Toll-like receptor 2 (TLR2) is involved in the innate immunity by recognizing various bacterial components. We have previously reported that TLR2 gene expression is rapidly induced by LPS or inflammatory cytokines in macrophages, and by TCR engagement or IL-2/IL-15 stimulation in T cells. Here, to investigate the mechanisms governing TLR2 transcription, we cloned the 5′ upstream region of the mouse TLR2 (mTLR2) gene and mapped its transcriptional start site. The 5′ upstream region of the mTLR2 gene contains two NF-κB, two CCAAT/enhancer binding protein, one cAMP response element-binding protein, and one STAT consensus sequences. In mouse macrophage cell lines, deletion of both NF-κB sites caused the complete loss of mTLR2 promoter responsiveness to TNF-α. NF-κB sites were also important but not absolutely necessary for LPS-mediated mTLR2 promoter activation. In T cell lines, mTLR2 responsiveness to IL-15 was abrogated by the 3′ NF-κB mutation, whereas 5′ NF-κB showed no functional significance. The STAT binding site also seemed to contribute, as the deletion of this sequence significantly reduced the IL-15-mediated mTLR2 promoter activation. EMSAs confirmed nuclear protein binding to both NF-κB sites in macrophages following LPS and TNF-α stimulation and to the 3′ NF-κB site in T cells after IL-15 treatment. Thus, NF-κB activation is important but differently involved in the regulation of mTLR2 gene expression in macrophages and T cells following LPS or cytokine stimulation.

Toll, first identified in Drosophila (1), participates in anti-microbial immune responses and is conserved in various species (2). It encodes a transmembrane protein whose intracellular domain is homologous to those of IL-1 receptor family proteins (1). In adult flies, Toll activation results in the activation of a NF-κB homologue known as dorsal and the subsequent production of antimicrobial peptides (1). Recently, a series of mammalian Toll homologues have been identified and termed Toll-like receptors (TLRs)3 (3).

In the past few years, various members of the TLR family have been discovered (3, 4, 5). Recent studies have shown that a member of this family, TLR2, mediates signals from bacterial LPS (6, 7, 8) or other bacterial components such as lipoteichoic acid, peptidoglycan, and lipoproteins (9, 10, 11, 12). Although TLR2 can mediate LPS signals in vitro, its role as the LPS receptor in vivo is ambiguous since the gene-disrupted mouse of TLR2 shows almost normal responses to LPS (13).

We have previously cloned the mouse TLR2 cDNA, analyzed its gene expression in immunocompetent cells, and reported that LPS and various cytokines including TNF-α, IFN-γ, IL-1β, IL-2, and IL-15 rapidly induce TLR2 gene expression in macrophages, whereas the gene expression of TLR4, another member of TLR, remains constant (14). We have also demonstrated that TCR engagement and the stimulation with IL-2 and IL-15 increase TLR2 mRNA in T cells. Although these results have indicated that the induced TLR2 plays important roles in mediating immune responses in the later phases of infections, the transcriptional machinery controlling TLR2 gene expression remains largely unknown. In the present study, we have analyzed the 5′ upstream region of the mouse TLR2 gene and investigated the mechanisms of its expression in mouse macrophage and T cell lines. The 5′ flanking region of the mTLR2 gene contains a number of cis-acting elements that LPS or inflammatory cytokines might modulate, including two NF-κB binding sites. We constructed a series of the 5′ deletion constructs along with NF-κB deletion mutants to analyze the functional importance of these elements. We also analyzed protein binding to some of these sites after LPS or cytokine stimulation. Our results indicated the critical but different requirements for NF-κB in the activation-driven mouse TLR2 (mTLR2) promoter in macrophages and T cells.

Recombinant mouse TNF-α and human IL-15 were purchased from PeproTech (Seattle, WA). LPS from Escherichia coli serotype B6:026 was obtained from Sigma (St. Louis, MO). Synthetic E. coli-type lipid A, ONO4007, was kindly provided by Ono Pharmaceutical (Tokyo, Japan). RPMI 1640 and DMEM were purchased from Sigma. Anti-p50, p65 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA) and anti-STAT5 Ab was obtained from PharMingen/Transduction Laboratories (San Diego, CA).

The mTLR2 cDNA containing the whole coding region was labeled with 32P by random priming and used for screening the mouse genomic phage library, Lambda Fix II (Stratagene, La Jolla, CA). Phages were plated with E coli strain XL1-Blue MRA and transferred to nitrocellulose membranes. The membranes were prehybridized in 500 mM NaCl, 1% SDS, and 10% dextran sulfate for 3 h at 65°C, followed by hybridization with 32P-labeled probe for 14 h at 65°C. Membranes were washed twice with 2× SSC and 0.1% SDS for 5 min at 50°C, twice with 0.1× SSC and 0.1% SDS for 15 min at 50°C, and exposed to x-ray films. Positive clones were plated and screened until successive pure clones were obtained. Phage DNAs were isolated from positive clones and characterized by enzyme restriction mapping. Subfragments were cloned into pBlueScript II KS+ (Stratagene) and were enzymatically nucleotide sequenced by the DNA sequencer (model 373A sequencer) using DYEnamic ET terminator cycle sequencing kit (Amersham Pharmacia Biotech, Piscataway, NJ). The nucleotide sequences upstream to the transcriptional initiation site were searched for the potential binding sites for transcription factors by TRANSFAC (http://www.dna.affrc.go.jp and http://www.motif.genome.ad.jp).

A mouse macrophage cell line, RAW264.7 was obtained from The Institute of Physical and Chemical Research (Japan) Cell Bank (Tsukuba, Japan) and maintained in DMEM with 10% newborn calf serum. A mouse T cell line, CTLL-2, was obtained from The Institute of Physical and Chemical Research (Japan) Cell Bank and maintained in RPMI 1640 with 10% FCS and 10 ng/ml mouse IL-2. For the transient transfection, 2 μg of the mTLR2 luciferase construct, in combination with 0.2 μg of pRL-SV40 as an internal control, was transfected into RAW264.7 by LipofectAMINE (Life Technologies, Rockville, MD) or CTLL-2 by DMRIE-C (Life Technologies) according to the manufacturer’s instructions. Forty-eight hours after transfection, cells were stimulated with 1 μg/ml LPS, 10 μg/ml synthetic lipid A, 10 ng/ml TNF-α, or 10 ng/ml IL-15 for 8 h. Then cells were lysed and the lysates were used for luciferase activity measurements using the dual luciferase reporter assay system (Toyo Ink, Tokyo, Japan) according to the manufacturer’s instructions. All of the luciferase assays shown in the current study were repeated at least three times, and a typical result was shown for each experiment.

