T560, a mouse B lymphoma that originated in gut-associated lymphoid tissue, expresses receptors that bind dimeric IgA and IgM in a mutually inhibitory manner but have little affinity for monomeric IgA. Evidence presented in this paper indicates that the receptor is poly-Ig receptor (pIgR) known in humans and domestic cattle to bind both IgA and IgM. The evidence includes the demonstration that binding of IgM is J chain dependent, and that pIg-precipitated receptor has an appropriate Mr of 116–120 kDa and can be detected on immunoblots with specific rabbit anti-mouse pIgR. Overlapping RT-PCR performed using template mRNA from T560 cells and oligonucleotide primer pairs designed from the published sequence of mouse liver pIgR indicate that T560 cells express mRNA virtually identical with that of the epithelial cell pIgR throughout its external, transmembrane, and intracytoplasmic coding regions. Studies using mutant IgAs suggest that the Cα2 domain of dimeric IgA is not involved in high-affinity binding to the T560 pIgR. Inasmuch as this mouse B cell pIgR binds IgM better than IgA, it is similar to human pIgR and differs from rat, mouse, and rabbit epithelial cell pIgRs that bind IgA but not IgM. Possible explanations for this difference are discussed. All clones of T560 contain some cells that spontaneously secrete both IgG2a and IgA, but all of the IgA recoverable from the medium and from cell lysates is monomeric; it cannot be converted to secretory IgA by T560 cells.

Ig Fc receptors are of interest because of their ability to transduce signals between bound, cross-linked Igs and the cell interior, leading either to activation or down-regulation of cellular function (1). Because the predominant Ig in the gut-associated lymphoid tissue (GALT)3 is IgA, it is likely that specific receptors for IgA (FcαR) may participate in the regulation of GALT B cell behavior, but this is difficult to study because few lymphocytes express them (2, 3, 4, 5, 6, 7, 8). Several years ago we discovered a GALT-derived murine B lymphoma, T560, that expressed an IgA receptor (9). Thinking that it might regulate GALT B cell behavior, we studied its properties only to find that it differed from the classical FcαR in that its binding of IgA immune complex (IC) was inhibitable not only by IgA but also by IgM, implying that it was, in reality, an IgA/IgM receptor. IgA/IgM receptors were already well known as poly-Ig receptors (pIgR), responsible for transporting both dimeric and polymeric IgA (pIgA) and IgM (collectively referred to as pIgs) through secretory epithelial cells into secretions (10, 11, 12, 13). pIgR are not thought to be importantly expressed on lymphoid cells, but they have been detected on a T cell hybridoma that also expresses FcαR (14), and the ability of Abs to secretory component (SC), the portion of pIgR bound to IgA in secretory IgA (S-IgA), to block binding of IgA to FcαR on GALT lymphoid cells of mice has been attributed to cross-reactivity between the FcαR and the pIgR (15).

In this paper, we show that the T560 IgA/IgM receptor is pIgR based on the following evidence: its binding of IgM is inhibited by pIgA but not by S-IgA and is J chain dependent as is binding of pIg by human (16, 17) and mouse (18) pIgRs; it binds IgM through a different structure from the distinct IgM receptor (FcμR) of mouse T cells (19); it is precipitable with either IgA or IgM; its Mr (116 kDa) is consistent with its being pIgR; and it is recognized by Abs to mouse pIgR on immunoblots. Furthermore, complete mRNA for pIgR is contained in T560 cells. Studies of the binding properties of mutant mouse IgAs also presented in this paper indicate that the Cα2 domain probably does not mediate interaction between dimeric IgA and the mouse pIgR. Because a small proportion of T560 cells coexpress IgA with IgG2a (20, 21) and the cell supernatant contains low concentrations of IgA, we considered the possibility that binding and uptake of autochthonous IgA might enable T560 to produce S-IgA. However, all of the IgA in both lysates and secretions of T560 cells proved to be monomeric; none of it had a high molecular mass consistent with that of S-IgA. T560 evidently does not convert endogenous IgA into S-IgA.

The T560.2.F7 and CH12.LX B lymphoma and the J774 macrophage cell lines were maintained as previously described (9, 22).

All goat Abs and Ab conjugates were obtained from Southern Biotechnology Associates (Birmingham, AL). Rat mAbs to the following four mouse Cμ domains, R33-24, rat IgG2a anti-Cμ1; b7/6, rat IgG1 anti-Cμ2; IM41, rat IgG1 anti-Cμ3; and C2-23, rat IgG2a anti-Cμ4 (19), were kindly provided by Dr. Richard Lynch (Department of Pathology, University of Iowa College of Medicine, Iowa City, IA). Rabbit anti-recombinant mouse pIgR reactive with denatured pIgR and SC in Western blots has been described previously (23). The mouse anti-rat κ-chain mAb RG7.9.1 (24) was purified from culture supernatants on protein A beads.

Binding of IgA and IgM for detection by flow cytometry was done as described in Ref.9 except that binding was at room temperature rather than 37°C. Various concentrations of IgA, IgM, or IgA-2,4,6 trinitrophenyl (TNP)-BSA IC (see below) or, for inhibition assays, mixtures of IgA IC and IgM, IgM and IgA, or IgM and anti-IgM mAb were used. Maximal binding of IgA or IgM was observed on T560 cells passed 24 h previously at 2 × 105 cells/ml, incubated at 37°C for 2 h in fresh medium, then washed three times with Dulbecco’s PBS (DPBS) at room temperature followed by buffer appropriate to the assay. Binding of mouse IgM was detected with FITC-goat anti-mouse μ-chain or, when only MOPC-104E IgM was used, with FITC-goat anti-mouse λ light chain; that of rat IgM was detected with FITC-goat anti-rat IgM, that of mouse IgA was detected with FITC-goat anti-mouse α-chain, and that of human IgA was detected with FITC-goat anti-human α-chain.

For inhibition studies, the percentage of inhibition was determined from the mean fluorescence (MF) in the various samples using the following formula: % inhibition = 100 (1 − (MF in inhibited sample − MF in low control)/(MF in unihibited sample − MF in low control)).

Human IgA.

Polymeric myeloma IgAλ (IgA polymer 1) and monomeric myeloma IgAλ from a single individual (Steele) were purified in the laboratory of one of us (B.J.U.). Polymeric myeloma IgAκ (IgA polymer 2) and dimeric myeloma IgAκ from two different individuals, McElhancy and Latimer, respectively, as well as normal human S-IgA, were kindly given to us by Dr. J. Mestecky (University of Alabama, Birmingham, AL).

Mouse IgA.

BALB/c mouse myeloma IgAs, TEPC-15 (T15; IgAκ) and MOPC-315 (M315; IgAλ) were prepared as previously described (9, 21) or purchased from Sigma-Aldrich. Mutant M315 IgA myeloma proteins were prepared by cassette mutagenesis, changing Cys301 to Ala, Tyr302 to Phe, and Cys311 to Ala, and substituting the flexible human IgA1 hinge or the very short human IgA2 hinge for the mouse hinge region. Briefly, the pSV2-VH 315 plasmid was constructed by inserting an XbaI-NaeI fragment of a cloned VH 315 segment together with an enhancer-containing Nae-EcoRI fragment of a JH3-JH4 probe into the XbaI and EcoRI sites of the multiple cloning site in pSV2NeoM (25). The wild-type (wt) pSV2-VH-Cα plasmid was created by inserting a 1.5-kb XhoI-SalI fragment containing the BALB/c germline Cα gene derived from the Cα30 phage clone (26) into the corresponding site of psV2-VH 315. pUC-Cα30 was made by excising the 1.5 kb XhoI-SalI wt Cα30 DNA fragment from pSV2-VH-Cα and cloning it into a modified pUC18 with no EcoRI and one XhoI site. IgA mutant constructs were generated from pUC-Cα30. The region encompassing residues 297–314 of wt Cα30 is flanked by EcoRI and EcoR47III restriction sites, which facilitated insertion of synthetic oligonucleotides containing the desired mutations. The mutants were sequenced to ensure a correct reading frame, and the mutant Cα was excised from pUC with XhoI-SalI and inserted into the pSV2-VH 315 plasmid. The wt and mutant IgA constructs were electroporated into cells of the light-chain-expressing recipient myeloma line M315.26. Mutant and wt IgAs in the supernatants of the transfected cells were used to coat TNP-ox RBC (TNP-ORBC) for rosette assays (9). ELISA and agglutination titers were used to adjust the IgA concentrations to approximate those in our standard preparation of M315 IgA myeloma protein.

Mouse IgM.

MOPC-104E (IgMλ) and TEPC-183 (IgMκ) were obtained from Sigma-Aldrich. TNP-specific normal and mutant IgMs were prepared from the supernatants of transfected cell lines expressing a TNP-specific κ-chain together with a normal or mutant TNP-specific μ-chain as previously described (27, 28, 29). SP-6 IgM has a wt μ-chain and consists mainly of polymers with J chain; J/IgM-S414 and J+/IgM-S414 both have μ-chains with Ser substituted for Cys414, but J/IgM-S414 consists mostly of monomers with some pentamers and tetramers lacking J chain, whereas J+/IgM-S414 (28) consists of polymers with J chain. J/IgM-S575 has μ-chains with Ser substituted for Cys575 and consists mainly of monomers with some polymers lacking J chain. These IgMs were isolated from the supernatants by binding to DNP-Sepharose followed by elution with 8 mM DNP-glycine. The eluates were dialyzed against PBS to remove the hapten and concentrated by ultrafiltration. A total of 200 μl of the concentrated SP-6, J/IgM-S414, and J/IgM-S575 protein solutions were ultracentrifuged on sucrose density gradients, essentially as described (27). Fractions (0.5 ml) collected from the top down were serially diluted and examined by ELISA, and the concentrations of IgM were plotted (Fig. 1). Pools of “monomer” (fractions 4–8) and “polymer” (fractions 12–20) were concentrated by ultrafiltration and dialyzed against DPBS to remove sucrose, and their IgM concentrations were determined in ELISA. Insufficient SP-6 monomer was obtained for experiments so only the polymer was used. The J+/IgM-S414 was concentrated but not subjected to sucrose gradient fractionation. Mouse IgM was also isolated from supernatants of WEHI-231, which lacks J chain and makes mainly hexameric IgM, and from two WEHI lines that were transfected with the J chain gene as previously described (30). Of these two cell lines, one, 3-H1, remains J chain negative; the other, 3-C10, is J chain positive. The IgMs were isolated by binding to Con A beads in the presence of 1 mM CaCl2, MgCl2, and MnCl2, and, after washing the beads, eluting the IgM with 0.2 M methyl-α-d-mannopyranoside (Sigma-Aldrich). The eluates were concentrated by ultrafiltration, dialyzed against DPBS, and the IgM concentrations were determined by ELISA (see below) and adjusted to working concentrations by dilution in DPBS.

