SCID mice have a defect in the catalytic subunit of the DNA-dependent protein kinase, causing increased sensitivity to ionizing radiation in all tissues and severely limiting the development of B and T cell lineages. SCID T and B cell precursors are unable to undergo normal V(D)J recombination: coding joint and signal joint products are less frequently formed and often will exhibit abnormal structural features. Paradoxically, irradiation of newborn SCID mice effects a limited rescue of T cell development. It is not known whether irradiation has a direct impact on the process of V(D)J joining, or whether irradiation of the thymus allows the outgrowth of rare recombinants. To investigate this issue, we sought to demonstrate an irradiation effect ex vivo. Here we have been able to reproducibly detect low-frequency coding joint products with V(D)J recombination reporter plasmids introduced into SCID cell lines. Exposure of B and T lineage cells to 100 cGy of gamma irradiation made no significant difference with respect to the number of coding joint and signal joint recombination products. However, in the absence of irradiation, the coding joints produced in SCID cells had high levels of P nucleotide insertion. With irradiation, markedly fewer P insertions were seen. The effect on coding joint structure is evident in a transient assay, in cultured cells, establishing that irradiation has an immediate impact on the process of V(D)J recombination. A specific proposal for how the DNA-dependent protein kinase catalytic subunit influences the opening of hairpin DNA intermediates during coding joint formation in V(D)J recombination is presented.

SCID mice have a defect in V(D)J recombination leading to a block in B and T cell production (reviewed in Ref. 1). The defect is due to a single base change in the gene encoding the catalytic subunit of the trimolecular DNA-dependent protein kinase (DNA-PK).4 As a result of the SCID mutation, the ∼470-kDa DNA-PK catalytic subunit (DNA-PKcs) protein is truncated by 83 aa (2, 3, 4, 5, 6).

The block in B and T cell development that results from the SCID mutation is severe, but not absolute. Fifteen percent of SCID mice develop detectable serum Ig by the age of 5 mo, (reviewed in Ref. 1), and it is possible to show Ig and TCR gene rearrangements, even in “nonleaky” SCID mice with sufficiently sensitive assays (7, 8, 9, 10, 11, 12). A similar T and B cell phenotype, with a leaky developmental block, has been reported for three additional mutations of the DNA-PKcs gene; two ostensibly null mutations resulting from a targeted knockout, and a third spontaneous mutation (13, 14, 15). Other studies with integrated recombination reporter vectors have also demonstrated that SCID mice and SCID lines can very infrequently form V(D)J “coding” joints, and that such joints can have an abnormal structure (16, 17, 18). However, as measured by any of the above-mentioned approaches, the frequencies with which normal coding structures arise are at least an order of magnitude lower when compared with wild-type (WT) cells. In some studies, especially those employing extrachromosomal substrates, coding joints have proven difficult to detect at all (19, 20).

The fact that SCID cells can produce coding joints, albeit at low levels, suggests that DNA-PKcs does not perform a strictly essential role in V(D)J recombination. At the same time, it is clear that this enzyme has a significant impact on the outcome of the T and B cell developmental program (21), one that clearly involves the V(D)J recombination process (9, 16, 19, 22). Clues to the possible function or functions of DNA-PK in V(D)J recombination are provided by the finding that a variety of conditions can at least partially revert the SCID phenotype. Treatments such as adoptive transfer of normal bone marrow cells into SCID mice (23), whole-body irradiation of SCID mice, (24, 25, 26), germline introduction of Ig or TCR transgenes (27, 28, 29, 30, 31), the elimination of p53 expression (32, 33), constitutive bcl2 expression (34), or mutation of Fas (35) are all reported to relieve the block in early T or B cell development to some extent. Of these, only ionizing radiation has been suggested to have a direct effect on the V(D)J recombination process itself (24, 26, 33). For other interventions, it seems likely that circumvention of apoptotic triggers, and/or the consequences of cellular selection in SCID promotes the survival of cells that would otherwise die, with no immediate impact on V(D)J joining. This raises the very real possibility that despite previous suggestions (24, 26), ionizing radiation also rescues T cell differentiation through these other means.

In particular, the case for reversion of the SCID V(D)J recombination defect at the molecular level as made through irradiation of intact mice (24, 26) is undermined somewhat by two observations. One is that ionizing irradiation will partially rescue thymocyte development not only in SCID, but also in recombination activating gene (RAG) deficient (RAG−/−) mice (36, 37). In RAG−/− mice, which are incapable of V(D)J recombination, irradiation clearly causes survival and progression of cells by means that must be unrelated to V(D)J recombination. This result raises the possibility that the radiation effect seen in SCID is complex, indirect, and perhaps even largely independent of the gene rearrangement process in the affected cells. Although, for example, it has been shown that TCR-δ coding joints detected in irradiated thymocytes from SCID mice are apparently “unselected” in that they are mostly out-of-frame (26), this study was not designed to rule out any selective effects of irradiation apart from those acting through the expressed TCR-δ protein. As mentioned, TCR-independent effects of radiation on T cell differentiation are demonstrated, and these effects unavoidably confound the interpretation of any in vivo radiation experiment. A second observation is that whole-body irradiation is seen to partially rescue T, but not B, cell development in SCID (Ref. 24 ; G.E.W., unpublished observations). If the principal effect of irradiation is to overcome insufficiencies in DNA recombination, a simplistic expectation is that both the T and B lineages ought to exhibit partial rescue when irradiated (see Ref. 24 for further discussion).

It is of interest to know whether or not ionizing radiation reverts the SCID phenotype at the level of V(D)J recombination, because this important piece of the puzzle would help elucidate the role of DNA-PK in Ag receptor gene assembly. To support the possibility that irradiation acts on V(D)J recombination and not simply on the cellular developmental environment, it is key to demonstrate a radiation effect in cells independent of a thymic context. The extrachromosomal V(D)J recombination assay, where an artificial V(D)J recombination substrate is transfected into clonal, transformed pre-B- or pre-T-like cell lines is, in theory, ideally suited to this endeavor. Here the possibility that the appearance of a reversion of the joining defect is a consequence of the unequal expansion of subpopulations of T lineage cells in an irradiated thymus is eliminated.

Despite the potential application of the extrachromosomal recombination assay system for elucidation of the radiation effect, in practice it has been difficult to detect any coding joint formation in SCID cells by this approach. Here, modifications of the transfection procedure have allowed us to reproducibly measure SCID coding joints, and, significantly, a radiation effect independent of thymic influences, was revealed. Although irradiation had no apparent impact on the frequency with which coding joints or signal joints were found, it markedly altered the fine structure of the coding junctions. Without irradiation, coding joints had a high level of palindromic (or “P”) nucleotide insertions. With irradiation, the levels of P insertion were significantly reduced. The same effect was seen for both B and T lineage SCID cell lines. Because lineage nonspecific radiation effects could be documented in a short timeframe using a clonal cell culture system, and because these effects are manifested as differences in the fine structure of the coding joints, we conclude that ionizing radiation has an impact on the V(D)J recombination mechanism itself. Implications with respect to proposed models for V(D)J recombination are discussed.