Primer extension analysis was applied to map the initiation start site of the mTLR2 gene. Total RNAs were prepared from RAW264.7 cells stimulated with 1 μg/ml LPS. An oligonucleotide, AGGAGTCCTCCAGCCGCCGC, complementary to the 5′ untranslated region of the mTLR2 cDNA (8) was end labeled with 32P and hybridized with 10 μg of RNA at 55°C for 8 h. The reverse transcription was performed in 20 μl of first-strand buffer and 100 U of Superscript II (Life Technologies) at 42°C for 1 h. The same primer was used in DNA sequencing on a plasmid containing the 5′ flanking region of the mTLR2 gene with fmol DNA sequencing systems (Promega, Madison, WI). The extended primer was run along with the sequencing product on an 8% denaturing polyacrylamide urea gel.

A series of synthesis oligonucleotide senses (CCGCTCGAGCCCAATCGTGGGATTCCATG (pGL3–2332), CCGCTCGAGGTTGACCCCATGGTGGTT (pGL3–1486), CCGCTCGAGGCAGGGGGACAAAGTGTTGA (pGL3–789), CCGCTCGAGTGGGCCTCGATAGGGTATTT (pGL3–598), CCGCTCGAGCATTCAGCCATCATTGTCCA (PGL3–384), CCGCTCGAGAACGTTTCCTAGCTGGAGCA (pGL3–297), CCGCTCGAGAGGCGAGCTGGGAGGCAGCT (pGL3–201), CCGCTCGAGACGGAGCCTCTGGACTTTCA (pGL3–144), CCGCTCGAGGCCTGCCCTGTGGCTCCTGC (pGL3–117)) and an antisense (GGAAGATCTCTGGGCACCAGCCTAGGAAG, derived from the respective part of the 5′ upstream region of the mTLR2 gene) were used to generate a series of 5′ deletion DNA fragments. All PCR fragments were digested with XhoI and BglII and subcloned into pGL3-basic vector (Promega).

To construct a NF-κB deletion mutant, 3′ NF-κB-mut, two PCR products from two pairs of primers (CCGCTCGAGGTTGACCCCATGGTGGTT and CGGATATCGGTGTCCTAAAGAGAAGCT; GCGATATCACGGAGCCTCTGGACTTTCA and GGAAGATCTCTGGGCACCAGCCTAGGAAG) were amplified, digested with EcoRV, ligated, and cloned into the pGL3-basic vector. To construct 5′ NF-κB-mut, PCR products from two pairs of primers (CCGCTCGAGGTTGACCCCATGGTGGTT and CGGATATCTACTTTAAAACAAGTTAATC; GCGATTATCCTTACAACTGGAATATGGAG and GGAAGATCTCTGGGCACCAGCCTAGGAAG) were amplified, digested with EcoRV, ligated, and cloned into pGL3-basic vector. To construct 3/5′ NF-κB-mut, PCR products from three pairs of primers (CCGCTCGAGGTTGACCCCATGGTGGTT and CGGATATCTACTTTAAAACAAGTTAATC; GCGATTATCCTTACAACTGGAATATGGAG and CGGATATCGGTGTCCTAAAGAGAAG CT; GCGATATCACGGAGCCTCTGGACTTTCA and GGAAGATCTCTGGGCACCAGCCTAGGAAG) were amplified, digested with EcoRV, and cloned into pGL3-basic vector. To prepare pGL3–384-mut, oligonucleotides used for pGL3–384 were used with the 3′ NF-κB-mut as the template. The amplified product was cloned into pGL3-basic vector. Plasmid DNAs were purified from bacterial cultures using an Endofree Plasmid Maxi kit (Qiagen, Chatsworth, CA). Finally, restriction enzyme mapping and sequencing confirmed all constructs.

PcDNA3-STAT5a, a dominant negative STAT5a expression plasmid, was a generous gift from Alan D. Andrea (Dana-Farber Cancer Institute, Boston, MA).

Cellular extracts were prepared from untreated or IL-15-treated CTLL-2 cells using PLC lysis buffer (50 mM HEPES (pH 7.0), 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF, 10 mM NaPPi, 1 mM Na3VO4, 1 mM PMSF, 10 mg/ml aprotinin, and 10 mg/ml leupeptin). The lysates from 107 cells were incubated with the STAT5 Ab for 2 h at 4°C, followed by protein G-Sepharose beads (Amersham Pharmacia Biotech) for an additional 1 h. The beads were washed three times with lysis buffer, suspended in SDS sample buffer, and heated at 95°C for 5 min. The eluted proteins were applied to SDS-polyacrylamide gel and electrotransferred to a nitrocellulose membrane. The membrane was blocked for 2 h in 2% BSA-TBST (20 mM Tris-HCl (pH 7.6), 0.15 M sodium chloride, and 0.1% Tween 20), incubated with primary Abs in TBST for 1 h, washed three times with TBST, and incubated for 1 h with HRP-conjugated antimouse Ig (Amersham, Arlington Heights, IL) diluted 1:10,000 in TBST. After three washes in TBST, the blot was developed with the ECL system (Amersham Pharmacia Biotech) according to the manufacturer’s instructions.

Nuclear extracts were prepared from RAW264.7 stimulated with 1 μg/ml LPS or 10 ng/ml TNF-α and from CTLL-2 stimulated with 10 ng/ml IL-15 as previously described (15). The binding sequences used for the EMSAs comprise 5′-TTTAAAGTAGGGGGTTTCCCCTTACAACTG for 5′ NF-κB, 5′-ACCTGGGGAATTCCCACACG for 3′ NF-κB, and 5′-GAGCATTCCAATAACCAAAG for STAT. Approximately 1 × 105 cpm of an oligonucleotide, labeled with 32P using T4 polynucleotide kinase, 10 μg of nuclear extract, and 1 μg of poly(dI · dC) were added to the binding buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 4% glycerol) and incubated for 30 min at 4°C. For competition assays, nuclear extracts were incubated with a 50- or 100-fold excess of unlabeled over labeled oligonucleotide in before the 32P-labeled probe. For supershift assays, anti-p50, anti-p65 NF-κB, or anti-STAT5 Abs were incubated with nuclear extracts for 2 h before the binding reactions. The reaction mixtures were run through a 6% nondenaturing polyacrylamide gel at 4°C in TBE buffer (90 mM Tris-borate, 2 mM EDTA).

We have previously demonstrated that TLR2 mRNA is up-regulated in mouse macrophages in response to LPS and various cytokines including IL-1β, IL-2, IL-15, TNF-α, and IFN-γ (14). TLR2 gene expression is also induced by TCR engagement, IL-2, or IL-15 stimulation in T cells (8). To study the transcriptional regulation of mTLR2, a mouse genomic library was screened with a mTLR2 cDNA probe. After screening ∼2 × 106 clones, we isolated two positive clones and characterized them by enzyme mapping and nucleotide sequencing. The two overlapping clones contained inserts of 14.6 and 15 kb, respectively (Fig. 1). The exon/intron junctions of the mTLR2 gene were partially decided. The published 5′ untranslated region of mTLR2 cDNA (8) was encoded by three exons. The first ATG that corresponded to the translational start codon was located at 15 bases downstream of the 5′ end of the third exon.

FIGURE 1.

