IL-4-producing γδ thymocytes in normal mice belong to a distinct subset of γδ T cells characterized by low expression of Thy-1. This γδ thymocyte subset shares a number of phenotypic and functional properties with the NK T cell population. Thy-1dull γδ thymocytes in DBA/2 mice express a restricted repertoire of TCRs that are composed of the Vγ1 gene product mainly associated with the Vδ6.4 chain and exhibit limited junctional sequence diversity. Using mice transgenic for a rearranged Vγ1Jγ4Cγ4 chain and a novel mAb (9D3) specific for the Vδ6.3 and Vδ6.4 murine TCRδ chains, we have analyzed the peripheral localization and functional properties of γδ T cells displaying a similarly restricted TCR repertoire. In transgenic mice, IL-4 production by peripheral γδ T cells was confined to the γδ+9D3+ subset, which contains cells with a TCR repertoire similar to that found in Thy-1dull γδ thymocytes. In normal DBA/2 mice such cells represent close to half of the γδ T cells present in the liver and around 20% of the splenic γδ T cells.

Most T lymphocytes in the thymus and peripheral lymphoid organs express a TCR composed of α- and β-chains (αβ T cells) and either the CD4 or CD8 coreceptor. However, two distinct populations of T cells have received increased attention during the last few years. One is composed of cells that use γ- and δ-chains to form their TCR (γδ T cells) (1). The other is composed of αβ T cells that bear markers common to NK cells and are referred to as NK T cells (2, 3, 4). Although they comprise a minor portion of T cells in the thymus and peripheral lymphoid organs, these T cell populations constitute an important fraction of T lymphocytes present in other anatomical sites. Thus, γδ T cells are the predominant T cell population in most epithelial surfaces (1), whereas NK T cells represent around half of the T lymphocytes found in liver and bone marrow (2, 5, 6, 7).

We have recently characterized a population of γδ thymocytes that shares a number of phenotypic and functional characteristics with NK T cells (8). In the thymus, this γδ T cell population differs from conventional γδ T cells in its low expression of Thy-1, and thus, we referred to it as the Thy-1dull γδ T cell population. Similar to NK T cells, most Thy-1dull γδ thymocytes express a phenotype usually associated with activated or memory T cells, and approximately half of them express the NK1.1 cell marker (a member of the NKR-P1 gene family) and/or the CD4 coreceptor (8). Upon activation in vitro, both NK T cells and Thy-1dull γδ T cells produce large amounts of various cytokines, including IL-4, IFN-γ, IL-3, IL-5, IL-10, and GM-CSF (8, 9, 10, 11, 12). Finally, both cell populations have been shown to express a highly restricted TCR repertoire (8, 13, 14, 15). The skewed TCR repertoire expressed by NK T cells is selected by the MHC class-I like molecule CD1d (16, 17, 18, 19). The identity of the putative endogenous molecule selecting the TCR repertoire of the Thy-1dull γδ T cell population (20) is not known.

The physiological functions of NK T cells and Thy-1dull γδ T cells remain unknown. However, recent experiments have shown that NK T cells mediate IL-12-induced tumor cell killing in vivo (21, 22, 23), and several independent lines of evidence suggest that NK T cells may be involved in regulating autoimmunity (24, 25, 26, 27). Despite their ability to promptly produce large amounts of IL-4 upon stimulation in vivo (28), the role of NK T cells in the induction of Th2 responses has been questioned (29, 30, 31). In contrast, a major role of γδ T cells has been demonstrated in the early production of IL-4, which is required for the development of specific IgE responses in the periphery and for subsequent airway inflammation upon intranasal Ag challenge (32). This led to the suggestion that IL-4 production by γδ T cells in the periphery could be important for the development of certain Th2 responses to protein Ags, and thus focused attention on the Thy-1dull γδ T cell population.

An important step in understanding the physiological function of the Thy-1dull γδ T cells is the characterization of their peripheral localization. In this report we have used mice transgenic (Tg)3 for a rearranged Vγ1Jγ4Cγ4 chain and a novel mAb (9D3) specific for the Vδ6.3 and Vδ6.4 murine TCRδ chains to analyze this issue. Our results show that γδ T cells expressing functional abilities and TCR repertoire similar to those described for the Thy-1dull γδ thymocytes are mainly present in liver and spleen. In normal DBA/2 mice, these γδ T cells are found in the thymus, liver, and spleen at a level of 1–4 × 105 cells/organ.

C57BL/6 (B6) mice Tg for a rearranged Vγ1Jγ4Cγ4 chain (Vγ1Tg) and TCRδ knockout mice were maintained in our animal facilities. DBA/2 and (B6 × DBA/2)F1 (B6D2F1) mice were obtained from Iffa Credo (L’Abresle, France). (DBA/2 × B6)F1 (D2B6F1) Vγ1Tg were produced by mating DBA/2 females with B6 Vγ1Tg males. F1 mice were typed for the presence of the transgene by PCR analysis on tail DNA using primers specific for the Vγ1 gene and for the Vγ1Jγ4 junction (see below). Mice were used between 7–15 wk of age.

Anti-CD4 (RL.174), anti-CD8 (HO-2.2), anti-heat-stable Ag (anti-HSA; J11d), anti-Cβ (H57-597), anti-Cδ (3A10), anti-Vγ1 (2.11), and anti-Vδ6.4/Vδ6.3 (9D3) were prepared and used as previously described (33). PE-labeled anti-Cδ (GL3), FITC- or PE-labeled anti-HSA, anti-Thy-1, anti-CD62 ligand (anti-CD62L), anti-CD44, anti-CD69, anti-CD3ε, anti-CD45RB, anti-NK1.1, anti-CD4, and anti-CD8 were purchased from PharMingen (San Diego, CA). Goat anti-mouse IgM was purchased from Sigma (St. Louis, MO). For the cytokine-specific ELISA we used the following mAb: anti-IFN-γ (clones R46A2, and AN18) and anti-IL-4 (clones BVD4 and BVD6; a gift from Dr. P. Minoprio, Unité d’Immunoparasitologie, Institut Pasteur, Paris, France).

Cells (105-106) were incubated in staining buffer (PBS, 3% FCS, and 0.1%NaN3) with the indicated labeled mAbs for 30 min on ice and washed twice. When biotin-conjugated mAbs were used, the cells were further incubated with either PE-labeled streptavidin (Southern Biotechnology Associates, Birmingham, AL) or streptavidin Tricolor (Caltag, South San Francisco, CA) for 15 min on ice. After another wash, cells were resuspended in staining buffer containing 1 μg/ml propidium iodide and analyzed using a FACScan flow cytometer (Becton Dickinson, Mountain View, CA). Dead cells were gated out either by their staining with PI or by their forward and angle light scatter profile. Data were analyzed using the CellQuest program.

