To test whether accumulation of naive lymphocytes is sufficient to trigger lymphoid development, we generated mice with islet expression of the chemokine TCA4/SLC. This chemokine is specific for naive lymphocytes and mature dendritic cells (DC) which express the CCR7 receptor. Islets initially developed accumulations of T cells with DC, with scattered B cells at the perimeter. These infiltrates consolidated into organized lymphoid tissue, with high endothelial venules and stromal reticulum. Infiltrate lymphocytes showed a naive CD44low CD25 CD69 phenotype, though half were CD62L negative. When backcrossed to RAG-1 knockout, DC were not recruited. Interestingly, islet lymphoid tissue developed in backcrosses to Ikaros knockout mice despite the absence of normal peripheral nodes. Our results indicate that TCA4/SLC can induce the development and organization of lymphoid tissue through diffential recruitment of T and B lymphocytes and secondary effects on stromal cell development.

In autoimmune diabetes in mice, islet infiltrates organize spontaneously into T cell/dendritic cell (DC)3-dependent compartments and B cell-dependent compartments (1, 2), supported by the development of high endothelial venule (HEV) expressing mucosal addressin cell adhesion molecule-1 (MAdCAM-1) and peripheral lymph node addressin (PNAd) and stromal reticular cells (3, 4). Since this development of new lymphoid tissue (“lymphoid neogenesis,” see Refs. 5, 6) is initiated at an unconventional site at a time well after normal lymph node development, it is clear that tissues retain the potential to support lymphoid tissue development given the appropriate stimulation. Understanding the mechanisms behind this lymphoid neogenesis should also provide important clues to normal lymphoid organ development.

The chemokine TCA4/SLC (7, 8, 9, 10, 11, 12) is expressed predominantly in lymph node HEV, but it is also expressed by cells in the T cell-dependent regions of lymphoid tissue (7). In the thymus, it is expressed by cells in the medulla, including blood vessels and medullary epithelium, and may contribute to tissue organization. For example, in the thymus, thymocytes and DC acquire expression of the TCA4/SLC receptor CCR7 during development (13, 14); therefore, medullary expression of TCA4/SLC may induce migration of mature cells toward the medulla. Similarly, expression of TCA4/SLC by HEV may help organize the T cell/DC compartment around HEV, whereas an opposing gradient of the chemokine B-lymphocyte chemoattractant (BLC) produced by follicular DC draws B cells into the B cell follicles (15).

To assess the role of TCA4/SLC in lymphoid tissue development, we generated transgenic mice with islet β cell specific expression of TCA4/SLC. Interestingly, the recruitment of lymphocytes and DC to pancreatic islets appeared to be sufficient to trigger development of organized lymphoid tissue. Our results suggest that the spontaneous development and organization of lymphoid tissues, including stroma, can be triggered by the simple accumulation of lymphocytes in an Ag-independent manner and that the compartmentalization of T and B lymphocytes can be influenced directly by differential responses to the chemokine TCA4/SLC.

The Ins-TCA4 transgene construct was generated by using the 650-bp rat insulin II HindIII-XhoI promoter fragment containing a single intron in the 5′ untranslated region, attached to a 2.5-kb BstXI genomic clone of the mouse TCA4 gene isolated from a strain 129 genomic library (our unpublished data). Transgenic mice were generated by microinjection into (BALB/c × C57BL/6)F2 embryos and backcrossed to C57BL/6 mice. Two founders were generated, but only one contained one to two complete copies of the transgene. Expression of transgene mRNA was assayed using RT-PCR of mRNA from several tissues. Using a 5′ primer, specific for the insulin 5′ untranslated sequence upstream from the intron (CTAAGTGACCAGCTACAGTCG) and a 3′ primer, specific for the TCA4 mRNA (CTGGCTGTACTTAAGGCAGCA), PCR amplification of the transgene genomic DNA yielded a band of 375 bp, whereas the expressed mRNA/cDNA yielded a band of 250 bp. Mice were also backcrossed to RAG-1 (The Jackson Laboratory, Bar Harbor, ME) and Ikaros knockout mice (provided by K. Georgopoulos, Harvard Medical School, Charlestown, MA). All mice were housed in the vivarium at The Scripps Research Institute in accordance with institutional and National Institutes of Health guidelines.