Restriction enzyme map and characterization of mTLR2 gene. Isolated positive phage clones were characterized by restriction enzyme mapping. The two positive clones with inserts of 14.6 and 15 kb overlapped by 11.7 kb. The first two exons are shown as black boxes and the position of the first methionine is shown.

FIGURE 1.

Restriction enzyme map and characterization of mTLR2 gene. Isolated positive phage clones were characterized by restriction enzyme mapping. The two positive clones with inserts of 14.6 and 15 kb overlapped by 11.7 kb. The first two exons are shown as black boxes and the position of the first methionine is shown.

Close modal

The transcriptional initiation site of the mouse TLR2 gene was determined by primer extension analysis. A synthetic oligonucleotide complementary to nucleotide positions 37–57 of the reported mTLR2 cDNA sequence (8) was hybridized to total RNA from LPS-stimulated RAW264.7 cells and extended by reverse transcription. As shown in Fig. 2,A, the length of the extended product was 102 nt, as determined by comparison with the sequence ladders from the same primer. This transcriptional initiation site was located 55 bp upstream of the 5′ end of the previously described cDNA (8). Several probes prepared from the genomic DNA 5′ upstream of this site did not generate any signals in Northern blotting analyses using RNA from LPS-treated RAW264.7 cells (data not shown). The mRNA transcription initiation site is designated as +1 in the numbering of the nucleotide sequence throughout this paper (Fig. 2 B).

FIGURE 2.

Nucleotide sequence of the mouse TLR2 gene 5′ upstream region. A, Primer extension assay. Ten micrograms of total RNA from LPS-stimulated RAW264.7 cells was hybridized with 32P-labeled oligonucleotide complementary to nucleotide positions 37–57 of the reported mTLR2 cDNA sequence. The reverse transcription was performed and the generated cDNA was run along with sequencing ladders on a polyacrylamide gel. ∗, Generated cDNA from primer extension. The complementary sequences of sequencing products are shown and the transcriptional start site is indicated. B, The nucleotide sequences of the 5′ flanking region are given in capital letters, nucleotide sequences of exon I are shown in lowercase letters, and the transcriptional start site is shown in bold capital letters. The numbering begins at the transcriptional start site. The potential transcription factor binding sites, C/EBP, CREB, NF-κB, and STAT, are indicated by underlines and 5′ end of each deletion luciferase reporter construct is indicated.

FIGURE 2.

Nucleotide sequence of the mouse TLR2 gene 5′ upstream region. A, Primer extension assay. Ten micrograms of total RNA from LPS-stimulated RAW264.7 cells was hybridized with 32P-labeled oligonucleotide complementary to nucleotide positions 37–57 of the reported mTLR2 cDNA sequence. The reverse transcription was performed and the generated cDNA was run along with sequencing ladders on a polyacrylamide gel. ∗, Generated cDNA from primer extension. The complementary sequences of sequencing products are shown and the transcriptional start site is indicated. B, The nucleotide sequences of the 5′ flanking region are given in capital letters, nucleotide sequences of exon I are shown in lowercase letters, and the transcriptional start site is shown in bold capital letters. The numbering begins at the transcriptional start site. The potential transcription factor binding sites, C/EBP, CREB, NF-κB, and STAT, are indicated by underlines and 5′ end of each deletion luciferase reporter construct is indicated.

Close modal

The nucleotide sequence analyses determined the coding part of the genomic DNA is precisely identical to the previously established cDNA sequence (8). Although the putative TATA or CAAT sequence was not identified in the DNA sequence upstream of the defined transcriptional start site, this region was rich in GC content. A computer search of the 5′ flanking sequence with the transcription factor databases from TRANSFAC (http://www.dna.affrc.go.jp and http://www.motif.genome.ad.jp) disclosed several putative binding sites for transcription factors. These included two NF-κB (positions −1115 to −1106 and −160 to −150), two CCAAT/enhancer binding protein (C/EBP; positions −1591 to −1578 and −777 to 765), a cAMP response element-binding protein (CREB; positions −1267 to −1260), and a STAT (positions −279 to −271) binding sites (Fig. 2 B).

A series of 5′ deletion constructs of the mTLR2 promoter region was initially generated to analyze mTLR2 promoter activity and to identify functional cis-acting elements required for mTLR2 gene expression (Fig. 3,A). These 5′-deleted DNAs were cloned into the promoter-less luciferase vector pGL3-basic (Promega). The generated plasmids were transfected into a mouse macrophage cell line, RAW264.7, whose mTLR2 mRNA was responsive to various stimulants (14). Forty-eight hours after the transfection, the cells were stimulated with LPS or TNF-α for 8 h, and the luciferase activity was measured. The results standardized by the internal control are shown in Fig. 3 B.

FIGURE 3.

mTLR2 promoter functional analysis using 5′ deletion constructs in RAW264.7 cells. A, Schematic presentation of the 5′ deletion luciferase constructs. The structure of the mTLR2 gene promoter is shown on the top. Symbols represent the binding site for indicated transcription factors. A series of 5′ deletion constructs were constructed as described in Materials and Methods. The number of each construct corresponds to its 5′ end. B, The 5′ deletion constructs (shown in A) were transfected into RAW264.7 cells along with pRL-SV40 as an internal control. The transfected cells were left untreated or treated for 8 h with 1 μg/ml LPS or 10 ng/ml TNF-α as indicated. Luciferase activities are expressed as fold induction in treated samples relative to untreated control for each luciferase reporter construct.

FIGURE 3.

mTLR2 promoter functional analysis using 5′ deletion constructs in RAW264.7 cells. A, Schematic presentation of the 5′ deletion luciferase constructs. The structure of the mTLR2 gene promoter is shown on the top. Symbols represent the binding site for indicated transcription factors. A series of 5′ deletion constructs were constructed as described in Materials and Methods. The number of each construct corresponds to its 5′ end. B, The 5′ deletion constructs (shown in A) were transfected into RAW264.7 cells along with pRL-SV40 as an internal control. The transfected cells were left untreated or treated for 8 h with 1 μg/ml LPS or 10 ng/ml TNF-α as indicated. Luciferase activities are expressed as fold induction in treated samples relative to untreated control for each luciferase reporter construct.

Close modal

The highest induction was obtained with pGL3–1486 for both LPS and TNF-α treatments. The longer construct, pGL3–2332, showed less induction for each treatment, suggesting that the 1486-bp 5′ upstream region of the mTLR2 gene is sufficient for the maximal induction by LPS and TNF-α. It may also indicate the region between −2332 and −1486 is inhibitory for the mTLR2 induction. The five shorter constructs (789, 598, 384, 297, and 201) showed slightly less induction for both LPS and TNF-α. However, the responsiveness for these treatments was abrogated when the construct was downed to −144 (pGL3–144). We also transfected these constructs into another mouse macrophage cell line, J774.1 and obtained very similar results to those from RAW264.7 cells (data not shown).

