ab (5 μg/ml) increased CpG DNA-induced IL-12 production to a similar degree as CsA (250 ng/ml; Fig. 4). Combination of the two inhibitors increased the amount of IL-12 secretion more than either alone. This might be explained by the inability of CsA to completely suppress CpG DNA-induced IL-10, even at the highest doses (Fig. 3,A) and by the fact that IL-10α bound only secreted IL-10 and did not affect CsA-suppressed intracellular IL-10 production. Consistent with our hypothesis that IL-10 inhibition results in increased IL-12 production, CsA treatment of spleen cells from IL-10 gene-disrupted mice had no effect on CpG DNA-induced IL-12 secretion (Fig. 5). Spleen cells from the wild-type littermate showed a similar response to CsA as BALB/c splenocytes, although at reduced levels due to the fewer number of cells used for this assay.

FIGURE 4.

Anti-IL-10 Ab demonstrates CsA-like effects on CpG DNA-induced IL-12 production. CpG DNA (S-ODN)-induced IL-12 production in 1 × 106/ml splenocytes cultured with 250 ng/ml CsA, 5 μg/ml IL-10α, or both. Comparable increases in IL-12 production were observed in the CsA and IL-10α conditions. When used together, IL-10α and CsA appeared to synergistically enhance IL-12 production. Each experiment was performed at least three times with similar results. Error bars represent the SD.

FIGURE 4.

Anti-IL-10 Ab demonstrates CsA-like effects on CpG DNA-induced IL-12 production. CpG DNA (S-ODN)-induced IL-12 production in 1 × 106/ml splenocytes cultured with 250 ng/ml CsA, 5 μg/ml IL-10α, or both. Comparable increases in IL-12 production were observed in the CsA and IL-10α conditions. When used together, IL-10α and CsA appeared to synergistically enhance IL-12 production. Each experiment was performed at least three times with similar results. Error bars represent the SD.

Close modal
FIGURE 5.

Effects of CsA on the CpG DNA-induced IL-12 secretion in IL-10 knockout mice. Splenocytes from 8- to 20-wk-old 129 SVEV mice (Taconic Farms, Germantown, NY) or mice with a disrupted IL-10 gene (IL-10−/−) were treated with CpG DNA (1826; 1 μM; S-ODN) with or without CsA (250 ng/ml). Lower numbers of cells were used in this experiment (105) due to increased baseline IL-12 expression in IL-10−/− mice. IL-12 production was evaluated by ELISA. The levels of IL-12 in response to CpG DNA increased in the presence of CsA in normal mice. However, CsA did not change the levels of IL-12 production induced by CpG DNA in IL-10 knockout mice. Each experiment was performed at least three times with similar results. Error bars represent the SD.

FIGURE 5.

Effects of CsA on the CpG DNA-induced IL-12 secretion in IL-10 knockout mice. Splenocytes from 8- to 20-wk-old 129 SVEV mice (Taconic Farms, Germantown, NY) or mice with a disrupted IL-10 gene (IL-10−/−) were treated with CpG DNA (1826; 1 μM; S-ODN) with or without CsA (250 ng/ml). Lower numbers of cells were used in this experiment (105) due to increased baseline IL-12 expression in IL-10−/− mice. IL-12 production was evaluated by ELISA. The levels of IL-12 in response to CpG DNA increased in the presence of CsA in normal mice. However, CsA did not change the levels of IL-12 production induced by CpG DNA in IL-10 knockout mice. Each experiment was performed at least three times with similar results. Error bars represent the SD.

Close modal

To examine whether the CsA response at the protein level also correlated with mRNA transcription, we performed an RPA on mRNA extracted from whole splenocytes cultured with CpG DNA in the presence or the absence of CsA (Fig. 6). The RPA revealed that CsA causes a partial decrease in the level of CpG-induced IL-10 mRNA with a corresponding increase in IL-12 mRNA, especially the p40 subunit, consistent with the results observed from ELISA analysis of protein levels.

FIGURE 6.