SCID 2.1 (a kind gift of Dr. R.A. Phillips, Toronto, Ontario, Canada) is an avian-murine leukemia virus (A-MuLV)-transformed pre-B cell line derived from the bone marrow of C.B-17 SCID. “WT 1-8” is our designation for the BALB/c bone marrow derived A-MuLV line, 204-1-8. This line, originally isolated by N. Rosenberg (Boston, MA) was obtained from M. Lieber (Los Angeles, CA) and is also referred to as 1-8 (19). SCID SL56, a spontaneous thymoma originally isolated by G. Bosma, was obtained from M. Lieber and has been described previously (19). SCID ST, like SCID SL56, is a spontaneous thymoma of C.B-17 SCID mice, and was the kind gift of Dr. J. Kearney (Birmingham, AL). All cell lines were grown in RPMI 1640 medium with 10% FCS, 2 mM l-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, and 55 μM 2-ME. To verify the DNA-PKcs status of the cell lines, RT-PCR of DNA-PKcs in the region of the SCID mutation was performed as described in (3), and the amplified bands were sequenced. The presence of a TAA codon at a position beginning with nt 12,192 (38) identified the SCID mutation in all the SCID lines (data not shown).

The recombination substrate plasmids (39) are shown in Fig. 1. pDR42 and pWTSJΔ plasmids are designed to measure coding and signal joints that form by deletion (as described in Refs. 40 and 41). Coding and signal joints that form by inversion were assayed with p12x23 (42). The transfection protocol was as described previously (39), but departs in some details. In brief, 1 μg of plasmid DNA is introduced into 2 × 107 cells by exposing the cells for 10 min at 37°C to 1 ml of the following solution: 670 μl additive-free RPMI 1640, 12 μl of 20 mg/ml DEAE dextran, 50 μl 1 M Tris, pH 7.6, 1 μg DNA (1 mg/ml), brought to volume with PBS (Ca2+ and Mg2+ free). At the end of the incubation, cells were washed and resuspended in 10 ml culture medium for an additional 48-h incubation. Except as indicated, all experiments included 1 mM caffeine (43) in the culture medium subsequent to transfection. For the irradiation experiments, cultures were removed from the incubator 4 h after transfection and either irradiated with 100 cGy from a cesium source or left unirradiated. The irradiated and unirradiated cultures were then returned to the incubator and cultured for another 44 h. The cells were then harvested and the plasmid DNA was extracted by an alkaline lysis procedure as described previously (39). The recovered DNA was digested with DpnI to remove unreplicated molecules, and an aliquot was transformed into bacteria (DH10B; Life Technologies, Gaithersburg, MD). Bacteria were plated on agar media containing 100 μg/ml ampicillin (amp) alone or, for selection of recombinants, on plates containing both amp and chloramphenicol (cam) (11 μg/ml for pWTSJΔ and p12x23; 50 μg/ml for pDR42). The ratio of the recombinants (colonies on cam + amp plates) to the total (colonies on amp) is called the R value and is a measure of the frequency of recombination for a given plasmid in a given cell line.

FIGURE 1.

Extrachromosomal recombination substrate plasmids used in this study. pTAC and pLAC are the promoters for the cam transferase (CAT) gene. The triangles mark the RSS with the “base” of the triangle being the heptamer end and the “point” being the nonamer end of the RSS. STOP denotes the prokaryotic transcription stop sequences that prevent transcription of the CAT gene driven by the pTAC and pLAC promoters. These constructs have been fully described previously (394041 ). The plasmids are diagrammed in their unrecombined state; after V(D)J recombination, the STOP sequence is excised (pDR42 and pWTSJΔ) or inverted (p12x23); both events allow the CAT gene to be transcribed and thereby confer resistance to cam on bacteria harboring a recombined plasmid.

FIGURE 1.

Extrachromosomal recombination substrate plasmids used in this study. pTAC and pLAC are the promoters for the cam transferase (CAT) gene. The triangles mark the RSS with the “base” of the triangle being the heptamer end and the “point” being the nonamer end of the RSS. STOP denotes the prokaryotic transcription stop sequences that prevent transcription of the CAT gene driven by the pTAC and pLAC promoters. These constructs have been fully described previously (394041 ). The plasmids are diagrammed in their unrecombined state; after V(D)J recombination, the STOP sequence is excised (pDR42 and pWTSJΔ) or inverted (p12x23); both events allow the CAT gene to be transcribed and thereby confer resistance to cam on bacteria harboring a recombined plasmid.

Close modal

Cells were irradiated at the Ontario Cancer Institute with a 137Cs source calibrated by the Radiation Division at the Department of Medical Biophysics. One fixed source delivered 53 rad/min; another movable source allowed variable dose rates. For all experiments, the final dose was 100 cGy.

DNA was prepared from individual ampr plus camr colonies using standard procedures. Plasmids were analyzed by restriction digestion, DNA sequencing with Pharmacia T7 kits (Pharmacia, Piscataway, NJ), or both. The primers used for DNA sequence analysis are listed in Table I.

Table I.

Primers used for DNA sequence analysis

PlasmidPrimerLocationSequence (5′ to 3′)
DR42 SJ1 5′ of Jκ RSS CTGGTCCGGTAACGTGCTGAG 
 SJ2 3′ of Vλ RSS AGCAACTGACTGAAATGCCTC 
pWTSJΔ lacprime 5′ of 12-RSS CTCATTAGGCACCCCAGGCT 
p12×23 ter-2 5′ of 23-RSS TCAGAACGCTCGGTTGCCGC 
PlasmidPrimerLocationSequence (5′ to 3′)
DR42 SJ1 5′ of Jκ RSS CTGGTCCGGTAACGTGCTGAG 
 SJ2 3′ of Vλ RSS AGCAACTGACTGAAATGCCTC 
pWTSJΔ lacprime 5′ of 12-RSS CTCATTAGGCACCCCAGGCT 
p12×23 ter-2 5′ of 23-RSS TCAGAACGCTCGGTTGCCGC 

Two-tailed p values were determined with the Fisher’s exact test, performed using GraphPad InStat version 3.01 for Windows 95, GraphPad Software (San Diego, CA), available at www.graphpad.com.

A colony formation assay was used to determine the survival of the mouse cell lines after irradiation. The lines were irradiated with 0–500 cGy using the cesium source described above. All cells were left at room temperature during the irradiation. Cells were then plated in RPMI 1640 media containing 0.3% Bacto-Agar (Difco, Detroit, MI) in Falcon 3002, 60-mm plates (Becton Dickinson, San Diego, CA) at from 200 to 1000 cells per plate. Colonies were counted 7 days later. The plating efficiency of unirradiated lines varied from 0.4 to 0.7.

The formation of signal or coding joints was measured with the plasmids pWTSJ or pDR42, respectively (Fig. 1).The calculated “R values” (a measurement of recombination proficiency; see Materials and Methods) for WT and SCID cells are shown in Table II. In WT 1-8, signal joints were formed with a mean R value of 4.1. As shown, there was variability in the R value determinations; however, the mean R value for signal joint formation in the WT cell line was at least 4-fold higher than any of the tested SCID cells. In the case of coding joints, WT 1-8 exhibited a mean R value at least 30-fold higher than the SCID cell lines. Of note was that all three SCID lines produced coding joints at a low but measurable frequency in every experiment. This contrasts with previous studies employing extrachromosomal recombination substrates, where coding joints have been particularly difficult to detect (19, 20). Two of the lines tested here (WT 1-8 and SCID SL56) were the same as in previous reports and the genotype of the cells was verified (Materials and Methods). The reason that we have been able to reproducibly detect low levels of coding joints in SCID cells by the extrachromosomal assay is not known but may be due to the coding joint construct, pDR42, which is different from those used in the other studies. Also, the transfection protocol was modified to eliminate the usual hypotonic shock (see Materials and Methods). The detection of low-level coding joint formation in SCID cells with an extrachromosomal assay is fully consistent with the effects of the SCID mutation based upon analyses of the endogenous Ig or TCR loci in mice (7, 12). The fact that coding joints can be detected allowed us to use this approach to explore the radiation effect on SCID V(D)J recombination.

