Toll-like receptors (TLRs) have recently been identified as fundamental components of the innate immune response to bacterial pathogens. We investigated the role of TLR signaling in immune defense of the mucosal epithelial cells of the lower female genital tract. This site provides first line defense against microbial pathogens while remaining tolerant to a complex biosystem of resident microbiota. Epithelial cells derived from normal human vagina, ectocervix, and endocervix expressed mRNA for TLR1, -2, -3, -5, and -6. However, they failed to express TLR4 as well as MD2, two essential components of the receptor complex for LPS in phagocytes and endothelial cells. Consistent with this, endocervical epithelial cells were unresponsive to protein-free preparations of lipooligosaccharide from Neisseria gonorrhoeae and LPS from Escherichia coli. However, they were capable of responding to whole Gram-negative bacteria and bacterial lysates, as demonstrated by NF-κB activation and proinflammatory cytokine production. The presence of soluble CD14, a high-affinity receptor for LPS and other bacterial ligands, enhanced the sensitivity of genital tract epithelial cells to both low and high concentrations of bacteria, suggesting that soluble CD14 can act as a coreceptor for non-TLR4 ligands. These data demonstrate that the response to N. gonorrhoeae and other Gram-negative bacteria at the mucosal surface of the female genital tract occurs in the absence of endotoxin recognition and TLR4-mediated signaling.

The mucosal surface of the lower female genital tract is a complex biosystem, providing a barrier against the outside world and participating in both innate and acquired immune defense. This mucosal compartment has adapted to a dynamic nonsterile environment challenged by a variety of antigenic/inflammatory stimuli associated with sexual intercourse and endogenous vaginal microbiota. Thus, the epithelial cells, lymphocytes, macrophages, and dendritic cells associated with the genital tract have unique features that enable them to adapt to this dynamic milieu. This would include the expression of hormone receptors, hormone-dependent immune function, and unique genital tract-specific defensins and mucins (1, 2, 3, 4, 5).

The epithelial cells that line mucosal surfaces are often the first cells to contact microbial pathogens, as normally there are very few immune cells present in the cervicovaginal mucosa and lumen (6, 7). Here, they initiate and coordinate the inflammatory response, alerting adjacent epithelium and the underlying immune cells of the potential danger posed by various microorganisms. Despite the important role that the genital tract mucosa plays in immune defense, little is known about the mechanism of epithelial cell activation by pathogens and the receptors and secondary mediators involved in this regulated response. We have recently established an in vitro model to study epithelial-microbial interaction in this compartment using immortalized epithelial cells derived from human vagina, ectocervix, and endocervix. These cells maintain the normal immunobiological characteristics of their tissues of origin and differ extensively from commonly used tumorigenic cell lines, such as HeLa cells (8, 9). We have used this model to study the downstream effects of cell signaling following Neisseria gonorrhoeae infection. Our previous investigations showed that all three epithelial cell lines respond to N. gonorrhoeae by up-regulation of cytokines and adhesion molecules and that these responses are independent of bacterial internalization and IL-1 production (10). However, the key components of the signaling pathways involved in the inflammatory responses of cervicovaginal epithelial cells to Gram-negative bacteria have yet to be identified.