For FACS sorting, cell suspensions were prepared as indicated above and incubated with the appropriate mAb at a concentration of 30 × 106 cells/ml for 30 min on ice. After two washes, cells were resuspended in PBS-10% FCS and sorted in a FACStarPlus cell sorter (Becton Dickinson). The purity of the sorted populations was >95%.

Single-cell suspensions were prepared from the thymus, spleen, lymph nodes, and liver according to standard procedures. CD4CD8 (DN) and CD8HSA thymocytes were prepared by complement-mediated killing as previously described (8). Liver mononuclear cells were isolated by centrifugation in a discontinuous gradient of Percoll (Pharmacia, Uppsala, Sweden). Briefly, total liver cells were resuspended in 100% isotonic Percoll solution and overlaid with 70 and 40% isotonic Percoll solutions. After centrifugation for 30 min at 500 × g, cells at the 40–70% interface were collected, washed twice, and further purified from contaminating RBC by density gradient centrifugation using Lympholyte M (Cedarlane, Hornby, Canada). The cells were washed twice in medium containing 5% FCS. Splenic RBC were lysed by incubating spleen cells for 2 min in 5 ml of NH4Cl solution. Lymph node cells and RBC-depleted spleen cells were resuspended in medium containing 10% FCS at a concentration of 2.5–10 × 106 cells/ml and incubated for 90 min in petri dishes (Optilux, Falcon 1005, Oxnard, CA) previously coated with anti-Cβ and anti-IgM Ab (each at 5 μg/ml in PBS), with sporadic agitation. Nonadherent cells were recovered and washed twice before use.

FACS-sorted cells (1.5 × 105 cells/ml) were cultured in flat-bottom microtiter plates previously coated with 10 μg/ml anti-Cδ mAb (3A10) in complete medium, i.e., DMEM with Glutamax-I medium (Life Technologies, Gaithersburg, MD) supplemented with sodium pyruvate, 5 × 10−5 M 2-ME, nonessential amino acids, and antibiotics (all from Life Technologies) and 10% FCS (Boehringer Mannheim, Meylan, Germany). Mouse rIL-2 was added at a final concentration of 100 U/ml. Supernatants from 3-day cultures were tested for the presence of IL-4 and IFN-γ by ELISA as previously described (34).

TCRδ KO mice were immunized i.p. twice at 2-wk intervals with 5 × 106 DTN40 (Vγ1/Vδ6.4) hybridoma cells and once i.v. with 106 DTN40 hybridoma cells resuspended in PBS. The DTN40 hybridoma was obtained by fusing Thy-1dull γδ thymocytes of DBA/2 origin with BW5147 thymoma cells (8). Three days after the last injection, spleen cells were fused with SP2/0 cells as described previously (33). The cells were then distributed in 96-well flat-bottom plates in complete medium supplemented with hypoxanthine-aminopterin-thymidine. Culture supernatants from growth-positive wells were tested for their ability to bind to the immunizing hybridoma cell but not to a TCR-negative variant of the same hybridoma. Binding of the Ab to the hybridoma cells was detected with FITC-labeled goat anti-mouse Ig (Caltag) and analyzed with a FACScan. The fine specificities of the selected Ab were determined by their ability to stain γδ T cell hybridomas that express different TCRγ and TCRδ chains.

The following oligonucleotide primers were used: Vδ6, TCTGTAGTCTTCCAGAAATCA; Vδ6.4, GTTTTCCTTATTCGACAAACA; Cδ, CGAATTCCACAATCTTCTTG; JS1, GTTCCTTGTCCAAAGACGAG; Vγ1, CCGGCAAAAAGCAAAAAAGTT; and Vγ1Jγ4Tg junction, CCCATGATGTGCCTGACCAG. PCR was performed using a GeneAmp PCR system 9600 (Perkin-Elmer/Cetus, Norwalk, CT). Each cycle consisted of incubation at 92°C for 20 s, followed by 55°C for 30 s and 72°C for 30 s. Before the first cycle, a 2-min 94°C denaturation step was included, and after the 35th cycle the extension at 72°C was prolonged for 4 min.

Total cellular RNA from sorted cells was extracted with RNA-B (Bioprobe Systems, Montreuil, France). Before RNA extraction, sorted cells were mixed with 106 SP2/0 cells as a carrier. cDNA was synthesized with oligo(dT) (Pharmacia) using superscript reverse transcriptase (Life Technologies) according to the manufacturer’s instructions. The population analysis of TCRδ rearrangements has been previously described in detail (8, 20).

Given the paucity of γδ cells in the peripheral lymphoid organs in the mouse, it was difficult to study the peripheral representation of the Thy-1dull γδ population in normal mice. To overcome this problem we took advantage of the availability of a mouse Tg for a rearranged Vγ1Jγ4Cγ4 chain that we produced previously (35). The DNA inserted to produce this Tg line consisted of a 45-kb cosmid containing the rearranged Vγ1Jγ4Cγ4 gene flanked by 10 kb of sequence upstream of the Vγ1 segment and 26 kb of sequence downstream of the last Cγ4 exon (Fig. 1,A). Thus, this construct should contain all the regulatory elements required to ensure normal expression of the transgene. The cosmid clone was isolated from a T cell hybridoma of B6 origin (T3.13.1) (33), and the Vγ1Jγ4 junctional sequence is identical with one of the two more common Vγ1Jγ4 junctional sequences found among the Thy-1dull γδ thymocytes in DBA/2 mice (8). αβ T cell development in these mice appears quite normal, as indicated by the similar number of total thymocytes (not shown) and of the major thymocyte populations defined by double staining with CD4 and CD8 mAbs in Tg animals and littermate controls (Fig. 1,B). In contrast, a 3- to 10-fold increase in the number of γδ thymocytes is present in Tg mice compared with littermates, and most of these cells express the transgenic chain (Fig. 1,C). This increase in the absolute numbers of γδ T cells in the Tg mice is also evident in the periphery, where Tg animals contain 3- to 10-fold more γδ T cells than control littermates; here again, most of the γδ T cells in Tg mice express the Vγ1 chain (Fig. 1 C).

FIGURE 1.