In our previous report, we demonstrated that specific inhibitors for extracellular signal-regulated kinase (ERK) did not inhibit LPS-mediated mTLR2 mRNA induction in RAW264.7 cells, suggesting that the activation of ERK is not essential for the induction (14). In contrast, curcumin, the NF-κB inhibitor, effectively inhibited the mTLR2 up-regulation by LPS (14). This result, however, was not conclusive since the inhibitory effect of curcumin is not specific to NF-κB.

Our luciferase assay data with 5′ deletion constructs (Fig. 3,A) are consistent with the essential roles of the two NF-κB sites (positions −1115 to −1106 and −160 to −150) in mTLR2 mRNA induction by LPS and TNF-α. To further confirm the roles of NF-κB binding sites, we separately mutated two NF-κB binding sites of pGL3–1486 (termed 5′ NF-κB-mut and 3′ NF-κB-mut, respectively) and compared their activity with pGL3–1486 (Fig. 4, A and B). Each NF-κB mutant showed a lower response to LPS or TNF-α treatment than the wild-type construct, suggesting that both NF-κB sites contributed to the full mTLR2 mRNA induction by LPS and TNF-α. Deletion of both NF-κB sites (5′/3′ NF-κB-mut) abrogated the response to TNF-α. This construct, however, still retained a significant response to LPS stimulation.

FIGURE 4.

Roles of NF-κB binding sites in the mTLR2 promoter activities in RAW264.7 cells. A, The mTLR2 promoter constructs, pGL3–1486 and pGL3–384, were used as wild types to produce the NF-κB deletion constructs. The X indicates that the particular transcription factor site has been deleted. B, The NF-κB deletion mutant constructs were produced from wild-type pGL3–1486 and transfected into RAW264.7 cells. The fold induction by LPS and TNF-α is shown. C, The shortened luciferase reporter construct, pGL3–384, was used as a template to construct pGL3–384-mut in which 3′ NF-κB was deleted. Luciferase activities from both constructs and pure pGL3-basic vector are shown.

FIGURE 4.

Roles of NF-κB binding sites in the mTLR2 promoter activities in RAW264.7 cells. A, The mTLR2 promoter constructs, pGL3–1486 and pGL3–384, were used as wild types to produce the NF-κB deletion constructs. The X indicates that the particular transcription factor site has been deleted. B, The NF-κB deletion mutant constructs were produced from wild-type pGL3–1486 and transfected into RAW264.7 cells. The fold induction by LPS and TNF-α is shown. C, The shortened luciferase reporter construct, pGL3–384, was used as a template to construct pGL3–384-mut in which 3′ NF-κB was deleted. Luciferase activities from both constructs and pure pGL3-basic vector are shown.

Close modal

To localize LPS-responsive elements other than NF-κB binding sites, we next mutated the 3′ NF-κB site of a shorter construct, pGL3–384. The new construct termed pGL3–384-mut did not show any induction in response to either LPS or TNF-α (Fig. 4 C). Altogether, these results have demonstrated that in mouse macrophages, two NF-κB binding sites of mTLR2 promoter are essential in the transcriptional response to TNF-α. They are also important for the LPS response, but transcriptional factors other than NF-κB are also activated by LPS and contribute by affecting the TLR2 5′ flanking region between −384 and −1486.

To rule out the possibility that LPS-mediated mTLR2 promoter activation was due to a small amount of contaminating substances other than LPS, additional experiments were done with synthetic lipid A, the biological center of LPS. A series of 5′ deletion constructs and NF-κB-mutated constructs were transfected into RAW264.7 cells and transfected cells were stimulated with 10 μg/ml synthetic lipid A. The luciferase assay results with lipid A (Fig. 5, A and B) showed very similar patterns to those with LPS (Figs. 3 and 4). These results indicated that the LPS-mediated mTLR2 promoter activation was not due to the contaminating substances such as lipoproteins.

FIGURE 5.

Responsiveness of mTLR2 promoter to synthetic lipid A stimulation. A, A series of mTLR2 deletion luciferase constructs was transfected into RAW264.7 cells. The transfected cells were left unstimulated or stimulated with 10 μg/ml synthetic lipid A for 8 h and the fold induction is shown. B, A series of NF-κB deletion constructs was also transfected into RAW264.7 cells. The fold induction of luciferase activities mediated by synthetic lipid A stimulation (10 μg/ml) is shown.

FIGURE 5.

Responsiveness of mTLR2 promoter to synthetic lipid A stimulation. A, A series of mTLR2 deletion luciferase constructs was transfected into RAW264.7 cells. The transfected cells were left unstimulated or stimulated with 10 μg/ml synthetic lipid A for 8 h and the fold induction is shown. B, A series of NF-κB deletion constructs was also transfected into RAW264.7 cells. The fold induction of luciferase activities mediated by synthetic lipid A stimulation (10 μg/ml) is shown.

Close modal

A significant fraction of T cells express TLR2 and TLR4 genes, and gene expression of TLR2, unlike that of TLR4, is rapidly induced by TCR engagement, IL-2, or IL-15 stimulation (8). Although we have revealed that ERK and p38 kinase activation are essential for the mTLR2 mRNA up-regulation by TCR engagement (14), molecular mechanisms mediating IL-2/IL-15 responsiveness have not been explored.

To analyze the mechanisms of IL-15-mediated mTLR2 gene expression in T cells, CTLL-2, a mouse T cell line, was transiently transfected with a series of 5′-deleted mTLR2 promoter constructs (Fig. 3,A). Forty-eight hours after transfection, cells were starved and stimulated with IL-15 for 8 h. The results of luciferase assays are shown in Fig. 6 A. They were similar to those with LPS- or TNF-α-stimulated RAW264.7 cells, except for pGL3–201. Although this construct was slightly responsive to IL-15, the induction ratio was significantly less than the four longer constructs (789, 598, 384, and 297). We also performed the assay with IL-2 stimulation and obtained very similar results (data not shown), which seemed reasonable since IL-2 and IL-15 share the same signaling receptors (IL-2R β and common γ chain) in T cells (16).

FIGURE 6.

The mTLR2 promoter activities in the CTLL-2 cell line. A, CTLL-2 cells were transfected with a series of 5′ deletion reporter luciferase constructs as described in Fig. 3 A. Transfected cells were left unstimulated or stimulated with 10 ng/ml IL-15 for 8 h. IL-15-mediated mTLR2 promoters activities are shown. B, IL-15 mediated mTLR2 promoter induction in CTLL-2 and RAW264.7 cells. The different NF-κB deletion mutants are indicated and fold induction by IL-15 in both cell lines is shown. C, The deletion of the 3′ NF-κB binding site eliminates the induction of IL-15. Luciferase activity in CTLL-2 is shown.

FIGURE 6.

The mTLR2 promoter activities in the CTLL-2 cell line. A, CTLL-2 cells were transfected with a series of 5′ deletion reporter luciferase constructs as described in Fig. 3 A. Transfected cells were left unstimulated or stimulated with 10 ng/ml IL-15 for 8 h. IL-15-mediated mTLR2 promoters activities are shown. B, IL-15 mediated mTLR2 promoter induction in CTLL-2 and RAW264.7 cells. The different NF-κB deletion mutants are indicated and fold induction by IL-15 in both cell lines is shown. C, The deletion of the 3′ NF-κB binding site eliminates the induction of IL-15. Luciferase activity in CTLL-2 is shown.