Pancreas and lymph nodes (mesenteric, axillary, cervical, and inguinal) harvested from normal and transgenic mice (25 mg) were homogenized in 0.3 ml PBS containing 1 mM PMSF, 0.01 mg/ml leupeptin, and 0.01 mg/ml aprotinin. The extract was sonicated and centrifuged, and supernatants were removed for assay. TCA4 was detected by ELISA using immobilized mAb 4B1 for capture and biotinylated mAb 3D5 (both mAb developed by M. Dorf, see Ref. 7) followed by alkaline phosphatase-coupled avidin (Pierce, Rockford, IL) and 5 mM p-nitrophenyl phosphate (Sigma, St. Louis, MO) for detection. TCA4 concentrations were calculated from standard curves created by titrating recombinant TCA4 into similar tissues from TCA4-deficient plt/plt mice (16, 17).

For immunostaining of tissues, cryostat sections (6–10 μM) were fixed in ice-cold acetone and incubated with Abs listed below. For flow cytometry, fluorescent conjugates were used. In the case of lymphocytes isolated from islet infiltrates, pancreas was digested for 10–15 min at 37°C in collagenase/DNase I (Sigma), followed by manual picking of islets under a dissecting microscope. Cell suspensions were made for immediate staining, although in one experiment, a parallel set of cells was cultured at 37°C in RPMI 1640/10% FBS for 1 h before staining. Abs used was as follows: PE-conjugated anti-CD4, PE-conjugated anti-CD8, biotinylated anti-B220, biotinylated anti-MAdCAM-1, biotinylated anti-PNAd, biotinylated anti-CD11c, FITC-conjugated anti-CD44, biotinylated anti-CD62L, FITC-conjugated anti-CD25, and FITC-conjugated anti-CD69 (PharMingen, San Diego, CA), purified anti-F4/80, and anti-NLDC-145/DEC-205 (Serotec, Oxford, U.K.), anti-FDC-M1 (gift from Dr. M. Kosco-Vilbois, Glaxo Wellcome Geneva, Switzerland), and anti-ER-TR7 (Accurate Chemicals, Westbury NY). For histological studies, purified primary Abs were detected using biotinylated anti-Rat IgG and peroxidase-conjugated streptavidin (Jackson ImmunoResearch, West Grove, PA), using 3-amino-9-ethylcarbazole as a chromagen, and for FACS analysis, biotinylated Abs were detected using streptavidin-conjugated APC (PharMingen).

To assess the effects of localized expression of TCA4/SLC, we generated transgenic mice using the rat insulin II promoter and the structural gene for TCA4/SLC (Ins-TCA4). Expression of the transgene was specific to the pancreas by RT-PCR and was not detectable in lymph node, spleen, thymus, skin, kidney, and liver (data not shown). Nontransgenic pancreas analyzed by ELISA contained only 0.06 ± 0.07 ng/mg TCA4 (10 mice), whereas Ins-TCA4 pancreas contained 2.77 ± 0.65 ng/mg (8 mice), comparable to levels in normal lymph node (1.95 ± 0.3 ng/mg from nontransgenic axillary, cervical, and inguinal nodes (5 mice), 2.08 ± 0.39 ng/mg from transgenic nodes (8 mice)).