In this study we determined the expression profiles of members of the Toll-like receptor (TLR)3 family in human cervicovaginal epithelial cells and correlated this with proinflammatory responses to bacterial pathogens. The TLR family plays a pivotal role in the recognition of bacterial ligands by the innate immune system (11, 12). Toll was initially identified as a receptor involved in embryonic development, where it controls dorsoventral polarization (13). It was later demonstrated that Toll and the related molecule, 18-Wheeler, control important antimicrobial responses against both fungi and bacteria in the adult fly (14). At least 10 mammalian orthologs of Toll, designated TLRs, have been identified, and several of them have been implicated in cellular responses to bacterial pathogens. While both TLR2 and TLR4 were initially implicated in cellular responses to LPS, the overwhelming evidence to date suggests that these two receptors have different roles in the recognition of pathogens. TLR4 is required for recognition of LPS (also known as endotoxin), the most proinflammatory cell wall component of Gram-negative bacteria (15, 16, 17, 18, 19). A small secreted protein, known as MD2, which associates with TLR4 on the cell surface of innate immune cells, may also be required for TLR4-mediated responses to LPS (20, 21). TLR2 has a broader role as a pattern recognition receptor for a variety of microbes and Gram-positive ligands, e.g., bacterial lipopeptides, lipoprotein, lipoteichoic acid, and peptidoglycan (22, 23, 24, 25, 26, 27, 28, 29). There is also some evidence that TLR2 may require association with TLR6 for recognition of certain ligands, including some lipoproteins (30, 31), peptidoglycan (32), and phenol-soluble modulin (33). In addition, TLR9 has been associated with responses to bacterial DNA (34), and TLR5 has been associated with responses to bacterial flagellin (35).

A key component of both TLR and IL-1 signaling is the adapter molecule MyD88. MyD88 is a unique protein that has homology to the cytoplasmic domain of the IL-1 and Toll receptors at the C-terminal, and an N-terminal death domain (36, 37). It is recruited by the IL-1 or Toll receptor complex after receptor stimulation and is an essential step in the sequential recruitment of the downstream kinases IL-1R-associated kinase and TNFR-associated factor-6, activation of NF-κB, and transcription of a myriad of proinflammatory molecules (38, 39).

We found that cervical and vaginal epithelial cells expressed mRNA for TLR1, -2, -3, -5, and -6, but failed to express TLR4 and MD2, two essential components of the receptor complex for responses to LPS. Consistent with this, cervical epithelial cells failed to respond to protein-free preparations of endotoxin derived from enteric (Escherichia coli) and nonenteric (N. gonorrhoeae) Gram-negative species, as measured by cytokine production and NF-κB activation. In contrast, the cells remained sensitive, in a MyD88-dependent fashion, to TLR2 bacterial ligands, i.e., lipoproteins and peptidoglycan, as well as to bacterial lysates and infection with whole N. gonorrhoeae. Interestingly, although cervicovaginal cells lack endogenous membrane CD14, soluble CD14 (sCD14), which was found in semen and cervicovaginal secretions, enhanced their proinflammatory host response to N. gonorrhoeae. These findings suggest that the lower female genital tract responds to Gram-negative bacterial components in the absence of endotoxin recognition and TLR4-mediated signaling.

PBS and trypsin-versene mixture (trypsin-EDTA) were obtained from BioWhittaker (Walkersville, MD), and FCS (<10 pg/ml LPS) was purchased from Summit Biotechnology (Greeley, CO). Recombinant human IL-1β and TNF-α were purchased from R&D Systems (Minneapolis, MN). Recombinant human sCD14 and LPS binding protein (LBP) were gifts from H. Lichenstein (Amgen, Thousand Oaks, CA). Lipo-oligosaccharide (LOS) purified from N. gonorrhoeae (strain 1291) was a gift from N. Qureshi (University of Wisconsin, Madison, WI). LPS purified from E. coli K235 was purchased from List Biologicals (Campbell, CA). Contaminating endotoxin proteins were removed by phenol re-extraction as described previously (40, 41). Synthetic lipopeptide corresponding to the N termini of the Treponema pallidum 47-kDa lipoprotein (designated 47-L) was a gift from J. Radolf (University of Connecticut, Farmington, CT). Synthetic lipopeptide based on the full-length MALP-2 membrane lipopeptide from Mycoplasma fermentans (sMALP-2) was a gift from G. Rawadi (Institut Pasteur, Paris, France) (27, 42). Soluble peptidoglycan (designated sPG) was a gift from R. Dziarski (Indiana University School of Medicine, Gary, IN). Heat-killed Listeria monocytogenes (HKLM) was a gift from G. Teti (Policlinico Universitario, Messina, Italy). Ab to human TLR2, TL2.1, was a gift from T. Espevik (Norwegian University of Science and Technology, Trondheim, Norway). Ab to human TLR4, HTA125, was a gift from K. Miyake (Saga Medical School, Saga, Japan). PE-conjugated sheep anti-mouse IgG (Sigma-Aldrich, St. Louis, MO) was used for Ab detection in flow cytometry. In some cases Ab preparations were also directly labeled with Alexa Fluor 488 using a commercially available kit (Molecular Probes, Eugene, OR). A human bone marrow cDNA library was purchased from Invitrogen (Carlsbad, CA).