Expression of IL-12 and IL-10 mRNA in splenocytes treated with CpG-DNA and CsA. To determine whether CsA increases IL-12 mRNA with a concomitant decrease in IL-10 mRNA levels, we evaluated mRNA expression in splenocytes in vitro. Splenocytes were prepared from BALB/c mice and were treated with CpG DNA (1 μM, S-ODN) in the presence or the absence of CsA (100 ng/ml). The levels of mRNA were analyzed by RPA. CpG DNA up-regulated both IL-12 p40 and IL-10 mRNA expression. Addition of CsA further increased IL-12 p40 mRNA levels, but slightly decreased IL-10 mRNA levels. Each experiment was performed at least three times with similar results.

FIGURE 6.

Expression of IL-12 and IL-10 mRNA in splenocytes treated with CpG-DNA and CsA. To determine whether CsA increases IL-12 mRNA with a concomitant decrease in IL-10 mRNA levels, we evaluated mRNA expression in splenocytes in vitro. Splenocytes were prepared from BALB/c mice and were treated with CpG DNA (1 μM, S-ODN) in the presence or the absence of CsA (100 ng/ml). The levels of mRNA were analyzed by RPA. CpG DNA up-regulated both IL-12 p40 and IL-10 mRNA expression. Addition of CsA further increased IL-12 p40 mRNA levels, but slightly decreased IL-10 mRNA levels. Each experiment was performed at least three times with similar results.

Close modal

Since CpG DNA stimulates cytokines primarily in B cells and macrophages (27, 35, 36), we studied IL-10 production in primary splenic B cells, a B cell line (WEHI-231), and a macrophage-like cell line (J774) treated with or without CpG DNA and/or CsA. Of note, CpG DNA directly induced IL-10 production in primary B cells and WEHI cells, but not in J774 cells (Fig. 7). CsA blocked IL-10 production induced by CpG DNA in a dose-dependent manner in primary B cells and WEHI-231 cells, whereas J774 macrophages did not produce detectable amounts of CpG-induced IL-10, regardless of the presence of CsA.

FIGURE 7.

IL-10 production in B cells and macrophages. Primary splenic B cells, WEHI-231 murine B lymphoma cells, and murine monocyte J774 cells were cultured with CpG DNA (S-ODN) and increasing doses of CsA. Primary B cells and WEHI-231 cells produced IL-10 in response to CpG DNA, and the response was diminished in the presence of CsA. J774 cells failed to produce detectable levels of IL-10, suggesting that CpG DNA induces IL-10 in B cells. Each experiment was performed at least three times with similar results. Error bars represent the SD.

FIGURE 7.

IL-10 production in B cells and macrophages. Primary splenic B cells, WEHI-231 murine B lymphoma cells, and murine monocyte J774 cells were cultured with CpG DNA (S-ODN) and increasing doses of CsA. Primary B cells and WEHI-231 cells produced IL-10 in response to CpG DNA, and the response was diminished in the presence of CsA. J774 cells failed to produce detectable levels of IL-10, suggesting that CpG DNA induces IL-10 in B cells. Each experiment was performed at least three times with similar results. Error bars represent the SD.

Close modal

CpG motifs present in bacterial DNA and synthetic oligodeoxynucleotides (CpG DNA) induce the production of proinflammatory cytokines, such as TNF-α, IL-6, IL-12, and IFN-γ. On the other hand, CpG DNA also induces IL-10 production, which can antagonize the secretion of IL-12 (30, 31, 32). Here we demonstrate that CpG DNA and CsA synergistically enhance IL-12 protein and mRNA production. CsA had no apparent effect on TNF-α or IL-6 levels, but decreased IL-10 and IFN-γ production in cells stimulated with CpG DNA. CpG DNA-induced IL-10 production in B cells is suppressed by CsA, apparently leading to enhanced IL-12 production. These findings were further supported in experiments on spleen cells of IL-10 gene-disrupted mice, in which CsA demonstrated no additional enhancement of CpG DNA-induced IL-12 production. Of note, CsA suppressed IL-10 production at 10 ng/ml, whereas the maximal CpG DNA-induced IL-12 production appeared to occur at 100 ng/ml CsA. The differences in dose response could represent inhibition of functional effects of IL-10 at higher CsA doses, or they may suggest that other factors, such as TGF-β, in addition to IL-10 inhibition are enhancing IL-12 production. We are currently examining these possibilities. Although not analyzed in these experiments, but shown elsewhere, the most likely cellular source of CpG DNA-induced IL-12 is the monocyte/macrophage (37). Based on these observations, we propose that CsA modulates the CpG DNA immune response by decreasing IL-10 production by B cells, which, in turn, promotes CsA-insensitive IL-12 production by macrophages.