In young Ins-TCA4 transgenic mice (4–6 wk of age), pancreatic islets contained small focal mononuclear infiltrates near the centers of the islets containing CD4 (Fig. 1,A) and CD8 (data not shown) T cells, and CD11c+ F4/80 NLDC-145+ DC (Fig. 1,B). B cells were only found as scattered cells at the perimeter of the islets, not associated with T cell clusters (Fig. 1,C), suggesting that B cells respond differently to the chemokine. In older Ins-TCA4 animals (6 wk to 4 mo), larger islet infiltrates were evident, with two striking features: First, islet tissue appeared to be intact, but pushed to the margins of the infiltrates (Fig. 1, E–I). Accordingly, Ins-TCA4 mice did not develop hyperglycemia even after several months. Second, the infiltrates resembled normal lymphoid tissue: Lymph node stromal reticulum development was evident, as ER-TR7 staining (18) detected a network of cells throughout the lymphoid tissue (Fig. 1, D and E). MAdCAM-1 and PNAd were detectable on vascular endothelium, which showed morphology consistent with HEV (Fig. 1, F and G). T cell/DC clusters merged with the collections of B cells, forming a lymph node-like structure with B cell follicles at the perimeter of the tissue (Fig. 1, H and I). Within B cell follicles, weak staining for the follicular DC marker FDC-M1 (19) was detectable, although germinal center formation was absent (data not shown). Not all Ins-TCA4 islets developed organized lymphoid tissue, but nearly all islets contained at least some lymphocytes, and all transgenic animals showed at least some lymphoid tissues in islets. These islet lymphoid infiltrates were easily distinguished from normal lymph node by the presence of islet tissue and the absence of a connective tissue capsule.

FIGURE 1.

Formation of lymphoid tissue in Ins-TCA4 islets. A, Accumulation of T cells (CD4 shown) as clusters in islets (I). B, T cell clusters always included NLDC-145+ DC (NLDC-145 staining shown). Islet tissue (I) remains intact at the perimeter. C, B220 staining shows B cells at the islet perimeter, separate from T cell clusters (T). D, Normal islet, stained for ER-TR7. E, infiltrates induce lymphoid stromal reticulum, staining positive for ER-TR7. Islet tissue (I) is pushed to the perimeter. F and G, many islet blood vessels develop a morphology resembling HEV and express high levels of MAdCAM-1 (F) and PNAd (G). H and I, serial sections stained for CD4 (H) and B220 (I). As infiltrates grow, T cell and B cell compartments fuse to resemble normal lymph node, except for the presence of islet tissue (I). Original magnification: A, ×400; B, C, E, and F, ×200, D, ×400; and G and H, ×100).

FIGURE 1.

Formation of lymphoid tissue in Ins-TCA4 islets. A, Accumulation of T cells (CD4 shown) as clusters in islets (I). B, T cell clusters always included NLDC-145+ DC (NLDC-145 staining shown). Islet tissue (I) remains intact at the perimeter. C, B220 staining shows B cells at the islet perimeter, separate from T cell clusters (T). D, Normal islet, stained for ER-TR7. E, infiltrates induce lymphoid stromal reticulum, staining positive for ER-TR7. Islet tissue (I) is pushed to the perimeter. F and G, many islet blood vessels develop a morphology resembling HEV and express high levels of MAdCAM-1 (F) and PNAd (G). H and I, serial sections stained for CD4 (H) and B220 (I). As infiltrates grow, T cell and B cell compartments fuse to resemble normal lymph node, except for the presence of islet tissue (I). Original magnification: A, ×400; B, C, E, and F, ×200, D, ×400; and G and H, ×100).

Close modal

In studies on a transgenic model expressing lymphotoxin α in islets (RIP-LT), lymphoid neogenesis was also observed, but nearly all lymphocytes showed an activated CD44 high phenotype (6, 20). Indeed, in both the RIP-LT mice and in spontaneous autoimmune diabetes, lymphocyte activation is present, either as a nonspecific response to an inflammatory cytokine or as a specific response to islet Ag. Thus, from those results it could not be established whether lymphocyte activation is a prerequisite for lymphoid neogenesis. By contrast, lymphocytes isolated from Ins-TCA4 islets were similar to normal lymph node in the proportions of CD4/CD8 T cells and B cells and their expression of activation markers. Flow cytometry analysis showed that islet lymphocytes appeared to be predominantly naive cells, similar to peripheral nodes from the same mice. That is, lymphocytes were mostly small lymphocytes by forward light scatter (data not shown), CD44low (Fig. 2 A) and negative for CD25 and CD69 (data not shown).