Table II.

Coding and signal joint frequencies

Cell LinenaR:b MeancRanged
SJe (pWTSJΔ)    
WT 1.8 4.1 8.6–1.5 
SCID ST 0.78 1.6–0.01 
SCID SL56 0.29 0.76–0.04 
SCID 2.1 0.22 0.34–0.02 
CJf (pDR42)    
WT 1.8 3.5 12.0–0.25 
SCID ST 0.09 0.34–0.01 
SCID SL56 0.01 0.26–0.003 
SCID 2.1 0.01 0.02–0.007 
Cell LinenaR:b MeancRanged
SJe (pWTSJΔ)    
WT 1.8 4.1 8.6–1.5 
SCID ST 0.78 1.6–0.01 
SCID SL56 0.29 0.76–0.04 
SCID 2.1 0.22 0.34–0.02 
CJf (pDR42)    
WT 1.8 3.5 12.0–0.25 
SCID ST 0.09 0.34–0.01 
SCID SL56 0.01 0.26–0.003 
SCID 2.1 0.01 0.02–0.007 
a

n, Number of independent transfections tested.

b

R, Total camr/ampr × 100 (ampr, the total number of ampicillin resistant bacterial colonies recovered after transformation with Dpn1-digested transfected DNA samples; camr, the total number of colonies resistant to both chloramphenicol and ampicillin).

c

Mean, R value, averaged from the n independent transfections.

d

Range, The highest and lowest R value obtained among the n independent transfections.

e

SJ, Signal joint.

f

CJ, Coding joint.

Coding joints formed by V(D)J recombination are characterized by variable deletion of coding sequences adjacent to the recombination site, by additions of “N” nucleotides, and by the appearance of “P” inserts (reviewed in Ref. 43). Deletions are associated with the processing that accompanies nonhomologous end-joining in general, although not much is known in detail about how they arise. N nucleotides result from the elongation of cut coding ends by the nontemplate-dependent polymerase, TdT. P nucleotides are short palindromic junctional inserts that appear when DNA hairpin ends are joined in cells (44). In V(D)J recombination, it has been shown that the site-specific proteins responsible for cleavage, RAG1 and RAG2, create coding end intermediates with hairpin termini (22, 45). Palindromic nucleotides are copied from the flap generated when a hairpin end has been opened through introduction of a single-strand nick positioned on one side, rather than exactly at the hairpin terminus. P nucleotides are only observed in VJ or VDJ junctions that contain a full-length (apparently untrimmed) coding end (reviewed in Ref. 46).

Whereas coding joints are typified by variability, signal joints are far less irregular. Deletion of signal end sequences and addition of N regions at the joint are not commonly seen. P nucleotide insertions do not occur at all in signal joints (47), and this feature corresponds to the fact that unlike the coding ends, signal end cleavage products produced by RAG1/2 do not have hairpin termini (22, 45).

A structural comparison of randomly selected coding joints and signal joints isolated either from WT 1-8 or from the SCID cell lines is presented in Figs. 2 and 3. With respect to signal joint structure, over 60% of those isolated from SCID cells contained N regions. The SCID recombinants were otherwise normal in appearance (Fig. 2).

FIGURE 2.

Signal joints isolated from transfections with plasmid pWTSJΔ. #, The number of identical recombinants identified. Some sequences were found in greater than one independent transfection; these are marked with an asterisk.

FIGURE 2.

Signal joints isolated from transfections with plasmid pWTSJΔ. #, The number of identical recombinants identified. Some sequences were found in greater than one independent transfection; these are marked with an asterisk.

Close modal

With respect to coding joint structure, two of the features we monitored, deletion and N addition, showed no consistent differences between WT and SCID products (Fig. 3). The number of nucleotides deleted per joined end was 2.5 for WT 1-8, while the SCID lines showed mean deletions of 1.8, 2.6, and 9.8 nt (SCID ST, SL56, and SCID 2.1 lines, respectively; the SCID 2.1 sample consisted of only three joints). The size and frequency of N additions among the SCID coding joints was quite similar when SCID and WT joints were compared (see Fig. 3).

FIGURE 3.

Sequences of coding joints cloned from plasmid pDR42. P nucleotides are in boldface capital letters. Sequences in the flanks that can be assigned to either flank are underscored. #, The number of identical recombinants identified. An asterisk denotes that the recombinant was found in more than one independent transfection.

FIGURE 3.

Sequences of coding joints cloned from plasmid pDR42. P nucleotides are in boldface capital letters. Sequences in the flanks that can be assigned to either flank are underscored. #, The number of identical recombinants identified. An asterisk denotes that the recombinant was found in more than one independent transfection.

Close modal

However, a marked difference in the occurrence of P insertions, was apparent when SCID and WT coding joints were compared: a higher portion of the SCID-derived coding junctions exhibited P insertions, and these were abnormally long (see Fig. 3). It is most meaningful to quantify P inserts on a per-end (rather than per-joint) basis, scoring the P inserts as a function of full-length ends (47). In the WT 1-8 sample, five full-length ends were associated with P insertions while seven were not. The corresponding values for the pooled SCID samples were 25 and 8 (the breakdown for the individual lines were as follows: 9 and 5 for SCID ST; 13 and 3 for SL56; 1 and 2 for SCID 2.1). Because the number of junctions sampled in the case of the WT 1-8 was small, the difference between WT and SCID cells was of borderline significance by Fisher’s exact test (p = 0.07). Nevertheless, the higher prevalence of P insertions in SCID V(D)J junctions is fully consistent with previous reports, including those employing approaches other than the extrachromosomal assay (7, 10, 18, 47, 48, 49, 50).

Another measurable difference between SCID and WT coding joints could be found in the length of P insertions. In the WT 1-8 sample, no P insertion was longer than 2 bp, consistent with more extensive studies of endogenous and extrachromosomally derived WT coding joints, where P nucleotide insertions longer than 2–3 bp were quite rare (47). In contrast, among the SCID junctions, half of the P insertions had lengths between 3 and 10 bp. The observation that P insertions in SCID coding joints, in addition to being more frequent, are abnormally long has been noted previously (7, 10, 51, 52).

In summary, we find that we can detect coding joints created by SCID lymphoid lines with a transient extrachromosomal assay, and that such junctions exhibit three quantifiable defects. The frequency of coding joints is depressed 10- to 100-fold compared with WT levels, P nucleotide insertions are more prevalent, and P nucleotide insertions are longer in SCID. All of these features, which we are now able to monitor, are consistent with previous reports. One aspect of SCID coding joints that is not well-reflected in the extrachromosomal assay was the feature of excessive deletion (Fig. 3). Large deletions of the coding ends within SCID joints are observed in some, but not all, studies (reviewed in Ref. 43). It could be that extensive deletions may be counter-selected in the extrachromosomal assay, where there are limits to the losses that occur at either “coding end” without removing necessary elements of the plasmid. However, for reasons to be discussed below, it is also possible that excessive deletion is perhaps not a dominant feature of the SCID defect.