N. gonorrhoeae laboratory strain 1291 was grown overnight on chocolate agar. Colonies were scraped and resuspended in PBS with 0.1% BSA. Cell density was adjusted to an OD600 equal to 0.1, corresponding to 108 CFU/ml bacteria. Crude bacterial lysates were generated from bacteria resuspended in pyrogen-free, sterile distilled water, subjected to a freeze-thaw cycle, and vortexed vigorously. Lysates were treated with DNase for 1 h, stored at −20°C, and vortexed before use.

Generation of the HPV16/E6E7 immortalized endocervical (End1/E6E7), ectocervical (Ect1/E6E7), and vaginal (Vk2/E6E7) epithelial cell lines has been previously described (8). The vaginal epithelial cells were derived from a different donor than the endocervical and ectocervical cells. Cells were maintained in keratinocyte serum-free medium (Life Technologies, Gaithersburg, MD) supplemented with 50 μg/ml bovine pituitary extract and 0.1 ng/ml epidermal growth factor (both supplied by the manufacturer), 10 μg/ml ciprofloxacin (Miles Pharmaceuticals, West Haven, CT), and CaCl2 to a final concentration of 0.4 mM. Cells tested negative for mycoplasma by PCR (43). HMEC-1 (human microvascular endothelial cells) were a gift from M. Arditi (Cedars Sinai Medical Center, Los Angeles, CA) (44). CHO-K1 fibroblasts stably transfected with human TLR2 or TLR4 were a gift from D. Golenbock (University of Massachusetts Medical Center, Worcester, MA) (27). Primary endocervical and ectocervical epithelial cells were purchased from BioWhittaker/Clonetics (San Diego, CA) and maintained according to the manufacturer’s instructions.

Total RNA was isolated from cells using Tri-Reagent according to the manufacturer’s instructions (Molecular Research Center, Cincinnati, OH) and was treated with RQ1 RNase-free DNase (Promega, Madison, WI). Reverse transcription and PCR were conducted using Superscript II (Life Technologies) and Taq DNA polymerase (Promega), respectively. The PCRs were conducted for 25 cycles in a PerkinElmer GeneAmp 2400 PCR machine (PerkinElmer/Cetus, Norwalk, CT) using the primer pairs and conditions described in Table I. Lack of DNA contamination in the RNA preparations was confirmed by PCR in the absence of reverse transcription.

Table I.