A, Restriction map of the γ2F construct used to generate Vγ1Tg mice. Variable and constant regions are indicated beneath the map. The sizes of the variable and constant regions are approximate. Not all the restriction sites are necessarily shown. A, ApaI; F, FspI; K, KpnI; N, NotI; R, EcoRI; S, SnaBI. B, Expression of CD4 and CD8 in the thymus of Vγ1Tg mice and non-Tg littermates. Thymocytes from the indicated mice were stained with FITC-labeled anti-CD4 and PE-labeled anti-CD8 mAb and analyzed with a FACScan. Numbers indicate the percentage of positive cells in each quadrant. C, Expression of the γδ TCR and the Vγ1 chain in different organs of Vγ1Tg mice and non-Tg littermates. Cells isolated from the indicated organs were stained with FITC-labeled anti-CD3 and biotin-labeled anti-δ mAb (left panels) or with FITC-labeled anti-δ and biotin-labeled anti-Vγ1 Ab (right panels) followed by streptavidin-PE. Dot plots show the log10 of fluorescence intensity and were produced with the CellQuest program. Numbers indicate the percentages of CD3+γδ+ and CD3+γδ (left panels) and of γδ+Vγ1+ and γδ+Vγ1 among total cells present in the lymphocyte gate. Some 20,000 to 100,000 cells were analyzed in each panel.

FIGURE 1.

A, Restriction map of the γ2F construct used to generate Vγ1Tg mice. Variable and constant regions are indicated beneath the map. The sizes of the variable and constant regions are approximate. Not all the restriction sites are necessarily shown. A, ApaI; F, FspI; K, KpnI; N, NotI; R, EcoRI; S, SnaBI. B, Expression of CD4 and CD8 in the thymus of Vγ1Tg mice and non-Tg littermates. Thymocytes from the indicated mice were stained with FITC-labeled anti-CD4 and PE-labeled anti-CD8 mAb and analyzed with a FACScan. Numbers indicate the percentage of positive cells in each quadrant. C, Expression of the γδ TCR and the Vγ1 chain in different organs of Vγ1Tg mice and non-Tg littermates. Cells isolated from the indicated organs were stained with FITC-labeled anti-CD3 and biotin-labeled anti-δ mAb (left panels) or with FITC-labeled anti-δ and biotin-labeled anti-Vγ1 Ab (right panels) followed by streptavidin-PE. Dot plots show the log10 of fluorescence intensity and were produced with the CellQuest program. Numbers indicate the percentages of CD3+γδ+ and CD3+γδ (left panels) and of γδ+Vγ1+ and γδ+Vγ1 among total cells present in the lymphocyte gate. Some 20,000 to 100,000 cells were analyzed in each panel.

Close modal

Before performing phenotypic, functional, and TCR repertoire analysis in the periphery of the Tg mice, we first established that the introduction of the transgene did not modify the representation of the Thy-1dull γδ thymocytes. As shown in Fig. 2, around 50 and 8% of the γδ thymocytes expressed low levels of Thy-1 in B6D2F1 and B6 Tg animals, respectively. These numbers correlate well with those previously found in normal B6D2F1 and B6 mice (8). The somewhat higher percentages of Thy-1dull γδ thymocytes found in Tg mice are probably due to the fact that virtually all γδ T cells in these mice express the Vγ1 gene product. Furthermore, most of the Thy-1dull γδ thymocytes isolated from B6D2F1 Tg mice express a HSA CD62L CD44+ phenotype (Fig. 2 B), characteristic of the Thy-1dull γδ thymocytes in normal animals (8).

FIGURE 2.

Vγ1Tg mice of D2B6F1 genetic background contain a major population of Thy-1dull thymocytes. DN thymocytes from the indicated Vγ1Tg mice were stained with PE-labeled anti-Thy-1, biotin-labeled anti-δ, and FITC-labeled anti-HSA, anti-CD62L, or anti CD44 mAb, followed by streptavidin-Tricolor and analyzed in a FACScan. A, Dot plots of γδ vs Thy-1 staining in B6 and D2B6F1 Vγ1Tg mice. Numbers indicate the percentage of Thy-1dull γδ thymocytes among total γδ+ cells (mean ± 1 SD of 10 animals analyzed individually). B, Profiles of expression of the indicated marker on γδ+Thy-1bright (upper panels) and γδ+Thy-1dull (lower panels) thymocytes from D2B6F1 Vγ1Tg mice.

FIGURE 2.

Vγ1Tg mice of D2B6F1 genetic background contain a major population of Thy-1dull thymocytes. DN thymocytes from the indicated Vγ1Tg mice were stained with PE-labeled anti-Thy-1, biotin-labeled anti-δ, and FITC-labeled anti-HSA, anti-CD62L, or anti CD44 mAb, followed by streptavidin-Tricolor and analyzed in a FACScan. A, Dot plots of γδ vs Thy-1 staining in B6 and D2B6F1 Vγ1Tg mice. Numbers indicate the percentage of Thy-1dull γδ thymocytes among total γδ+ cells (mean ± 1 SD of 10 animals analyzed individually). B, Profiles of expression of the indicated marker on γδ+Thy-1bright (upper panels) and γδ+Thy-1dull (lower panels) thymocytes from D2B6F1 Vγ1Tg mice.

Close modal

When we analyzed the periphery of B6D2F1 Tg mice for the presence of Thy-1dull γδ T cells, we found that only around 10% of the γδ T cells present in the spleen, lymph nodes, liver, and bone marrow expressed low levels of Thy-1 (not shown). These data could imply that cells expressing similar phenotypic and functional properties as the Thy-1dull γδ thymocytes rarely seed the periphery. Alternatively, this could also indicate that Thy-1dull γδ thymocytes modulate their levels of Thy-1 in the periphery. To distinguish between these two possibilities we sought an independent marker that could specifically identify the Thy-1dull γδ thymocyte population and putative peripheral descendents. Because the most characteristic feature of this population is the expression of a very restricted TCR repertoire, with almost exclusive utilization of the Vγ1 chain together with certain members of the Vδ6 subfamily (8), we decided to produce an Ab able to recognize these Vδ6 subfamily members.