Signal joints appear to be less affected by the SCID mutation, but even so, there was evidence for a depression in the frequency of their formation (Table II), as well as for excessive N addition (Fig. 2). In general, the level of N addition found among signal joints has been shown to correlate with variable TdT levels, although the highest frequency of N insertion among tested WT cell lines was about 25% (53). As shown (Fig. 2), well over 50% of the signal joints from the SCID lines had N nucleotide insertions. The high level of N insertion along with the somewhat lower frequency with which signal joints are recovered point to the possibility of an impact on signal joint formation that can be scored by the extrachromosomal assay. Another suggestion that both signal and coding joint formation are detectably affected by the SCID mutation is that, even with our current protocol, which allows us to detect coding joints with the pDR32 deletion-type substrate, we have never been able to isolate inversional rearrangements using the p12x23 substrate (Fig. 1 and Table III). The extreme deficit in inversional joins for SCID is consistent with previous reports (19, 20).

Table III.

Joining by inversion (p12 × 23)

Cell LineRa
1-8 1.85 
SCID ST <.002 
SCID SL56 <.004 
Cell LineRa
1-8 1.85 
SCID ST <.002 
SCID SL56 <.004 
a

R is as defined for Table II. One determination was made for each of the three cell lines, transfected in parallel.

In SCID mice, low levels of ionizing irradiation lead to the emergence of thymocytes with TCR-β and TCR-δ rearrangements (24, 26). We reasoned that if irradiation directly affected V(D)J recombination, we should be able to detect differences in irradiated vs nonirradiated SCID cells through use of extrachromosomal substrates.

Coding and signal joints generated in SCID cells with and without γ irradiation were examined in the short-term recombination assay (Fig. 4). Each of the several signature features of SCID junctions discussed above was examined under the two experimental conditions. Cell lines transfected with pDR42 or pWTSJΔ received a dose of 100 cGy of radiation from a cesium source 4 h posttransfection, and, as in our standard protocol, DNA was recovered from transfected cells 48 h posttransfection. For each data point, parallel cultures were treated identically except that they were not irradiated.

FIGURE 4.

Coding joints from irradiated and unirradiated cell lines. Experiment VII was performed without caffeine. P nucleotide additions are in bold-face capital letters. Nucleotides that could be assigned to either end are indicated by parenthesis (in the case of P nucleotide) or by underlining (in the case of flank sequences that may or may not comprise a P nucleotide). In all cases, the assignments shown were consistently chosen to minimize the number of P-associated ends. #, The number of identical recombinants identified within a given transfection experiment. Roman numerals identify sets of transfections performed in parallel (as unirradiated with irradiated). Flanking sequences are shown up to the position of the RSS border. Dashes indicate sequences that are deleted relative to the RSS border. When deletions from the flank ends exceed the sequence shown, the notation “#bp Δ” indicates the number of basepairs deleted from the tip of the coding end. When the join is either 3′ of the proper recombination site at the upstream flank/RSS border or 5′ of the proper recombination site at the downstream RSS/flank border, the notation “#bp 3′” or #bp 5′, respectively, indicates the position. These aberrant recombinants are not site-specific and may not have been RAG-mediated. No i.d., A sequence that had no homology to the vector and could not be otherwise identified. The symbol “·” indicates an N insertion of one nucleotide, and “··” indicates any N insertion of greater than 1 nt. £, The N sequence is a perfect match to the endogenous genomic 5′ DFL16.1 RSS. Δ, N region is similar to the VH J558 RSS. Σ, Twenty-four base pairs of the insertion matches a portion of the DR42 CAT gene (bp 1420–1444).

FIGURE 4.

Coding joints from irradiated and unirradiated cell lines. Experiment VII was performed without caffeine. P nucleotide additions are in bold-face capital letters. Nucleotides that could be assigned to either end are indicated by parenthesis (in the case of P nucleotide) or by underlining (in the case of flank sequences that may or may not comprise a P nucleotide). In all cases, the assignments shown were consistently chosen to minimize the number of P-associated ends. #, The number of identical recombinants identified within a given transfection experiment. Roman numerals identify sets of transfections performed in parallel (as unirradiated with irradiated). Flanking sequences are shown up to the position of the RSS border. Dashes indicate sequences that are deleted relative to the RSS border. When deletions from the flank ends exceed the sequence shown, the notation “#bp Δ” indicates the number of basepairs deleted from the tip of the coding end. When the join is either 3′ of the proper recombination site at the upstream flank/RSS border or 5′ of the proper recombination site at the downstream RSS/flank border, the notation “#bp 3′” or #bp 5′, respectively, indicates the position. These aberrant recombinants are not site-specific and may not have been RAG-mediated. No i.d., A sequence that had no homology to the vector and could not be otherwise identified. The symbol “·” indicates an N insertion of one nucleotide, and “··” indicates any N insertion of greater than 1 nt. £, The N sequence is a perfect match to the endogenous genomic 5′ DFL16.1 RSS. Δ, N region is similar to the VH J558 RSS. Σ, Twenty-four base pairs of the insertion matches a portion of the DR42 CAT gene (bp 1420–1444).

Close modal

Irradiation did not differentially affect the number of cells surviving transfection and the subsequent 44-h incubation. At the time of harvest, the number of viable cells (measured by trypan blue exclusion) had approximately doubled in all cases. However, by a colony forming assay, SCID cells proved to have suffered significantly more damage with irradiation than WT cells. Typically, 100 cGy had no discernible effect on WT 1-8 cell colony forming ability, but reduced SCID colony formation to about a third (data not shown).

In neither the WT 1-8 cells nor the SCID cells was there any consistent relationship between the levels with which coding joints or signal joints could be recovered and whether or not a sample had been irradiated (Table IV). This suggests that if there is a class of SCID coding or signal joints with deletions larger than can be scored with the extrachromosomal assay, either irradiation did not change this feature or, if it did, such junctions must not have comprised a substantial fraction of the total. Inversional joining with p12x23 was not examined in these experiments due to the lack of any products in SCID cells in the absence of irradiation. In other studies with SCID cells (using a different A-MuLV transformed SCID cell line and a related but nonidentical protocol), 100 cGy irradiation had not restored inversional joining with p12x23 (S.M.L., unpublished observations).

Table IV.