PCR primer pairs for amplification of human mRNA

ProductUpper PrimerLower PrimerProgramProduct Size (bp)
TLR-1 ACCAAGTTGTCAGCGATGTGTT GATTGTCCCCTGCTTTTATTGA 95°C/30 s, 54°C/45 s, 72°C/45 s 660 
TLR-2 GAGTGAGTGGTGCAAGTATGAAC GGGCCACTCCAGGTAGGTCT 95°C/30 s, 54°C/45 s, 72°C/45 s 169 
TLR-3 TCCCAAGCCTTCAACGACTG TCCTGAAAGCTGGCCCGAAAAC 95°C/30 s, 55°C/45 s, 72°C/45 s 471 
TLR-4 TGCGGGTTCTACATCAAA CCATCCGAAATTATAAGAAAAGTC 95°C/30 s, 50°C/45 s, 72°C/45 s 413 
TLR-5 CTCCTTTGATGGCCGAATAGC CCCAAATGAAGGATGAAGGTAAAG 95°C/30 s, 55°C/45 s, 72°C/45 s 430 
TLR-6 CAAGGCCCTGCCCATCTGTAAG TTGGGCCAAAGAAATTGAAAGACTC 95°C/30 s, 54°C/45 s, 72°C/45 s 429 
MD-2 GAAGCTCAGAAGCAGTATTGGGTC GGTTGGTGTAGGATGACAAACTCC 95°C/30 s, 52°C/45 s, 72°C/45 s 422 
CD14 GGAACTGACGCTCGAGGACCTAAAGATAAC TCCAGCCCAGCGAACGACAGATTGAG 95°C/30 s, 60°C/45 s, 72°C/45 s 510 
GAPDH GTCATCATCTCCGCCCCTTCTGC GATGCCTGCTTCACCACCTTCTTG 95°C/30 s, 54°C/45 s, 72°C/45 s 443 
ProductUpper PrimerLower PrimerProgramProduct Size (bp)
TLR-1 ACCAAGTTGTCAGCGATGTGTT GATTGTCCCCTGCTTTTATTGA 95°C/30 s, 54°C/45 s, 72°C/45 s 660 
TLR-2 GAGTGAGTGGTGCAAGTATGAAC GGGCCACTCCAGGTAGGTCT 95°C/30 s, 54°C/45 s, 72°C/45 s 169 
TLR-3 TCCCAAGCCTTCAACGACTG TCCTGAAAGCTGGCCCGAAAAC 95°C/30 s, 55°C/45 s, 72°C/45 s 471 
TLR-4 TGCGGGTTCTACATCAAA CCATCCGAAATTATAAGAAAAGTC 95°C/30 s, 50°C/45 s, 72°C/45 s 413 
TLR-5 CTCCTTTGATGGCCGAATAGC CCCAAATGAAGGATGAAGGTAAAG 95°C/30 s, 55°C/45 s, 72°C/45 s 430 
TLR-6 CAAGGCCCTGCCCATCTGTAAG TTGGGCCAAAGAAATTGAAAGACTC 95°C/30 s, 54°C/45 s, 72°C/45 s 429 
MD-2 GAAGCTCAGAAGCAGTATTGGGTC GGTTGGTGTAGGATGACAAACTCC 95°C/30 s, 52°C/45 s, 72°C/45 s 422 
CD14 GGAACTGACGCTCGAGGACCTAAAGATAAC TCCAGCCCAGCGAACGACAGATTGAG 95°C/30 s, 60°C/45 s, 72°C/45 s 510 
GAPDH GTCATCATCTCCGCCCCTTCTGC GATGCCTGCTTCACCACCTTCTTG 95°C/30 s, 54°C/45 s, 72°C/45 s 443 

Cells were grown in 96-well tissue culture dishes at a density of 105 cells/well and stimulated for the stated period of time. Plates were centrifuged at 400 × g for 5 min at 4°C before cell culture supernatants were collected. Samples were stored at −80°C and later assayed for IL-8 and IL-6 using PeliKine compact ELISA kits from Research Diagnostics (Flanders, NJ) using the manufacturer’s protocol. OD was measured using a Bio-Kinetics microplate reader (Bio-Tek Instruments, Winooski, VT). All cytokine assays were plated in triplicate, and experiments were repeated at least three times. Data are reported as the mean of triplicate samples ± SD. Significance (p value) was calculated using a t test.

One day before stimulation cells were grown in six-well tissue culture dishes at a density of 1 × 106/well. After a 60-min stimulation cells were harvested and nuclear extracts were prepared as previously described (45). Nuclear NF-κB was identified using EMSA with a 32P-labeled oligonucleotides containing the consensus sequence for NF-κB binding from the murine Ig κ L chain gene enhancer (45).