To produce such an mAb we immunized γδ-deficient mice with a Thy-1dull γδ T cell hybridoma of DBA/2 origin. Spleen cells from immunized mice were fused with SP2/0 cells, and the resulting hybridomas were tested for their ability to bind to the immunizing cells but not to a TCR-negative variant of the same hybridoma. The fine specificities of the selected mAbs were analyzed by staining a large panel of T cell hybridomas of B6 and DBA/2 origin previously characterized for their Vγ and Vδ usage (P. Pereira, unpublished observations). One hybridoma, termed 9D3, specifically stained some γδ T cell hybridomas expressing a Vδ6 chain but did not stain γδ T cell hybridomas expressing other Vδ chains, including Vδ2, Vδ4, Vδ5, and Vδ7 (not shown). Further analyses with γδ T cell hybridomas expressing different members of the Vδ6 subfamily showed that 9D3 stained all γδ T cell hybridomas of B6 origin expressing the Vδ6.3 chain (36) and all γδ T cell hybridomas of DBA/2 origin expressing the Vδ6.4 (8) chain but not hybridomas expressing any other member of the Vδ6 subfamily, including the related B6 Vδ6.1 (37) chain and the DBA/2 Vδ6.5 and Vδ6.6 chains (8) (Table I). Furthermore, 9D3 stained a sizable proportion of γδ thymocytes, splenocytes, and intestinal intraepithelial lymphocytes in DBA/2 and B6 strains as well as in B10 and B10.D2 mice that share the same TCRα/δ haplotype as B6 mice (39, 40, 41), but did not stain any γδ T cells in BALB/c, C3H, CBA, or 129/Sv strains of mice, which share a different TCRα/δ haplotype (39, 40, 41), suggesting that the 9D3 mAb does not recognize the Vδ6.2 chain (37) (not shown).

Table I.

Specificity of the 9D3 mAba

HybridomaTCRb9D3
DBA/2   
DTN63 Vγ1Vδ6.4 
DTN40 Vγ1Vδ6.4 
DTN55 Vγ1Vδ6.4 
DTN30 Vγ1Vδ6.4 
DIC47 Vγ1Vδ6.4 
DIC56 Vγ1Vδ6.5 − 
DTN35 Vγ1Vδ6.6 − 
DIC34 Vγ1Vδ6.6 − 
DTC27 Vγ1Vδ6B − 
DIC61 Vγ1Vδ6B − 
7D Vγ7Vδ6.4 
6F3 Vγ7Vδ6.6 − 
5F2 Vγ7Vδ6B − 
   
B6   
BIC3 Vγ1Vδ6.3 
BIC66 Vγ1Vδ6.1 − 
BIC16 Vγ1Vδ6B − 
BTC80 Vγ1Vδ6B − 
HybridomaTCRb9D3
DBA/2   
DTN63 Vγ1Vδ6.4 
DTN40 Vγ1Vδ6.4 
DTN55 Vγ1Vδ6.4 
DTN30 Vγ1Vδ6.4 
DIC47 Vγ1Vδ6.4 
DIC56 Vγ1Vδ6.5 − 
DTN35 Vγ1Vδ6.6 − 
DIC34 Vγ1Vδ6.6 − 
DTC27 Vγ1Vδ6B − 
DIC61 Vγ1Vδ6B − 
7D Vγ7Vδ6.4 
6F3 Vγ7Vδ6.6 − 
5F2 Vγ7Vδ6B − 
   
B6   
BIC3 Vγ1Vδ6.3 
BIC66 Vγ1Vδ6.1 − 
BIC16 Vγ1Vδ6B − 
BTC80 Vγ1Vδ6B − 
a

Reactivity of the 9D3 mAb to different γδ T cell hybridomas of DBA/2 and B6 origin was determined by indirect immunofluorescence using FITC-labeled anti- mose IgG.

b

TCR V-gene usage was determined by immunofluorescence with Vγ-specific mAbs and by sequence of the PCR products obtained after amplification with Vδ- and Cδ-specific primers. Vδ6B denotes members of the Vδ6 subfamily with >90% nucleotide identity to the pλ12 (Ref. 38).

Three-color staining of DN thymocytes from D2B6F1 Tg mice with anti-γδ, anti-Thy-1, and 9D3 mAb showed that 80–90% of Thy-1dull γδ thymocytes were 9D3+, consistent with the predicted specificity of the 9D3 mAb. Conversely, around 90% of the γδ+9D3+ thymocytes expressed low levels of Thy-1 (Fig. 3). These data indicated that it would be possible to enrich for Thy-1dull γδ T cells by separating the cells on the basis of 9D3 expression.

FIGURE 3.

Correlation between 9D3 expression and low levels of Thy-1. DN thymocytes from D2B6F1 Vγ1Tg mice were stained with FITC-labeled anti-δ, PE-labeled anti-Thy-1, and biotin-labeled 9D3 mAb followed by streptavidin-Tricolor and analyzed in a FACScan. A dot plot of γδ vs 9D3 staining in total DN cells (left) and Thy-1 expression by γδ+9D3+ (R2) and γδ+9D3 (R3) populations is shown. R2 and R3 denote the electronic gates used for the analysis.

FIGURE 3.

Correlation between 9D3 expression and low levels of Thy-1. DN thymocytes from D2B6F1 Vγ1Tg mice were stained with FITC-labeled anti-δ, PE-labeled anti-Thy-1, and biotin-labeled 9D3 mAb followed by streptavidin-Tricolor and analyzed in a FACScan. A dot plot of γδ vs 9D3 staining in total DN cells (left) and Thy-1 expression by γδ+9D3+ (R2) and γδ+9D3 (R3) populations is shown. R2 and R3 denote the electronic gates used for the analysis.

Close modal

We next analyzed the frequency of 9D3+ cells among γδ lymphocytes in different organs in D2B6F1 Tg mice. As shown in Table II, 9D3+ cells represent roughly 50, 30, and 20% of the γδ T cells in liver, spleen, and peripheral lymph nodes, respectively. In other sites, such as bone marrow and peritoneal cavity, the frequency of γδ T cells was too low to allow accurate quantification even in Tg mice, although γδ+9D3+ cells were present at those sites.

Table II.

Representation of γδ+9D3+ T cells in different organs from D2B6F1 Vγ1Tg mice

Organ9D3+ Cells (% of total γδ+ cells) (mean ± SE)a
Thymus 49.3 ± 3.2 
Spleen 35.0 ± 2.1 
Liver 53.3 ± 3.8 
Lymph nodes 23.5 ± 1.5 
Organ9D3+ Cells (% of total γδ+ cells) (mean ± SE)a
Thymus 49.3 ± 3.2 
Spleen 35.0 ± 2.1 
Liver 53.3 ± 3.8 
Lymph nodes 23.5 ± 1.5 
a

A minimum of four mice were analyzed.