CJ and SJ frequencies with and without irradiationa

Cell LineAssayNot IrradiatedIrradiated
R:SJbR:CJcR:SJR:CJ
WT 1-8 Ad 1.5 0.87 1.8 0.73 
 Bd 3.2 0.25 3.5 0.45 
 Cd 2.9 0.15 3.0 0.39 
 2.9 ND 6.5 ND 
 Ed 2.2 ND 2.5 ND 
 1.9 1.2 10.9 2.0 
mean R  2.1 0.49 4.7 0.44 
SCID ST Ad 0.63 0.011 0.084 0.005 
 Bd 0.98 0.011 0.25 0.010 
 Cd 0.25 0.011 0.42 0.015 
 1.2 ND 0.62 ND 
 Ed 0.16 ND 0.11 ND 
 3.4 0.039 2.30 0.010 
 0.79 0.030 0.45 0.003 
 Hd ND 0.051 ND 0.038 
 ND ND ND 0.036 
 ND ND ND 0.034 
mean R  1.1 0.025 0.60 0.018 
SCID SL56 Ad 0.061 0.002 0.15 0.016 
SCID 2.1 Ad 0.024 0.016 0.036 0.004 
 Bd 3.4 0.0072 0.55 0.0083 
 Cd 0.22 0.0087 0.13 <0.002 
 1.6 ND 0.86 ND 
 Ed 0.27 ND 0.17 ND 
 3.1 0.023 1.4 0.016 
 0.30 0.015 0.14 0.0087 
mean R  1.3 0.011 0.47 0.0078 
Cell LineAssayNot IrradiatedIrradiated
R:SJbR:CJcR:SJR:CJ
WT 1-8 Ad 1.5 0.87 1.8 0.73 
 Bd 3.2 0.25 3.5 0.45 
 Cd 2.9 0.15 3.0 0.39 
 2.9 ND 6.5 ND 
 Ed 2.2 ND 2.5 ND 
 1.9 1.2 10.9 2.0 
mean R  2.1 0.49 4.7 0.44 
SCID ST Ad 0.63 0.011 0.084 0.005 
 Bd 0.98 0.011 0.25 0.010 
 Cd 0.25 0.011 0.42 0.015 
 1.2 ND 0.62 ND 
 Ed 0.16 ND 0.11 ND 
 3.4 0.039 2.30 0.010 
 0.79 0.030 0.45 0.003 
 Hd ND 0.051 ND 0.038 
 ND ND ND 0.036 
 ND ND ND 0.034 
mean R  1.1 0.025 0.60 0.018 
SCID SL56 Ad 0.061 0.002 0.15 0.016 
SCID 2.1 Ad 0.024 0.016 0.036 0.004 
 Bd 3.4 0.0072 0.55 0.0083 
 Cd 0.22 0.0087 0.13 <0.002 
 1.6 ND 0.86 ND 
 Ed 0.27 ND 0.17 ND 
 3.1 0.023 1.4 0.016 
 0.30 0.015 0.14 0.0087 
mean R  1.3 0.011 0.47 0.0078 
a

Abbreviations are as in Table II. All assays identified by the same letter were performed at the same time. Dose rate was 53 rad/min.

b

pDR42 was used for CJ assays.

c

pWTSJΔ was used for SJ assays.

d

These assays were performed without caffeine.

To determine what effects irradiation had on the quality of coding or signal joints, we sequenced recombinants derived from sets of parallel transfections performed with and without irradiation. Eight irradiation experiments were performed for SCID ST, one for SCID 2.1, and one for WT 1-8. DNA sequence analysis is given in Fig. 4, and the results are compiled and quantified in Table V.

Table V.

The effect of ionizing radiation on SCID coding jointsa

Not IrradiatedIrradiated
Avg. lengthbEnds +PcEnds −PAvg. lengthEnds +PEnds −P
SCID ST       
5.3 3.0 
II 4.8 15 11 4.4 10 
III 6.0 2.7 
IV 2.0 6.0 
5.3 5.0 
VI a 3.0 5.0 15 
   2.0 
VII 6.8 15 4.0 
SCID 2.1 
SCID total 5.0e 53 67 4.1f 26 73 
WT 1-8 13 1.3 15 
Not IrradiatedIrradiated
Avg. lengthbEnds +PcEnds −PAvg. lengthEnds +PEnds −P
SCID ST       
5.3 3.0 
II 4.8 15 11 4.4 10 
III 6.0 2.7 
IV 2.0 6.0 
5.3 5.0 
VI a 3.0 5.0 15 
   2.0 
VII 6.8 15 4.0 
SCID 2.1 
SCID total 5.0e 53 67 4.1f 26 73 
WT 1-8 13 1.3 15 
a

Data are compiled from Fig. 4. Roman numerals identify individual experiments as presented in Fig. 4. Irradiation was at 100 cGy; dose rates for each experiment are given in Fig. 4. The nonirradiated sample in Experiment VI was tested in parallel with samples irradiated at two different dose rates given as VIIa and VIIb (see Fig. 4).

b

Total number of P nucleotides in given sample ÷ number of ends exhibiting P insertions.

c

Number based on assignments in Fig. 4: for ambiguous cases, assignments were chosen to minimize the number of ends with P nucleotides (see text).

d

Ends that are designated “no i.d.” in Fig. 4 are not included.

e

Number was calculated from pooled total of P nucleotides in nonirradiated samples (n = 264) ÷ total number of ends with P nucleotides (n = 53). If instead, ambiguous P nucleotides were assigned so as to maximize the number of P-associated ends; this value is 4.5.

f

Number was calculated from pooled total of P nucleotides in irradiated samples (n = 106) ÷ total number of ends with P nucleotides (n = 26). If instead, ambiguous P nucleotides were assigned so as to maximize the number of P-associated ends; this value is 3.9.

Analysis of signal joints formed with and without irradiation revealed no noticeable differences; signal joints from SCID ST were sampled and a high fraction of these possessed N nucleotide insertions under both conditions (data not shown). In contrast, a clear change in coding joint structure occurred with irradiation. As seen in Fig. 4, a reduced number of joined ends were associated with P nucleotides in the irradiated cells. The difference in the number of ends with P insertions when SCID cells were irradiated was very significant (two-tailed p = 0.0072; Fisher’s exact test).

The p value was calculated by treating each unique sequence within a transfection as a single independent recombinant, even if a particular junction had been isolated multiple times. Of concern was whether this approach might systematically under-represent recurrent sequences that were in reality independent recombination events, perhaps giving a misleading impression of a radiation effect. Therefore, we tested the relationship between irradiated and unirradiated samples where every isolate was scored as an independent recombinant. In this case, the p value was still significant (<0.0001). Neither method of scoring can be taken to reflect the true situation, which doubtless lies between these two extremes (i.e., some but not all multiples are independent); however, by either method a significant difference with respect to P insertion upon irradiation is observed.

An additional concern in this evaluation arises with respect to nucleotides that can be assigned to either end. These are shown in parentheses (for P nucleotides) and as underlinings (for flank sequences). We have assigned each nucleotide in Fig. 4 in a fashion that minimizes the number of P-associated ends. Assignments can instead be made so as to maximize the number of P-associated ends. When this is done and the p values are recalculated as above, either taking unique sequences as independent or taking all isolates as independent, the association between P nucleotide insertions and irradiation remains significant (p = 0.0403 and p = 0.0006, respectively). Thus, even though there is unavoidable ambiguity in the assignment of P nucleotides as well as uncertainties with respect to independence within a given sample, none of the possible alternatives appeared to eradicate the significance of the radiation effect.

Ionizing radiation did not cause a complete reversion to a normal coding joint structure. Even though the incidence of P insertion was reduced, the average length of P nucleotide insertions (Table V) was 4.1 nt, longer than for a WT cell (see data for WT 1-8, Table V and Ref. 47). Other irregularities in the SCID junctions were apparent in both irradiated and nonirradiated samples. For several junctions it was evident that cleavage at one of the recombinant signal sequences (RSS) had not been site-specific, because the recombination site was either 3′ of its normal position at the upstream flank or 5′ of the usual site in the downstream flank (see Fig. 4). The average number of base pairs lost from junctions wasnot excessive without irradiation (2.6 bp per end), and this value, if anything, increased with irradiation (5.4 bp). As mentioned above (see also Fig. 3), excessive deletion was not a global property of SCID coding joints; and although a few recombinants showed evidence of abnormal deletions where 30 to over 100 bp were lost at the junction, such examples were found in both treated and untreated samples. Another feature that indicated that irradiation only incompletely compensated for the SCID defect was the inclusion of DNA sequence at the junction that originated either from the genome or from another part of the recombination substrate (see Fig. 4). The capture of sequences at recombinant junctions that preexist either in the vector backbone or in the genome of the transfected cell has been reported for nonhomologous end-joining in other experiments in which plasmid DNA is transiently introduced into cells (54, 55). However, this type of anomaly is not observed in WT coding joints and did not vary with irradiation.