Close modal

Since IL-15 activates NF-κB (17, 18), we also used NF-κB binding site-disrupted constructs to analyze the role of NF-κB in mTLR2 gene expression mediated by IL-15 in CTLL-2 cells (Fig. 6, B and C). Surprisingly, 5′ NF-κB deletion had no effect on mTLR2 gene induction by IL-15. In contrast, the 3′ NF-κB mutation caused the complete loss of the responsiveness in CTLL-2 cells. These results indicated that the two NF-κB binding sites of the mTLR2 gene promoter play different roles in IL-15-mediated mTLR2 gene transcription in T cells. We also transfected these constructs into another mouse T cell line, S49.1, for IL-15 stimulation and obtained basically the same results as those from CTLL-2 cells (data not shown).

The different roles of the two NF-κB sites are not specific to IL-15 but due to the cell type difference, since IL-15-mediated mTLR2 promoter activation was mediated by each NF-κB site in RAW264.7 cells (Fig. 6 B).

To examine the NF-κB binding to the mTLR2 promoter, EMSAs were performed (Fig. 7). The double-strand oligonucleotides corresponding to the 5′ and 3′ NF-κB sequences of mTLR2 promoter were labeled and incubated with nuclear extracts from RAW264.7 cells stimulated with LPS or TNF-α. We observed constitutive protein binding to the 3′ NF-κB probe, but not to the 5′ NF-κB probe in this cell line (Fig. 7, A and B). Stimulation with LPS or TNF-α significantly induced protein binding to both 5′ and 3′ NF-κB probes. The protein binding was abrogated by the addition of a 50-fold molar excess of unlabeled oligonucleotides, suggesting the binding was specific.

FIGURE 7.

Specific protein-binding activities of NF-κB sequences in RAW264.7 cells. A, The nuclear extracts were prepared from RAW264.7 cells. RAW264.7 cells were untreated or treated with 10 ng/ml TNF-α or 1 μg/ml LPS for 30 min. Ten micrograms of nuclear extracts was incubated with 32P-labeled oligonucleotide complementary to the 5′ NF-κB sequence for 30 min. Protein-DNA complexes were separated on a 6% polyacrylamide gel run in 0.25× TBE. Autoradiography was performed at room temperature for 12 h. Comp refers to EMSA binding reactions that also contained a 50-fold molar excess of the unlabeled oligonucleotide as the competitor. The binding efficiencies and free probe signals are shown. B, The nuclear extracts from treated RAW264.7 cells were preincubated for 2 h with Abs against the p50 or p65 subunit as indicated. The 5′ NF-κB probe was added and the mixtures were incubated on ice for 30 min. The results of supershift assays are shown. C, The competition assay to the 3′ NF-κB sequence. The 100-fold excess unlabeled oligonucleotide was added as the competitor. The binding mixtures were run in 1× TBE. The DNA-protein binding complexes and competition results are shown. D, The supershift assays with Abs against p50 and p65 used the 3′ NF-κB probe. The shifted bands are shown.

FIGURE 7.

Specific protein-binding activities of NF-κB sequences in RAW264.7 cells. A, The nuclear extracts were prepared from RAW264.7 cells. RAW264.7 cells were untreated or treated with 10 ng/ml TNF-α or 1 μg/ml LPS for 30 min. Ten micrograms of nuclear extracts was incubated with 32P-labeled oligonucleotide complementary to the 5′ NF-κB sequence for 30 min. Protein-DNA complexes were separated on a 6% polyacrylamide gel run in 0.25× TBE. Autoradiography was performed at room temperature for 12 h. Comp refers to EMSA binding reactions that also contained a 50-fold molar excess of the unlabeled oligonucleotide as the competitor. The binding efficiencies and free probe signals are shown. B, The nuclear extracts from treated RAW264.7 cells were preincubated for 2 h with Abs against the p50 or p65 subunit as indicated. The 5′ NF-κB probe was added and the mixtures were incubated on ice for 30 min. The results of supershift assays are shown. C, The competition assay to the 3′ NF-κB sequence. The 100-fold excess unlabeled oligonucleotide was added as the competitor. The binding mixtures were run in 1× TBE. The DNA-protein binding complexes and competition results are shown. D, The supershift assays with Abs against p50 and p65 used the 3′ NF-κB probe. The shifted bands are shown.

Close modal

We next addressed whether extracts bound to 5′ and 3′ NF-κB probes could be modified by Abs against NF-κB/Rel family members p50 and p65. As shown in the Fig. 7,C, the inducible 3′ NF-κB complexes were supershifted with Abs against p50 and p65, indicating the contributions of both p65 and p50 in the shift complexes. In contrast, inducible 5′ NF-κB complexes were shifted with Ab against p65 but not affected by that of p50 (Fig. 7 D). Thus, the 5′ NF-κB site binds the p65 homodimer.

EMSAs using two NF-κB probes were also performed for IL-15-treated CTLL-2 cells (Fig. 8, A and C). Unlike LPS or TNF-α in macrophages, IL-15 induced nuclear protein binding only to the 3′ NF-κB site in T cells (Fig. 8, A and C). The protein-DNA complex of the 3′ NF-κB site was supershifted by both anti-p65 and p50 Abs (Fig. 8 B).

FIGURE 8.

Specific protein-binding activities of NF-κB sequences in CTLL-2 cells. A, CTLL-2 were untreated or treated with 10 ng/ml IL-15 for 50 min and the nuclear extracts were prepared. For competition assays, 10 μg of nuclear extracts was incubated with a 100-fold molar excess of the unlabeled 3′ NF-κB oligonucleotide as described in Materials and Methods. The binding bands are shown. B, The nuclear extracts used in A were used for supershift assays with Abs against p50 and p65 used 3′ NF-κB probe. The shifted bands are indicated. C, IL-15 does not induce protein binding to the 5′ NF-κB site in CTLL-2 cells. The 50-fold excess unlabeled oligonucleotide was added as the competitor.

FIGURE 8.

Specific protein-binding activities of NF-κB sequences in CTLL-2 cells. A, CTLL-2 were untreated or treated with 10 ng/ml IL-15 for 50 min and the nuclear extracts were prepared. For competition assays, 10 μg of nuclear extracts was incubated with a 100-fold molar excess of the unlabeled 3′ NF-κB oligonucleotide as described in Materials and Methods. The binding bands are shown. B, The nuclear extracts used in A were used for supershift assays with Abs against p50 and p65 used 3′ NF-κB probe. The shifted bands are indicated. C, IL-15 does not induce protein binding to the 5′ NF-κB site in CTLL-2 cells. The 50-fold excess unlabeled oligonucleotide was added as the competitor.