One of the characteristics of the Thy-1dull γδ thymocytes is their very restricted TCR repertoire. Besides their almost exclusive use of the Vγ1 chain and one or two members of the Vδ6 chain subfamily, their VδDδJδ junctional sequences show limited diversity, and the great majority of them show identical length (8, 20). To investigate the putative relationship between the Thy-1dull γδ thymocytes and the γδ+9D3+ cells in the periphery we examined the junctional length of the Vδ6 transcripts present in sorted γδ+9D3+ and γδ+9D3 cells isolated from thymus, spleen, liver, and peripheral lymph nodes as well as from a Thy-1dull γδ hybridoma (DTN40). RT-PCR reactions with Vδ6- and Cδ-specific primers on cDNA isolated from all sorted populations were performed. An aliquot of each amplification product was submitted to a run-off reaction in the presence of a 6-carboxy-fluorescein (FAM)-labeled Jδ1 primer, and the fluorescent products were resolved on a denaturing acrylamide gel cast on an automated sequencer.

Typical of polyclonal VδDδJδ junctions, the profiles obtained from sorted γδ+9D3 populations isolated from different organs showed 11–15 defined peaks that form a Gaussian-type curve (Fig. 4). All adjacent peaks differ in size by three nucleotides, and thus, the profiles show mainly in-frame junctions. In contrast, the profiles obtained for the sorted γδ+9D3+ populations showed a prominent peak at a CDR3 length identical with that displayed by the DTN40 hybridoma cell line, although the relative representation of this peak varied depending on the organ from which the cells were isolated. Calculation of the area of this peak relative to the area of all peaks in each organ indicated that 70, 35, 50, and 25% of the Vδ6(D)Jδ1 rearrangements present in γδ+9D3+ populations isolated from thymus, spleen, liver, and lymph nodes, respectively, showed this particular CDR3 size.

FIGURE 4.

Population analysis of Vδ6(D)Jδ1 rearrangements expressed by γδ+9D3+ and γδ+9D3 populations isolated from different anatomical sites. Total RNA samples isolated from sorted γδ+9D3+ and γδ+9D3 populations isolated from the indicated anatomical sites and from the DTN40 hybridoma cells were converted to cDNA and amplified with Vδ6- and Cδ-specific primers. An aliquot of the amplified products was submitted to a run-off reaction with a FAM-labeled Jδ1 primer, and the final products were resolved with an automated sequencer. Plots show the profile of fluorescence intensity vs the length of the fragments. LN, lymph node cells

FIGURE 4.

Population analysis of Vδ6(D)Jδ1 rearrangements expressed by γδ+9D3+ and γδ+9D3 populations isolated from different anatomical sites. Total RNA samples isolated from sorted γδ+9D3+ and γδ+9D3 populations isolated from the indicated anatomical sites and from the DTN40 hybridoma cells were converted to cDNA and amplified with Vδ6- and Cδ-specific primers. An aliquot of the amplified products was submitted to a run-off reaction with a FAM-labeled Jδ1 primer, and the final products were resolved with an automated sequencer. Plots show the profile of fluorescence intensity vs the length of the fragments. LN, lymph node cells

Close modal

We have previously shown that Thy-1dull γδ thymocytes secrete high levels of IL-4 and IFN-γ upon activation in vitro with coated anti-γδ mAbs and IL-2 (8). To investigate whether γδ+9D3+ cells in the periphery have the same functional abilities as the Thy-1dull γδ thymocyte population, sorted γδ+9D3+ and γδ+9D3 cells from thymus, spleen, lymph nodes, and liver of D2B6F1 Tg mice were cultured in anti-γδ mAb-coated plates in the presence of IL-2, and the levels of IL-4 and IFN-γ present in the culture supernatants were quantitated (Table III). Regardless of the organ from which they were isolated, γδ T cells secreted substantial amounts of IFN-γ, although 2- to 4-fold higher levels were detected in γδ+9D3 cells than in γδ+9D3+ cells. In contrast, larger differences were observed in the levels of IL-4 produced by these two γδ T cell subsets in the different organs. Thus, in thymus, spleen, and lymph nodes, γδ+9D3+ cells secreted 10- to 20-fold higher levels of IL-4 than γδ+9D3 cells, while the difference was only 2-fold in the liver. It is likely that in the thymus, the low levels of IL-4 detected in the γδ+9D3 cultures arise from the roughly 10% of Thy-1dull γδ thymocytes in D2B6F1 animals, which express the Vδ6.6 gene product and are not recognized by the 9D3 mAb. Similarly, the low levels of IL-4 detected in the γδ+9D3 cultures from spleen and lymph nodes could arise from Vδ6.6-bearing cells, although we do not have direct evidence for this interpretation. Taken together, these experiments suggest that the production of IL-4 by peripheral γδ T cells is primarily accomplished by cells expressing the Vδ6 chain and a restricted TCR repertoire.

Table III.

Cytokine production by sorted γδ+9D3+ (+) and γδ+9D3 (−) cells in D2B6F1 Vγ1Tg mice

ThymusSpleenLiverLymph nodes
++++
IFN-γa 68 114 26 105 19.3 41.5 28 120 
IL-4a 143 10.5 40 4.5 5.4 2.1 49.5 2.1 
ThymusSpleenLiverLymph nodes
++++
IFN-γa 68 114 26 105 19.3 41.5 28 120 
IL-4a 143 10.5 40 4.5 5.4 2.1 49.5 2.1 
a

Results show cytokine concentrations in ng/ml.

We then investigated the surface phenotype of the γδ+9D3+ and γδ+9D3 cells present at different anatomical sites, and their FACS profiles in thymus, spleen, and liver are illustrated in Fig. 5. Invariably, most γδ+9D3+ cells showed an HSAlow CD44bright CD62Llow CD45RBint CD69+ phenotype, similar to that of NK T cells and activated T cells. However, none of these markers could unambiguously define the γδ+9D3+ population. In fact, the same activated phenotype is expressed by the vast majority of γδ T cells in the liver, and CD44bright cells represent an important fraction of the γδ+9D3 cells in thymus and spleen.

FIGURE 5.

Phenotypic analysis of γδ+9D3+ and γδ+9D3 populations. Cells were prepared as described in Materials and Methods and three color stained as described in Fig. 2. Shown are the profiles of the indicated Ab in γδ+9D3+ and γδ+9D3 populations isolated from the indicated organs. Staining results of lymph node cells were similar to those presented for spleen cells.