Two other observations should be mentioned. One is that for WT 1-8, the fine structure of signal joints (not shown) and coding joints (Fig. 4, Table V) was unaffected by irradiation. Thus, the impact that irradiation has on coding joint structure, as measured with the extrachromosomal assay, appears to be limited to cells with the SCID mutation. A second observation is that, because the biological consequences of radiation are known to reflect not only the total dose of radiation but also the rate at which it is delivered (56), we obtained samples where dose rates had been varied from 13 to 109 rad/min. No consistent trends with respect to P nucleotide addition (or any other feature of coding joint structure) were observed as a result (Fig. 4, Table V).

These data show that long P nucleotide insertions are less likely to occur in V(D)J coding joints after irradiation of SCID cells. Interestingly, neither the frequency of recombination (Table IV) nor the average nucleotide loss from ends within coding joints (see Fig. 3) were obviously affected. Thus, a feature that uniquely reflects one specific step in the V(D)J recombination mechanism, that of hairpin end-opening (reviewed in Ref. 46), is altered under conditions that induce a DNA damage response in mammalian cells.

Before this demonstration, it was possible that all of T cell developmental consequences of irradiation of newborn mice with defects in early T/B cell differentiation were in fact independent of V(D)J recombination. This possibility was indicated by the demonstration that for RAG−/− animals, where maturation of thymocytes from a double negative to a double positive phenotype is blocked as in SCID (21, 57, 58), the block is overcome by irradiation (36, 37). In the case of RAG−/− mice, radiation clearly can foster the progression of T cell progenitors that are unable to carry out V(D)J recombination. This feature, in combination with the fact that SCID cells are able to generate coding joints, albeit at a low level, could well account for an increase in detected TCR-β rearrangements (24, 25) or TCR-δ (26) rearrangements in thymocyte DNA after irradiation. For RAG−/− mice, radiation effects are more difficult to demonstrate in B than T lineage cells (36), and, perhaps not coincidentally, a T lineage-restricted radiation response is observed in SCID mice. The imbalanced effect on B vs T cell differentiation in both cases could indicate that the irradiation may act largely through thymus-related processes and in both cases may be independent of V(D)J recombination. However, according to the present study, a specific, direct effect on the coding joints formed in irradiated T as well as B lineage SCID cells is in fact demonstrated. The irradiation effect is documented in a nondevelopmental system, in a short-term assay, in the absence of any thymic influence, and with genetically unmodified, cloned, SCID cell lines as maintained and treated in culture. Therefore, in SCID, irradiation has an effect that is independent of its developmental impact.

The significance of this observation with respect to the molecular mechanism of V(D)J recombination can be appreciated in light of two findings. One is that the same proteins responsible for site-specific recognition and cleavage of the RSS in V(D)J recombination, RAG1 and RAG2, are capable, in vitro, of introducing nicks near the tips of hairpin coding ends (59, 60). The second finding is that RAG1/2 is not the exclusive agent for hairpin opening in cells. It has been shown that SCID cells are still competent for hairpin end-joining, and that this takes place via a hairpin nicking activity that exists in both lymphoid and nonlymphoid cell types (44, 55). A distinguishing characteristic of the “non-RAG” hairpin-opening activity is that hairpins are opened in a way that often generates long (>3 bp) P nucleotide insertions (44, 55). Although it has not yet been proved which activity is responsible for coding end resolution in vivo, the fact that RAG1/2 has an efficient hairpin opening function and in addition cuts in a manner consistent with the small size and low frequency of P addition in V(D)J coding joints, suggests that under normal circumstances RAG 1/2 is indeed the physiological “coding end nickase.”

We propose that in T and B cells, a key role of DNA-PK is to ensure that the coding ends and signal ends, as first created after site-specific cleavage, remain in proximity to one another. Without a fully functional DNA-PKcs, as is the case in SCID, a postcleavage complex comprised of the RAG proteins and the four cleaved DNA ends is not stable. RAG1/2 proteins are bound to the signal ends after cleavage (61, 62, 63, 64), so that if coding and signal ends are allowed to drift apart at this stage of the recombination process, proximity of the hairpin intermediates and the RAG nuclease would not be maintained. As a result, SCID cells are dependent upon a default, non-RAG hairpin opening function for coding joint formation. We take the presence of the long P insertions in SCID as symptomatic of just this situation, where coding ends are not being opened by RAG1/2, but rather, by the non-RAG hairpin nicking activity. On this view, irradiation of SCID cells induces a response that once again allows RAG1/2 to open at least some of the hairpin coding ends.

By the above model, DNA-PK could be serving as a scaffold to hold coding ends and RAG1/2 together. One could also suppose that DNA-PK indirectly accomplishes this function by modifying another protein or by ensuring “proximity” in a temporal rather than spatial sense. In any case, the ultimate outcome is that without functional DNA-PK, RAG-mediated hairpin opening will not readily take place. The role of facilitating RAG-mediated hairpin opening may be what distinguishes DNA-PK function from that of the Ku proteins in V(D)J recombination. Although Ku70 and Ku80, along with DNA-PKcs, comprise DNA-PK, there is mounting evidence that the Ku70 and Ku80 proteins have functions apart from those they serve as DNA-PK components (13, 15, 65, 66). Viewed simplistically, it may be that DNA-PK helps maintain the proximity of signal ends and coding ends in particular (facilitating hairpin opening), whereas Ku stabilizes end-to-end interactions in general (facilitating all facets of end-joining).

We thank members of our laboratories and the Repair Repent and Recombine group for their critical input. We thank Drs. J. Danska and C. Guidos for help in verifying the SCID mutation in the cell lines and for ongoing stimulating discussions.

1

This work was supported by grants to G.E.W. from the Medical Research Council, the Terry Fox Marathon of Hope, and the Cancer Research Fund of Canada and to S.M.L. from the National Cancer Institutes of Canada. A.B. was supported by a Life Sciences Scholarship to the Department of Immunology. S.M.L. is a National Cancer Institute Scientist. G.E.W. is a Medical Research Council Scientist.

4

Abbreviations used in this paper: DNA-PK, DNA-dependent protein kinase; DNA-PKcs, DNA-PK catalytic subunit; RAG, recombination activating gene; CJ, coding joint; SJ, signal joint; WT, wild type; A-MuLV, avian-murine leukemia virus; amp, ampicillin; cam, chloramphenicol; RSS, recombination signal sequence.