The following expression plasmids were gifts from D. Golenbock (University of Massachusetts Medical Center): reporter plasmid pELAM-luc, which transcribes firefly luciferase from an NF-κB-dependent promoter (16); mutant murine MyD88 dominant-negative (MyD88 DN), containing the C-terminal half (aa 146–296) of the protein in the mammalian expression vector pLEP3 (46); and mutant murine TLR2 dominant-negative, which lacks the terminal 13 aa of the TLR2-coding sequence, expressed in the mammalian expression vector pcDNA3 (46). The expression plasmid for nontagged human TLR4 in the mammalian expression plasmid pcDNA3 was a gift from R. Medzhitov (Yale University, New Haven, CT) (12). The expression plasmid for human MD2 in the mammalian expression plasmid pEFBOS was a gift from K. Miyake (Saga Medical School) (20). All plasmids were prepared using EndoFree Plasmid Maxi Kit plasmid DNA purification columns from Qiagen (Valencia, CA).

Transient transfections were conducted using either DEAE-dextran or a lipid transfection reagent. For the DEAE-dextran method, cells were plated at a density of 2.5 × 105 cells/well and transfected with 0.25 μg DNA using DEAE-dextran (47). For the lipid transfection, cells were plated at a density of 104/well and transfected with 0.1 μg DNA using Effectene (Qiagen). Cell activation was determined by measuring luciferase activity in the total cellular lysate using an assay kit from Promega according to the manufacturer’s instructions and a Monolight 3010 luminometer (BD PharMingen, San Diego, CA). All transfection experiments were performed in triplicate and repeated at least three times. Data are reported as the mean of triplicate samples ± SD. Significance (p value) was calculated using a t test.

Cells growing in tissue culture were harvested with 1 mM EDTA and incubated for 30 min on ice with Alexa-conjugated anti-TLR2 or anti-TLR4 Ab or with control mouse IgG at a concentration of 20 μg/ml. After labeling, the cells were washed, resuspended in PBS/1% FBS, and analyzed by flow cytometry using a FACScan microfluorometer (BD Biosciences, San Jose, CA). A total of 10,000 events were counted for each condition.

Seminal fluid samples were a gift from A. Sunde (Trondheim, Norway). Normal semen was collected at the Department of Obstetrics and Gynecology of the Norwegian University of Science and Technology and processed as previously described (48). Cervical secretions were a gift from P. Crowley-Nowick (Brigham and Women’s Hospital, Boston, MA). Samples were collected using the Weck-cel collection method (49) during routine follow-up for abnormal Pap smears at Louisiana State Medical School (Shreveport, LA). Sponges were weighed before and after collection to correct for dilution. sCD14 was assayed by ELISA as described previously (50) (lower limit of detection, 0.78 ng/ml). All samples were taken after obtaining informed consent.

The immortalized End1/E6E7 epithelial cells and the primary endocervical epithelial cells were evaluated for expression of mRNA for the various TLRs by RT-PCR. HMEC cDNA and a bone marrow cDNA library were used as controls. PCR primers and primer conditions are listed in Table I. While both End1/E6E7 and primary endocervical cells expressed mRNA for TLR1, -2, -3, and -6, no PCR product was detected for TLR4 in either cell population (Fig. 1). The primary cells also failed to express message for TLR5. In contrast, a TLR4 product of appropriate size was detected in HMEC endothelial cells and the bone marrow library. The endocervical epithelial cells also failed to express a significant amount of message for the TLR4-associated molecule MD2 (Fig. 1). As expected, neither the epithelial cell lines nor the HMEC cells expressed mRNA by RT-PCR for the macrophage differentiation marker CD14 (data not shown). Ectocervical (Ect1/E6E7) and vaginal (Vk2/E6E7) epithelial cells demonstrated a pattern of TLR expression similar to that of the endocervical epithelial cells (data not shown), suggesting that this pattern of expression is consistent throughout the three compartments of the lower female genital tract.

FIGURE 1.

