Abs reactive to DNA and DNA/histone complexes are distinguished by the presence of positively charged amino acids, such as arginine, in the heavy chain complementarity-determining region 3. The presence of these amino acids partly results from atypical VH-D-JH rearrangements such as D-D fusions and D inversions. Previous results in our laboratory demonstrated that newborn autoimmune MRL/MpJ-+/+ mice undergo these unusual recombinations more frequently when compared with normal C3H/HeJ controls. In addition, the heavy chain junctions in newborn MRL mice demonstrated a preferred usage of VH-proximal D genes and distal JH genes suggestive of secondary gene rearrangements. In this study we explore the possibility that adult MRL B220+IgM pre B cells, which have not yet undergone Ag selection, exhibit similar rearrangement patterns. Indeed, MRL pre-B cells possessed more atypical rearrangements (D-D fusions) than those of C3H/HeJ mice. However, the biased use of upstream D genes and downstream JH genes observed in the newborn MRL mice was not present in the pre-B cell library. These results suggest that the heavy chain rearrangement process persists later during B cell life in lupus-prone mice and lead us to propose a model of heavy chain receptor revision in the periphery of autoimmune mice.

Immunoglobulin gene rearrangement is a complex and ordered process that originates with recombination of D to JH, then VH to D-JH genes at the heavy chain locus. Once a functional heavy chain is created, a similar process drives rearrangement at the light chain locus, eventually resulting in production of Abs capable of responding to a diverse number of foreign Ags.

In the autoimmune disease systemic lupus erythematosus, B cells produce Abs reactive to self Ags such as DNA or chromatin (1, 2, 3, 4, 5). The B cells producing these Abs are deleted, anergized, or edited in normal individuals (6, 7, 8, 9). Although somatic mutation and V gene usage are partly accountable for the specificity of these autoreactive Abs, unconventional Ig gene rearrangements at the heavy chain locus such as D-D fusions may also be responsible (10, 11, 12). D-D fusions result from the joining of two heavy chain D genes and create a drastic change in the amino acid sequence of the heavy chain complementarity-determining region 3 (CDR3).3 The presence of positively charged amino acids such as arginine increase the affinity for Ab binding to DNA or DNA complexed to nuclear proteins such as histones (4, 10, 13). Although D-D fusions are uncommon in the normal Ab repertoire, these unusual rearrangements have frequently been observed in Abs with antinuclear specificities (12, 14).

Previous results in our laboratory demonstrated that these unusual rearrangements (D-D fusions and D inversions) occur more frequently in the Ab repertoire of newborn autoimmune-prone MRL/MpJ-+/+ (MRL) mice when compared with C3H/HeJ (C3H) normal controls (15). In addition, the autoimmune strain used more frequently upstream D genes and the most D-distal JH genes. In comparison, the nonautoimmune C3H mice tended to use the most 3′ D gene, DQ52, and the most D-proximal JH gene, JH 1. This suggests that MRL mice may have undergone secondary gene rearrangements that delete evidence of a primary rearrangement. Thus, the MRL strain may be prone to generate secondary gene rearrangements at the heavy chain locus that are more likely to include atypical junctions (15).

In this study, we wanted to determine whether similar rearrangement patterns and atypical junctions are also present in the MRL adult pre-B cell repertoire. Thus, we analyzed the heavy chain gene rearrangements in B220+IgM cells in both MRL and C3H mice. Again, the MRL strain demonstrated an increased frequency of unconventional Ig heavy chain rearrangements when compared with C3H mice. However, the pattern of D and JH use was different in adult pre-B cells compared with newborns. Therefore, we propose a model of secondary gene rearrangements at the heavy chain locus in MRL mice, which explains the differences in gene usage between the newborn and adult libraries and the frequent occurrence of atypical rearrangements in MRL mice.

Male and female animals from the lupus-prone MRL/MpJ++ (MRL) and the nonautoimmune C3H/HeJ (C3H) strains were obtained from The Jackson Laboratory (Bar Harbor, ME; Ref. 16). C3H was chosen as a control for MRL because the MRL strain is partly derived from C3H and both strains share the same Igh j allotype. The animals were maintained in our facility and sacrificed at 3 mo of age.

Bone marrow cells were obtained as previously described (17, 18). Briefly, a single-cell suspension was obtained by flushing femurs from five mice with ice-cold staining media (deficient RPMI 1640 medium without l-glutamine or phenol red (Cellgro, Herndon, VA) containing 10 mM HEPES, 3% FBS, and 0.1% NaN3). The cells were then mixed with a 1 ml syringe and treated with 0.165 M NH4Cl to eliminate erythrocytes. After washing with staining medium, the bone marrow cells were incubated with FITC-RA3.6B2 anti-B220 mAb (Southern Biotechnology Associates, Birmingham, AL) and PE-goat anti-mouse IgM (Jackson ImmunoResearch, West Grove, PA) for 15 min at 4°C, followed by 3 washes in staining media. Flow cytometric analysis and sorting of the B220+ IgM subpopulation was conducted at the Temple University FACS core facility using an Epics Elite equipped with an autocloning attachment. The sorted fractions were reanalyzed to verify that their purity exceeds 95%. We further verified that there was virtually no (<0.34%) light chain expression in the sorted pre-B cell populations (data not shown; Ref. 19).