FIGURE 1.

Sucrose gradient separation of mutant IgMs J/IgM S414, J/IgM-S575, and wt SP-6 IgM. IgM fractions 4–8 and 12–20 were pooled as “monomer” and “polymer,” respectively.

FIGURE 1.

Sucrose gradient separation of mutant IgMs J/IgM S414, J/IgM-S575, and wt SP-6 IgM. IgM fractions 4–8 and 12–20 were pooled as “monomer” and “polymer,” respectively.

Close modal

Mouse IgG2aκ (UPC-10), IgG2bκ (MOPC-141; Sigma-Aldrich), and rat IgM (Rockland, Gilbertsville, PA) were taken to have the concentrations specified by the manufacturer. Normal Sprague Dawley rat-IgG was prepared by binding to and elution from protein G beads (Pierce, Rockford, IL). Its concentration was determined from its OD280.

Mouse whey was kindly given to us by Dr. Michael Lamm (Department of Pathology, Case Western Reserve University, Cleveland, OH).

T560.2.F7 cells were incubated at 37°C with 50 μ/ml PI-PLC from Bacillus cereus (Boehringer Mannheim, Indianapolis, IN) and from Bacillus thuringiensis (ICN Pharmaceuticals, Costa Mesa, CA) in medium or in medium alone for 45 min in the presence or absence of 0.2 ng/ml calphostin C (Calbiochem-Novabiochem, La Jolla, CA), washed three times in medium containing FCS, and resuspended in DPBS for rosette assay as previously described (9).

ELISA were performed as described in Ref. 21 using plates sensitized with goat anti-mouse μ-chain or anti-mouse or -human α-chain in PBS (pH 7.0). The concentrations of the various mouse IgM and IgA and human pIgA preparations were determined by interpolation on standard curves. Because polymeric IgM and IgA titrate in ELISAs with different slopes from their monomeric counterparts, both the samples and the standards, MOPC-104E for mouse IgM, M315 for mouse IgA (both from Sigma-Aldrich), were reduced to monomers and alkylated before titration. Briefly, 0.1-ml volumes of IgM or IgA in PBS containing 1 mg/ml BSA were mixed with 0.3 ml 0.1 M Tris-HCl buffer (pH 8.6). DTT (0.1 ml, 0.03 M in the same buffer) was added, and the mixtures were incubated for 1 h at 37°C. After reduction, iodoacetamide (0.1 ml, 0.07 M in buffer) was added, and the mixtures were incubated for 20 min at 37°C. Sodium acetate buffer (0.4 ml, 0.1 M) was then added to bring the pH to ∼7.0 and the volume to 1.0 ml. Serial dilutions of the standards and samples were applied to the sensitized ELISA wells. The human pIgAs had titration curves similar to that of the standard (human colostral IgA from Sigma-Aldrich) and so were not reduced, but the monomeric human IgA preparation had a titration curve of very different slope so its concentration was calculated simply from its OD. The concentration of rat IgM (Rockland) was taken as that specified by the manufacturer.

To check that the ability of the rat anti-mouse Cμ domain mAbs to bind to mouse IgM was intact, ELISA wells coated with 10 μg/ml of MOPC-104E IgM were blocked with BSA, and serial dilutions of the mAbs or of normal rat IgG were added to the wells and incubated. After washing, rat IgG bound to the wells was detected with HRP-goat anti-rat IgG Ab. All of the mAbs bound strongly to the IgM-coated wells and binding was not diminished at all by serial dilution down to 1.5 μg/ml. At this concentration, binding of normal rat IgG was at background levels.

To assay the ability of IgM to inhibit binding of mouse IgA to the IgA/IgM receptor by flow cytometry, the IgA signal was increased by using IgA IC formed in Ab excess. Dilutions of TNP-BSA (27 TNP groups/mol) were incubated with M315 IgA myeloma protein, and the mixtures were examined by ELISA to establish an amount of TNP-BSA that would barely inhibit binding of 10 μg/ml M315 IgA to plates precoated with TNP-BSA. Half of this concentration was then used together with 10 times the concentration of M315 IgA to prepare IgA IC in such vast Ab excess that no TNP groups could possibly be available to mediate binding of IC to the surface Ig of T560 cells. In practice, equal volumes of BSA-DPBS containing 12.8 μg TNP-BSA/ml and 100 μg M315 IgA/ml were mixed and incubated for 1 h at room temperature. The IC was then diluted 1:2 with diluent or the IgM inhibitor, yielding a final concentration of 25 μg/ml IgA in the mixture.

Rat IgM and M315 IgA at 1 mg/ml were treated with an equal volume of 40 mM sodium metaperiodate in 0.6 M sodium acetate buffer (pH 4.0) or with the acetate buffer alone for 2 h at 4°C in the dark (31), blocked with 1% glycine at pH 9.6, and then dialyzed vs DPBS.

To 4 × 107 washed T560.2.F7 or CH12.LX cells resuspended in 0.4 ml DPBS were added 20 μl DPBS containing 4 U lactoperoxidase (Sigma-Aldrich) followed by 1.5–2 mCi carrier-free 125I as NaI (ICN Biomedicals, Irvine, CA). Ten microliters 0.05% hydrogen peroxide in H2O were then added five times over the next 30 min, and the mixture was allowed to stand 10 min after the last addition. The volume was then brought to 10 ml with DPBS, and the cells were spun down and washed four times with DPBS. Aliquots of 2 × 107 125I-labeled cells in 0.2 ml DPBS were lysed with 1 ml DPBS-based lysis buffer (pH 6.0) containing 0.5% Nonidet P-40, 0.01% soybean trypsin inhibitor, 10 μg/ml leupeptin, 1 μg/ml pepstatin A, 2 μg/ml chymostatin, 2 μg/ml antipain, 100 μg/ml PMSF, 10 mM benzamidine hydrochloride, 50 mM ε-amino-caproic acid, 20 mM iodoacetamide, and 0.02% sodium azide (32) at 4°C for 1 h. After centrifugation, the supernatants were transferred to clean tubes and supplemented with 1/10 volume of 3.5 M NaCl containing 100 μg/ml PMSF and 3 mg/ml protease-free BSA. The supernatants were precleared by rotating them at 4°C overnight with mixtures of 30 μl each of packed plain protein G beads, protein G beads coated with goat anti-mouse IgM (for CH12 cells), IgA, and IgG and protein G beads coated with the eventual Ab to be used to bind IgM or IgA to the beads to precipitate the receptor (i.e., goat anti-mouse λ light chain for MOPC-104E or M315, and anti-rat κ-chain mAb RG7.9.1 (24) for rat IgM). These beads were removed by centrifugation, and a second preclearance was performed by transferring the supernatants into fresh tubes containing 30 μl of packed MOPC-21 (mouse IgG1)-coated beads, rotating the mixtures at 4°C for 2 h. Equal volumes of the supernatants were then placed into fresh microfuge tubes containing 30 μl washed protein G beads precoated with either monoclonal anti-rat κ-chain followed by rat IgM or control, BSA-containing buffer, or goat anti-mouse λ light chain Ab followed by either M315 dimeric IgA, MOPC-104E IgM, or control, BSA-containing buffer. The lysates were rotated with the beads overnight at 4°C. The beads were recovered by centrifugation and washed twice with 1 ml high-salt lysis buffer, five times with 0.5 ml of this same buffer, and once with 1 ml low-salt lysis buffer. The protein was solubilized from the beads by boiling with 50 μl fresh Laemmli sample buffer (33) with or without 0.7 M 2-ME and electrophoresed on SDS-PAGE. In some experiments, precipitation was done in ELISA plates instead of on beads (32). For preclearance, the wells were coated with goat anti-mouse λ light chain or TNP-BSA, washed with PBS, and blocked with BSA. The lysates were precleared seven times by serial transfer to and incubation at 4°C in such coated wells, then placed in wells coated with goat anti-mouse λ light chain, followed by either MOPC-104E IgM, control BSA-containing buffer, or with TNP-BSA followed by M315 dimeric IgA or BSA-containing buffer. After adsorption to the coated wells, the lysates were removed, and the wells were washed seven times with PBS. Bound proteins were removed from the wells with Laemmli sample buffer with or without 0.7 M 2-ME and boiled for 5 min before separation on SDS-PAGE.

For immunoblotting, lysates or 10-fold concentrated supernatants of unlabeled cells were precleared with protein G beads precoated with goat anti-mouse γ2a chain (T560 cells) or goat anti-mouse μ-chain Ab (CH12 cells), and the pIgR or IgA present were precipitated onto protein G beads coated as above with RG7.9.1 anti-rat κ-chain rat IgM IC, with goat anti-human λ light chain human IgA polymer (1) complex, with the Abs alone with BSA (controls), or with goat anti-α-chain Ab. For the pIgR, 10% SDS-PAGE was used, and the proteins were electrophoretically transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA). For S-IgA, 5% SDS-PAGE was used, and the proteins were transferred to ζ-probe (Bio-Rad). The membranes were blocked with 10% BSA in PBS containing 0.05% Tween 20 and 0.02% sodium azide, washed in PBS-Tween 20 without azide, and stained with either rabbit anti-denatured recombinant pIgR (23) or normal rabbit serum followed by HRP-conjugated goat anti-rabbit IgG heavy and light chains (human/mouse adsorbed) or HRP-conjugated goat anti-mouse α-chain, diluted in 5% normal goat serum/PBS-Tween 20. The bands were developed with ECL Western blotting detection reagents (Amersham, Arlington Heights, IL).

PCR were performed using pIgR primers with cDNA templates prepared from T560.2.F7 cells, from mouse and rat liver, and from control J774 macrophages and CH12.LX B lymphoma cells, and the PCR products were TA-cloned and sequenced as previously described (21). Sequential, overlapping PCRs were done using one primer designed from the sequence contained within the preceding amplified fragment and a second primer designed from the mouse liver pIgR sequence (34) 5′ or 3′ of the existing fragment. Combination of the sequences of all these fragments allowed determination of the complete sequence of the T560 pIgR except for the 5′ and 3′ ends, which were given by the mouse liver primers. The names and locations of the primer sequences are given in Table I.

Table I.