The cellular mechanism by which CsA modulates CpG DNA-induced IL-10 with subsequent increased IL-12 levels is not known. IL-10 is a pleiotropic cytokine first identified to reduce cytokines produced by Th1 clones (38). IL-10 is a potent autocrine factor for proliferation and differentiation of B cells (39) and is a known inhibitor of IL-12, IL-2, and IFN-γ proinflammatory proteins associated with a Th1-type or cell-mediated immune effector response (40). Such inhibition leads to the development of a Th2-type or humoral response mainly characterized by B cell proliferation and Ab secretion. We have shown that primary splenic B cells and WEHI-231 murine B lymphoma cells secrete IL-10 in response to CpG DNA and that this response is sensitive to the effects of CsA. This induction of IL-10 may have relevance in proliferative and antiapoptotic effects observed in B cells stimulated with CpG DNA (3, 4). If IL-10 is involved in mediating such effects, then theoretically CsA could prevent the proliferative effects that CpG DNA has on B cells. Due to our B cell-purifying methods, we cannot exclude the possibility that contaminating cells in our B cell preparations are producing IL-10. However, based on supporting evidence from B cell lines, our results suggest that CpG DNA induces B cells to produce IL-10 in a CsA-sensitive manner. These results conflict with those from an earlier report in which IL-10 secretion was not detected upon CpG DNA stimulation (6). The methods used previously may not have had the sensitivity to detect IL-10 production, since our present findings and previous data (30) confirm that CpG DNA induces IL-10.

It may also be possible that CsA may suppress IL-10 production indirectly rather than directly. CsA inhibits other cytokines, such as IL-2 or IFN-γ, which act as positive and negative regulators of IL-10 production, respectively (34, 41). However, CpG DNA does not appear to stimulate T cells or induce IL-2 (6). We have also shown that CsA down-regulates CpG DNA-induced IFN-γ production (Fig. 3 B), suggesting that IFN-γ is not suppressing IL-10 production.

CsA inhibits calcineurin activity, thereby preventing the translocation of NF-AT to the nucleus in response to leukocyte activation. Preliminary work in our laboratory suggests that CpG DNA activates NF-AT (M. Anitescu, T. W. Redford, A.-K. Yi, and A. M. Krieg, unpublished observations). Although there are no reports of NF-AT-regulated IL-10 transcription, recent studies suggest that NF-AT may be required for a Th2 immune response. In these studies, mice with disrupted genes for NF-AT1 (NF-ATp) and NF-AT2 (NF-ATc) displayed impaired Th2 responses, as demonstrated by decreases in IL-4 and IL-6 production (42, 43, 44). This observation might be extended to other Th2 cytokines, such as IL-10, and it may be possible that CsA is inhibiting NF-AT activation that is required for CpG DNA-induced IL-10 production. We are currently investigating such a possibility.

Clinically, these findings may have relevance in patients treated with CsA for organ transplant or autoimmune disease. IL-12 plays a role in exacerbating acute graft-vs-host disease (45, 46). It is possible that the risk of acute graft-vs-host disease may be compounded with concomitant bacterial or viral infection and subsequent IL-12 release in the presence of CsA-induced IL-10 suppression. Also of interest is the finding that IL-10 production is increased in a number of lymphoproliferative disorders, including Burkitt’s lymphoma and other non-Hodgkins lymphomas (47, 48), as well as autoimmune diseases, such as systemic lupus erythematosus (49). If IL-10 is promoting B cell proliferation and preventing apoptosis in these disorders, then CsA may be used therapeutically to down-regulate IL-10 production. Before such findings have clinical relevance, further work needs to be performed to elucidate the mechanisms involved in perturbation of the IL-10/IL-12 cytokine axis.

We thank Daniel Berg for providing the IL-10 gene disrupted mice and Debra Campbell for her excellent technical assistance.