DNA was extracted from the B220+ IgM bone marrow cells by proteinase K digestion and was then subjected to PCR amplification. The PCR primers and protocols were adapted from previously described methods (20, 21, 22). Amplifications were conducted using nested PCR as follows. In the first PCR, DNA was amplified with a mixed set of antisense JH primers (15) and either a sense J558 primer (GGGCAAGGCCACATTGACTGTAG) or a sense 7183 primer (GGGCCGATTCACCATCTCCAGAG). In the second PCR, 10 μl of the first PCR product was reamplified with primers that were internal to those used in the first PCR. The internal JH primers were identical with those previously used (15), while the internal VH primers were as follows: J558 sense (GTAGACAAATCCTCCAGCACAGC) and 7183 sense (GAGACAATGCCAAGAACACCCTG). All PCR were conducted in a volume of 50 μl containing 1.5 mM MgCl2, dNTPs (200 μM each), primers (0.4 μM each), and 2 units Taq DNA polymerase. Cycling conditions were as follows: an initial 5-min denaturation at 94°C; 35 cycles (1 min at 94°C, 2 min at 50°C, 1 min at 72°C); and a final 5-min extension at 72°C. After the second (internal) PCR, amplification products were separated on a 1% agarose gel and bands of the appropriate size were isolated with the QIAEX II agarose gel extraction kit (Qiagen, Chatsworth, CA). The purified products were directly ligated into the pGEM-T vector (Promega, Madison, WI) and transformed into JM109 cells. After blue/white selection, positive colonies were grown in 5 ml Luria-Bertani/Amp for plasmid purification. The inserts were sequenced using the fmol DNA sequencing system (Promega) with a 32P-labeled primer complementarity to the T7 promoter (GTAATACGACTCACTATAGGGC). Virtually all plasmids contain a VH-D-JH rearrangement and their sequences were analyzed using the GCG program by comparison with known D and JH germline sequences (23, 24, 25). A minimum of four contiguous identical nucleotides was required for assignment to a germline D sequence.

All analyses were conducted with the Prism software (Release 2.01; GraphPad, San Diego, CA).

B220+IgM pre-B cells were sorted from MRL and C3H bone marrow. Ig gene rearrangements were amplified using a nested PCR with primers specific for the 7183 and J558 VH gene families and for each of the four JH genes. A total of 180 MRL and 153 C3H VH-D-JH clones were sequenced and analyzed for this study. There was no significant difference in the frequency of productive vs nonproductive rearrangements between both strains (73% productive rearrangements in MRL mice and 67% in C3H mice). These sequences are available from GenBank under accession numbers AF265709 to AF266041.

Conventional heavy chain Ab gene rearrangements result from the combining of single VH, D, and JH genes in the appropriate orientation, whereas we define atypical rearrangements as D-D fusions and D inversions. D-D fusions are possible due to an cryptic heptamer embedded within most D genes that simulates a 23-bp recombination signal sequence (26). Further, D inversions result from the fact that D genes are flanked by symmetric recombination signal sequences with a 12-bp spacer that allows recombination in either orientation.

As previously observed in a newborn VH-D-JH rearrangement library (15), MRL mice displayed more atypical rearrangements than their Igh allotype-matched C3H controls (48/180 for MRL vs 25/153 for C3H) (p = 0.016 using the Fisher’s exact test; Table I). This difference was mostly due to D-D fusions in that MRL mice exhibited 44 D-D fusions, whereas C3H mice had only 15 D-D fusions. The increased frequency of atypical junctions in MRL mice was observed for both productive and nonproductive rearrangements (Table I).

Table I.

Atypical rearrangements in productive, nonproductive, and total MRL and C3H VH-D-JH rearrangementsa

StrainsMRLC3H
PNPTotalPNPTotal
Total number of rearrangements analyzed 131 49 180 103 50 153 
Total number of atypical VH-D-JH rearrangements 32 (24.4) 16 (32.7) 48 (26.7) 18 (17.5) 7 (14.0) 25 (16.3) 
Number of D-D fusions 29 (22.1) 15 (30.6) 44 (24.4) 12 (11.7) 3 (6.0) 15 (9.8) 
Number of D inversions 3 (2.3) 1 (2.0) 4 (2.2) 6 (5.8) 4 (8.0) 10 (6.5) 
StrainsMRLC3H
PNPTotalPNPTotal
Total number of rearrangements analyzed 131 49 180 103 50 153 
Total number of atypical VH-D-JH rearrangements 32 (24.4) 16 (32.7) 48 (26.7) 18 (17.5) 7 (14.0) 25 (16.3) 
Number of D-D fusions 29 (22.1) 15 (30.6) 44 (24.4) 12 (11.7) 3 (6.0) 15 (9.8) 
Number of D inversions 3 (2.3) 1 (2.0) 4 (2.2) 6 (5.8) 4 (8.0) 10 (6.5) 
a

Total atypical rearrangements are defined as D-D fusions and D inversions. Values in parentheses represent the percentage of atypical rearrangements indicated. P, Productive; NP, nonproductive.

The D genes at the heavy chain locus can be divided into four gene families. The DFL16 family is comprised of two D genes, DFL16.1 and DFL16.2, which are VH proximal. The next D family, DSP2, is the largest and is composed of 10 known members, including DSP 2.x, which we have observed to be frequently used in MRL and C3H mice (15). The last two families are composed of single genes, DST4 and DQ52. The DQ52 gene is the most JH-proximal D gene, mapping only 700 bp upstream of JH 1.

In a previous study of newborn MRL and C3H mice, we observed a clear difference in the pattern of D gene usage (15). Although C3H mice tended to use DQ52 in the majority of their heavy chain rearrangements, MRL mice used most often members of the more upstream D gene family, DSP2 (15). In the present study, there was also a significant difference in the overall distribution of D genes used between the MRL and C3H pre B cells (Table II), although the difference was less pronounced than in the newborn repertoire. Most notably, MRL mice used the JH-distal DFL16 gene family more often than their C3H counterparts. The pattern of D gene usage was similar for productive and nonproductive rearrangements in MRL and C3H mice (Table II).