PCR primers used for sequencing the pIgR of T56O

IdentifierHomologyDirectionPrimer (5′ to 3′)
pIgR S5 −84 to −62 Sense TCACCTGGAGAGAAGGAAGTAGC 
pIgR S2 110–132 Sense TCCATCACGTGCTACTACCCAGA 
pIgR S3 365–386 Sense ATGTCAGCCTGGAGGTCAGCCA 
pIgR S9 591–614 Sense GACCGACCTAACTGTATTCTATGT 
pIgR S6 693–715 Sense GAATGTTGACCTCCAGGTGCTAG 
pIgR S10 901–923 Sense AAGGATGACAATGGCCGCTTCAG 
pIgR S14 1134–1154 Sense CAGCCTCAAGTACTGGTGTCG 
pIgR S11 1517–1539 Sense ACATCCTGCCAAGCCATGACGAA 
pIgR S7 1607–1630 Sense TCAGTAAGGAAGATGAAGGCTGGT 
pIgR S8 1670–1693 Sense CTACCGCCATCTATATAGCAGTTG 
pIgR S4 1771–1793 Sense GTAGTGGACTCCTCCATCAGTGA 
pIgR S12 2009–2031 Sense TCCGACATCGGAAGAATGTAGAC 
pIgR AS3 154–176 Antisense TCCTTGTCGGCACCAGTATTTCC 
pIgR AS2 424–447 Antisense GGTCACATTTCTGCCTATGTCCTT 
pIgR AS5 719–740 Antisense TTATAAAGCAGCTCTGGCTCAG 
pIgR AS10 1132–1153 Antisense AGCGACACCAGTACTTGAGGCT 
pIgR AS6 1420–1442 Antisense GAAGGTCTCTCCTAGTACTGCTG 
pIgR AS4 1765–1787 Antisense ATGGAGGAGTCCACTACCTCTTC 
pIgR AS11 2024–2047 Antisense TGTCCTGTAGCTGCTGATTGACAT 
pIgR AS12 2389–2409 Antisense AAGAGCGGAGGTGATGGGTGA 
IdentifierHomologyDirectionPrimer (5′ to 3′)
pIgR S5 −84 to −62 Sense TCACCTGGAGAGAAGGAAGTAGC 
pIgR S2 110–132 Sense TCCATCACGTGCTACTACCCAGA 
pIgR S3 365–386 Sense ATGTCAGCCTGGAGGTCAGCCA 
pIgR S9 591–614 Sense GACCGACCTAACTGTATTCTATGT 
pIgR S6 693–715 Sense GAATGTTGACCTCCAGGTGCTAG 
pIgR S10 901–923 Sense AAGGATGACAATGGCCGCTTCAG 
pIgR S14 1134–1154 Sense CAGCCTCAAGTACTGGTGTCG 
pIgR S11 1517–1539 Sense ACATCCTGCCAAGCCATGACGAA 
pIgR S7 1607–1630 Sense TCAGTAAGGAAGATGAAGGCTGGT 
pIgR S8 1670–1693 Sense CTACCGCCATCTATATAGCAGTTG 
pIgR S4 1771–1793 Sense GTAGTGGACTCCTCCATCAGTGA 
pIgR S12 2009–2031 Sense TCCGACATCGGAAGAATGTAGAC 
pIgR AS3 154–176 Antisense TCCTTGTCGGCACCAGTATTTCC 
pIgR AS2 424–447 Antisense GGTCACATTTCTGCCTATGTCCTT 
pIgR AS5 719–740 Antisense TTATAAAGCAGCTCTGGCTCAG 
pIgR AS10 1132–1153 Antisense AGCGACACCAGTACTTGAGGCT 
pIgR AS6 1420–1442 Antisense GAAGGTCTCTCCTAGTACTGCTG 
pIgR AS4 1765–1787 Antisense ATGGAGGAGTCCACTACCTCTTC 
pIgR AS11 2024–2047 Antisense TGTCCTGTAGCTGCTGATTGACAT 
pIgR AS12 2389–2409 Antisense AAGAGCGGAGGTGATGGGTGA 

Rosette assays were previously used to show that T560 cells bind both mouse IgA- and IgM-coated erythrocytes and that these two Igs are mutually inhibitory (9). Similar binding and inhibitory phenomena are here demonstrated by flow cytometry with both mouse and human IgA and mouse and rat IgM. Binding of polymeric M315 mouse IgA myeloma protein to T560.2.F7 cells in the presence or absence of TNP-BSA is shown in Fig. 2,A. IgA binds to T560.2.F7 cells, and the presence of TNP-BSA in Ab excess markedly enhances the signal from FITC anti-α-chain Ab, presumably because there is more IgA to take it up in the bound complex. Not all of this IgA is necessarily in contact with receptors on the cell surface, but multipoint attachment to the cell surface receptors probably increases the avidity of binding of complexes over that of pIgA alone. No binding to CH12.LX cells, which lack IgA/IgM receptors, is seen (Fig. 2 B).

FIGURE 2.

Binding of 50 μg M315 IgA myeloma protein/ml and of M315 IgA IC preformed in Ab excess (equal volumes of 100 μg/ml M315 IgA plus 12.8 μg/ml TNP27-BSA mixed and incubated for 1 h at room temperature) to T560.2.F7 (A) and CH12.LX (B) B lymphoma cells. Staining was done with FITC-goat anti-mouse α-chain. Dark line, IgA; light line, control. The numbers represent the MF. The MF of the FITC-goat anti-mouse α-chain control binding to T560.2.F7 cells was 15.0 and to CH12.LX was 25.6.

FIGURE 2.

Binding of 50 μg M315 IgA myeloma protein/ml and of M315 IgA IC preformed in Ab excess (equal volumes of 100 μg/ml M315 IgA plus 12.8 μg/ml TNP27-BSA mixed and incubated for 1 h at room temperature) to T560.2.F7 (A) and CH12.LX (B) B lymphoma cells. Staining was done with FITC-goat anti-mouse α-chain. Dark line, IgA; light line, control. The numbers represent the MF. The MF of the FITC-goat anti-mouse α-chain control binding to T560.2.F7 cells was 15.0 and to CH12.LX was 25.6.

Close modal

Inhibition of binding of M315 IgA-TNP-BSA IC to T560.2.F7 cells by normal rat IgM is illustrated in Fig. 3. More than 50% inhibition of binding of IgA complex containing 25 μg/ml IgA is achieved with as little as 9 μg/ml of rat IgM.

FIGURE 3.

Inhibition of binding of M315 IgA IC preformed in Ab excess (equal volumes of 100 μg/ml M315 IgA plus 12.8 μg/ml TNP27-BSA were mixed and incubated for 1 h at room temperature) to T560.2F7 cells by normal rat IgM. The IC were mixed with equal volumes of medium alone or of medium containing different concentrations of IgM to achieve the stated IgM concentration and 25 μg IgA/ml. Staining was done with FITC-goat anti-mouse α-chain. Dark line, IgA; light line, control. The numbers represent the MF with the percentage of inhibition in parentheses. The control MF was 13.2.

FIGURE 3.

Inhibition of binding of M315 IgA IC preformed in Ab excess (equal volumes of 100 μg/ml M315 IgA plus 12.8 μg/ml TNP27-BSA were mixed and incubated for 1 h at room temperature) to T560.2F7 cells by normal rat IgM. The IC were mixed with equal volumes of medium alone or of medium containing different concentrations of IgM to achieve the stated IgM concentration and 25 μg IgA/ml. Staining was done with FITC-goat anti-mouse α-chain. Dark line, IgA; light line, control. The numbers represent the MF with the percentage of inhibition in parentheses. The control MF was 13.2.

Close modal

Binding of 40 μg/ml of MOPC-104E mouse IgM to T560.2.F7 cells is inhibited by human polymeric and dimeric IgA, but not at all by S-IgA and very little by monomeric IgA. Fifty percent inhibition requires ∼100 μg/ml of IgA polymer (1) and dimer, but 350 μg/ml of IgA polymer (2) and >1000 μg/ml IgA monomer (Fig. 4). Because the inhibition curves for polymer and monomer have the same slope, it is possible that the inhibition by monomer is due to minor contamination by polymer.

FIGURE 4.

Inhibition of binding of MOPC-104E IgM myeloma protein at 40 μg/ml (final concentration) by human monomeric, dimeric, polymeric, and secretory IgA. This figure shows means of two to three experiments with each IgA, not all done at the same time. The concentrations have been corrected to those determined by ELISA.

FIGURE 4.

Inhibition of binding of MOPC-104E IgM myeloma protein at 40 μg/ml (final concentration) by human monomeric, dimeric, polymeric, and secretory IgA. This figure shows means of two to three experiments with each IgA, not all done at the same time. The concentrations have been corrected to those determined by ELISA.

Close modal

We previously noted (9) that high concentrations of both mouse IgG2a (UPC-10) and IgG2b (MOPC-141) inhibited IgA rosette formation. These two proteins were shown not to be appreciably contaminated with IgA. In the present work, we tested the same lots of protein for their ability to inhibit binding of MOPC-104E IgM to T560.2.F7 cells as measured by flow cytometry. We found that IgG2a inhibited IgM binding by 40% at 300 μg/ml and by 16% at 150 μg/ml whereas, at the same concentrations, IgG2b enhanced it (data not shown). ELISA subsequently revealed that the IgG2b preparation was contaminated by IgM, which would explain why it inhibited IgA rosette formation in our earlier experiments. However, the inhibition of both IgA and IgM-binding by IgG2a is still unexplained for it was not contaminated by either IgA or IgM. Inhibition of IgM binding by IgG2a in the experiments discussed here is much less impressive than the 100% inhibition of IgA rosette formation seen with only 65 μg/ml IgG2a in our earlier study (9).

To examine the possibility that IgA and IgM bind to the IgA/IgM receptor through a shared carbohydrate, the effect of periodate oxidation of the carbohydrate on binding of rat IgM and M315 IgA was tested. The data (Table II) indicate that treatment with periodate has little or no effect on the ability of IgM to bind to the cells (in the first experiment it reduced it, in the second it did not) but, in three experiments, it increased the ability of IgA to do so. It is not clear why it has this effect on IgA but not IgM. One possibility is that cleavage of sugar rings in the carbohydrates on IgA renders the IgA susceptible to aggregation, another is that it relieves a partial blockade of binding of IgA to the pIgR normally mediated by native carbohydrates. Whatever the explanation, there being no major reduction in binding of either protein, it seems unlikely that interaction with the T560 receptor is mediated through a carbohydrate shared between IgM and IgA.

Table II.