Close modal

Since IL-15 induced the activation of STAT5 in T cells (19), we investigated the possibility that STAT-binding element might also be required in IL-15-mediated mTLR2 gene expression in T cells. Western blot analyses revealed that IL-15 induced tyrosine phosphorylation of STAT5 in CTLL-2 cells (Fig. 9,A). Shortened luciferase reporter constructs that have 3′ NF-κB and STAT binding sites, pGL3–384, were cotransfected with a STAT5a dominant negative expression plasmid. The cotransfection of this dominant negative construct abrogated the response to IL-15 (Fig. 9,B). We then performed electrophoretic gel shift assay using an oligonucleotide corresponding to the STAT consensus sequence found in the mTLR2 promoter region and STAT5 Ab. As shown in Fig. 8 C, IL-15 induced the specific protein binding to this STAT consensus sequence, which was supershifted by STAT5 Ab. These results have indicated that STAT5 activation contributes to the mTLR2 gene transcription in IL-15-stimulated T cells.

FIGURE 9.

The roles of the STAT-binding element in IL-15-mediated mTLR2 gene transcription in CTLL-2 cells. A, The cell lysates were prepared from untreated or IL-15-treated CTLL-2 cells. STAT5 immunoprecipitates were separated by SDS-PAGE and blotted with either anti-phosphotyrosine or anti-STAT5 Ab. B, The pGL3–384 reporter construct was cotransfected with STAT5a dominant negative expression plasmid. The fold induction of luciferase activities by IL-15 is shown. C, CTLL-2 cells were untreated or treated with 10 ng/ml IL-15 for 15 min and the nuclear extracts were prepared. The competition and supershift assays performed as described in Materials and Methods used STAT5 probe. The competition results and shifted band are shown.

FIGURE 9.

The roles of the STAT-binding element in IL-15-mediated mTLR2 gene transcription in CTLL-2 cells. A, The cell lysates were prepared from untreated or IL-15-treated CTLL-2 cells. STAT5 immunoprecipitates were separated by SDS-PAGE and blotted with either anti-phosphotyrosine or anti-STAT5 Ab. B, The pGL3–384 reporter construct was cotransfected with STAT5a dominant negative expression plasmid. The fold induction of luciferase activities by IL-15 is shown. C, CTLL-2 cells were untreated or treated with 10 ng/ml IL-15 for 15 min and the nuclear extracts were prepared. The competition and supershift assays performed as described in Materials and Methods used STAT5 probe. The competition results and shifted band are shown.

Close modal

In this study, we have described the isolation and characterization of the 5′ regulatory region of the mTLR2 gene. In our previous reports (8, 14), we have demonstrated that mTLR2 gene expression is significantly inducible in macrophages and T cells. In macrophages, mTLR2 mRNA was rapidly induced by LPS, IL-1β, IL-2, IL-15, IFN-γ, or TNF-α (14), whereas in T cells it was responsive to TCR engagement, IL-2, or IL-15 (8). In our current study, we focused on the molecular mechanism of how mTLR2 transcription is regulated by LPS, TNF-α, and IL-15. Our results of promoter functional analyses showed that the upstream region reaching up to −1486 is sufficient for the fully inducible expression of the mTLR2 gene in both macrophages and T cells. Nucleotide sequencing analysis of this region identified consensus sequences for binding of various transcription factors that may be involve in the induction of mTLR2 gene expression. They included two NF-κB, two C/EBP, one CREB, and one STAT consensus sequences, all of which are responsive to LPS or cytokine stimulation in some gene promoters. This is in contrast to mouse and human TLR4 promoters, in which neither NF-κB nor CREB consensus sequences were found in the 5′ proximal regions of the transcriptional initiation sites. Both human and mouse TLR4 genes, however, contains two C/EBP sites in their promoter regions (20). The difference of the promoter sequences between these two TLRs probably explains their different mRNA induction patterns in macrophages and T cells as we have previously reported (8, 14).

In our previous report, we demonstrated that curcumin, an NF-κB inhibitor, effectively inhibited the LPS-mediated mTLR2 gene expression in macrophages (14). This result, however, was not conclusive since the inhibitory effect of curcumin is not specific. The luciferase assay results in our current report are consistent with the important roles of the two NF-κB sites (positions −1115 to −1106 and −160 to −150) in mTLR2 mRNA induction by both LPS and TNF-α. The deletion analysis of each NF-κB site clearly showed that NF-κB has indeed integrating function for full stimulation of the mTLR2 promoter in macrophages. Thus, like several other receptors, TLR2 not only activates NF-κB, but it itself is induced by NF-κB.

NF-κB encompasses an important family of transcriptional activators. It is critical for the inducible expression of multiple genes, including those playing essential roles in immune responses. The members of the NF-κB family include p50 (NF-κB1), p52 (NF-κB2), p65 (RelA), RelB, v-Rel, and c-Rel (21, 22, 23, 24, 25). In cells, NF-κB exists as homo- or heterodimers with distinct DNA-binding specificity. A heterodimer composed of p50 and p65 subunits is the most common dimer (21, 22). In unstimulated cells, the NF-κB proteins exist in cytoplasm and form an inactive complex with the inhibitory protein inhibitor κB (26, 27). Cellular stimulation with LPS, inflammatory cytokines, or phorbol ester results in phosphorylation, ubiquitination, and subsequent degradation of inhibitor κB. This allows the translocation of NF-κB to the nucleus where it up-regulates the transcription of the target genes (1, 23).

In contrast to the essential role of NF-κB activation in TNF-α-mediated mTLR2 mRNA induction, LPS and lipid A could activate mTLR2 promoter, albeit to a lesser degree, in the absence of both NF-κB binding sites (Fig. 4,B). The additional regulatory site(s) should exist between −1486 and −384 because pGL3–384-mut, in which the 3′ NF-κB site was mutated, failed to respond to LPS and lipid A (Figs. 4 C and 5B). Although NF-κB is the most typical transcription factor activated by LPS, LPS signals also involve several other transcription factors in various cell types, namely, ATF-2, AP-1, Sp-1, CREB, and C/EBP (28, 29, 30). It is of note that the 1486 bp upstream region of the mTLR2 gene contains CREB and C/EBP binding sites. It is thus conceivable that some of these sites contribute to the LPS-mediated mTLR2 transcription. Our experiments using 5′ deletion constructs revealed that the difference between pGL3–1486 and pGL3–789 was more marked with LPS than with TNF-α treatment. In contrast, pGL3–598 showed almost the same induction as pGL-789 with LPS treatment. These results are consistent with the idea that the CREB binding site (−1267 to −1260) plays a role in the LPS-mediated mTLR2 induction. It has recently been reported that CREB plays a role in the TNF-α mRNA induction by LPS in macrophages (28). In another report, it has been revealed that CREB is activated by LPS through p38 stress-activated protein kinase and is involved in the up-regulation of CD80, CD83, and CD86 (31). It is noteworthy that LPS-mediated mTLR2 gene expression was slightly inhibited by a specific inhibitor of p38 stress-activated protein kinase (14).