Table II.

D family usage in productive, nonproductive, and total MRL and C3H VH-D-JH rearrangementsa

StrainsMRLC3H
ProductiveNonproductiveTotalProductiveNonproductiveTotal
DSP 63 (48.1) 20 (40.8) 83 (46.1) 64 (62.1) 33 (66.0) 97 (63.4) 
DFL16 19 (14.5) 8 (16.3) 27 (15.0) 5 (4.9) 6 (12.0) 11 (7.2) 
Q52 5 (3.8) 1 (2.0) 6 (3.3) 7 (6.8) 4 (8.0) 11 (7.2) 
ST4 7 (5.3) 4 (8.2) 11 (6.1) 6 (5.8) 2 (4.0) 8 (5.2) 
Others 37 (28.2) 16 (32.7) 53 (29.4) 21 (20.4) 5 (10.0) 26 (17.0) 
StrainsMRLC3H
ProductiveNonproductiveTotalProductiveNonproductiveTotal
DSP 63 (48.1) 20 (40.8) 83 (46.1) 64 (62.1) 33 (66.0) 97 (63.4) 
DFL16 19 (14.5) 8 (16.3) 27 (15.0) 5 (4.9) 6 (12.0) 11 (7.2) 
Q52 5 (3.8) 1 (2.0) 6 (3.3) 7 (6.8) 4 (8.0) 11 (7.2) 
ST4 7 (5.3) 4 (8.2) 11 (6.1) 6 (5.8) 2 (4.0) 8 (5.2) 
Others 37 (28.2) 16 (32.7) 53 (29.4) 21 (20.4) 5 (10.0) 26 (17.0) 

A minimum of four identical contiguous nucleotides was required for assignment to a given D germline gene. Others refers to D segments that are too short to be identified or D-D fusions. Values in parentheses indicate the percentage of D family use.

As in the newborns, both strains again frequently recombined a particular DSP family member, DSP 2.x, in most of their normal and atypical heavy chain gene rearrangements. MRL mice used this particular D segment in 16% of both types of rearrangements, whereas the C3H mice recombined this particular gene in 23% of conventional rearrangements and 28% of their atypical rearrangements (data not shown). The predominance of the DSP 2.x gene is interesting in that it has frequently been observed in Abs with autoreactive specificities (27, 28, 29, 30, 31). The repeated usage of DSP 2.x may be a property of the Igh j heavy chain allotype shared between the strains. DSP2.x may be unique to this allotype or it may possess distinct recombination signal sequences or regulatory elements that favor recombination to this particular gene.

Productively rearranged heavy chain D genes can be read in three different reading frames (RF; Ref. 32, 33). The majority of rearrangements use RF1 which encodes a glycine-tyrosine-rich neutral amino acid sequence. Often, RF2 usage results in the expression of a truncated Dμ protein that is selected against, whereas RF3 frequently contains a premature stop codon (34). As in the newborn library, both MRL and C3H mice favored RF1 and there was no significant difference between the two strains (Table III).

Table III.

RF usage in MRL and C3H productive VH-D-JH rearrangementsa

StrainsMRLC3H
RF1 70 (85.4) 62 (86.1) 
RF2 3 (3.7) 1 (1.4) 
RF3 9 (11.0) 9 (12.5) 
StrainsMRLC3H
RF1 70 (85.4) 62 (86.1) 
RF2 3 (3.7) 1 (1.4) 
RF3 9 (11.0) 9 (12.5) 
a

Only VH-D-JH rearrangements using single D genes from the SP2 or FL16 families were included since there is no established bias in Q52 or ST4 RF usage. Values in parentheses indicate the percentage of RF use.

There was also an overall significant difference in JH gene usage in the MRL and C3H libraries (Table IV). Most notably, both strains overused JH 3, a bias that was not observed in the newborn library (15). The JH 3 over-representation could be due to the fact that different primers were used in the present study and that certain primer pairs may favor amplification over others. This assay bias, although theoretically possible, is unlikely in that the adult library was created using the same primers for the JH genes and only those used to amplify VH gene families were changed. Biased JH 3 usage has also been observed in other repertoire studies in autoimmune and nonautoimmune mouse strains, although it is yet unclear why the over-representation was detected (35, 36).

Table IV.

JH germline gene usage in productive, nonproductive, and total MRL and C3H VH-D-JH rearrangementsa

StrainsMRLC3H
ProductiveNonproductiveTotalProductiveNonproductiveTotal
JH17 (13.0) 2 (4.1) 19 (10.5) 7 (6.8) 3 (6.0) 10 (6.5) 
JH25 (19.1) 15 (30.6) 40 (22.2) 10 (9.7) 10 (20.0) 20 (13.1) 
JH83 (63.4) 32 (65.3) 115 (63.9) 75 (72.8) 34 (68.0) 109 (71.2) 
JH6 (4.6) 0 (0) 6 (3.3) 11 (10.7) 3 (6.0) 14 (9.2) 
StrainsMRLC3H
ProductiveNonproductiveTotalProductiveNonproductiveTotal
JH17 (13.0) 2 (4.1) 19 (10.5) 7 (6.8) 3 (6.0) 10 (6.5) 
JH25 (19.1) 15 (30.6) 40 (22.2) 10 (9.7) 10 (20.0) 20 (13.1) 
JH83 (63.4) 32 (65.3) 115 (63.9) 75 (72.8) 34 (68.0) 109 (71.2) 
JH6 (4.6) 0 (0) 6 (3.3) 11 (10.7) 3 (6.0) 14 (9.2) 
a

Values in parentheses are the percentage of JH use.