FIGURE 2.

FACS analysis of lymphocytes from Ins-TCA4 infiltrates. A, Peripheral lymph node, islet infiltrates, and spleen cells were stained for CD4, CD8, and activation/memory markers. Cells were gated for CD4 or CD8 expression and shown as a histogram for CD44 or CD62L expression. The proportion of cells with an activated/memory phenotype (CD44high, CD62Llow) is listed in the corner of each histogram. Lymph nodes have few CD4 and CD8 T cells that are CD44high and CD62Llow, whereas spleen has more cells with these phenotypes. Curiously, among Ins-TCA4 islet CD4 and CD8 T cells, only a few are CD44high, but a high proportion are CD62Llow. B, Three-color analysis of CD4 T cells shows that although CD44high cells tend to be found among the CD62Llow population, levels of CD44 are broadly distributed among both CD62L populations in lymph node, spleen, and islet infiltrates.

FIGURE 2.

FACS analysis of lymphocytes from Ins-TCA4 infiltrates. A, Peripheral lymph node, islet infiltrates, and spleen cells were stained for CD4, CD8, and activation/memory markers. Cells were gated for CD4 or CD8 expression and shown as a histogram for CD44 or CD62L expression. The proportion of cells with an activated/memory phenotype (CD44high, CD62Llow) is listed in the corner of each histogram. Lymph nodes have few CD4 and CD8 T cells that are CD44high and CD62Llow, whereas spleen has more cells with these phenotypes. Curiously, among Ins-TCA4 islet CD4 and CD8 T cells, only a few are CD44high, but a high proportion are CD62Llow. B, Three-color analysis of CD4 T cells shows that although CD44high cells tend to be found among the CD62Llow population, levels of CD44 are broadly distributed among both CD62L populations in lymph node, spleen, and islet infiltrates.

Close modal

Curiously, islet T cells showed a high proportion of CD62Llow cells (Fig. 2,A). It was formally possible that the isolation procedure for islets caused shedding of CD62L from lymphocytes; therefore, we also cultured the lymphocytes for 1 h to allow for re-expression of CD62L. The proportion of CD62Llow cells was unchanged by this procedure (data not shown), and the fluorescence intensity of the CD62L-positive peak cells remained similar to that in normal peripheral nodes. Three-color analysis (Fig. 2 B, showing data on CD4 cells) showed that although CD44high cells were largely found among the CD62Llow population, the range of CD44 expression was broad among both CD62Lhigh and CD62Llow populations in lymph node, spleen, and islet infiltrates. Thus, the islet-infiltrating lymphocytes were not remarkable in any way apart from the increased proportion of CD62Llow cells. This unusual phenotype might be a direct consequence of high local expression of TCA4/SLC, including the possible increased recruitment of CD62Llow cells from lymphatics. Alternatively, the MAdCAM-1+ HEV in the islets may selectively recruit a CD62Llow population or induce shedding of CD62L during transit across the HEV.

Considering the ability of the transgene TCA4/SLC to drive new lymphoid tissue growth, it was possible that the chemokine may also expand the total lymphocyte pool. To test this, we counted lymph node and spleen cells from Ins-TCA4 mice and littermate controls (Table I). There was no clear effect on the total numbers of lymphocytes in these tissues; however, since these counts do not include the islet infiltrates, there may be a significant overall increase in the total number of lymphocytes over time due to the increase in the total lymphoid tissue.

Table I.