Effect of periodate treatment of rat IgM and M315 mouse IgA on their ability to bind to T560.2.F7 cells

Expt.ProteinStaining ReagentPeriodate TreatmentMF
None FITC-goat anti-rat IgM  8.0 
 IgM FITC-goat anti-rat IgM − 41.8 
 IgM FITC-goat anti-rat IgM 29.5 
 None FITC-goat anti-mouse α-chain  7.7 
 IgA FITC-goat anti-mouse α-chain − 39.2 
 IgA FITC-goat anti-mouse α-chain 61.9 
None FITC-goat anti-rat IgM  12.6 
 IgM FITC-goat anti-rat IgM − 76.3 
 IgM FITC-goat anti-rat IgM 75.3 
 None FITC-goat anti-mouse α-chain  12.1 
 IgA FITC-goat anti-mouse α-chain − 67.4 
 IgA FITC-goat anti-mouse α-chain 107.8 
None FITC-goat anti-mouse α-chain  10.4 
 IgA FITC-goat anti-mouse α-chain − 43.2 
 IgA FITC-goat anti-mouse α-chain 63.2 
Expt.ProteinStaining ReagentPeriodate TreatmentMF
None FITC-goat anti-rat IgM  8.0 
 IgM FITC-goat anti-rat IgM − 41.8 
 IgM FITC-goat anti-rat IgM 29.5 
 None FITC-goat anti-mouse α-chain  7.7 
 IgA FITC-goat anti-mouse α-chain − 39.2 
 IgA FITC-goat anti-mouse α-chain 61.9 
None FITC-goat anti-rat IgM  12.6 
 IgM FITC-goat anti-rat IgM − 76.3 
 IgM FITC-goat anti-rat IgM 75.3 
 None FITC-goat anti-mouse α-chain  12.1 
 IgA FITC-goat anti-mouse α-chain − 67.4 
 IgA FITC-goat anti-mouse α-chain 107.8 
None FITC-goat anti-mouse α-chain  10.4 
 IgA FITC-goat anti-mouse α-chain − 43.2 
 IgA FITC-goat anti-mouse α-chain 63.2 

Marked inhibition of binding of murine IgM to the T cell IgM receptor was shown to occur when either of two different rat mAbs (IM41 and 2911) to the Cμ3 domain were complexed with the IgM at ratios higher than 5:1 (Ab to IgM) before addition to the cells (19). Borderline inhibition was seen with one of two mAbs to the Cμ2 domain and no inhibition was seen with anti-Cμ1 or with either of two mAbs to the Cμ4 domain. We tested the ability of some of these same Abs to inhibit binding of MOPC-104E to the T560 IgA/IgM receptor at Ab:IgM ratios ranging from 8:1 down to 1:1. There was no inhibition of binding with any of the mAbs to any of domains Cμ1 through Cμ4, most notably not with IM41, which reacts with Cμ3, indicating that the epitopes bound by the mAbs are not involved in binding to the T560 IgA/IgM receptor (data not shown). Marked potentiation of the signal provided by FITC-goat anti-mouse λ light chain actually occurred with Abs to Cμ2 and Cμ3 but not with Abs to Cμ1 and Cμ4, suggesting that the former promoted the build-up of MOPC-104E-Ab IC on the cell surface.

The best described IgA/IgM receptor to date is the pIgR, normally expressed on secretory epithelial cells. Expression of the structure recognized by this receptor is dependent on the presence of J chain in the IgA or IgM polymer (16, 17, 18). To examine a possible relationship between the T560 IgA/IgM receptor and the pIgR, binding of IgMs containing or lacking J chain was investigated. TNP-specific SP-6 mutant and wt IgMs were affinity purified from the supernatants of transfected cells, separated into monomers and polymers on sucrose gradients (J/IgM-S414, J/IgM-S575, and wt SP-6) or left unseparated, (J+/IgM-S414), and their ability to bind to T560.2.F7 cells was assessed by flow cytometry (Fig. 5, A and B).

FIGURE 5.

FACScan of T560.2.F7 cells incubated with normal and mutant IgMs at 40 μg/ml, washed, and then stained with FITC-goat anti-mouse μ-chain Ab. Dark line, IgM; light line, control. A, Comparison between the binding of unseparated wt MOPC-104E and TEPC-183 IgM, the polymer fraction of wt SP-6 IgMs, and both monomer and polymer fractions of the mutant proteins, J/S414-IgM and J/S575-IgM. The numbers represent the MF for IgM binding; the control was 9.6. B, Comparison between the binding of unseparated wt MOPC-104E IgM, the polymer fraction of wt SP-6 IgM, and the polymer fractions of the mutant proteins, J+/S414-IgM, J/S414-IgM, and J/S575-IgM (control). The numbers represent the MF for IgM binding; the control was 12.0.

FIGURE 5.

FACScan of T560.2.F7 cells incubated with normal and mutant IgMs at 40 μg/ml, washed, and then stained with FITC-goat anti-mouse μ-chain Ab. Dark line, IgM; light line, control. A, Comparison between the binding of unseparated wt MOPC-104E and TEPC-183 IgM, the polymer fraction of wt SP-6 IgMs, and both monomer and polymer fractions of the mutant proteins, J/S414-IgM and J/S575-IgM. The numbers represent the MF for IgM binding; the control was 9.6. B, Comparison between the binding of unseparated wt MOPC-104E IgM, the polymer fraction of wt SP-6 IgM, and the polymer fractions of the mutant proteins, J+/S414-IgM, J/S414-IgM, and J/S575-IgM (control). The numbers represent the MF for IgM binding; the control was 12.0.

Close modal

The data indicated that neither the polymers nor the monomers from the J mutant IgMs could bind significantly to T560.2.F7 cells (there was a trace of binding of J/IgM-S414 polymer) but J+/IgM-S414 and wt SP-6 polymeric IgM as well as additional control, unseparated IgMs, MOPC-104E, and TEPC-183 all bound very well. They suggested that pIgM-lacking J chain does not bind to the receptor. However, they were not conclusive because the mutations in the μ-chains of S414 and S575 might have affected their ability to bind independently of affecting their J chain content.

The role of J chain in binding to the T560.2.F7 IgA/IgM receptor was further examined by comparing the binding of WEHI-231 IgM with normal μ-chains but lacking J chain (30) with that of IgM from two transfected cell lines: one, 3-C10, expressing J chain; the other, 3-H1, not expressing J chain. (Fig. 6). The results were clear cut. 3-C10 IgM-containing J chain, bound well to T560.2.F7 cells; WEHI-231 IgM and 3-HI IgM, both lacking J chain, failed to bind. Because WEHI-231 IgM is substantially hexameric, the results support the conclusion that it is not sufficient for IgM to be polymeric; it must contain J chain to bind to the receptor. The results are consistent with the idea that the T560 IgA/IgM receptor is a form of pIgR, known to require J chain for binding of polymeric Ig.

FIGURE 6.

FACScan of T560.2.F7 cells incubated with normal wt MOPC-104E IgM (J chain+), wt WEHI-231 IgM (J chain), and IgM from two J chain-transfected clones of WEHI-231, clone 3-C10, which is J chain+, and 3-H1, which is J chain. The cells were incubated with IgMs at 20 μg/ml, washed, then stained with FITC-anti μ-chain Ab. Dark line, IgM; light line, control. The numbers represent the MF; the control was 16.8.

FIGURE 6.

FACScan of T560.2.F7 cells incubated with normal wt MOPC-104E IgM (J chain+), wt WEHI-231 IgM (J chain), and IgM from two J chain-transfected clones of WEHI-231, clone 3-C10, which is J chain+, and 3-H1, which is J chain. The cells were incubated with IgMs at 20 μg/ml, washed, then stained with FITC-anti μ-chain Ab. Dark line, IgM; light line, control. The numbers represent the MF; the control was 16.8.

Close modal

Radioiodinated IgA/IgM receptor was precipitated with pIg from T560 cells under several sets of conditions. Both rat and mouse IgM precipitated it more readily than pIgA. No similar molecule was precipitated from CH12 cells. In our earliest studies (20) using the protease inhibitors described in Ref. 14 , triethanolamine, iodoacetamide, chymostatin, leupeptin, pepstatin, antipain, and PMSF, we precipitated small amounts of a molecule similar in size (36 kDa) to that of the IgA-binding 38-kDa molecule precipitated from murine T cells (35). However, when we added soybean trypsin inhibitor, aprotinin, diisopropylfluorophosphate, and sodium azide to the inhibitors mentioned above (32), we brought down a band of much higher Mr (116 kDa; Fig. 7), and the 36-kDa band disappeared. It seems likely that the 36-kDa band represented an IgM-binding product of proteolysis derived from the 116-kDa band. The apparent Mr of the 116-kDa band increased to about 120 kDa on 7.5% polyacrylamide gels but was unaltered under reducing vs nonreducing conditions (not shown). The band was also precipitated by IgA or IgM in PBS in the presence of EDTA indicating that its binding is not dependent on divalent cation (not shown).

FIGURE 7.

Electrophoretic analysis of Nonidet P-40 lysates of 125I-labeled T560.2.F7 and CH12.LX cells precipitated in wells of ELISA plates sensitized with goat anti-mouse λ light chain Ab followed by MOPC-104E IgM (M) or diluent alone (MC), or with TNP-BSA followed by M315 IgA (A) or diluent alone (AC). The samples were reduced and run on 10% SDS-PAGE. Arrows indicate the 116-kDa receptor band.

FIGURE 7.

Electrophoretic analysis of Nonidet P-40 lysates of 125I-labeled T560.2.F7 and CH12.LX cells precipitated in wells of ELISA plates sensitized with goat anti-mouse λ light chain Ab followed by MOPC-104E IgM (M) or diluent alone (MC), or with TNP-BSA followed by M315 IgA (A) or diluent alone (AC). The samples were reduced and run on 10% SDS-PAGE. Arrows indicate the 116-kDa receptor band.

Close modal

The receptor precipitated from Nonidet P-40 lysates of T560 cells with either rat IgM or human pIgA was detectable as a band of ∼116 kDa on immunoblots with rabbit Ab to denatured mouse pIgR followed by HRP-goat Ab to rabbit IgG (Fig. 8). No such band was precipitated from lysates of CH12 cells, which lack the IgA/IgM receptor. Control lanes show both free SC (∼90–95 kDa) and covalently bound SC in the unreduced S-IgA molecule contained in whey and of SC alone in reduced whey.

FIGURE 8.

Immunoblot showing precipitation of 116-kDa band from T560 cells by rat IgM or human pIgA on protein G beads. The beads were preincubated with RG7.9.1 anti-rat κ-chain, washed, and then incubated with rat IgM (M), diluent alone (MC), goat anti-human λ light chain followed by human IgA polymer (1 ) (A), or diluent alone (AC). Reduced samples were run on 10% SDS-PAGE, blotted onto nitrocellulose, and developed by anti-pIgR Ab. Negative controls were done with CH12.LX cells stained with anti-pIgR (shown), as well as with T560 cells stained with normal rabbit serum followed by HRP goat anti-rabbit IgG (not shown). Nonreduced (NR) and reduced mouse whey provided positive controls for staining of intact S-IgA (the high Mr bands above 208 kDa) and free SC (the bands above 84 kDa) by the anti-pIgR Ab.