The junctional diversity of Ab genes is enhanced through the addition of N and P nucleotides. N nucleotides are added by TdT, which is absent in newborn mice and up-regulated in the adult (20, 37). As expected, almost all of the adult pre-B cell sequences contained N nucleotide additions (Table V), whereas newborn MRL and C3H mice showed a limited number of N nucleotides (15). Further, there was no significant difference in the amount of N nucleotide additions between the two strains. MRL mice possessed an average of 5.71 (± 3.54) N nucleotides per CDR3, and C3H mice had an average of 5.34 (±3.31) N nucleotides per CDR3. P nucleotides are presumably created by uneven cutting of DNA that resolves hairpins created by intermediate coding joints of the Ab genes (38). As with N nucleotide additions, there was no significant difference between MRL and C3H adult pre-B cells in the frequency of P nucleotide additions (Table V).

Table V.

Frequency of MRL and C3H VH-D-JH rearrangements with homologous junctions and N or P nucleotide additionsa

StrainsMRLC3H
Total number of rearrangements analyzed 180 153 
Number of rearrangements with homologous junctions 40 (22.2) 28 (18.3) 
Number of rearrangements with N nucleotides 175 (97.2) 146 (95.4) 
Number of rearrangements with P nucleotides 69 (38.3) 67 (43.8) 
StrainsMRLC3H
Total number of rearrangements analyzed 180 153 
Number of rearrangements with homologous junctions 40 (22.2) 28 (18.3) 
Number of rearrangements with N nucleotides 175 (97.2) 146 (95.4) 
Number of rearrangements with P nucleotides 69 (38.3) 67 (43.8) 
a

The values in parentheses indicate the percentage of homologous junctions and N or P nucleotides for each strain.

The deduced amino acid sequences for the productive MRL and C3H VH-D-JH rearrangements are listed in Fig. 1. The heavy chain CDR3 is critical for interaction with Ag. In particular, specific residues such as arginine have been linked to mediating CDR3 binding of Abs to DNA or DNA/histone complexes (4, 10, 29). Overall, the CDR3 sequences deduced from productive pre-B cell rearrangements displayed similar properties for both strains (Table V, Fig. 1). For instance, there was no significant difference in length between the MRL and C3H CDR3 sequences (12.14 ± 2.562 amino acids for MRL and 11.29 ± 2.768 for C3H) and their average arginine contents were similar (0.37 ± 0.62 arginine per CDR3 for MRL and 0.31 ± 0.51 arginine per CDR3 for C3H). Taken together, these data suggest that at least some of the events leading to the presence of antichromatin CDR3 sequences in MRL mice occur later than the pre-B cell stage.

FIGURE 1.

Deduced amino acid sequences from productive VH-D-JH rearrangements in MRL and C3H mice. The amino acid sequences include the second invariant VH cysteine (position 92) and the invariant JH tryptophan (position 103; Ref. 24 ). MRL sequences start with the letter M, while C3H sequences begin with the letter C.

FIGURE 1.

Deduced amino acid sequences from productive VH-D-JH rearrangements in MRL and C3H mice. The amino acid sequences include the second invariant VH cysteine (position 92) and the invariant JH tryptophan (position 103; Ref. 24 ). MRL sequences start with the letter M, while C3H sequences begin with the letter C.

Close modal

The development of systemic lupus erythematosus is characterized by the presence of antinuclear Abs capable of binding DNA and nucleosomes (1, 2, 3, 4). These Abs differ from conventional Abs in that they frequently possess positively charged amino acids such as arginine in the CDR3 of their heavy chain (4, 10). Atypical VH-D-JH rearrangements such as D-D fusions and D inversions favor the presence of these residues allowing binding to nuclear epitopes (10). Previous results in our laboratory revealed that in the lupus-prone MRL mouse strain, an increased number of B cell precursors with atypical VH-D-JH rearrangements may favor the production of antinuclear Abs (15). The analysis of PCR-amplified heavy chain rearrangements from newborn mice showed that this strain possesses more unusual rearrangements of D-D fusions and D inversions than C3H controls (15).

In this study, we wanted to evaluate the VH-D-JH rearrangements amplified from adult MRL and C3H B220+IgM pre-B cells which have not yet undergone Ag selection. Our current results confirm our earlier study (15) and suggest that MRL mice indeed exhibit an intrinsic defect that leads to the development of B cell precursors with atypical Ig heavy chain gene rearrangements. It is interesting that most of the difference between the strains is due to D-D fusions in that MRL mice had 44 D-D fusions compared with 15 in C3H. This observation is revealing in that while D inversions are uncommon, they are “conventional” in that they follow established recombination rules. However, D-D fusions may be more predictive of an inherent recombination defect because of the unconventional nature of this particular rearrangement which breaks the 12/23 rule.