1

This work was supported by a fellowship from the Arthritis Foundation (to A.-K.Y.), a grant from the Lupus Foundation of America (to A.-K.Y.), and grants (to A.M.K.) from the Department of Veterans Affairs, the RGK Foundation, the Order of the Eastern Star, CpG ImmunoPharmaceuticals, and the National Institutes of Health (R29-AR42556 and P01CA665078). Services were provided by the University of Iowa Diabetes and Endocrinology Research Center (National Institutes of Health Grant DK25295).

3

Abbreviations used in this paper: CsA, cyclosporin A; S-ODN, phosphorothioate oligodeoxynucleotides; EC-DNA, Escherichia coli DNA; CT-DNA, calf thymus DNA; RPA, ribonuclease protection assay.

1
Cardon, L. R., C. Burge, D. A. Clayton, S. Karlin.
1994
. Pervasive CpG suppression in animal mitochondrial genomes.
Proc. Natl. Acad. Sci. USA
91
:
3799
2
Bird, A. P..
1986
. CpG rich islands and the function of DNA methylation.
Nature
321
:
209
3
Krieg, A. M., A.-K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretsky, D. Klinman.
1995
. CpG motifs in bacterial DNA trigger direct B-cell activation.
Nature
374
:
546
4
Yi, A.-K., P. Hornbeck, D. E. Lafrenz, A. M. Krieg.
1996
. CpG DNA rescue of murine B lymphoma cells from anti-IgM-induced growth arrest and programmed cell death is associated with increased expression of c-myc and bcl-xl.
J. Immunol.
157
:
4918
5
Yi, A.-K., A. M. Krieg.
1998
. CpG DNA rescue from anti-IgM-induced WEHI-231 B lymphoma apoptosis via modulation of IκBα and IκBβ and sustained activation of nuclear factor-κB/c-rel.
J. Immunol.
160
:
1240
6
Klinman, D. M., A.-K. Yi, S. L. Beuacage, J. Conover, A. M. Krieg.
1996
. CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12 and interferon γ.
Proc. Natl. Acad. Sci. USA
93
:
2879
7
Ballas, Z. K., W. L. Rasmussen, A. M. Krieg.
1996
. Bacterial DNA induces in vivo interferon-γ production by NK cells and increases sensitivity to endotoxin.
J. Immunol.
157
:
1840
8
Halpern, M. D., R. J. Kurlander, D. S. Pisetsky.
1996
. Bacterial DNA induces murine gamma-interferon production by stimulation of interleukin-12 and tumor necrosis factor α.
Cell. Immunol.
167
:
72
9
Yamamoto, S., T. Yamamoto, S. Shimada, E. Kuramoto, O. Yano, T. Kanataoka, T. Tonkunaga.
1992
. DNA from bacteria, but not vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth.
Microbiol. Immunol.
36
:
983
10
Yi, A.-K., R. Tuetken, T. W. Redford, M. Waldschmidt, J. Kirsch, A. M. Krieg.
1998
. CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species.
J. Immunol.
160
:
4755
11
Wooldridge, J. E., Z. Ballas, A. M. Krieg, G. J. Weiner.
1997
. Immunostimulatory oligodeoxynucleotides containing CpG motifs enhance the efficacy of monoclonal antibody therapy in lymphoma.
Blood
89
:
2994
12
Kline, J. N., T. J. Waldschmidt, T. R. Businga, J. E. Lemish, J. V. Weinstock, P. S. Thorne, A. M. Krieg.
1998
. Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma.
J. Immunol.
160
:
2555
13
Davis, H. L., R. Weeranta, T. Waldschmidt, L. Tygrett, J. Schorr, A. M. Krieg.
1998
. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen.
J. Immunol.
160
:
870
14
Weiner, G. J., H. M. Liu, J. E. Wooldridge, C. E. Dahle, A. M. Krieg.
1997
. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization.
Proc. Natl. Acad. Sci. USA
94
:
10833
15
Chu, R. S., O. S. Targoni, A. M. Krieg, P. V. Lehman, C. V. Harding.
1997
. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity.