The results of the supershift assay suggested the difference between the two NF-κB sites. The 3′ NF-κB was supershifted by Abs against p50 and p65, whereas 5′ NF-κB was supershifted only by an Ab against p65. Thus, 3′ NF-κB is preferably bound by the p50/p65 heterodimer and 5′ NF-κB is more prone to bind the p65 homodimer.

p65 homodimers have different binding specificities from p50/p65 heterodimers (32). p65 homodimers preferentially bind GGGRNTTTCC, as evidenced by screening with a pool of random oligonucleotides (33). This motif is somewhat different from the p50 homodimer consensus sequence (GGGGATYCCC), and the DNA motifs that bind p65 homodimers but not p50 homodimers do not bind p50/p65 heterodimers well. The sequence of the 5′ NF-κB binding site of the mTLR2 promoter (GGGGGTTTCC) exactly matches the motif for the p65 homodimer and thus may preferentially bind p65 homodimers.

In a recent paper, it has been suggested that some kinds of the commercially available LPS contain small amounts of contaminants that can be recognized by TLR2 (34). In our study, however, mTLR2 promoter was activated by synthetic lipid A treatment, clearly indicating that LPS could activate mTLR2 promoter with its lipid A portion.

In contrast to macrophages, only the 3′ NF-κB sequence seemed functional in IL-15-treated CTLL-2 cells. It is consistent with the EMSA data in which the 5′ NF-κB probe was not shifted with nuclear extracts prepared from the IL-15-treated T cell line (Fig. 8,B). The different roles of these NF-κB sites seemed cell-type specific, since both 5′ and 3′ NF-κB sites were functional in IL-15-treated RAW264.7 cells (Fig. 6 B). Considering the differences of the binding specificity of the two NF-κB sites, it is reasonable to presume that IL-15-treated CTLL-2 cells did not contain sufficient amounts of p65 homodimers. The molar ratio of the three NF-κB complexes (p50 homodimer, p50/p65 heterodimer, and p65 homodimer) varies among different cell types (21). Although the expression of p65 is essentially constitutive, some increases have been reported in some T cell lines (21) and TNF-α-treated astrocytes (35). Unfortunately, the effects of LPS, TNF-α, or IL-15 on the ratio of NF-κB dimers in macrophages or T cells has not been elucidated.

In contrast to LPS or TNF-α, the region between −297and −201 plays a role in the IL-15-mediated mTLR2 transcription. It is likely that a STAT binding site in this region is responsible for this, since STAT5 was tyrosine phosphorylated and bound the STAT consensus sequence in IL-15-treated CTLL-2 cells (Fig. 9, A and C). Interestingly, the expression of the dominant negative form of STAT5a abrogated the mTLR2 promoter activation by IL-15 (Fig. 9 B). Although STAT3 is also activated by IL-15 in T cells (19), this result indicates that STAT5 is not only involved but is required for the IL-15-mediated mTLR2 gene expression in T cells. It was of note, however, that pGL3–384-mut, which contains the STAT binding site, but no NF-κB site, was not responsive to IL-15 treatment. It suggests that the cooperation of the active STAT and 3′ NF-κB sites is necessary to mediate the IL-15 effect in T cells. Synergy between different signal pathways has recently been demonstrated for many cytokines and growth factors. The collaboration between the NF-κB motif and a STAT-binding element has recently been reported for IFN regulatory factor-1 gene promoter (36). It has been reported that artificial constructs containing a single copy of both a STAT-binding element and a NF-κB motif were able to mediate a synergistic response to IFN-γ and TNF-α, and this response varied with both the relative spacing and the specific sequence of the regions between these two sites (36).

In conclusion, the present study has explored how mTLR2 promoter is activated in immunocompetent cells by LPS, TNF-α, or IL-15. We have found that NF-κB, probably the most important transcriptional factor in immune responses of the host, plays important but different roles in response to these three stimulants. Although NF-κB is sufficient for the full response to TNF-α, other factors contribute to the maximum mTLR2 induction by LPS or IL-15. Both TNF-α and IL-15 are rapidly induced in the early phase of bacterial infections. Since TLR2 can induce signals by recognizing a wide variety of bacterial components, the rapid induction of TLR2 will enhance the prompt responses of the host to bacteria. There are at least 11 members of TLRs in the mouse, and our preliminary data suggested that the gene expression of at least 2 other members of TLRs, TLR3 and TLR5, were induced by LPS treatment (T. Matsuguchi, unpublished results). It remains an open question whether the expression of these TLRs are under the similar control mechanisms to TLR2.

We thank K. Itano, A. Kato, and A. Nishikawa for their technical assistance.

1

This work was supported in part by grants from the Ono Pharmaceutical Company, the Yokoyama Research Foundation for Clinical Pharmacology, and the Naito Foundation (to T.M.) and by the Ministry of Education, Science and Culture of the Japanese government (Grant JSPS-RFTF97L00703) and the Yakult Bioscience Foundation (to Y.Y.).

3

Abbreviations used in this paper: TLR, Toll-like receptor; C/EBP, CCAAT/enhancer inducing protein; CREB, cAMP response element-binding protein; mTLR, mouse TLR; ERK, extracellular signal-regulated kinase.