Peripheral lymphoid organ cell countsa

Cell Counts, ×10−7CD4 T CellsCD8 T CellsB Cells
Tg negativeIns-TCA4Tg negativeIns-TCA4Tg negativeIns-TCA4
Spleen 2.3 ± 0.45 1.9 ± 0.21 1.2 ± 0.31 1.1 ± 0.0 10.0 ± 2.4 10.4 ± 0.62 
Lymph node 2.1 ± 0.50 1.7 ± 0.12 1.1 ± 0.25 1.2 ± 0.06 2.1 ± 0.10 2.2 ± 0.31 
Total 4.5 ± 0.95 3.5 ± 0.32 2.3 ± 0.56 2.3 ± 0.06 12.1 ± 2.3 12.6 ± 0.80 
Cell Counts, ×10−7CD4 T CellsCD8 T CellsB Cells
Tg negativeIns-TCA4Tg negativeIns-TCA4Tg negativeIns-TCA4
Spleen 2.3 ± 0.45 1.9 ± 0.21 1.2 ± 0.31 1.1 ± 0.0 10.0 ± 2.4 10.4 ± 0.62 
Lymph node 2.1 ± 0.50 1.7 ± 0.12 1.1 ± 0.25 1.2 ± 0.06 2.1 ± 0.10 2.2 ± 0.31 
Total 4.5 ± 0.95 3.5 ± 0.32 2.3 ± 0.56 2.3 ± 0.06 12.1 ± 2.3 12.6 ± 0.80 
a

Lymph nodes (cervical, axillary, inguinal, and mesenteric) and spleen were stained for CD4, CD8, and B220; total cell counts were multiplied by percentage of cells staining positive for each lymphocyte marker (three mice per group, age-matched littermates).

b

Tg, transgene.

It is possible that lymphoid tissue development in the fetus uses distinct mechanisms from those involved in lymphoid neogenesis in the adult. In this context, we began an analysis of Ins-TCA4 mice backcrossed to RAG-1 and Ikaros knockouts (Fig. 3). In the case of RAG-1 knockout mice, normal lymph node stroma developed in the fetus despite the absence of lymphocytes, possibly due to a CD3CD4+LTβ+ cell-driving stromal development (21, 22). In contrast, mice deficient in the transcription factor Ikaros fail to develop any peripheral lymph node tissue (23, 24). T lymphocyte development is delayed in these mice, but it is not clear whether this is responsible for the lymph node defect. Thus, backcrossing the Ins-TCA4 transgene to these knockouts may help distinguish between different mechanisms of lymphoid tissue development.

FIGURE 3.

Histology of Ins-TCA4/RAG-1 knockout (A) and Ins-TCA4/Ikaros knockout (B–E) islets. A, Islets of Ins-TCA4/RAG-1 knockouts only contain a few NLDC-145+ DC (arrow). B, Ins-TCA4/Ikaros knockout islets accumulate CD4 and CD8 T cells and NLDC-145+ DC, but B220+ cells are not detectable (CD4 staining shown). C, An ER-TR7+ stromal network develops, but islet tissue is drawn out into “rivers” (arrows). MAdCAM-1 (D) and PNAd (E) are expressed in large structures resembling HEV. Original magnification: A–E, ×200).

FIGURE 3.

Histology of Ins-TCA4/RAG-1 knockout (A) and Ins-TCA4/Ikaros knockout (B–E) islets. A, Islets of Ins-TCA4/RAG-1 knockouts only contain a few NLDC-145+ DC (arrow). B, Ins-TCA4/Ikaros knockout islets accumulate CD4 and CD8 T cells and NLDC-145+ DC, but B220+ cells are not detectable (CD4 staining shown). C, An ER-TR7+ stromal network develops, but islet tissue is drawn out into “rivers” (arrows). MAdCAM-1 (D) and PNAd (E) are expressed in large structures resembling HEV. Original magnification: A–E, ×200).