FIGURE 8.

Immunoblot showing precipitation of 116-kDa band from T560 cells by rat IgM or human pIgA on protein G beads. The beads were preincubated with RG7.9.1 anti-rat κ-chain, washed, and then incubated with rat IgM (M), diluent alone (MC), goat anti-human λ light chain followed by human IgA polymer (1 ) (A), or diluent alone (AC). Reduced samples were run on 10% SDS-PAGE, blotted onto nitrocellulose, and developed by anti-pIgR Ab. Negative controls were done with CH12.LX cells stained with anti-pIgR (shown), as well as with T560 cells stained with normal rabbit serum followed by HRP goat anti-rabbit IgG (not shown). Nonreduced (NR) and reduced mouse whey provided positive controls for staining of intact S-IgA (the high Mr bands above 208 kDa) and free SC (the bands above 84 kDa) by the anti-pIgR Ab.

Close modal

The binding characteristics of the IgA/IgM receptor, especially its requirement for J chain, its high molecular mass, and its ability to bind anti-murine pIgR Ab suggest that it is pIgR. The possibility that it might represent some new B cell form of the pIgR, perhaps with GPI linkage to the cell membrane, as suggested by the sensitivity of the T560 IgA receptor to PI-PLC (9, 36), was next explored by RT-PCR. First we demonstrated (Fig. 9) that T560 cells contain message for the pIgR using primers encompassing ∼80% of domain I and a small portion of domain II of the mouse liver pIgR sequence. Identically sized fragments (337 bp) were amplified from rat and mouse liver and from both of two separately prepared T560.2.F7 mRNAs but not from mRNA of either CH12.LX, the B cell line used as control above, or J774, a receptor-negative macrophage line (9), and not from a control containing no template. The fragments were TA-cloned and sequenced; fragments amplified from rat mRNA contained rat sequence while those amplified from mouse liver and from T560 contained mouse sequence.

FIGURE 9.

Photograph of agarose gel electrophoretic analysis of the products of PCRs done with sense and antisense primers derived from the first and second domain of mouse pIgR and with sense and antisense primers for β2-microglobulin as a control. Lane 1, Ladder (1-kb); lane 2, mouse liver cDNA; lane 3, rat liver cDNA; lane 4, J774 macrophage cell line cDNA; lane 5, T560.2.F7 cDNA; lane 6, CH12.LX B lymphoma cell line cDNA; lane 7, T560.2.F7 cDNA (different preparation from that shown in lane 5); lane 8, no template control.

FIGURE 9.

Photograph of agarose gel electrophoretic analysis of the products of PCRs done with sense and antisense primers derived from the first and second domain of mouse pIgR and with sense and antisense primers for β2-microglobulin as a control. Lane 1, Ladder (1-kb); lane 2, mouse liver cDNA; lane 3, rat liver cDNA; lane 4, J774 macrophage cell line cDNA; lane 5, T560.2.F7 cDNA; lane 6, CH12.LX B lymphoma cell line cDNA; lane 7, T560.2.F7 cDNA (different preparation from that shown in lane 5); lane 8, no template control.

Close modal

Multiple, serial RT-PCRs were then performed using T560 mRNA as template and overlapping sets of primers. The fragments were TA-cloned and sequenced. The whole T560 pIgR sequence is shown in Fig. 10. T560 cells clearly contain mRNA coding for a protein identical with epithelial cell pIgR throughout its external, transmembrane, and intracytoplasmic regions except for a single T to C base change at position 476 that results in a Val→Ala change in domain II. This change, which could well be allelic, was verified by sequencing the product of an independent RT-PCR. Two C to T changes, one conservative in domain 4, the other in the 3′ untranslated region, have not been so verified. The sequence provided no grounds for supposing that the form of pIgR on T560 was different from that on epithelial cells.

FIGURE 10.

Comparison of the sequences of pIgR mRNA from mouse liver and from the T560 B lymphoma. Dashes indicate identity between the T560 and mouse liver sequences; horizontal arrows underline the sequences used to make the forward and reverse primers for RT-PCR; vertical lines define the domain borders; asterisks indicate the initiation and termination codons; and the CDR1, CDR2, and CDR3 homology regions of domain I are italicized.

FIGURE 10.

Comparison of the sequences of pIgR mRNA from mouse liver and from the T560 B lymphoma. Dashes indicate identity between the T560 and mouse liver sequences; horizontal arrows underline the sequences used to make the forward and reverse primers for RT-PCR; vertical lines define the domain borders; asterisks indicate the initiation and termination codons; and the CDR1, CDR2, and CDR3 homology regions of domain I are italicized.

Close modal

We previously noted (9) that treatment of T560 cells with PI-PLC destroyed their ability to bind IgA-coated erythrocytes, suggesting that the IgA receptor might be GPI-linked to the cell membrane. We also found that activation of protein kinase C (PKC) by PMA caused down-regulation of IgA receptor activity. Subsequently, we discovered (36) that the effect of PI-PLC was partially reversed by staurosporine, a protein kinase inhibitor. We now show that it is completely reversed by calphostin C, which is PKC-specific. As shown in Table III, treating T560 cells with PI-PLC reduces their ability to form IgA rosettes by ∼85%. Addition of calphostin C diminishes the reduction due to PI-PLC to only 3%. These results suggest that PI-PLC causes loss of IgA receptor activity (by inference pIgR receptor activity) from T560 cells indirectly, by activating PKC. PKC activation may follow cleavage by PI-PLC of a bona fide GPI-linked molecule from the cell surface or (much less likely) by PI-PLC itself crossing the cell membrane and cleaving phosphatidylinositol bisphosphate. Whatever the mechanism of PI-PLC-induced activation of PKC, it is clear that the T560 pIgR is not GPI-linked to the cell membrane but has conventional type I transmembrane and cytoplasmic regions consistent with the sequence data presented above.

Table III.

Effect of calphostin C on PI-PLC-induced reduction in IgA rosette formation by T560.2.F7 cells incubated with M315 IgA-coated TNP-ORBC

PI-PLC-1a (50 mU/ml)PI-PLC-2 (50 mU/ml)Calphostin C (0.2 ng/ml)% IgA RFCb
− − − 35.3 
− − 4.3 (87.8) 
− − 6.1 (82.7) 
− − 32.7 (7.4) 
− 34.2 (3.1) 
− 34.2 (3.1) 
PI-PLC-1a (50 mU/ml)PI-PLC-2 (50 mU/ml)Calphostin C (0.2 ng/ml)% IgA RFCb
− − − 35.3 
− − 4.3 (87.8) 
− − 6.1 (82.7) 
− − 32.7 (7.4) 
− 34.2 (3.1) 
− 34.2 (3.1) 
a

PI-PLC-1 was from B. cereus; PI-PLC-2 was from B. thuringiensis.

b

A minimum of 200 cells per sample was counted in either the RFC or non-RFC category. Figures in parentheses represent the percentage decrement in RFC resulting from treatment. No RFC were found when T560 cells were incubated with control TNP-ORBC without M315 IgA.

Motifs in the Cα2 domain have been postulated to mediate binding between pIgA and the pIgR. To explore the roles of Cα2 domain Cys residues in the binding of IgA to the pIgR, rosette assays were performed comparing normal and mutant IgA proteins. The residues targeted were Cys301, its adjacent Tyr302, and Cys311. Both Cys301 and Cys311 are responsible for inter-α-chain bonding within the IgA monomer. In addition, Cys311 of one α-chain in an IgA dimer undergoes a disulfide exchange reaction and binds to a highly conserved Cys in pIgR domain 5 (Cys467 in human pIgR) during the formation of S-IgA. At similar concentrations and agglutination titers, there was no significant difference between mutant and nonmutant IgAs in their ability to mediate rosette formation (Table IV). Discrepancies between the concentrations and agglutination titers probably reflect the ratios of monomer to polymer in the different supernatants. Because either of two Cys and a Tyr in the Cα2 domain can undergo change without impairing the ability of the dimeric IgA molecule to bind to the pIgR, the Cα2 domain is probably not directly involved in high-affinity binding to the pIgR. It also makes no difference to rosette formation whether the extended, flexible human IgA1 or the very short human IgA2 hinge is substituted for the mouse hinge region.

Table IV.

Rosette formation on T560.2.F7 cells incubated with TNP-ORBC precoated with wt and mutant M315 IgA derived from supernatants of transfected M315.26 myeloma cells

Supernatant Used to Coat TNP-ORBC (dilution)MutationInitial IgA Conc. (μg/ml)Aggl. Titer% IgA RFCa
M315 standard (1/12) None 123 1:32 45.4 
FCS control — 2.4 
Cα30 (wt IgA) (1/2) None; wt 15 1:4 31.3 
1905 (1/2) Cys301→Ala 35 1:32 47.1 
2077 (1/2) Tyr302→Phe 32 1:8 31.3 
1920 (1/2) Cys311→Ala 126 1:64 47.1 
IgA1 (1/2) Human IgA1 hinge 14 1:4 36.9 
IgA2 (1/2) Human IgA2 hinge 272 1:64 51.3 
Supernatant Used to Coat TNP-ORBC (dilution)MutationInitial IgA Conc. (μg/ml)Aggl. Titer% IgA RFCa
M315 standard (1/12) None 123 1:32 45.4 
FCS control — 2.4 
Cα30 (wt IgA) (1/2) None; wt 15 1:4 31.3 
1905 (1/2) Cys301→Ala 35 1:32 47.1 
2077 (1/2) Tyr302→Phe 32 1:8 31.3 
1920 (1/2) Cys311→Ala 126 1:64 47.1 
IgA1 (1/2) Human IgA1 hinge 14 1:4 36.9 
IgA2 (1/2) Human IgA2 hinge 272 1:64 51.3 
a

Means of duplicate samples. A minimum of 200 cells per sample was counted in either the RFC or non-RFC category.

Because T560 cells can produce IgA and contain mRNA for J chain as determined by RT-PCR (not shown), we explored the possibility that T560 might make dimeric IgA that could bind to the pIgR and then be internalized, processed in endosomes, and released as S-IgA. In immunoblots (Fig. 11), the lanes containing the supernatants and lysates of T560.2.F7 lanes contain α-chain bands with an Mr of ∼100 kDa, consistent with α-chain dimers (the light chains of mouse IgA are not covalently bound to heavy chains). No tetrameric or higher molecular mass α-chain bands, such as are seen in the lanes containing T15 IgA, M315 IgA, and S-IgA (in mouse whey), are detectable.