J. Exp. Med.
186
:
1623
16
Roman, M., E. Martin-Orozco, J. S. Goodman, M. D. Nyguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, E. Raz.
1997
. Immunostimulatory sequences function as T helper-1-promoting adjuvants.
Nat. Med.
3
:
849
17
Lipford, G. B., M. Bauer, C. Blank, R. Reiter, H. Wagner, K. Heeg.
1997
. CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants.
Eur. J. Immunol.
27
:
2340
18
Sparwasser, T., T. Miethke, G. Lipford, K. Borschert, H. Hacker, K. Heet, H. Wagner.
1997
. Bacterial DNA causes septic shock.
Nature
386
:
336
19
Cowdery, J. S., J. H. Chace, A.-K. Yi, A. M. Krieg.
1996
. Bacterial DNA induces NK cells to produce IFN-γ in vivo and increases the toxicity of lipopolysaccharides.
J. Immunol.
156
:
4570
20
Rathman, C. G., B. D. Myers.
1992
. Cyclosporine therapy for autoimmune disease.
N. Engl. J. Med.
326
:
1693
21
Clipstone, N. A., G. R. Crabtree.
1992
. Identification of calcineurin as a key signalling enzyme in T-lymphocyte activation.
Nature
357
:
695
22
Fruman, D. A., C. B. Klee, B. E. Bierer, S. J. Burakoff.
1992
. Calcineurin phosphatase activity in T lymphocytes is inhibited by FK 506 and cyclosporine A.
Proc. Natl. Acad. Sci. USA
89
:
3686
23
Boussiotis, V. A., L. M. Nadler, J. L. Strominger, A. E. Goldfeld.
1994
. Tumor necrosis factor is an autocrine growth factor for normal B cells.
Proc. Natl. Acad. Sci. USA
91
:
7007
24
Tsai, E. Y., J. Yie, D. Thanos, A. E. Goldfield.
1996
. Cell-type specific regulation of the human tumor necrosis factor α gene in B cells and T cells by NFATp and ATF-2/JUN.
Mol. Cell. Biol.
16
:
5232
25
Cockfield, S. M., V. Ramsaar, P. F. Halloran.
1993
. Regulation of IFN-γ and tumor necrosis factor-α expression in vivo: effects of cyclohexamide and cyclosporine in normal and lipopolysaccharide-treated mice.
J. Immunol.
150
:
342
26
Andersson, J., S. Nagy, C. G. Groth, U. Andersson.
1992
. Effects of FK506 and cyclosporin A on cytokine production studied in vitro at a single cell level.
Immunology
75
:
136
27
Yi, A.-K., D. M. Klinman, T. L. Martin, S. Matson, A. M. Krieg.
1996
. Rapid immune activation by CpG motifs in bacterial DNA: systematic induction of IL-6 transcription through an antioxidant-sensitive pathway.
J. Immunol.
157
:
5394
28
Ashman, R. F., D. Peckham, S. Alhasan, L. L. Stunz.
1995
. Membrane unpacking and the rapid disposal of apoptotic cells.
Immunol. Lett.
48
:
159
29
Sullivan, J. D., F. W. Valois, S. W. Watson.
1976
. Endotoxins: the Limulus amebocyte lysate system. A. W. Bernheimer, ed.
Mechanisms in Bacterial Toxicology
217
John Wiley & Sons, New York.
30
Anitescu, M., J. H. Chace, R. Tuetken, A.-K. Yi, D. J. Berg, A. M. Krieg, J. S. Cowdery.
1998
. IL-10 functions in vitro and in vivo to inhibit bacterial DNA-induced secretion of IL-12.
J. Interferon Cytokine Res.
17
:
781
31
D’Andrea, A., M. Aste-Amezaga, N. M. Valiante, X. Ma, M. Kubin, G. Trichieri.
1993
. Interleukin 10 (IL-10) inhibits human lymphocyte interferon γ-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells.
J. Exp. Med.
178
:
1041
32
Meyaard, L., E. Hovenkamp, S. A. Otto, F. Miedema.
1996
. IL-12-induced IL-10 production by human T cells as a negative feedback for IL-12-induced immune responses.
J. Immunol.
156
:
2776
33
Ma, X., J. M. Chow, G. Gri, G. Carra, F. Gerosa, S. F. Wolf, R. Dzialo, G. Trinchieri.
1996
. The interleukin 12 p40 gene promoter is primed by interferon γ in monocytic cells.