FIGURE 5.

Phenotypic analysis of γδ+9D3+ and γδ+9D3 populations. Cells were prepared as described in Materials and Methods and three color stained as described in Fig. 2. Shown are the profiles of the indicated Ab in γδ+9D3+ and γδ+9D3 populations isolated from the indicated organs. Staining results of lymph node cells were similar to those presented for spleen cells.

Close modal

γδ+9D3+ cells are heterogeneous with regard to the expression of other cell surface markers (Fig. 6). Thus, approximately half these cells express the NK1.1 marker in every organ tested. However, a similar proportion of the γδ+9D3 cells present in the liver are also NK1.1+. We have previously shown that, unlike other γδ thymocytes, around half the Thy-1dull γδ thymocytes express the CD4 coreceptor (8). Similarly, a fraction of the γδ+9D3+ cells present in the spleen and liver expresses the CD4 molecule, although the fraction of CD4+γδ+ cells appears to be lower in the liver than in the spleen. Finally, most γδ+9D3+ cells are negative for the expression of CD8, even though CD8+γδ+ cells can be readily detected among the γδ+9D3 cells in liver and spleen, confirming previous results (42).

FIGURE 6.

CD4, CD8, and NK1.1 expression by γδ+9D3+ and γδ+9D3 populations. A, D2B6F1 Tg thymocytes treated with anti-HSA and anti-CD8 mAbs and complement were stained with FITC-labeled anti-CD4, PE-labeled anti-δ, and biotin-labeled 9D3 followed by streptavidin-Tricolor. The histogram shows CD4 expression in γδ+9D3+ cells. B, DN thymocytes from D2B6F1 Tg mice were stained with FITC-labeled anti-NK1.1, PE-labeled anti-δ, and biotin-labeled 9D3 mAb followed by streptavidin-Tricolor. Histograms show NK1.1 expression in γδ+9D3+ and γδ+9D3 populations. C, Cells were prepared as described in Materials and Methods and three color stained as described above. Shown are the profiles of the indicated Ab in γδ+9D3+ and γδ+9D3 populations isolated from the indicated organs. All cells were analyzed with a FACScan. Staining results of lymph node cells were similar to those shown for spleen cells.

FIGURE 6.

CD4, CD8, and NK1.1 expression by γδ+9D3+ and γδ+9D3 populations. A, D2B6F1 Tg thymocytes treated with anti-HSA and anti-CD8 mAbs and complement were stained with FITC-labeled anti-CD4, PE-labeled anti-δ, and biotin-labeled 9D3 followed by streptavidin-Tricolor. The histogram shows CD4 expression in γδ+9D3+ cells. B, DN thymocytes from D2B6F1 Tg mice were stained with FITC-labeled anti-NK1.1, PE-labeled anti-δ, and biotin-labeled 9D3 mAb followed by streptavidin-Tricolor. Histograms show NK1.1 expression in γδ+9D3+ and γδ+9D3 populations. C, Cells were prepared as described in Materials and Methods and three color stained as described above. Shown are the profiles of the indicated Ab in γδ+9D3+ and γδ+9D3 populations isolated from the indicated organs. All cells were analyzed with a FACScan. Staining results of lymph node cells were similar to those shown for spleen cells.

Close modal

Two types of experiments were performed to investigate the presence of this type of γδ T cells in the periphery of normal mice and to estimate their numbers. First we performed RT-PCR reactions on total RNA isolated from different organs of DBA/2 mice with primers specific for the Vδ6.4 and Cδ gene segments. Because most αβ T cells have deleted the TCRδ locus in both chromosomes, this PCR is expected to mainly, if not exclusively, amplify transcripts expressed by γδ T cells. The PCR amplifications were submitted to run-off reactions with a FAM-conjugated Jδ1 primer, and the labeled fragments were separated on a sequencing gel. The profiles obtained from one such experiment are shown in Fig. 7. As can be seen, a major peak protruding from the Gaussian-type curve and corresponding to a CDR3 length identical with that of the DTN40 hybridoma cell line is evident in thymus, spleen, and liver. The same peak is also evident, although to a lesser extent, in the lymph nodes and in the peritoneal cavity. These experiments suggested that cells expressing a restricted TCRδ repertoire are present in these organs in normal mice.

FIGURE 7.

Cells with a restricted TCRδ repertoire exist in the periphery of normal mice. RNA isolated from the indicated organs of DBA/2 mice was amplified by RT-PCR with Vδ6.4- and Cδ-specific primers. An aliquot of the amplified products was submitted to a run-off reaction with a FAM-labeled Jδ1 primer, and the final products were resolved with an automated sequencer. Plots show the profile of fluorescence intensity vs the length of the fragments. LN, lymph node cells; PC, peritoneal cavity cells.

FIGURE 7.

Cells with a restricted TCRδ repertoire exist in the periphery of normal mice. RNA isolated from the indicated organs of DBA/2 mice was amplified by RT-PCR with Vδ6.4- and Cδ-specific primers. An aliquot of the amplified products was submitted to a run-off reaction with a FAM-labeled Jδ1 primer, and the final products were resolved with an automated sequencer. Plots show the profile of fluorescence intensity vs the length of the fragments. LN, lymph node cells; PC, peritoneal cavity cells.

Close modal

The second set of experiments concerned the quantification of γδ+9D3+ cells by FACS analysis in different anatomical sites, and the results are presented in Table IV. The proportion of 9D3+ cells among γδ T cells in different organs in normal mice compared well with those found in Tg mice, keeping in mind that all γδ T cells in the Tg mice express the Vγ1 gene product. From this and the previous set of experiments we estimate that in normal DBA2 mice, roughly 2–4 × 105 thymocytes, and between 0.5 and 2 × 105 cells in the spleen and liver share the characteristics previously described for the Thy-1dull γδ thymocytes.

Table IV.

Representation of γδ+9D3+ and γδ+Vγ1+ T cells in different organs from normal DBA/2 mice

Organ% of Total γδ+ Cells (mean ± SE)a
9D3+ cellsVγ1+ cells
Thymus 31.2 ± 3.5 44.6 ± 1.5 
Spleen 15.7 ± 1.7 60.8 ± 1.5 
Lymph nodes 12.3 ± 1.0 59.9 ± 2.0 
Liver 42.6 ± 1.7 77.0 ± 2.6 
Organ% of Total γδ+ Cells (mean ± SE)a
9D3+ cellsVγ1+ cells
Thymus 31.2 ± 3.5 44.6 ± 1.5 
Spleen 15.7 ± 1.7 60.8 ± 1.5 
Lymph nodes 12.3 ± 1.0 59.9 ± 2.0 
Liver 42.6 ± 1.7 77.0 ± 2.6 
a

Six to seven mice were analyzed.