When comparing the current results to our previous report (15), we observed that the bias in upstream D and downstream JH gene usage previously seen in newborn MRL rearrangements was not present in the adult libraries. A significant difference is that the neonatal libraries were unselected and contained a large proportion of mature B cells, whereas the adult libraries were restricted to pre-B cells. Therefore, the difference in D and JH usage pattern between the newborn and adult libraries in MRL mice may be related to the stage of B cell maturation. Our results with the newborn library led us to propose that MRL mice may undergo more secondary D-JH rearrangements because they typically recombine more VH-proximal D genes to more distal JH genes when compared with C3H controls. Because of this biased gene usage and the presence of atypical rearrangements in MRL mice, we hypothesized that the mechanisms of atypical heavy chain gene rearrangement and secondary gene rearrangements were related. In a conventional secondary rearrangement, an upstream D gene recombines to a downstream JH gene, thus eliminating the intervening DNA sequence and any evidence of a primary rearrangement. In a D-D fusion, an upstream D gene combines with a preformed D-JH rearrangement forming a D-DJH complex. However, although our MRL pre-B cells contained a significant number of D-D fusions, we did not observe the strong bias in D and JH gene usage seen in the newborn library (15). This suggests that during autoimmunity D-D fusions may also arise from mechanisms other than incomplete secondary rearrangements. For example, VH genes could directly recombine with downstream D genes in accordance with the 12/23 rule. This VH-D product may then rearrange to a downstream D-JH complex resulting in a heavy chain with a D-D fusion (26). It has also been suggested that TdT may play a role in both the production of anti-DNA Abs and Ig gene usage. TdT-mediated N nucleotide additions increase the length of the CDR3 thus increasing the potential to generate arginine residues in the Ag binding site (39). C57BL/6-Fas(lpr) mice deficient in TdT had significantly fewer arginines in their CDR3 and a lower frequency of anti-DNA Abs (39). Further, Tuaillon and Capra (40) recently demonstrated that the presence or absence of TdT can modulate the choice of VH, D, and JH use independent of B cell Ag stimulation. Nevertheless, the mechanism by which TdT could affect Ig gene choice during rearrangement remains unknown and our data do not indicate a quantitative difference in TdT activity between MRL and C3H mice.

The analysis of the VH-D-JH libraries from newborn (15) and adult pre-B cells (this study) leads us to propose a model of D-JH revision in the periphery of autoimmune mice (Fig. 2). After D to JH rearrangements on both alleles at the pro-B cell stage, the first allele undergoes a VH to DJH rearrangement (Fig. 2, A and B). If the rearrangement on the first heavy chain allele is productive, the B cell will proceed through normal maturation stages. However, subsequent D to JH rearrangements may continue on the other allele, resulting in a biased usage of upstream D and downstream JH sequences or in D-D fusions (Fig. 2,B; Ref. 41). Later in B cell life, the productive rearrangement on the first allele is inactivated (for instance by a nonproductive VH replacement), but the B cell may be rescued by a productive VH to DJH (or VH to D-DJH) rearrangement on the second allele (Fig. 2,D; Ref. 42). The B cell now possesses a new productive rearrangement on the second allele that will be biased in its D and JH usage and may also contain D-D fusions that will predispose the B cell to react with DNA or DNA-protein complexes (Fig. 2 E).

FIGURE 2.

Atypical rearrangements in autoimmunity: a putative mechanism involving secondary Ig heavy chain rearrangements. A, At the pro-B cell stage, D to JH rearrangements take place on both alleles. B, The first (upper) allele undergoes a VH to DJH rearrangement. If the rearrangement on the first heavy chain allele is productive, the B cell will proceed through normal maturation stages. Subsequent D to JH rearrangements continue on the other (lower) allele, resulting in a D-D fusion (C) or in a biased usage of upstream D and downstream JH sequences (not depicted). D, The productive rearrangement on the first allele is inactivated (designated by the X), for instance by a nonproductive VH replacement, but the doomed B cell may be rescued by a productive VH to D-DJH rearrangement on the second allele. E, The B cell now possesses a new productive rearrangement on the second allele that contains a D-D fusion or is biased in its D and JH usage. A and B take place centrally whereas, in our model, the events in D and E occur in the periphery.

FIGURE 2.

Atypical rearrangements in autoimmunity: a putative mechanism involving secondary Ig heavy chain rearrangements. A, At the pro-B cell stage, D to JH rearrangements take place on both alleles. B, The first (upper) allele undergoes a VH to DJH rearrangement. If the rearrangement on the first heavy chain allele is productive, the B cell will proceed through normal maturation stages. Subsequent D to JH rearrangements continue on the other (lower) allele, resulting in a D-D fusion (C) or in a biased usage of upstream D and downstream JH sequences (not depicted). D, The productive rearrangement on the first allele is inactivated (designated by the X), for instance by a nonproductive VH replacement, but the doomed B cell may be rescued by a productive VH to D-DJH rearrangement on the second allele. E, The B cell now possesses a new productive rearrangement on the second allele that contains a D-D fusion or is biased in its D and JH usage. A and B take place centrally whereas, in our model, the events in D and E occur in the periphery.

Close modal

This model obviously applies only to situations where the first VH-D-JH rearrangement is productive. This situation occurs often enough to make our model meaningful and biologically relevant. The model also proposes that B cell development in autoimmune mice will manifest some unique properties. The first is that D to JH rearrangements will be ongoing on the second allele, even after a successful VH to D-JH rearrangement on the first allele. This is not unlikely, especially when one considers that secondary D to JH rearrangement is mechanistically similar to a secondary Vk to Jk rearrangement (8, 9). Secondary light chain rearrangements occur routinely during the process of receptor editing, and recent work suggests that both central and peripheral editing can occur more frequently in lupus patients (43, 44, 45). Further, D-JH replacements were observed in an Abelson murine leukemia virus-transformed B cell line providing evidence that an initial D-JH recombination does not prevent secondary recombinations (41).

Another critical element of our model is the rescue of a doomed B cell by a V to D-JH rearrangement on the second heavy chain allele. In our model, the B cell should be doomed because its initial VH-D-JH rearrangement has become inactivated. A likely reason for this event could be a stop codon resulting from the somatic hypermutation process, but this may also result from an additional rearrangement event within the VH-D-JH region. Most VH genes contain embedded heptamers that may serve to mediate V(D)J recombination-type events (46). When the heptamer located in the 3′ region of the VH segment is used, the rearrangement may be functional, leading to a so-called VH replacement, but rearrangements at other heptamers will be nonfunctional and remain undetected because they result in the death of the B cell (47, 48). Studies with transgenic mice as well as recent human work suggest that such recombination within pre-existing VH-D-JH rearrangements are more common than previously thought (49, 50, 51, 52). RAG1 and RAG2 are likely to be required for these types of VH replacements. This is supported by studies showing that these enzymes can be expressed in the periphery although it is unclear whether this is due to re-activation or continuous expression in B cells that have left the bone marrow only recently (53, 54, 55, 56). Irrespective of the mechanism, the involvement of RAG1 and RAG2 in the recombination on the first allele would indicate that they are also available to mediate the recombination on the second allele.