Endocervical epithelial cells fail to express mRNA for TLR4 and MD2. RNA was prepared from immortalized endocervical epithelial cells (End1/E6E7, left column) and primary endocervical epithelial cells (Prim Endo, right column) and assayed by RT-PCR for expression of TLRs 1–6, MD2, and the housekeeping gene GAPDH as described in the text and Table I. HMEC-1 cDNA and a bone marrow cDNA library (BM Libr) are shown for comparison. A second set of TLR4 primers also failed to yield a product in the epithelial cells. Neither End1/E6E7 epithelial cells nor primary epithelial cells expressed message for CD14 by RT-PCR (data not shown).

FIGURE 1.

Endocervical epithelial cells fail to express mRNA for TLR4 and MD2. RNA was prepared from immortalized endocervical epithelial cells (End1/E6E7, left column) and primary endocervical epithelial cells (Prim Endo, right column) and assayed by RT-PCR for expression of TLRs 1–6, MD2, and the housekeeping gene GAPDH as described in the text and Table I. HMEC-1 cDNA and a bone marrow cDNA library (BM Libr) are shown for comparison. A second set of TLR4 primers also failed to yield a product in the epithelial cells. Neither End1/E6E7 epithelial cells nor primary epithelial cells expressed message for CD14 by RT-PCR (data not shown).

Close modal

To confirm the PCR finding that the cervical epithelial cells lacked TLR4, we looked for evidence of protein expression. The immortalized End1/E6E7 and primary endocervical epithelial cells were stained using available mAbs to TLR2 (TL2.1) and TLR4 (HTA125) and were analyzed by flow cytometry. We found that both the End1/E6E7 cells (Fig. 2,A) and the primary endocervical epithelial cells (Fig. 2,B) expressed low levels of TLR2 on the surface, but neither expressed TLR4. The specificity of the Abs for TLR2 and TLR4 is demonstrated in Fig. 2 C. Of interest, we found that the HMEC endothelial cells expressed surface TLR4 but failed to express TLR2 (data not shown), as has been reported by others (51).

FIGURE 2.

Endocervical epithelial cells express surface TLR2, but not TLR4. Shown above are FACS histograms for the End1/E6E7 cell line (A), primary endocervical epithelial cells (B), and TLR2- or TLR4-transfected CHO-K1 fibroblasts (C). Cells were stained with Ab to TLR2 (TL2.1, upper graph) or TLR4 (HTA125, lower graph) as described in the text. In each case the staining is compared with that of control mouse IgG (thin solid line). The vertical axis represents the relative cell number, while the horizontal axis represents the intensity of fluorescence staining for the Ab. These histograms are representative of at least three separate experiments.

FIGURE 2.

Endocervical epithelial cells express surface TLR2, but not TLR4. Shown above are FACS histograms for the End1/E6E7 cell line (A), primary endocervical epithelial cells (B), and TLR2- or TLR4-transfected CHO-K1 fibroblasts (C). Cells were stained with Ab to TLR2 (TL2.1, upper graph) or TLR4 (HTA125, lower graph) as described in the text. In each case the staining is compared with that of control mouse IgG (thin solid line). The vertical axis represents the relative cell number, while the horizontal axis represents the intensity of fluorescence staining for the Ab. These histograms are representative of at least three separate experiments.

Close modal

To determine whether N. gonorrhoeae infection of epithelial cells could initiate a proinflammatory signal, cells were assayed for a pretranscriptional event, the nuclear translocation of the transcription factor NF-κB. NF-κB activation is central to the inflammatory response to bacterial pathogens, leading to the release of several proinflammatory cytokines and chemokines (reviewed in Ref. 52). We found evidence of NF-κB activation by the EMSA within 1 h of stimulation using both live N. gonorrhoeae and bacterial lysates, suggesting that attachment and invasion were not necessary for cellular activation (Fig. 3 A). In fact, the bacterial lysates appeared to be more potent than the live bacteria, perhaps reflecting the availability of more inflammatory ligands in the particulates compared with intact bacteria.