Close modal

Ins-TCA4 transgenic mice backcrossed to RAG-1 knockout did not develop lymphoid tissue or MAdCAM-1+ PNAd+ HEV in islets. Surprisingly, mature DC were also not recruited (Fig. 3 A), despite the fact that DC subsets are present in normal proportions in RAG-1 knockout spleen (25). It is possible that DC in RAG-1 knockouts do not express the CCR7 receptor or their persistence or development in islets may depend on T cells (26).

In Ikaros knockout mice, T cells but not B cells are generated late in mouse development due to late compensatory expression of the related gene Aiolos (24). In these studies, we used Ikaros “null” mice with a complete deficiency in Ikaros expression (23); as described for the Ikaros dominant negative mutant, these mice also fail to generate lymph nodes (data not shown). In mice with the Ins-TCA4 transgene on the Ikaros knockout background, lymphoid tissues still developed in islets: they contained CD4 (Fig. 3,B) and CD8 T cells and NLDC-145+ DC (data not shown), with development of ER-TR7+ stromal reticulum (Fig. 3,C), and MAdCAM-1+ PNAd+ HEV (Fig. 3, D and E). Thus, although normal peripheral lymph nodes were not produced, recruitment of T cells (without B cells) to Ins-TCA4 islets was sufficient to trigger new lymphoid tissue development.

It has not yet been established whether Ikaros expression is required in lymphoid stroma. However, it is possible that while the absence of early Ikaros expression blocked normal lymph node development, inducible expression of Aiolos (or related molecule) in stromal cells may allow for the induction of lymphoid neogenesis in adult tissues. Assuming Ikaros null T cells are capable of expressing LT ligands, these may be sufficient to trigger this alternative mechanism of stromal cell development.

In summary, the expression of a TCA4/SLC transgene was sufficient to drive lymphoid neogenesis under conditions where the majority of recruited cells showed a naive phenotype. Induction of lymphoid stromal cell development (HEV, stromal reticular cells) occurs late and continues through adult life, probably through lymphotoxin-mediated signals (27). It will be of great interest to identify the specific signals involved, since studies on the role of LTα and LTβ in normal lymph node development had previously suggested that lymphoid tissue could only develop within an early developmental window in fetal life (28). Finally, the differential recruitment of B cells relative to T cells and DC suggests that the action of TCA4/SLC has a primary role in the segregation of lymphoid compartments. Maintenance of the lymphoid compartment segregation may then depend on subsequent B cell-mediated induction of follicular DC producing the B cell chemokine BLC (29, 30).

We acknowledge the excellent assistance of the Scripps Transgenic Mouse Facility, and we thank Dr. Monica Carson for helpful suggestions and discussions. We also thank Dr. Marie Kosco-Vilbois for providing the anti-FDC-M1 Ab and Dr. Katia Georgopoulos for providing the Ikaros knockout mice. This is manuscript number 12837-IMM from The Scripps Research Institute.

1

This work was supported by National Institutes of Health Grants RO1-CA67416 (to M.E.D.) and RO1-AI38375 (to D.L.), a Juvenile Diabetes Foundation International grant (to D.L.), and a Human Frontier Science Program grant (to D.L.).

3

Abbreviations used in this paper: DC, dendritic cell; HEV, high endothelial venule; MAdCAM-1, mucosal addressin cell adhesion molecule-1; PNAd, peripheral lymph node addressin.