1
Bosma, M. J., A. M. Carroll.
1991
. The Scid mouse mutant: definition, characterization, and potential uses.
Annu. Rev. Immunol.
9
:
323
2
Kirchgessner, C. U., C. K. Patil, J. W. Evans, C. A. Cuomo, L. M. Fried, T. Carter, M. A. Oettinger, J. M. Brown.
1995
. DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect.
Science
267
:
1178
3
Danska, J. S., C. P. Holland, S. Mariathasan, K. M. Williams, C. J. Guidos.
1996
. Biochemical and genetic defects in the DNA-dependent protein kinase in murine scid lymphocytes.
Mol. Cell. Biol.
16
:
5507
4
Blunt, T., M. Fox, G. E. Taccioli, A. R. Lehmann, S. P. Jackson, R. A. Jeggo.
1996
. Identification of a nonsense mutation in the carboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the scid mouse.
Proc. Natl. Acad. Sci. USA
93
:
10285
5
Blunt, T., N. J. Finnie, G. E. Taccioli, G. C. M. Smith, J. Demengeot, T. M. Gottlieb, R. Mizuta, A. J. Varghese, F. W. Alt, P. A. Jeggo, S. P. Jackson.
1995
. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation.
Cell
80
:
813
6
Araki, R., A. Fujimori, K. Hamatani, K. Mita, T. Saito, M. Mori, R. Fukumura, M. Morimyo, M. Muto, M. Itoh, K. Tatsumi, M. Abe.
1997
. Nonsense mutation at Tyr-4046 in the DNA-dependent protein kinase catalytic subunit of severe combined immune deficiency mice.
Proc. Natl. Acad. Sci. USA
94
:
2438
7
Fish, S. M., M. J. Bosma.
1994
. Abnormal deletions in the T-cell receptor δ locus of mouse thymocytes.
Mol. Cell. Biol.
14
:
4455
8
Carroll, A. M., R. R. Hardy, J. Petrini, M. J. Bosma.
1989
. T cell leakiness in scid mice.
Curr. Top. Microbiol. Immunol.
152
:
117
9
Schuler, W., I. J. Weiler, A. Schuler, R. A. Phillips, N. Rosenberg, T. W. Mak, J. F. Kearney, R. P. Perry, M. J. Bosma.
1986
. Rearrangement of antigen receptor genes is defective in mice with severe combined immune deficiency.
Cell
46
:
963
10
Schuler, W., N. R. Reutsch, M. Amsler, M. J. Bosma.
1991
. Coding joint formation of endogenous T cell receptor genes in lymphoid cells from SCID mice: unusual P-nucleotide additions in VJ-coding joints.
Eur. J. Immunol.
21
:
589
11
Young, D., J. F. Kearney.
1995
. Sequence analysis and antigen binding characteristics of Ig SCID Ig+ mice.
Int. Immunol.
7
:
807
12
Pennycook, J. L., Y. T. Chang, J. Celler, R. A. Phillips, G. E. Wu.
1993
. High frequency of normal DJH joints in B cell progenitors in scid mice.
J. Exp. Med.
178
:
1007
13
Taccioli, G. E., A. B. Amatucci, H. J. Beamish, D. Gell, X. H. Xiang, M. I. Torres Arzayus, A. Marshak Rothstein, P. A. Jeggo, V. L. M. Herrera.
1998
. Targeted disruption of the catalytic subunit of the DNA-PK gene in mice confers severe combined immunodeficiency and radiosensitivity.
Immunity
9
:
355
14
Gao, Y., J. Chaudhuri, C. Zhu, L. Davidson, D. T. Weaver, F. W. Alt.
1998
. A targeted DNA-PKcs-null mutation reveals DNA-PK-independent functions for KU in V(D)J recombination.
Immunity
9
:
367
15
Bogue, M. A., C. Jhappan, D. B. Roth.
1998
. Analysis of variable (diversity) joining recombination in DNA-dependent protein kinase (DNA-PK)-deficient mice reveals DNA-PK-independent pathways for both signal and coding joint formation.
Proc. Natl. Acad. Sci. USA
95
:
15559
16
Malynn, B. A., T. K. Blackwell, G. M. Fulop, G. A. Rathbun, A. J. W. Furley, P. Ferrier, L. B. Heinke, R. A. Phillips, G. D. Yancopoulos, F. W. Alt.
1988
. The scid defect affects the final step of the immunoglobulin VDJ recombinase mechanism.
Cell
54
:
453
17
Hendrickson, E. A., M. S. Schlissel, D. T. Weaver.
1990
. Wild-type V(D)J recombination in scid pre-B cells.
Mol. Cell. Biol.
10
:
5397
18
Ferrier, P., L. Covey, S. C. Li, H. Suh, B. A. Malynn, T. K. Blackwell, M. A. Morrow, F. W. Alt.
1990
. Normal recombination substrate VH to DJH rearrangements in pre-B cell lines from SCID mice.
J. Exp. Med.
171
:
1909
19
Lieber, M. R., J. E. Hesse, S. Lewis, G. C. Bosma, N. Rosenberg, K. Mizuuchi, M. J. Bosma, M. Gellert.
1988
. The defect in murine severe combined immune deficiency: joining of signal sequences but not coding segments in V(D)J recombination.
Cell
55
:
7
20
Harrington, J., C.-L. Hsieh, J. Gerton, G. Bosma, M. R. Lieber.
1992
. Analysis of the defect in DNA end joining in the murine scid mutation.
Mol. Cell. Biol.
12
:
4758
21
Carroll, A. M., M. J. Bosma.
1991
. T-lymphocyte development in scid mice is arrested shortly after the initiation of T-cell receptor δ gene recombination.
Genes Dev.
5
:
1357
22
Roth, D. B., J. P. Menetski, P. Nakajima, M. J. Bosma, M. Gellert.
1992
. V(D)J recombination: broken DNA molecules with covalently sealed (hairpin) coding ends in SCID mouse thymocytes.
Cell
70
:
983
23
Shores, E. W., S. O. Sharrow, I. Uppenkamp, A. Singer.
1990
. T cell receptor-negative thymocytes from SCID mice can be induced to enter the CD4/CD8 differentiation pathway.
Eur. J. Immunol.
20
:
69
24
Danska, J., F. Pflumio, C. Williams, O. Huner, J. Dick, C. Guidos.
1994
. Rescue of T cell-specific V(D)J recombination in SCID mice by DNA-damaging agents.
Science
266
:
450
25
Murphy, W. J., S. K. Durum, M. R. Anver, D. K. Ferris, D. W. McVicar, J. J. O’Shea, S. K. Ruscetti, M. R. Smith, H. A. Young, D. L. Longo.
1994
. Induction of T cell differentiation and lymphomagenesis in the thymus of mice with severe combined immune deficiency (SCID).
J. Immunol.
153
:
1004
26
Livák, F., S. C. Welsh, C. J. Guidos, I. N. Crispe, J. S. Danska, D. G. Schatz.
1996
. Transient restoration of gene rearrangement at multiple T cell receptor loci in γ-irradiated scid mice.
J. Exp. Med.
184
:
1
27
Chang, Y., G. C. Bosma, M. J. Bosma.
1995
. Development of B cells in scid mice with immunoglobulin transgenes: implications for the control of V(D)J recombination.
Immunity
2
:
607
28
Reichman-Fried, M., R. R. Hardy, M. J. Bosma.
1990
. Development of B lineage cells in the bone marrow of scid/scid mice following the introduction of functionally rearranged immunoglobulin transgenes.
Proc. Natl. Acad. Sci. USA
87
:
418
29
Kotloff, D. B., M. J. Bosma, N. R. Ruetsch.
1993
. Scid mouse pre-B cells with intracellular μ chains: analysis of recombinase activity and IgH gene rearrangements.
Int. Immunol.
5
:
383
30
Chang, Y., M. J. Bosma.
1997
. Effect of different Ig transgenes on B cell differentiation in scid mice.
Int. Immunol.
9
:
373
31
Shores, E. W., T. Nakayama, D. L. Wiest, Y. Takahama, S. Sharrow, A. Singer.