Another critical factor is the existence of apoptosis defects during lupus. Although no single consistent defect has been identified, there is evidence that apoptosis is impaired in lupus individuals (57, 58, 59, 60). This decrease in apoptosis efficiency may be critical in this situation because it would allow enough survival time for the productive rearrangement to take place on the second allele, whereas a normal B cell would otherwise die before being rescued. An additional important element for autoimmunity is the timing of this secondary rearrangement. As mentioned above, the rearrangements on the second allele will be biased toward the use of certain D and JH genes. This is of particular relevance during systemic autoimmunity where self-reactive Abs often express the downstream JH 4 gene, an observation consistent with our hypothesis that successive rearrangements may have taken place on the second allele (61, 62, 63, 64). Further, these secondary rearrangements may include D-D fusions that favor reactivity with chromatin Ags. Because these “rescue-type” rearrangements will take place in the periphery, they will not be subject to the rigorous mechanisms of central tolerance and they may even occur within a context of B cell activation, resulting in the expansion of potentially self-reactive clones.

We are grateful to Dr. Martin Weigert for his comments on the manuscript, to Dr. Reiner Class for help with the flow cytometry, and to Mike Fowler for his technical assistance.

1

This work was supported by National Institutes of Health Grant AI-26665.

3

Abbreviations used in this paper: CDR3, complementarity-determining region 3; MRL, MRL/MpJ-+/+ mice; C3H, C3H/HeJ mice; RF, reading frames.