In conclusion, our studies have shown that γδ T cells able to simultaneously produce IL-4 and IFN-γ upon activation in vitro exist in the periphery of mice Tg for a rearranged Vγ1 chain. These cells, which are found predominantly in spleen and liver, express a restricted repertoire of TCR composed of the Vγ1 gene product mainly associated with the Vδ6.4 chain and exhibit limited junctional sequence diversity. γδ T cells with a similarly restricted TCR repertoire are present in the same organs in normal DBA/2 mice. These cells probably represent the descendants of the previously described Thy-1dull γδ thymocytes (8), although they seem to up-regulate Thy-1 expression upon seeding the periphery. Our experiments, however, did not directly address this issue, and such a relation between Thy-1dull γδ thymocytes and the cells studied here is, therefore, not formally established. Although this γδ T cell subset expresses an activated/memory phenotype, none of a variety of markers tested could unambiguously define this T cell population.

The phenotype, TCR diversity level, and functional properties found in this γδ T cell subset are also characteristic of the T NK population, and both T cell populations seem to home preferentially to liver and spleen. These common properties may reflect a similar differentiation program and/or a related function. However, the likely difference in their specificities implies separate aspects of function. Additional experiments will aim at characterizing the specific ligands recognized by this γδ T cell population.

We thank P. Minoprio for providing the anti-cytokine mAb. The Tg mice used here were produced in the laboratory of Prof. S. Tonegawa.

1

This work was supported by institutional grants and grants from the Association pour la Recherche sur le Cancer, Fondation pour la Recherche Medicale, and Association Nationale pour la Recherche contre le Sida.

3

Abbreviations used in this paper: Tg, transgenic; CD62L, CD62 ligand; DN, double negative; FAM, 6-carboxy-fluorescein; HSA, heat-stable Ag.