1993
. Structurally distinct T cell receptor complexes on developmentally distinct T cell populations in severe combined immunodeficiency mice expressing a TCRβ transgene.
J. Immunol.
150
:
1263
32
Gurley, K. E., K. Vo, C. J. Kemp.
1998
. DNA double-strand breaks, p53, and apoptosis during lymphomagenesis in scid/scid mice.
Cancer Res.
58
:
3111
33
Guidos, C. J., C. J. Williams, I. Grandal, G. Knowles, M. T. F. Huang, J. S. Danska.
1996
. V(D)J recombination activates a p53-dependent DNA damage checkpoint in scid lymphocyte precursors.
Genes Dev.
10
:
2038
34
Strasser, A., A. W. Harris, L. M. Corcoran, S. Corey.
1994
. Bcl-2 expression promotes B- but not T-lymphoid development in scid mice.
Nature
368
:
457
35
Yasutomo, K., D. Maeda, H. Hisaeda, R. A. Good, Y. Kuroda, K. Himeno.
1997
. The Fas-deficient SCID mouse exhibits the development of T cells in the thymus.
J. Immunol.
158
:
4729
36
Zúñiga-Pflücker, J. C., D. Jiang, P. L. Schwartzberg, M. J. Lenardo.
1994
. Sublethal γ-irradiation induces differentiation of CD4/CD8 into CD4+/CD8+ thymocytes without T cell receptor β rearrangement in recombinase activation gene 2−/− mice.
J. Exp. Med.
180
:
1517
37
Guidos, C. J., C. J. Williams, G. E. Wu, C. J. Paige, J. S. Danska.
1995
. Development of CD4+ CD8+ thymocytes in RAG-deficient mice through a T cell receptor β chain-independent pathway.
J. Exp. Med.
181
:
1187
38
Hartley, K., D. Gell, G. Smith, H. Zhang, N. Divecha, M. Connelly, A. Admon, S. Lees-Miller, C. Anderson, S. Jackson.
1995
. DNA-dependent protein kinase catalytic subunit: a relative of phosphatidylinositol 3-kinase and the ataxia telangiectasia gene product.
Cell
82
:
849
39
Hesse, J. E., M. R. Lieber, M. Gellert, K. Mizuuchi.
1987
. Extrachromosomal DNA substrates in pre-B cells undergo inversion or deletion at immunoglobulin V-(D)-J joining signals.
Cell
49
:
775
40
Ramsden, D. A., G. E. Wu.
1991
. Mouse κ light-chain recombination signal sequences mediate recombination more frequently than those of λ light chain.
Proc. Natl. Acad. Sci. USA
88
:
10721
41
Lewis, S. M., E. Agard, S. Suh, L. Czyzyk.
1997
. Cryptic signals and the fidelity of V(D)J joining.
Mol. Cell. Biol.
17
:
3125
42
Lewis, S. M., J. E. Hesse.
1991
. Cutting and closing without recombination in V(D)J joining.
EMBO J.
10
:
3631
43
Lewis, S. M..
1994
. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses.
Adv. Immunol.
56
:
27
44
Lewis, S. M..
1994
. P nucleotide insertions and the resolution of hairpin DNA structures in mammalian cells.
Proc. Natl. Acad. Sci. USA
91
:
1332
45
van Gent, D., J. F. McBlane, D. Ramsden, J. Hesse, M. Gellert.
1995
. Initiation of V(D)J recombination in a cell-free system.
Cell
81
:
1
46
Lewis, S. M..
1994
. P nucleotides, hairpin DNA, and V(D)J joining: making the connection.
Semin. Immunol.
6
:
131
47
Meier, J. T., S. M. Lewis.
1993
. P nucleotides in V(D)J recombination: a fine-structure analysis.
Mol. Cell. Biol.
13
:
1078
48
Taccioli, G. E., G. Rathbun, E. Oltz, T. Stamato, P. A. Jeggo, F. W. Alt.
1993
. Impairment of V(D)J recombination in double-strand break repair mutants.
Science
260
:
207
49
Pennycook, J. L. M. H. 1997. Analysis of endogenous immunoglobulin gene rearrangement in the SCID mouse. Ph.D. Thesis, Immunology Department, University of Toronto, Toronto, Ontario, Canada.
50
Kienker, L. J., W. A. Kuziel, P. W. Tucker.
1991
. T cell receptor γ and δ gene junctional sequences in SCID mice: excessive P nucleotide insertion.
J. Exp. Med.
174
:
769
51
Kienker, L. J., W. A. Kuziel, B. A. Garni-Wagner, V. Kumar, P. W. Tucker.
1991
. T cell receptor γ and δ gene rearrangements in SCID thymocytes: similarity to those in normal thymocytes.
J. Immunol.
147
:
4351
52
Kotloff, D. B., M. J. Bosma, N. R. Reutsch.
1993
. V(D)J recombination in peritoneal B cells of leaky scid mice.
J. Exp. Med.
178
:
1981
53
Lieber, M. R., J. E. Hesse, K. Mizuuchi, M. Gellert.
1988
. Lymphoid V(D)J recombination: nucleotide insertion at signal joints as well as coding joints.
Proc. Natl. Acad. Sci. USA
85
:
8588
54
Gorbunova, V., A. A. Levy.
1997
. Non-homologous DNA end joining in plant cells is associated with deletions and filler DNA insertions.
Nucleic Acids Res.
25
:
4650
55
Lewis, S. M..
1999
. Palindromy is eliminated through a structure-specific recombination process in rodent cells.
Nucleic Acids Res.
27
:
2521
56
Thacker, J., R. E. Wilkinson.
1995
. The genetic basis of cellular recovery from radiation damage: response of the radiosensitive irs lines to low-dose-rate irradiation.
Radiat. Res.
144
:
294
57
Mombaerts, P., J. Iacomini, R. S. Johnson, K. Herrup, S. Tonegawa, V. E. Papaioannou.
1992
. RAG-1 deficient mice have no mature B and T lymphocytes.
Cell
68
:
869
58
Shinkai, Y., G. Rathbun, K.-P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, F. W. Alt.
1992
. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement.
Cell
68
:
855
59
Besmer, E., J. Mansilla-Soto, S. Cassard, D. J. Sawchuk, G. Brown, M. Sadofsky, S. M. Lewis, M. C. Nussenzweig, P. Cortes.
1998
. Hairpin coding end opening is mediated by the recombination activating genes RAG1 and RAG2.
Mol. Cell
2
:
817
60
Shockett, P. E., D. G. Schatz.
1999
. DNA hairpin opening mediated by the RAG1 and RAG2 proteins.
Mol. Cell. Biol.
19
:
4159
61
Agrawal, A., D. B. Schatz.
1997
. RAG1 and RAG2 form a stable post-cleavage synaptic complex with DNA containing signal ends in V(D)J recombination.
Cell
89
:
43
62
Hiom, K., M. Gellert.
1997
. A stable RAG1-RAG2-DNA complex that is active in V(D)J cleavage.
Cell
88
:
65
63
Akamatsu, Y., M. A. Oettinger.
1998
. Distinct roles of RAG1 and RAG2 in binding the V(D)J recombination signal sequences.
Mol. Cell. Biol.
18
:
4670
64
Bailin, T., X. Mo, M. Sadofsky.
1999
. A RAG1 and RAG2 tetramer complex is active in cleavage in V(D)J recombination.
Mol. Cell. Biol.
19
:
4664
65
Zhu, C., M. A. Bogue, D.-S. Lim, P. Hasty, D. B. Roth.
1996
. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates.
Cell
86
:
379
66
Gu, Y., K. J. Seidl, G. A. Rathbun, C. Zhu, J. P. Manis, N. van der Stoep, L. Davidson, H. L. Cheng, J. M. Sekiguchi, K. Frank, P. Stanhope-Baker, M. S. Schlissel, D. B. Roth, F. W. Alt.
1997
. Growth retardation and leaky SCID phenotype of Ku70-deficient mice.
Immunity
7
:
653