FIGURE 11.

Immunoblot showing IgA from the T15 and M315 IgA myelomas from mouse whey and from lysates and supernatants of T560.2.F7 cells. The cells were grown for 3 days to a density of 1.6 × 106/ml. The cells contained in 35 ml culture fluid were centrifuged out and lysed with 0.5% Nonidet P-40. The supernatants were concentrated 10-fold by ultrafiltration. Both the lysates and supernatants were then adsorbed to protein G beads coated with goat anti-mouse α-chain Ab. After washing, bound IgA was eluted from the beads with Laemli sample buffer without reducing agent, run on 5% SDS-PAGE, and blotted onto ζ-probe membranes. The membranes were stained with HRP-goat anti-mouse α-chain Ab. High molecular mass bands in the mouse whey lane represent murine S-IgA.

FIGURE 11.

Immunoblot showing IgA from the T15 and M315 IgA myelomas from mouse whey and from lysates and supernatants of T560.2.F7 cells. The cells were grown for 3 days to a density of 1.6 × 106/ml. The cells contained in 35 ml culture fluid were centrifuged out and lysed with 0.5% Nonidet P-40. The supernatants were concentrated 10-fold by ultrafiltration. Both the lysates and supernatants were then adsorbed to protein G beads coated with goat anti-mouse α-chain Ab. After washing, bound IgA was eluted from the beads with Laemli sample buffer without reducing agent, run on 5% SDS-PAGE, and blotted onto ζ-probe membranes. The membranes were stained with HRP-goat anti-mouse α-chain Ab. High molecular mass bands in the mouse whey lane represent murine S-IgA.

Close modal

The IgA/IgM receptor expressed on the murine B lymphoma, T560, is clearly conventional pIgR, well known to function in the transport of dimeric or pIgA and IgM across epithelial cells into secretions. Binding to the T560 receptor by both IgA and IgM is independent of any hypothetical shared carbohydrate on these Igs, because periodate oxidation of the carbohydrates on the Igs does not prevent binding. This excludes the possibility that the T560 IgA/IgM receptor might be related to the lectin-like IgD receptor (37) or to the monocyte FcαR which may (38) or may not (39) need the Cα2 of human IgA1 to be N-glycosylated for binding. Both polymeric and dimeric human IgA inhibit binding of IgM to the T560 IgA/IgM receptor, but human S-IgA does not, suggesting that SC already present in the S-IgA prevents its interaction with the receptor. Binding of IgM to the T560 IgA/IgM receptor is J chain dependent as are binding of IgM and pIgA to the epithelial pIgR (16, 17, 18). Binding of IgM to the T560 IgA/IgM receptor does not involve the Cμ3 epitope used in binding to the mouse T cell FcμR (19). IgA/IgM receptor precipitated from the T560 cell surface has an appropriately high Mr (116 kDa), much higher than that of FcαR on either murine T cells (38 kDa; Refs. 14 and 35), human myeloid cells (30 kDa; Ref. 32), or human B cells (58 kDa; Ref. 40), or of the FcμR on human B cells (58–60 kDa; Refs. 41 and 42) or T cells (60 kDa; Ref. 42), and can be detected on immunoblots with rabbit Ab to murine pIgR. mRNA-encoding pIgR is expressed within T560 cells, and its sequence indicates that the molecule has external and transmembrane regions as well as a cytoplasmic tail identical with that of the molecule expressed on epithelial cells (34). Of course, because the sequence was determined from cloned RT-PCR-amplified products, it is possible that mRNA for a distinct, hypothetical B cell GPI-linked pIgR was also present, but not detected. This hypothesis is rendered unlikely by the following two findings: first, the loss of IgA receptor activity from the cell surface following PI-PLC treatment was shown to be due not to cleavage of a GPI-linked pIgR from the cell surface but rather to down-regulation of cell surface pIgR activity following activation of PKC; second, only one receptor band was detectable on immunoblots.

The ease with which wt rat or mouse IgM, as compared with dimeric or pIgA, binds to the pIgR on T560 cells is striking. Only 9 μg/ml rat IgM are needed for 50% inhibition of binding of MOPC-315 IgA IC containing 25 μg IgA/ml to T560 cells, whereas 100 μg/ml of polymeric or dimeric human IgA are needed for 50% inhibition of binding of IgM at 40 μg/ml. The affinity of the T560 pIgR for IgM vs IgA is difficult to compare with that measured in different laboratories because it depends on what species is under consideration and whether the pIgR is free (as SC in solution) or cell bound. For instance, human IgM has a Ka 2–12.5 times that of dimeric IgA in binding to human SC in solution (43, 44) but binds to human pIgR on the surface of transfected Madin-Darby canine kidney epithelial cells with much lower and more nearly equal affinity, though the amount of IgM bound per cell is 3-fold higher (45). The affinity of binding also depends on the source of the pIg; for example, one of us (R.B.C.) has found that while mouse pIgA, like human pIgA and IgM, binds to human SC in an ELISA, mouse IgM does not, implying that differences between human and mouse IgM affect their interaction with human SC; in addition, human pIgA has a lower affinity for human than for rabbit pIgR (46).

Although human pIgR and the T560 mouse pIgR bind both pIgA and IgM, rabbit (44) and rat (47) hepatocyte pIgR bind only pIgA well and do not translocate IgM into bile. Because mouse liver similarly translocates pIgA but not IgM into bile (48, 49), it is generally assumed that mouse hepatocyte pIgR resembles rat and rabbit pIgR and binds IgM poorly or not at all. If this is true, then the difference between the mouse hepatocyte and the T560 pIgR that makes the latter behave more like human pIgR must be explained. Given that the amino acid sequences of the mouse hepatocyte and T560 B cell pIgRs are the same except for the Val to Ala change in domain 2, the difference most likely reflects differential folding or glycosylation of the pIgR, probably the latter. It is easy to imagine that a bulky carbohydrate on hepatocyte-derived pIgR could interfere with IgM but not with IgA binding. Furthermore, it has already been shown that deglycosylation of human SC allows it to inhibit binding of biotinylated native SC to pIgA with 10 times greater efficiency than native SC itself (50), suggesting that some of the carbohydrate moieties on human pIgR may actually impede binding even of pIgA.

Initial, high-affinity, noncovalent binding of pIgA or IgM to the epithelial cell pIgR involves interaction with its first domain (50, 51, 52, 53, 54). This first domain of the pIgR contains three Ig-related complementarity determining region (CDR)1-, CDR2-, and CDR3-like loops (see Fig. 10) that may form a binding surface, much as they would in a conventional Ig (52). The CDR1-like loop of human pIgR is essential for binding human pIgA (50, 53, 54), but a distinct binding site containing the CDR2-like loop is critical for binding IgM (55). The amino acid sequences of mouse and rat pIgR CDR-2 loops are identical but have Asn in place of the human Glu and rabbit Thr at position 53. However, the amino acid sequence following this Asn is incompatible with its being a potential glycosylation site that could be variably glycosylated in mouse hepatocytes vs B cells (34). If differential glycosylation is, as suggested above, involved in rendering the pIgR of mouse B cells more capable of binding IgM than mouse hepatocytes, it must be at some other site.

Blocking experiments using Fab of Ab to discrete epitopes in human Cα2 and Cα3 suggest that both of these domains are involved in the interaction between human dimeric IgA and rabbit SC (56), but recent studies with a panel of IgA1/IgG1 constant region “domain swap” mutants implicate a peptide in Cα3 rather than Cα2 in binding of human IgA to human pIgR (57). A tentative model depicting the interaction of SC with dimeric IgA aligns pIgR domain 1 with Cα2 of one IgA subunit and pIgR domain 5 with Cα2 of the second subunit (57). It has been suggested (50) that initial binding of pIgA to pIgR domain 1 may be followed by less avid interactions between the remaining pIgR domains and pIgA that result in conformational changes and closer alignment of pIgR with pIgA. Late in transcytosis of pIgA-pIgR complexes, a covalent bond is formed between a highly conserved Cys residue in pIgR domain 5 and Cys311 in the Cα2 domain in one of the pIgA heavy chains (58, 59). Obviously, for this to happen these two domains must somehow be brought close together. That they have an affinity for one another that contributes to the overall affinity of binding is not supported, at least for the mouse system, by our data; it made no significant difference to IgA rosette formation whether either of the two Cα2 Cys involved in interchain disulfide bonding were mutated to Ala. Of particular relevance, mutation of Cys311, which is actually used in disulfide bridging to SC, had no effect. This does not, of course, argue against the idea that a linear epitope of Cα2 independent of interchain S-S bonding might be involved in initial binding of dimeric IgA to pIgR domain 1.

The requirement for J chain for binding of IgM to the pIgR has been used in the present work as a criterion identifying our T560 IgA/IgM receptor as pIgR: two different IgMs proved capable of binding to T560 cells only when they contained J chain. However, it is still not known what function J chain performs in binding to pIgR, and the requirement for it may not be absolute (16, 17, 18) because some pIgAs lacking J chain do bind to pIgR (60, 61). J chain may merely hold the IgA and IgM subunits with their loops in a configuration necessary for their interaction with the pIgR or may itself interact with pIgR. Isolated J chain dimers bind only marginally to SC (16), but Abs to certain J chain epitopes can block binding of intact pIg to SC (62) and prevent pIgR-mediated biliary and epithelial transport of human pIgA (63), suggesting that J chain may participate in binding to pIgR. Only one J chain is present in any given IgA polymer or IgM pentamer (64). Differences in the sizes of the IgA polymers or ratios of IgM pentamer with J chain to hexamer without J chain in the proteins we used might account for the differences in binding observed in our experiments with human polymeric vs dimeric IgA and with MOPC-104E vs TEPC-183 vs the separated polymeric fraction of SP-6 IgM.

The ability of murine IgG2a (UPC-10) to inhibit binding of both pIgA and IgM to the murine pIgR is unexplained. T560 exhibits low-level direct binding of a second mouse IgG2a myeloma protein (UN2S1) in rosette assays (9) so the inhibitory effect may not be restricted to the UPC-10 IgG2a myeloma protein. Inhibition might depend on sharing of one or more binding structures between IgM, IgA, J chain or pIgR, and murine IgG2a. Alternatively, it might depend on some interaction between IgG2a and another molecule on the T560 cell surface that down-regulates the pIgR by, for example, activating PKC (9). Optimal expression of the pIgR on T560 cells is seen when the cells have been cultured in fresh medium before being washed and used in the assay. This thorough washing procedure may allow the pIgR on T560 cells to recover from down-regulation or inhibition by the IgG2a the cells themselves secrete. It was originally instituted because we thought that IgA secreted by T560 (20) might block the IgA/IgM receptor. However, this is unlikely to be the case because all of the IgA contained in both T560 cell lysates and supernatants (no more than 10 ng IgA/ml of supernatant at the end of a 3-day culture) is monomeric. Perhaps T560 cells do not make J chain due to some unknown defect in J chain mRNA (detectable in T560 by RT-PCR). None of the T560 IgA is converted to S-IgA, which is consistent with the fact that monomeric IgA does not bind to the pIgR. We conclude that endogenously produced IgA is not capable of autocrine stimulation of T560 cells through the pIgR.