1
Haas, W., P. Pereira, S. Tonegawa.
1993
. γ/δ cells.
Annu. Rev. Immunol.
11
:
637
2
Bendelac, A., M. N. Rivera, S.-H. Park, J. H. Roark.
1997
. Mouse CD1-specific NK1 T cells: development, specificity, and function.
Annu. Rev. Immunol.
15
:
535
3
MacDonald, H. R..
1995
. NK1.1+ T cell receptor-αβ+ cells: new clues to their origin, specificity, and function.
J. Exp. Med.
182
:
633
4
Vicari, A. P., A. Zlotnik.
1996
. Mouse NK1.1+ cells: a new family of T cells.
Immunol. Today
17
:
71
5
Ohteki, T., H. R. MacDonald.
1994
. Major histocompatibility complex class I related molecules control the development of CD4+8+ and CD48 subsets of natural killer 1.1+ T cell receptor-α/β+ cells in the liver of mice.
J. Exp. Med.
180
:
699
6
Sykes, M..
1990
. Unusual T cell populations in adult murine bone marrow: prevalence of CD3+CD4+CD8+ and αβ TCR+NK1.1+ cells.
J. Immunol.
145
:
3209
7
Yankelevich, B., C. Knobloch, M. Nowicki, G. Dennert.
1989
. A novel cell type responsible for marrow graft rejection in mice: cells with NK phenotype cause acute rejection of marrow grafts.
J. Immunol.
142
:
3423
8
Azuara, V., J. P. Levraud, M. P. Lembezat, P. Pereira.
1997
. A novel subset of adult γδ thymocytes that secretes a distinct pattern of cytokines and expresses a very restricted T cell receptor repertoire.
Eur. J. Immunol.
27
:
544
9
Zlotnik, A., D. I. Godfrey, M. Fischer, T. Suda.
1992
. Cytokine production by mature and immature CD4CD8 T cells: αβ-T cell receptor+ CD4CD8 T cells produce IL-4.
J. Immunol.
149
:
1211
10
Hayakawa, K., B. T. Lin, R. R. Hardy.
1992
. Murine thymic CD4+ T cell subsets: a subset (Thy0) that secretes diverse cytokines and overexpresses the Vβ8 T cell receptor gene family.
J. Exp. Med.
176
:
269
11
Vicari, A. P., S. Mocci, P. Openshaw, A. O’Garra, A. Zlotnik.
1996
. Mouse γδ TCR+NK1.1+ thymocytes specifically produce interleukin-4, are major histocompatibility complex class I independent, and are developmentally related to αβ TCR+NK1.1+ thymocytes.
Eur. J. Immunol.
26
:
1424
12
Arase, H., N. Arase, K. Nakagawa, R. A. Good, K. Onoe.
1993
. NK1.1+ CD4+CD8 thymocytes with specific lymphokine secretion.
Eur. J. Immunol.
23
:
307
13
Arase, H., N. Arase, K. Ogasawara, R. A. Good, K. Onoe.
1992
. An NK1.1+ CD4+CD8 single-positive thymocyte subpopulation that expresses a highly skewed T-cell antigen receptor Vβ family.
Proc. Natl. Acad. Sci. USA
89
:
6506
14
Lantz, O., A. Bendelac.
1994
. An invariant T cell receptor α chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD48 T cells in mice and humans.
J. Exp. Med.
180
:
1097
15
Ohteki, T., H. R. MacDonald.
1996
. Stringent Vβ requirement for the development of NK1.1+ T cell receptor-α/β+ cells in mouse liver.
J. Exp. Med.
183
:
1277
16
Bendelac, A..
1995
. Positive selection of mouse NK1+ T cells by CD1-expressing cortical thymocytes.
J. Exp. Med.
182
:
2091
17
Chen, Y.-H., N. M. Chiu, M. Mandal, N. Wang, C.-R. Wang.
1997
. Impaired NK1+ T cell development and early IL-4 production in CD1-deficient mice.
Immunity
6
:
459
18
Mendiratta, S. K., W. D. Martin, S. Hong, A. Boesteanu, S. Joyce, L. V. Kaer.
1997
. CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4.
Immunity
6
:
469
19
Smiley, S. T., M. H. Kaplan, M. J. Grusby.
1997
. Immunoglobulin E production in the absence of interleukin-4-secreting CD1-dependent cells.
Science
275
:
977
20
Azuara, V., M. P. Lembezat, P. Pereira.
1998
. The homogeneity of the TCRδ repertoire expressed by the Thy-1dull γδ T cell population is due to cellular selection.
Eur. J. Immunol.
28
:
3456
21
Hashimoto, W., K. Takeda, R. Anzai, K. Ogasawara, H. Sakihara, K. Sugiura, S. Seki, K. Kumagai.
1995
. Cytotoxic NK1.1 Ag+ αβ T cells with intermediate TCR induced in the liver of mice by IL-12.
J. Immunol.
154
:
4333
22
Takeda, K., S. Seki, K. Ogasawara, R. Anzai, W. Hashimoto, K. Sugiura, M. Takahashi, M. Satoh, K. Kumagai.
1996
. Liver NK1.1+ CD4+ αβ T cells activated by IL-12 as a major effector in inhibition of experimental tumor metastasis.
J. Immunol.
156
:
3366
23
Cui, J., T. Shin, T. Kawano, H. Sato, E. Kondo, I. Toura, Y. Kaneko, H. Koseki, M. Kanno, M. Taniguchi.
1997
. Requirement for Vα14 NKT cells in IL-12-mediated rejection of tumors.
Science
278
:
1623
24
Mieza, M. A., T. Itoh, J. Q. Cui, Y. Makino, T. Kawano, K. Tsuchida, T. Koike, T. Shirai, H. Yagita, A. Matsuzawa, et al
1996
. Selective reduction of Vα14+ NK T cells associated with disease development in autoimmune-prone mice.
J. Immunol.
156
:
4035
25
Sumida, T., A. Sakamoto, H. Murata, Y. Makino, H. Takahashi, S. Yoshida, K. Nishioka, I. Iwamoto, M. Taniguchi.
1995
. Selective reduction of T cells bearing invariant Vα24JαQ antigen receptor in patients with systemic sclerosis.
J. Exp. Med.
182
:
1163
26
Hammond, K. J. L., L. D. Poulton, L. J. Palmisano, P. A. Silveira, D. I. Godfrey, A. G. Baxter.
1998
. α/β-T cell receptor (TCR)+ CD4CD8 (NKT) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic (NOD)/Lt mice by the influence of interleukin (IL)-4 and/or IL-10.
J. Exp. Med.
187
:
1047
27
Wilson, S. B., S. C. Kent, K. T. Patton, T. Orban, R. A. Jackson, M. Exley, S. Porcelli, D. A. Schatz, M. A. Atkinson, S. P. Balk, et al
1998
. Extreme Th1 bias of invariant Vα24JαQ T cells in type 1 diabetes.
Nature
391
:
177
28
Yoshimoto, T., W. E. Paul.
1994
. CD4pos, NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3.
J. Exp. Med.
179
:
1285
29
Launois, P., I. Maillard, S. Pingel, K. G. Swihart, I. Xenarios, H. Acha-Orbea, H. Diggelmann, R. M. Locksley, H. R. MacDonald, J. A. Louis.
1997
. IL-4 rapidly produced by Vβ4 Vα8 CD4+ T cells instructs Th2 development and susceptibility to Leishmaniamajor in BALB/c mice.
Immunity
6
:
541
30
Brown, D. R., D. J. Fowell, D. B. Corry, T. A. Wynn, N. H. Moskowitz, A. W. Cheever, R. M. Locksley, S. L. Reiner.
1996
. β2-microglobulin-dependent NK1.1+ T cells are not essential for T helper cell 2 immune responses.
J. Exp. Med.
184
:
1295
31
Zhang, Y., K. H. Rogers, D. B. Lewis.
1996
. β2-microglobulin-dependent T cells are dispensable for allergen-induced T helper 2 responses.
J. Exp. Med.
7184
:
1507
32
Zuany-Amorim, C., C. Ruffie, S. Haile, B. B. Vargaftig, P. Pereira, M. Pretolani.
1998
. Requirement for γδ T cells in allergic airway inflammation.
Science
280
:
1265
33
Pereira, P., D. Gerber, S. Y. Huang, S. Tonegawa.
1995
. Ontogenic development and tissue distribution of Vγ1 expressing γ/δ T lymphocytes in normal mice.
J. Exp. Med.
182
:
1921
34
Gueirard, P., P. Minoprio, N. Guiso.
1996
. Intranasal inoculation of Bordetella bronchiseptica in mice induces long lasting antibody and T-cell mediated immune responses.
Scand. J. Immunol.
43
:
181
35
Malissen, M., P. Pereira, D. J. Gerber, B. Malissen, J. P. DiSanto.
1997
. The common cytokine receptor γ chain controls survival of γ/δ T cells.
J. Exp. Med.
186
:
1277
36
Happ, M. P., R. T. Kubo, E. Palmer, W. K. Born, R. L. O’Brien.
1989
. Limited receptor repertoire in a mycobacteria-reactive subset of γδ T cells.
Nature
342
:
696
37
McConnell, T. J., W. M. Yokoyama, G. E. Kikuchi, G. P. Einhorn, G. Stingl, E. M. Shevach, J. E. Coligan.
1989
. δ-Chain of dendritic epidermal T cell receptors are diverse but pair with γ-chains in a restricted manner.
J. Immunol.
142
:
2924
38
Chien, Y. H., M. Iwashima, K. B. Kaplan, J. F. Elliott, M. M. David.
1987
. A new T-cell receptor gene located within the α locus and expressed early in T-cell differentiation.
Nature
327
:
677
39
Singer, P. A., R. J. McEvilly, R. S. Balderas, F. J. Dixon, A. N. Theofilopoulos.
1988
. T-cell receptor α-chain variable region haplotypes of normal and autoimmune laboratory mouse strains.
Proc. Natl. Acad. Sci. USA
85
:
7729
40
Klotz, J. L., R. K. Barth, G. L. Kiser, L. E. Hood, M. Kronenberg.
1989
. Restriction fragment length polymorphisms of the mouse T-cell receptor gene families.
Immunogenetics
29
:
191
41
Jouvin-Marche, E., M. G. Morgado, N. Trede, P. N. Marche, D. Couez, I. Hue, C. Gris, M. Malissen, P. A. Cazenave.
1989
. Complexity, polymorphism and recombination of mouse T-cell receptor α gene families.
Immunogenetics
30
:
99
42
Ohteki, T., T. Abo, S. Seki, T. Kobata, H. Yagita, K. Okumura, K. Kumagai.
1991
. Predominant appearance of γδ T lymphocytes in the liver of mice after birth.
Eur. J. Immunol.
21
:
1733