1
Lo, D., L. Feng, L. Li, M. J. Carson, M. Crowley, M. Pauza, A. Nguyen, C. Reilly.
1999
. Integrating innate and adaptive immunity in the whole animal.
Immunol. Rev.
169
:
225
2
Lo, D., C. R. Reilly, B. Scott, R. Liblau, H. O. McDevitt, L. C. Burkly.
1993
. Antigen presenting cells in adoptively transferred and spontaneous diabetes.
Eur. J. Immunol.
23
:
1693
3
Yang, X. D, H. K. Sytwu, H. O. McDevitt, S. A. Michie.
1997
. Involvement of β7 integrin and mucosal addressin cell adhesion molecule-1 (MAdCAM-1) in the development of diabetes in nonobese diabetic mice.
Diabetes
46
:
1542
4
Hanninen, A., C. Taylor, P. R. Streeter, L. S. Stark, J. M. Sarte, J. A. Shizuru, O. Simell, S. A. Michie.
1993
. Vascular addressins are induced on islet vessels during insulitis in nonobese diabetic mice and are involved in lymphoid cell binding to islet endothelium.
J. Clin. Invest.
92
:
2509
5
Ruddle, N. H..
1999
. Lymphoid neo-organogenesis: lymphotoxin’s role in inflammation and development.
Immunol. Res.
19
:
119
6
Kratz, A., A. Campos-Neto, M. S. Hanson, N. H. Ruddle.
1996
. Chronic inflammation caused by lymphotoxin is lymphoid neogenesis.
J. Exp. Med.
183
:
1461
7
Tanabe, S., Z. Lu, Y. Luo, E. J. Quackenbush, M. A. Berman, L. A. Collins-Racie, S. Mi, C. Reilly, D. Lo, K. A. Jacobs, M. E. Dorf.
1997
. Identification of a new mouse β-chemokine, TCA4, with activity on T lymphocytes and mesangial cells.
J. Immunol.
159
:
5671
8
Gunn, M. D., K. Tangemann, C. Tam, J. G. Cyster, S. D. Rosen, L. T. Williams.
1998
. A chemokine expressed in lymphoid high endothelial venules promotes the adhesion and chemotaxis of naive T lymphocytes.
Proc. Natl. Acad. Sci. USA
95
:
258
9
Hedrick, J. A., A. Zlotnik.
1997
. Identification and characterization of a novel β chemokine containing six conserved cysteines.
J. Immunol.
159
:
1589
10
Nagira, M., T. Imai, K. Hieshima, J. Kusuda, M. Ridanpaa, S. Takagi, M. Nishimura, M. Kakizaki, H. Nomiyama, O. Yoshie.
1997
. Molecular cloning of a novel human CC chemokine secondary lymphoid-tissue chemokine that is a potent chemoattractant for lymphocytes and mapped to chromosome 9p13.
J. Biol. Chem.
272
:
19518
11
Hromas, R., C. H. Kim, M. Klemsz, M. Krathwohl, K. Fife, S. Cooper, C. Schnizlein-Bick, H. E. Broxmeyer.
1997
. Isolation and characterization of Exodus-2, a novel C-C chemokine with a unique 37-amino acid carboxyl-terminal extension.
J. Immunol.
159
:
2554
12
Campbell, J. J., E. P. Bowman, K. Murphy, K. R. Youngman, M. A. Siani, D. A. Thompson, L. Wu, A. Zlotnick, E. C. Butcher.
1998
. 6-C-kine (SLC), a lymphocyte adhesion-triggering chemokine expressed by high endothelium, is an agonist for the MIP-3β receptor CCR7.
J. Cell Biol.
141
:
1053
13
Suzuki, G., H. Sawa, Y. Kobayashi, Y. Nakata, K. Nakagawa, A. Uzawa, H. Sakiyama, S. Kakinuma, K. Iwabuchi, K. Nagashima.
1999
. Pertussis toxin-sensitive signal controls the trafficking of thymocytes across the corticomedullary junction in the thymus.
J. Immunol.
162
:
5981
14
Kellermann, S., S. Hudak, E. R. Oldham, Y. Liu, L. M. McEvoy.
1999
. The CC chemokine receptor-7 ligands 6Ckine and macrophage inflammatory protein-3b are potent chemoattractants for in vitro- and in vivo-derived dendritic cells.
J. Immunol.
162
:
3859