Activation of PKC down-regulates T560 IgA binding activity (9, 35), which we now know represents pIgR activity. The mechanism of down-regulation is not clear. We previously showed (9) that, after down-regulation by PMA, receptor activity recovered slowly (over several hours) even in the presence of cycloheximide, suggesting that the receptor had not been shed or degraded and that a recycling mechanism might be involved. In Madin-Darby canine kidney cells, activation of PKC by PMA causes transcytosis and apical recycling of transfected pIgR but does not stimulate endocytosis at the basolateral surface; i.e., in these polarized cells, pIgR is transcytosed from the basolateral surface to the apical recycling compartment and then delivered to the apical surface more rapidly in the presence than in the absence of PMA (65). T560 B cells are nonpolar, and nothing is known about the membrane compartment with which their pIgR is associated. Perhaps activation of PKC in T560 cells promotes endocytosis of pIgR rather than an increase in its surface expression.

That T560, a B lymphoma, expresses pIgR at all is a novelty. It raises the question whether pIgR expression occurs naturally on a small cohort of normal B cells, of which T560 is a transformed representative, or whether it is due to some aspect of the transformation process. Support for the notion that pIgR may be expressed on normal or activated lymphocytes comes from work showing that the splenocytes of mice carrying an IgA-secreting myeloma express IgA receptors whose ability to bind IgA is blocked by rabbit anti-rat SC (15). No other evidence indicating expression of pIgR by normal lymphoid cells has appeared, although numerous immunohistochemical studies have shown binding of anti-SC Abs to human intestinal epithelial cells in health and disease (65). If binding of anti-SC Abs to mucosal lymphocytes were common, it should surely have been recorded. Perhaps expression of the pIgR on the T560 lymphoma initially occurred as a response to cytokines available during malignant transformation. T560 is highly activated (22) with heavily mutated Ig heavy and light chains (21) and originated in the GALT of an F1 hybrid mouse that had been injected with parental splenocytes. Although signs of an ongoing graft-vs-host reaction were not apparent at the time of sacrifice, a graft-vs-host reaction had probably been initiated and then abrogated. Graft-vs-host reactions involve release of many cytokines that might up-regulate pIgR on an activated B cell (64) that was subsequently transformed. In several human systems, synergy between IFN-γ and IL-4 in up-regulating pIgR has been reported (66). Whether these same cytokines would function in the same way with respect to murine B cells is unknown, but it may be significant that T560 secretes IL-4 (22). An alternative hypothesis, suggested to us by Dr. Randy Goldblum (University of Texas Medical Branch, Galveston, TX), is that the pIgR gene, normally localized to chromosome 1 in both human (67, 68) and mouse (69), has been switched on in T560 as a consequence of translocation events that put it under the control of the promoter of some other constitutively activated gene. We have not investigated the chromosomes of T560 and do not know the genetic mechanism of its transformation.

1

This work was supported by American Cancer Society Grant IM-684, U.S. Public Health Service Grants AI-29682 and AI-31209, the Medical Research Council of Canada, and by Grant 3200–057088 from the Swiss National Science Foundation.

3

Abbreviations used in this paper: GALT, gut-associated lymphoid tissue; FcαR, IgA receptor; FcμR, IgM receptor; IC, immune complex; MF, mean fluorescence; pIgR, poly-Ig receptor; pIg, polymeric Ig; pIgA, polymeric IgA; PI-PLC, phosphatidylinositol-specific phospholipase C; SC, secretory component; S-IgA, secretory IgA; TNP, 2,4,6 trinitrophenyl; TNP-ORBC, TNP-ox RBC; wt, wild type; PKC, protein kinase C; CDR, complementarity determining region; RFC, rosette-forming cells; DPBS, Dulbecco’s PBS.