1
Pisetsky, D. S..
1992
. Anti-DNA antibodies in systemic lupus erythematosus.
Rheum. Dis. Clin. N. Am.
18
:
437
2
Stollar, B. D..
1994
. Molecular analysis of anti-DNA antibodies.
FASEB J.
8
:
337
3
Radic, M. Z., M. Weigert.
1994
. Genetic and structural evidence for antigen selection of anti-DNA antibodies.
Annu. Rev. Immunol.
12
:
487
4
Monestier, M..
1997
. Autoantibodies to nucleosomes and histone-DNA complexes.
Methods
11
:
36
5
Spatz, L., A. Iliev, V. Saenko, L. Jones, M. Irigoyen, A. Manheimer-Lory, B. Gaynor, C. Putterman, M. Bynoe, C. Kowal, et al
1997
. Studies on the structure, regulation, and pathogenic potential of anti-dsDNA antibodies.
Methods
11
:
70
6
Nemazee, D. A., L. Burki.
1988
. Clonal deletion in B lymphocytes in a transgenic mouse bearing anti-MHC class I antibody genes.
Nature
337
:
562
7
Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. Smith-Gill, R. A. Brink, H. Pritchard-Briscoe, J. Wotherspoon, R. H. Loblay, K. Raphael, et al
1988
. Altered immunoglobulin expression and functional silencing of self-reactive lymphocytes in transgenic mice.
Nature
334
:
676
8
Tiegs, S. L., D. M. Russell, D. Nemazee.
1993
. Receptor editing in self-reactive bone marrow B cells.
J. Exp. Med.
177
:
1009
9
Gay, D., T. Saunders, S. Camper, M. Weigert.
1993
. Receptor editing: an approach by autoreactive B cells to escape tolerance.
J. Exp. Med.
177
:
999
10
Shlomchik, M., M. Mascelli, H. Shan, M. Z. Radic, D. Pisetsky, A. Marshak-Rothstein, M. Weigert.
1990
. Anti-DNA antibodies from autoimmune mice arise by clonal expansion and somatic mutation.
J. Exp. Med.
171
:
265
11
Radic, M. Z., M. A. Mascelli, J. Erikson, H. Shan, M. Shlomchik, M. Weigert.
1989
. Structural patterns in anti-DNA antibodies from MRL/lpr mice.
Cold Spring Harbor Symp. Quant. Biol.
54
:
933
12
Eilat, D., R. Fischel.
1991
. Recurrent utilization of genetic elements in V regions of antinucleic acid antibodies from autoimmune mice.
J. Immunol.
147
:
361
13
Radic, M. Z., J. Mackle, J. Erikson, C. Mol, W. F. Anderson, M. Weigert.
1993
. Residues that mediate DNA binding of autoimmune antibodies.
J. Immunol.
150
:
4966
14
Bangs, L. A., I. E. Sanz, J. M. Teale.
1991
. Comparison of D, JH, and junctional diversity in the fetal, adult, and aged B cell repertoires.
J. Immunol.
146
:
1996
15
Klonowski, K. D., L. L. Primiano, M. Monestier.
1999
. Atypical VH-D-JH rearrangements in newborn autoimmune MRL mice.
J. Immunol.
162
:
1566
16
Theofilopoulos, A. N., R. Kofler, D. Noonan, P. Singer, F. J. Dixon.
1986
. Molecular aspects of murine systemic lupus erythematosus.
Springer Semin. Immunopathol.
9
:
121
17
Wasserman, R., Y.-S. Li, R. R. Hardy.
1997
. Down-regulation of terminal deoxynucleotidyl transferase by Ig heavy chain in B lineage cells.
J. Immunol.
158
:
1133
18
Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, K. Hayakawa.
1991
. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow.
J. Exp. Med.
1744
:
1213
19
Ye, J., S. K. McCray, S. H. Clarke.
1996
. The transition of pre-BI to pre-BII cells is dependent on the VH structure of the μ/surrogate L chain receptor.
EMBO J.
15
:
1524
20
Feeney, A. J..
1990
. Lack of N regions in fetal and neonatal mouse immunoglobulin V-D-J junctional sequences.
J. Exp. Med.
172
:
1377
21
Feeney, A. J..
1992
. Predominance of VH-D-JH junctions occurring at sites of short sequence homology results in limited junctional diversity in neonatal antibodies.
J. Immunol.
149
:
222
22
Chukwuocha, R. U., A. J. Feeney.
1993
. Role of homology-directed recombination: predominantly productive rearrangements of Vh81X in newborns but not in adults.
Mol. Immunol.
30
:
1473
23
Devereux, J., P. Haeberli, O. Smithies.
1984
. A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12
:
387
24
Kabat, E. A., T. T. Wu, H. M. Perry, K. S. Gottesman, C. Foeller.
1991
.
Sequences of Proteins of Immunological Interest
1
U.S. Government Printing Office, Bethesda.
25
Feeney, A. J., R. Riblet.
1993
. DST4: a new, and probably the last, functional DH gene in the BALB/c mouse.
Immunogenetics
37
:
217
26
Meek, K. D., C. A. Hasemann, J. D. Capra.
1989
. Novel rearrangements at the immunoglobulin D locus: inversions and fusions add to IgH somatic diversity.
J. Exp. Med.
170
:
39
27
Tarlinton, D., A. M. Stall, L. A. Herzenberg.
1988
. Repetitive usage of immunoglobulin VH and D gene segments in CD5+ Ly-1 B clones of (NZB × NZW)F1 mice.
EMBO J.
7
:
3705
28
Staines, N. A., F. J. Ward, A. N. Denbury, J. Mitchiner, O. Hartley, D. Eilat, D. A. Isenberg, S. Bansal.
1993
. Primary sequence and location of the idiotopes of V-88, a DNA-binding monoclonal autoantibody, determined by idiotope scanning with synthetic peptides on pins.
Immunology
78
:
371
29
Krishnan, M. R., N. T. Jou, T. N. Marion.
1996
. Correlation between the amino acid position of arginine in VH-CDR3 and specificity for native DNA among autoimmune antibodies.
J. Immunol.
157
:
2430
30
Mo, J. A., R. Holmdahl.
1996
. The B cell response to autologous type II collagen: biased V gene repertoire with V gene sharing and epitope shift.
J. Immunol.
157
:
2440
31
Weller, S., C. Conde, A. M. Knapp, H. Levallois, S. Gilfillan, J. L. Pasquali, T. Martin.
1997
. Autoantibodies in mice lacking terminal deoxynucleotidyl transferase: evidence for a role of N region addition in the polyreactivity and in the affinities of anti-DNA antibodies.
J. Immunol.
159
:
3890
32
Raaphorst, F. M., C. S. Raman, B. T. Nall, J. M. Teale.
1997
. Molecular mechanisms governing reading frame choice of immunoglobulin diversity genes.
Immunol. Today
18
:
37
33
Kaartinen, M., O. Mäkelä.
1985
. Reading of D genes in variable frames as a source of antibody diversity.
Immunol. Today
6
:
324
34
Gu, H., D. Kitamura, K. Rajewsky.
1991
. B cell development regulated by gene rearrangement: arrest of maturation by membrane-bound Dμ protein and selection of DH element reading frames.
Cell
65
:
47
35
Alarcon-Riquelme, M. E., C. Fernandez.
1995