J. Exp. Med.
183
:
147
34
Chormarat, P., M. Rissoan, J. Banchereau, P. Miossec.
1993
. Interferon γ inhibits interleukin 10 production by monocytes.
J. Exp. Med.
177
:
523
35
Stacey, K. J., M. J. Sweet, D. A. Hume.
1996
. Macrophages ingest and are activated by bacterial DNA.
J. Immunol.
157
:
2116
36
Sparwasser, T., T. Miethke, G. Lipford, A. Erdmann, H. Hacker, K. Heeg, H. Wagner.
1997
. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-α-mediated shock.
Eur. J. Immunol.
27
:
1671
37
Chace, J. H., N. A. Hooder, K. L. Mildenstein, A. M. Krieg, J. S. Cowdery.
1997
. Bacterial DNA-induced NK Cell IFN-gamma production is dependent on macrophage secretion of IL-12.
Clin. Immunol. Immunopathol.
84
:
185
38
Fiorentino, D. F., M. W. Bond, T. R. Mosmann.
1989
. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones.
J. Exp. Med.
170
:
2081
39
Rousset, F., E. Garcia, T. Defrance, C. Perrone, N. Vezzio, D.-H. Hsu, R. Kastelein, K. W. Moore, J. Banchereau.
1992
. Interleukin-10 is a potent growth and differentiation factor for activated human B lymphocytes.
Proc. Natl. Acad. Sci. USA
89
:
1890
40
Fiorentino, D. F., A. Zlotnik, T. R. Mossmann, M. Howard, A. O’Garra.
1991
. IL-10 inhibits cytokine production by activated macrophages.
J. Immunol.
147
:
3815
41
Cohen, S. B., S. L. Parry, M. Feldmann, B. Foxwell.
1997
. Autocrine and paracrine regulation of human T cell IL-10 production.
J. Immunol.
158
:
5596
42
Yoshida, H., H. Nishina, H. Takimoto, L. E. M. Marengere, A. C. Wakeham, D. Bouchard, Y.-Y. Kong, T. Ohteki, A. Shahinian, M. Bachmann, P. S. Ohashi, J. M. Penniger, G. R. Crabtree, T. W. Mak.
1998
. The transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2 cytokine production.
Immunity
8
:
115
43
Ranger, A. M., M. R. Hodge, E. M. Gravallese, M. Oukha, L. Davidson, F. W. Alt, F. C. de la Brousse, T. Hoey, M. Grusby, L. H. Glimcher.
1998
. Delayed lymphoid regulation with defects in IL-4-driven responses produced by inactivation of NF-ATc.
Immunity
8
:
125
44
Hodge, M. R., A. M. Ranger, F. C. de la Brousse, T. Hoey, M. J. Grusby, L. H. Glimcher.
1996
. Hyperproliferation and dysregulation of IL-4 expression in NF-ATp-deficient mice.
Immunity
4
:
397
45
Williamson, E., P. Garside, J. A. Bradley, I. A. More, A. M. Mowat.
1997
. Neutralizing IL-12 during induction of murine acute graft-versus-host disease polarizes the cytokine profile toward a Th2-type alloimmune response and confers long-term protection from disease.
J. Immunol.
159
:
1208
46
Kichian, K., F. P. Nestel, D. Kim, L. Ponka, W. S. Lapp.
1996
. IL-12 p40 messenger RNA expression in target organs during acute graft-versus-host disease: possible involvement of IFN-γ.
J. Immunol.
157
:
2851
47
Finke, J., P. Ternes, W. Lange, R. Mertelsmann, G. Dolken.
1993
. Expression of interleukin-10 in B lymphocytes of different origin.
Leukemia
7
:
1852
48
Benjamin, D., T. J. Knobloch, M. A. Dayton.
1992
. Human B cell interleukin 10: B cell lines derived from patients with acquired immunodeficiency syndrome and Burkitt’s lymphoma constituitively secrete large quantities of interleukin-10.
Blood
80
:
1289
49
Jandi, M., A. Dalaan, S. Balla, M. Huamaidi, S. Raziuddin.
1996
. Interleukin-10 secretion in systemic lupus erythematosus and rheumatoid arthritis: IL-10 dependent CD4+ CD45RO+ T cell and B cell antibody synthesis.
J. Clin. Immunol.
16
:
198