1
Daeron, M. C..
1997
. Fc receptor biology.
Annu. Rev. Immunol.
15
:
203
2
Tsujimura, K., Y.-H. Park, M. Miyama-Inaba, T. Meguro, T. Ohno, M. Ueda, T. Masuda.
1990
. Comparative studies on FcR (FcRII, FcRIII, and Fcα) functions of murine B cells.
J. Immunol.
144
:
4571
3
Strober, W., N. E. Hague, L. G. Lum, P. A. Henkart.
1978
. IgA-Fc receptors on mouse lymphoid cells.
J. Immunol.
121
:
2440
4
Hoover, R. G., R. G. Lynch.
1980
. Lymphocyte surface membrane Ig in myeloma II: T cells with IgA-Fc receptors are markedly increased in mice with IgA plasmacytomas.
J. Immunol.
125
:
1280
5
Hoover, R. G., B. K. Dickgraeffe, R. G. Lynch.
1981
. T cells with Fc receptors for IgA: induction of Tα cells in vivo and in vitro by purified IgA.
J. Immunol.
127
:
1560
6
Yodoi, J., M. Adachi, T. Masuda.
1982
. Induction of FcRα on murine lymphocytes by IgA in vitro.
J. Immunol.
128
:
888
7
Adachi, M., J. Yodoi, N. Noro, T. Masuda, J. Uchino.
1984
. Murine IgA binding factors produced by FcαR+ T cells: role of FcγR+ cells for the induction of FcαR and formation of IgA-binding factor in Con A-activated cells.
J. Immunol.
133
:
65
8
Yodoi, J., M. Adachi, N. Noro.
1987
. IgA binding factors and Fc receptors for IgA: comparative studies between IgA and IgE Fc receptor systems.
Int. Rev. Immunol.
2
:
117
9
Rao, T. D., A. A. Maghazachi, A. V. Gonzalez, J. M. Phillips-Quagliata.
1992
. A novel IgA receptor expressed on a murine B cell lymphoma.
J. Immunol.
149
:
143
10
Mostov, K. E., M. Friedlander, G. Blobel.
1984
. The receptor for transepithelial transport of IgA and IgM contains multiple immunoglobulin-like domains.
Nature
308
:
37
11
Mostov, K. E., J. P. Kraehenbuhl, G. Blobel.
1980
. Receptor-mediated transcellular transport of immunoglobulin: synthesis of secretory component as multiple and larger transmembrane forms.
Proc. Natl. Acad. Sci. USA
77
:
7257
12
Mostov, K. E., G. Blobel.
1982
. A transmembrane precursor of secretory component.
J. Biol. Chem.
257
:
11816
13
Hoppe, C. A., T. P. Connolly, A. L. Hubbard.
1985
. Transcellular transport of polymeric IgA in the rat hepatocyte: biochemical and morphological characterization of the transport pathway.
J. Cell Biol.
101
:
2113
14
Aicher, W. K., M. L. McGhee, J. R. McGhee, Z. Moldoveanu, V. J. Kidd, M. Tomana, J. Mestecky, J. H. Eldridge, T. F. Meyer, H. Kiyono.
1992
. Properties of IgA-binding receptors on murine T cells: relative importance of FcαR, β-galactosyltransferase and anti-secretory component reactive proteins (ASCP).
Scand. J. Immunol.
35
:
469
15
Crago, S. S., C. J. Word, T. B. Tomasi.
1989
. Antisera to the secretory component recognize the murine Fc receptor for IgA.
J. Immunol.
142
:
3909
16
Brandtzaeg, P..
1985
. Role of J chain and secretory component in receptor-mediated glandular and hepatic transport of immunoglobulins in man.
Scand. J. Immunol.
22
:
111s
17
Brandtzaeg, P., H. Prydz.
1984
. Direct evidence for an integrated function of J chain and secretory component in epithelial transport of immunoglobulins.
Nature
311
:
71
18
Hendrickson, B. A., D. A. Conner, D. J. Ladd, D. Kendall, J. Casanova, B. Corthesy, E. A. Max, M. Neutra, C. E. Seidman, J. G. Seidman.
1995
. Altered hepatic transport of immunoglobulin A in mice lacking the J chain.
J. Exp. Med.
182
:
1905
19
Mathur, A., R. G. Lynch, G. Kohler.
1988
. The contribution of constant region domains to the binding of murine IgM to Fcμ receptors on T cells.
J. Immunol.
140
:
143
20
Faria, A. M. C., T. D. Rao, and J. M. Phillips-Quagliata 1995. A new IgA receptor expressed on a highly activated murine B cell lymphoma. >In Advances in Mucosal Immunology, Vol. A. J. McGhee, J. Mestecky, M. W. Russell, S. Jackson, S. M. Michalek, H. Tlaskalová-Hogenova, and J. Sterzl, eds. Plenum, New York, p. 663.
21
Phillips-Quagliata, J. M., A. M. C. Faria, J. Han. D. H. Spencer, G. Haughton, P. Casali.
1999
. The IgA produced by the murine T560 B lymphoma, that arose during a graft-versus-host reaction, is polyreactive and somatically mutated.
Autoimmunity
29
:
215
22
Rao, T. D., A. A. Maghazachi, A. M. C. Faria, R. S. Basch, J. M. Phillips-Quagliata.
1992
. T560: an (H-2b × H-2a) F1 hybrid, phosphorylcholine (PC)-binding, murine B cell lymphoma that bears receptors for IgA and IgG, presents antigen and secretes IL-4.
Int. Immunol.
3
:
107
23
Hendrickson, B. A., L. Rindisbacher, B. Corthesy, D. Kendall, D. A. Waltz, M. R. Neutra, J. G. Seidman.
1996
. Lack of association of secretory component with IgA in J chain-deficient mice.
J. Immunol.
157
:
750
24
Springer, T., J. T. Bhattacharya, J. T. Cardoza, F. Saanchez-Madrid.
1982
. Monoclonal antibodies specific for rat IgG1, IgG2a, and IgG2b subclasses and κ-chain monotypic and allotypic determinants: reagents for use with rat monoclonal antibodies.
Hybridoma
1
:
257
25
Rinfret, A., C. Horne, H. Boux, A. Marks, K. J. Dorrington, M. Klein.
1990
. Isotype modulation of idiotypic expression in recombinant isotypic variants of MOPC 315.
J. Immunol.
145
:
925
26
Tucker, P. W., J. L. Slightom, F. R. Blattner.
1981
. Mouse IgA heavy chain gene sequence: implications for evolution of immunoglobulin hinge exons.
Proc. Natl. Acad. Sci. USA
78
:
7684
27
Davis, A. C., K. H. Roux, J. Pursey, M. J. Shulman.
1989
. Intermolecular disulfide bonding in IgM: effects of replacing cysteine residues in the μ heavy chain.
EMBO J.
8
:
2519
28
Fazel, S, E. J. Wiersma, M. J. Shulman.
1997
. Interplay of J chain and disulphide bonding in assembly of polymeric IgM.
Int. Immunol.
9
:
1149
29
Wiersma, E. J., C. Collins, S. Fazel, M. J. Shulman.
1998
. Structural and functional analysis of J chain-deficient IgM.
J. Immunol.
160
:
5979
30
Randall, T. D., J. W. Brewer, R. B. Corley.
1992
. Direct evidence that J chain regulates the polymeric structure of IgM in antibody-secreting B cells.
J. Biol. Chem.
267
:
18002
31
Woodward, M. P., W. W. Young, R. A. Bloodgood.
1985
. Detection of monoclonal antibodies specific for carbohydrate epitopes using periodate oxidation.
J. Immunol. Methods
178
:
143
32
Monteiro, R. C., H. Kubagawa, M. D. Cooper.
1990
. Cellular distribution, regulation and biochemical nature of an Fcα receptor in humans.
J. Exp. Med.
171
:
597
33
Laemmli, U. K..
1970
. Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227
:
680
34
Piskurich, J. F., M. H. Blanchards, K. R. Youngman, J. A. France, C. S. Kaetzel.
1995
. Molecular cloning of the mouse polymeric Ig receptor.
J. Immunol.
154
:
1735
35
Aicher, W. K., M. L. McGhee, J. R. McGhee, J. H. Eldridge, K. W. Beagley, T. F. Meyer, H. Kiyono.
1990
. Mouse IgA Fc receptor on CD3+ T cells. Molecular forms of IgA that bind to a 38-kDa FcαR protein and development of an anti-FcαR antisera.
J. Immunol.
145
:
1745
36
Phillips-Quagliata, J. M., T. D. Rao, A. A. Maghazachi, A. Gonzalez, M. C. Faria.
1991
. Sensitivity of receptors for IgA on T560, a murine B lymphoma, to phorbol myristate acetate and to phosphatidylinositol-specific phospholipase C.
Immunol. Res.
10
:
432
37
Swenson, C. D., T. Patel, R. B. Parekh, S. M. Lakshmi Tamma, R. F. Coico, G. J. Thorbecke, A. R. Amin.
1998
. Human T cell IgD receptors react with O-glycans on both human IgD and IgA1.
Eur. J. Immunol.
28
:
2366
38
Carayannopoulos, L., J. M. Hexham, J. D. Capra.
1996
. Localization of the binding site for the monocyte immunoglobulin (Ig) A-Fc receptor (CD89) to the domain boundary between Ca2 and Ca3 in human IgA1.
J. Exp. Med.
183
:
1579
39
Mattu, T. S., R. J. Pleass, A. C. Willis, M. Kilian, M. R. Wormald, A. C. Lelouch, P. M. Rudd, J. M. Woof, R. A. Dwek.
1998
. The glycosylation and structure of human serum IgA1, Fab, and Fc regions and the role of N-glycosylation on Fcα receptor interactions.
J. Biol. Chem.
273
:
2260
40
Maliszewski, C. R., C. J. March, M. A. Schoenborn, S. Gimpel, L. Shen.
1990
. Expression cloning of a human Fc receptor for IgA.
J. Exp. Med.
172
:
1665
41
Sanders, S. K., H. Kubagawa, T. Suzuki, J. L. Butler, M. D. Cooper.
1987
. IgM-binding protein expressed by activated B cells.
J. Immunol.
139
:
188
42
Nakamura, T., H. Kubagawa, T. Ohno, M. D. Cooper.
1993
. Characterization of an IgM Fc-binding receptor on human T cells.
J. Immunol.
151
:
6933
43
Brandtzaeg, P..
1977
. Human secretory component VI: immunoglobulin-binding properties.
Immunochemistry
14
:
179
44
Socken, D. J., B. J. Underdown.
1978
. Comparison of human, bovine and rabbit secretory component-immunoglobulin interactions.
Immunochemistry
15
:
499
45
Natvig, I. B., F.-E. Johansen, T. W. Nordeng, G. Haraldsen, P. Brandtzaeg.
1997
. Mechanism for enhanced external transfer of dimeric IgA over pentameric IgM: studies of diffusion, binding to the human polymeric Ig receptor, and epithelial transcytosis.
J. Immunol.
159
:
4330
46
Natvig Norderhaug, I., F.-E. Johansen, P. Krajci, P. Brandtzaeg.
1999
. Domain deletions in the human polymeric Ig receptor disclose differences between its dimeric IgA and pentameric IgM interaction.
Eur. J. Immunol.
29
:
3401
47
Underdown, B. J., I. Switzer, G. D. F. Jackson.
1992
. Rat secretory component binds poorly to rodent IgM.
J. Immunol.
149
:
487
48
Brown, T. A., M. W. Russell, R. Kulhavy, J. Mestecky.
1983
. IgA-mediated elimination of antigens by the hepatobiliary route.
Fed. Proc.
42
:
3218
49
Phillips, J. O., M. W. Russell, T. A. Brown, J. Mestecky.
1984
. Selective hepatobiliary transport of human polymeric IgA in mice.
Mol. Immunol.
21
:
907
50
Bakos, M.-A., A. Kurosky, R. M. Goldblum.
1991
. Characterization of a critical binding site for human polymeric Ig on secretory component.
J. Immunol.
147
:
3419
51
Bakos, M. A., A. Kurosky, C. S. Woodard, R. M. Denney, R. M. Goldblum.
1991
. Probing the topography of free and polymeric Ig-bound human secretory component with monoclonal antibodies.
J. Immunol.
146
:
162
52
Bakos, M.-A., A. Kurosky, E. W. Czerwinsky, R. M. Goldblum.
1993
. A conserved binding site on the receptor for polymeric Ig is homologous to CDR1 of IgVκ domains.
J. Immunol.
151
:
1346
53
Frutiger, S., G. J. Hughes, W. C. Hanly, M. Kingzette, J. C. Jaton.
1986
. The amino-terminal domain of rabbit secretory component is responsible for noncovalent binding to immunoglobulin A dimers.
J. Biol. Chem.
261
:
16673
54
Coyne, R. S., M. Siebrecht, M. C. Peitsch, J. E. Casanova.
1994
. Mutational analysis of polymeric immunoglobulin receptor/ligand interactions: evidence for the involvement of multiple complementarity determining region (CDR)-like loops in receptor domain 1.
J. Biol. Chem.
269
:
31620
55
Roe, M., I. N. Norderhaug, P. Brandtzaeg, F.-E. Johansen.
1999
. Fine specificity of ligand-binding domain 1 in the polymeric Ig receptor: importance of the CDR2-containing region for IgM interaction.
J. Immunol.
162
:
6046
56
Geneste, C., S. Iscaki, R. Mangalo, J. Pillot.
1986
. Both Fcα domains of human IgA are involved in in vitro interaction between secretory component and dimeric IgA.
Immunol. Lett.
13
:
221
57
Hexham, J. M., K. D. White, L. N. Carayannopoulos, W. Mandecki, R. Brisette, Y.-S. Yang, J. D. Capra.
1999
. A human immunoglobulin (Ig)A Cα3 domain motif directs polymeric Ig receptor-mediated secretion.
J. Exp. Med.
189
:
747
58
Fallgreen-Gebauer, E., W. Gebauer, A. Bastian, H. D. Kratzin, H. Eiffert, B. Zimmermann, M. Karas, N. Hilschmann.
1993
. The covalent linkage of secretory component to IgA.
Biol. Chem. Hoppe-Seyler
374
:
1023
59
Chintalcharuvu, K. R., A. S. Tavill, L. N. Louis, J.-P. Vaerman, M. E. Lamm, C. S. Kaetzel.
1994
. Disulphide bond formation between dimeric immunoglobulin A and the polymeric immunoglobulin receptor during hepatic transcytosis.
Hepatology
19
:
162
60
Tomasi, T. B., D. S. Czerwinski.
1976
. Naturally occurring polymers of IgA lacking J chain.
Scand. J. Immunol.
5
:
647
61
Crottet, P., S. Cottet, B. Corthésy.
1999
. Expression, purification and biochemical characterization of recombinant murine secretory component: a novel tool in mucosal immunology.
Biochem. J.
341
:
299
62
Brandtzaeg, P..
1975
. Blocking effect of J chain and J-chain antibody on the binding of secretory component to human IgA and IgM.
Scand. J. Immunol.
4
:
837
63
Vaerman, J.-P., E. E. Langendries, D. A. Giffroy, C. S. Kaetzel, C. M. Tamer Fiani, I. Moro, P. Brandtzaeg, K. Kobayashi.
1998
. Antibody against the human J chain inhibits polymeric Ig receptor-mediated biliary and epithelial transport of human polymeric IgA.
Eur. J. Immunol.
28
:
171
64
Koshland, M. E..
1975
. Structure and function of the J chain.
Adv. Immunol.
20
:
41
65
Cardone, M. H., B. L. Smith, W. Song, D. Mochly-Rosen, K. Mostov.
1994
. Phorbol myristate acetate-mediated stimulation of transcytosis and apical recycling in MDCK cells.
J. Cell Biol.
124
:
717
66
Mostov, K., C. S. Kaetzel.
1999
. Immunoglobulin transport and the polymeric immunoglobulin receptor. J. Mestecky, and J. Bienenstock, and J. McGhee, and M. Lamm, and W. Strober, and P. Ogra, eds.
Mucosal Immunology
2nd Ed.
181
Academic, San Diego.
67
Davidson, M. K., M. M. Le Beau, R. L. Eddy, T. B. Show, L. A. DiPietro, M. Kingzette, W. C. Hanly.
1988
. Genetic mapping of the human polymeric immunoglobulin receptor gene to chromosome region 1q31–q41.
Cytogenet. Cell Genet.
48
:
107
68
Krajci, P., K. H. Grzeschik, A. H. M. Guerts van Kessel, B. Olaison, P. Brandtzaeg..
1991
. The human transmembrane secretory component (poly-Ig receptor) molecular cloning, restriction fragment length polymorphism and chromosomal sublocalization.
Hum. Genet.
87
:
642
69
Kushiro, A., T. Sato.
1997
. Polymeric immunoglobulin receptor gene of mouse: sequence, structure and chromosomal location.
Gene
204
:
277