1
Belvin, M. P., K. V. Anderson.
1996
. A conserved signaling pathway: the Drosophila Toll-dorsal pathway.
Annu. Rev. Cell. Dev. Biol.
12
:
393
2
Lemaitre, B., E. Nicolas, L. Michaut, J. M. Reichhart, J. A. Hoffmann.
1996
. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults.
Cell
86
:
973
3
Rock, F. L., G. Hardiman, J. C. Timans, R. A. Kastelein, J. F. Bazan.
1998
. A family of human receptors structurally related to Drosophila Toll.
Proc. Natl. Acad. Sci. USA
95
:
588
4
Medzhitov, R., P. Preston-Hurlburt, C. A. Janeway, Jr.
1997
. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity.
Nature
388
:
394
5
Chaudhary, P. M., C. Ferguson, V. Nguyen, O. Nguyen, H. F. Massa, M. Eby, A. Jasmin, B. J. Trask, L. Hood, P. S. Nelson.
1998
. Cloning and characterization of two Toll/interleukin-1 receptor-like genes TIL3 and TIL4: evidence for a multi-gene receptor family in humans.
Blood
91
:
4020
6
Yang, R. B., M. R. Mark, A. Gray, A. Huang, M. H. Xie, M. Zhang, A. Goddard, W. I. Wood, A. L. Gurney, P. J. Godowski.
1998
. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signalling.
Nature
395
:
284
7
Kirschning, C. J., H. Wesche, T. Merrill Ayres, M. Rothe.
1998
. Human Toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide.
J. Exp. Med.
188
:
2091
8
Matsuguchi, T., K. Takagi, T. Musikacharoen, Y. Yoshikai.
2000
. Gene expressions of lipopolysaccharide receptors, Toll-like receptors 2 and 4, are differently regulated in mouse T lymphocytes.
Blood
95
:
1378
9
Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, C. J. Kirschning.
1999
. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by Toll-like receptor 2.
J. Biol. Chem.
274
:
17406
10
Yoshimura, A., E. Lien, R. R. Ingalls, E. Tuomanen, R. Dziarski, D. Golenbock.
1999
. Cutting edge: recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via Toll-like receptor 2.
J. Immunol.
163
:
1
11
Brightbill, H. D., D. H. Libraty, S. R. Krutzik, R. B. Yang, J. T. Belisle, J. R. Bleharski, M. Maitland, M. V. Norgard, S. E. Plevy, S. T. Smale, et al
1999
. Host defense mechanisms triggered by microbial lipoproteins through Toll-like receptors.
Science
285
:
732
12
Hirschfeld, M., C. J. Kirschning, R. Schwandner, H. Wesche, J. H. Weis, R. M. Wooten, J. J. Weis.
1999
. Cutting edge: inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by Toll-like receptor 2.
J. Immunol.
163
:
2382
13
Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda, S. Akira.
1999
. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components.
Immunity
11
:
443
14
Matsuguchi, T., T. Musikacharoen, T. Ogawa, Y. Yoshikai.
2000
. Gene expression of Toll-like receptor 2, but not Toll-like receptor 4, is induced by LPS and inflammatory cytokines in mouse macrophages.
J. Immunol.
165
:
5767
15
Schwenzer, R., K. Siemienski, S. Liptay, G. Schubert, N. Peters, P. Scheurich, R. M. Schmid, H. Wajant.
1999
. The human tumor necrosis factor (TNF) receptor-associated factor 1 gene (TRAF1) is up-regulated by cytokines of the TNF ligand family and modulates TNF-induced activation of NF-κB and c-Jun N-terminal kinase.
J. Biol. Chem.
274
:
19368
16
Porter, B. O., T. R. Malek.
1999
. IL-2Rβ/IL-7Rα doubly deficient mice recapitulate the thymic and intraepithelial lymphocyte (IEL) developmental defects of γc−/− mice: roles for both IL-2 and IL-15 in CD8αα IEL development.
J. Immunol.
163
:
5906
17
McDonald, P. P., M. P. Russo, S. Ferrini, M. A. Cassatella.
1998
. Interleukin-15 (IL-15) induces NF-κB activation and IL-8 production in human neutrophils.
Blood
92
:
4828
18
Pahl, H. L..
1999
. Activators and target genes of Rel/NF-κB transcription factors.
Oncogene
18
:
6853
19
Johnston, J. A., C. M. Bacon, D. S. Finbloom, R. C. Rees, D. Kaplan, K. Shibuya, J. R. Ortaldo, S. Gupta, Y. Q. Chen, J. D. Giri, et al
1995
. Tyrosine phosphorylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and 15.
Proc. Natl. Acad. Sci. USA
92
:
8705
20
Rehli, M., A. Poltorak, L. Schwarzfischer, S. W. Krause, R. Andreesen, B. Beutler.
2000
. PU.1 and interferon consensus sequence-binding protein regulate the myeloid expression of the human Toll-like receptor 4 gene.
J. Biol. Chem.
275
:
9773
21
Siebenlist, U., G. Franzoso, K. Brown.
1994
. Structure, regulation and function of NF-κB.
Annu. Rev. Cell. Biol.
10
:
405
22
Thanos, D., T. Maniatis.
1995
. NF-κB: a lesson in family values.
Cell
80
:
529
23
Ghosh, S., M. J. May, E. B. Kopp.
1998
. NF-κB and Rel proteins: evolutionarily conserved mediators of immune responses.
Annu. Rev. Immunol.
16
:
225
24
Baeuerle, P. A., D. Baltimore.
1996
. NF-κB: ten years after.
Cell
87
:
13
25
Baldwin, A. S., Jr.
1996
. The NF-κB and IκB proteins: new discoveries and insights.
Annu. Rev. Immunol.
14
:
649
26
Baeuerle, P. A., D. Baltimore.
1988
. IκB: a specific inhibitor of the NF-κB transcription factor.
Science
242
:
540
27
Zabel, U., P. A. Baeuerle.
1990
. Purified human IκB can rapidly dissociate the complex of the NF-κB transcription factor with its cognate DNA.
Cell
61
:
255
28
Tsai, E. Y., J. V. Falvo, A. V. Tsytsykova, A. K. Barczak, A. M. Reimold, L. H. Glimcher, M. J. Fenton, D. C. Gordon, I. F. Dunn, A. E. Goldfeld.
2000
. A lipopolysaccharide-specific enhancer complex involving Ets, Elk-1, Sp1, and CREB binding protein and p300 is recruited to the tumor necrosis factor alpha promoter in vivo.
Mol. Cell. Biol.
20
:
6084
29
Boehlk, S., S. Fessele, A. Mojaat, N. G. Miyamoto, T. Werner, E. L. Nelson, D. Schlondorff, P. J. Nelson.
2000
. ATF and Jun transcription factors, acting through an Ets/CRE promoter module, mediate lipopolysaccharide inducibility of the chemokine RANTES in monocytic Mono Mac 6 cells.
Eur. J. Immunol.
30
:
1102
30
Pan, J., L. Xia, L. Yao, R. P. McEver.
1998
. Tumor necrosis factor-α- or lipopolysaccharide-induced expression of the murine P-selectin gene in endothelial cells involves novel κB sites and a variant activating transcription factor/cAMP response element.
J. Biol. Chem.
273
:
10068
31
Ardeshna, K. M., A. R. Pizzey, S. Devereux, A. Khwaja.
2000
. The PI3 kinase, p38 SAP kinase, and NF-κB signal transduction pathways are involved in the survival and maturation of lipopolysaccharide-stimulated human monocyte-derived dendritic cells.
Blood
96
:
1039
32
Schmitz, M. L., P. A. Baeuerle.
1991
. The p65 subunit is responsible for the strong transcription activating potential of NF-κB.
EMBO J.
10
:
3805
33
Kunsch, C., S. M. Ruben, C. A. Rosen.
1992
. Selection of optimal κB/Rel DNA-binding motifs: interaction of both subunits of NF-κB with DNA is required for transcriptional activation.
Mol. Cell. Biol.
12
:
4412
34
Hirschfeld, M., Y. Ma, J. H. Weis, S. N. Vogel, J. J. Weis.
2000
. Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2.
J. Immunol.
165
:
618
35
Lee, S. J., J. Hou, E. N. Benveniste.
1998
. Transcriptional regulation of intercellular adhesion molecule-1 in astrocytes involves NF-κB and C/EBP isoforms.
J. Neuroimmunol.
92
:
196
36
Ohmori, Y., R. D. Schreiber, T. A. Hamilton.
1997
. Synergy between interferon-γ and tumor necrosis factor-α in transcriptional activation is mediated by cooperation between signal transducer and activator of transcription 1 and nuclear factor κB.
J. Biol. Chem.
272
:
14899