15
Gunn, M. D., V. N. Ngo, K. M. Ansel, E. H. Ekland, J. G. Cyster, L. T. Williams.
1998
. A B-cell-homing chemokine made in lymphoid follicles activates Burkitt’s lymphoma receptor-1.
Nature
391
:
799
16
Nakano, H., T. Tamura, T. Yoshimoto, H. Yagita, M. Miasa, E. C. Butcher, H. Nariuchi, T. Kakiuchi, A. Matsuzawa.
1997
. Genetic defect in T lymphocyte-specific homing into peripheral lymph nodes.
Eur. J. Immunol.
27
:
215
17
Gunn, M. D., S. Kyuwa, C. Tam, T. Kakiuchi, A. Matsuzawa, L. T. Williams, H. Nakano.
1999
. Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization.
J. Exp. Med.
189
:
451
18
Van Vliet, E., M. Melis, J. M. Foidart, W. Van Ewijk.
1986
. Reticular fibroblasts in peripheral lymphoid organs identified by a monoclonal antibody.
J. Histochem. Cytochem.
34
:
883
19
Kosco-Vilbois, M. H., J. Y. Bonnefoy, Y. Chvatchko.
1997
. The physiology3 of murine germinal center reactions.
Immunol. Rev.
156
:
127
20
Sacca, R., C. A. Cuff, W. Lesslauer, N. H. Ruddle.
1998
. Differential activities of secreted lymphotoxin-α3 and membrane lymphotoxin-α1β2 in lymphotoxin-induced inflammation: critical role of TNF receptor 1 signaling.
J. Immunol.
160
:
485
21
Mebius, R. E., P. Rennert, I. L. Weissman.
1997
. Developing lymph nodes collect CD4+CD3LTβ+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells.
Immunity
7
:
493
22
Mebius, R. E., I. L. Schadee-Eestermans, I. L. Weissman.
1998
. MAdCAM-1 dependent colonization of developing lymph nodes involves a unique subset of CD4+ CD3 hematolymphoid cells.
Cell Adhes. Commun.
6
:
97
23
Wang, J., A. Nichogiannopooulou, L. Wu, L. Sun, A. H. Sharpe, M. Bigby, K. Georgopoulos.
1996
. Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation.
Immunity
5
:
537
24
Georgopoulos, K., S. Winandy, N. Avitahl.
1997
. The role of the Ikaros gene in lymphocyte development and homeostasis.
Annu. Rev. Immunol.
15
:
155
25
Crowley, M. T., C. R. Reilly, D. Lo.
1999
. Influence of lymphocytes on the presence and organization of dendritic cell subsets in the spleen.
J. Immunol.
163
:
4894
26
Shreedhar, V., A. M. Moodycliffe, S. E. Ullrich, C. Bucana, M. L. Kripke, I. Flores-Romo.
1999
. Dendritic cells require T cells for functional maturation in vivo.
Immunity
11
:
625
27
Rennert, P. D., D. James, F. Mackay, J. L. Browning, P. S. Hochman.
1998
. Lymph node genesis is induced by signaling through the lymphotoxin β receptor.
Immunity
9
:
71
28
Rennert, P. D., J. L. Browning, R. Mebius, F. Mackay, P. S. Hochman.
1996
. Surface lymphotoxin α/β complex is required for the development of peripheral lymphoid organs.
J. Exp. Med.
184
:
1999
29
Endres, R., M. B. Alimzhanov, T. Plitz, A. Futterer, M. H. Kosco-Vilbois, S. A. Nedospasov, K. Rajewsky, K. Pfeffer.
1999
. Mature follicular dendritic cell networks depend on expression of lymphotoxin β receptor by radioresistant stromal cells and of lymphotoxin beta and tumor necrosis factor by B cells.
J. Exp. Med.
189
:
159
30
Ngo, V. N., H. Korner, M. D. Gunn, K. N. Schmidt, D. S. Riminton, M. D. Cooper, J. L. Browning, J. D. Sedgwick, J. G. Cyster.
1999
. Lymphotoxin α/β and tumor necrosis factor are required for stromal cell expression of homing chemokines in B and T cell areas of the spleen.
J. Exp. Med.
189
:
403