. CDR3 regions in the preimmune VH B cell repertoire of lpr mice.
Clin. Exp. Immunol.
101
:
73
36
Tsukada, S., H. Sugiyama, Y. Oka, S. Kishimoto.
1990
. Estimation of D segment usage in initial D to JH joinings in a murine immature B cell line: preferential usage of DFL16.1, the most 5′ D segment and DQ52, the most JH-proximal D segment.
J. Immunol
144
:
4053
37
Li, Y. S., K. Hayakawa, R. R. Hardy.
1993
. The regulated expression of B lineage associated genes during B cell differentiation in bone marrow and fetal liver.
J. Exp. Med.
178
:
951
38
Shockett, P. E., D. G. Schatz.
1999
. DNA hairpin opening mediated by the RAG1 and RAG2 proteins.
Mol. Cell Biol.
19
:
4159
39
Molano, I. D., M. K. Wloch, A. A. Alexander, H. Watanabe, G. S. Gilkeson.
2000
. Effect of a genetic deficiency of terminal deoxynucleotidyl transferase on autoantibody production by C57BL6 Fas(lpr) mice.
Clin. Immunol.
94
:
24
40
Tuaillon, N., J. D. Capra.
2000
. Evidence that terminal deoxynucleotidyltransferase expression plays a role in Ig heavy chain gene segment utilization.
J. Immunol.
164
:
6387
41
Reth, M. G., S. Jackson, F. W. Alt.
1986
. VHDJH formation and DJH replacement during pre-B differentiation: non-random usage of gene segments.
EMBO J.
5
:
2131
42
Maeda, T., H. Sugiyama, Y. Tani, S. Kishimoto.
1989
. The DJH complex remains active in recombination to VH segments after the loss of μ-chain expression in μ-positive pre-B cells.
J. Immunol
142
:
3652
43
Dorner, T., N. L. Farner, P. E. Lipsky.
1999
. Igλ and heavy chain gene usage in early untreated systemic lupus erythematosus suggests intensive B cell stimulation.
J. Immunol
163
:
1027
44
Dorner, T., S. J. Foster, N. L. Farner, P. E. Lipsky.
1998
. Immunoglobulin κ-chain receptor editing in systemic lupus erythematosus.
J. Clin. Invest.
102
:
688
45
Brard, F., M. Shannon, E. L. Prak, S. Litwin, M. Weigert.
1999
. Somatic mutation and light chain rearrangement generate autoimmunity in anti-single-stranded DNA transgenic MRL/lpr mice.
J. Exp. Med.
190
:
691
46
Reth, M., P. Gehrmann, E. Petrac, P. Wiese.
1986
. A novel VH to VHDJH joining mechanism in heavy-chain-negative (null) pre-B cells results in heavy-chain production.
Nature
322
:
840
47
Choi, Y., S. J. Greenberg, T. L. Du, P. M. Ward, P. M. Overturf, M. L. Brecher, M. Ballow.
1996
. Clonal evolution in B-lineage acute lymphoblastic leukemia by contemporaneous VH-VH gene replacements and VH-DJH gene rearrangements.
Blood
87
:
2506
48
Fanning, L., F. E. Bertrand, C. Steinberg, G. E. Wu.
1998
. Molecular mechanisms involved in receptor editing at the Ig heavy chain locus.
Int. Immunol.
10
:
241
49
Cascalho, M., J. Wong, M. Wabl.
1997
. VH gene replacement in hyperselected B cells of the quasimonoclonal mouse.
J. Immunol
159
:
5795
50
Lantelme, E., B. Palermo, L. Granziero, S. Mantovani, R. Campanelli, V. Monafo, A. Lanzavecchia, C. Giachino.
2000
. Recombinase-activating gene expression and V(D)J recombination in CD4+CD3low mature T lymphocytes.
J. Immunol.
164
:
3455
51
Wilson, P. C., K. Wilson, Y. J. Liu, J. Banchereau, V. Pascual, J. D. Capra.
2000
. Receptor revision of immunoglobulin heavy chain variable region genes in normal human B lymphocytes.
J. Exp. Med.
191
:
1881
52
Nemazee, D., M. Weigert.
2000
. Revising B cell receptors.
J. Exp. Med.
191
:
1813
53
Han, S., B. Zheng, D. G. Schatz, E. Spanopoulou, G. Kelsoe.
1996
. Neoteny in lymphocytes: Rag1 and Rag2 expression in germinal center B cells.
Science
274
:
2094
54
Hikida, M., M. Mori, T. Takai, K. Tomochika, K. Hamatani, H. Ohmori.
1996
. Reexpression of RAG-1 and RAG-2 genes in activated mature mouse B cells.
Science
274
:
2092
55
Yu, W., H. Nagaoka, M. Jankovic, Z. Misulovin, H. Suh, A. Rolink, F. Melchers, E. Meffre, M. C. Nussenzweig.
1999
. Continued RAG expression in late stages of B cell development and no apparent re-induction after immunization.
Nature
400
:
682
56
Monroe, R. J., K. J. Seidl, F. Gaertner, S. Han, F. Chen, J. Sekiguchi, J. Wang, R. Ferrini, L. Davidson, G. Kelsoe, F. W. Alt.
1999
. RAG2:GFP knockin mice reveal novel aspects of RAG2 expression in primary and peripheral lymphoid tissues.
Immunity
11
:
201
57
Wu, J., J. Wilson, J. He, L. Xiang, P. H. Schur, J. D. Mountz.
1996
. Fas ligand mutation in a patient with systemic lupus erythematosus and lymphoproliferative disease.
J. Clin. Invest.
98
:
1107
58
Dianzani, U., M. Bragardo, D. DiFranco, C. Alliaudi, P. Scagni, D. Buonfiglio, V. Redoglia, S. Bonissoni, A. Correra, I. Dianzani, U. Ramenghi.
1997
. Deficiency of the Fas apoptosis pathway without Fas gene mutations in pediatric patients with autoimmunity/lymphoproliferation.
Blood
89
:
2871
59
Elkon, K. B., A. Marshak-Rothstein.
1996
. B cells in systemic autoimmune disease: recent insights from Fas-deficient mice and men.
Curr. Opin. Immunol
8
:
852
60
Caricchio, R., P. L. Cohen.
1999
. Spontaneous and induced apoptosis in systemic lupus erythematosus: multiple assays fail to reveal consistent abnormalities.
Cell. Immunol.
198
:
54
61
Shlomchik, M., D. Nemazee, J. Van Snick, M. Weigert.
1987
. Variable region sequences of murine IgM anti-IgG monoclonal autoantibodies (rheumatoid factors). II. Comparison of hybridomas derived by lipopolysaccharide stimulation and secondary protein immunization.
J. Exp. Med.
165
:
970
62
Bloom, D. D., J. L. Davignon, M. W. Retter, M. J. Shlomchik, D. S. Pisetsky, P. L. Cohen, R. A. Eisenberg, S. H. Clarke.
1993
. V region gene analysis of anti-Sm hybridomas from MRL/Mp-lpr/lpr mice.
J. Immunol.
150
:
1591
63
Duchosal, M. A., R. Kofler, R. S. Balderas, M. T. Aguado, F. J. Dixon, A. N. Theofilopoulos.
1989
. Genetic diversity of murine rheumatoid factors.
J. Immunol.
142
:
1737
64
Losman, M. J., T. M. Fasy, K. E. Novick, M. Monestier.
1992
. Monoclonal autoantibodies to subnucleosomes from a MRL/Mp-+/+ mouse: oligoclonality of the antibody response and recognition of a determinant composed of histones H2A, H2B, and DNA.
J. Immunol.
148
:
1561