FIGURE 3.

N. gonorrhoeae activates proinflammatory signals in endocervical epithelial cells. A, NF-κB translocation. End1/E6E7 cells were stimulated with live N. gonorrhoeae or gonococcal lysates for 60 min. Nuclear proteins were prepared, and nuclear levels of NF-κB were measured by EMSA using a κB site-containing probe. The upper band represents NF-κB bound to the κB. Shown above is a representative of at least three independent experiments. B, IL-8 release. End1/E6E7 cells were stimulated with increasing concentrations of N. gonorrhoeae lysates, and supernatant was harvested over time and assayed for IL-8 by ELISA. Shown above is a representative of at least three independent experiments. Similar results were found when supernatant was assayed for IL-6 (data not shown).

FIGURE 3.

N. gonorrhoeae activates proinflammatory signals in endocervical epithelial cells. A, NF-κB translocation. End1/E6E7 cells were stimulated with live N. gonorrhoeae or gonococcal lysates for 60 min. Nuclear proteins were prepared, and nuclear levels of NF-κB were measured by EMSA using a κB site-containing probe. The upper band represents NF-κB bound to the κB. Shown above is a representative of at least three independent experiments. B, IL-8 release. End1/E6E7 cells were stimulated with increasing concentrations of N. gonorrhoeae lysates, and supernatant was harvested over time and assayed for IL-8 by ELISA. Shown above is a representative of at least three independent experiments. Similar results were found when supernatant was assayed for IL-6 (data not shown).

Close modal

During mucosal infections, epithelial cells are a major source of IL-8 and IL-6, which, in turn, participate in local inflammation, neutrophil chemotaxis, T and B cell activation, and Ab production (reviewed in Ref. 53). To investigate a model of natural infection in the endocervical canal, endocervical epithelial cells were incubated with increasing concentrations of N. gonorrhoeae lysates and assessed over time for the release of IL-8 and IL-6 into the supernatant. As shown in Fig. 3 B, IL-8 concentrations were increased in culture supernatants in a time- and dose-dependent manner when stimulated with bacterial lysates. Similar results were found when supernatants were assayed for IL-6 (data not shown).

Because the cells are grown in serum-free medium, they are not exposed to the serum proteins sCD14 (54, 55, 56) and LBP (57), which have been shown by many groups to enhance responses to LPS. sCD14 has also been shown to interact with other bacterial ligands, including mycobacterial lipoarabinomannan (58) and mycobacterial cell wall components (50), peptidoglycan (59, 60) and cell wall components of Staphylococcus aureus (61), and bacterial outer membrane lipoproteins (62). When the culture medium was supplemented with sCD14, the endocervical epithelial cells were more sensitive to activation by N. gonorrhoeae lysates, with the cytokine response to stimulatory concentrations of bacteria enhanced at all levels of sCD14 tested (Fig. 4). Furthermore, high levels of sCD14 (>100 ng/ml) enabled cellular responses to normally substimulatory concentrations of bacteria (Fig. 4). Identical results were obtained using live bacteria (data not shown). No effect of LBP, either by itself or in combination with sCD14, was seen (data not shown).

FIGURE 4.

Cellular activation by N. gonorrhoeae is enhanced by sCD14. End1/E6E7 cells were stimulated with N. gonorrhoeae lysates in the presence of increasing concentrations of sCD14. Supernatant was collected after 18 h and assayed for IL-8 by ELISA. Shown is a representative of at least three independent experiments. Similar results were found when supernatant was assayed for IL-6 (data not shown). Significance is noted as follows: ∗, p < 0.0001; †, p < 0.001 (stimulated vs unstimulated).

FIGURE 4.

Cellular activation by N. gonorrhoeae is enhanced by sCD14. End1/E6E7 cells were stimulated with N. gonorrhoeae lysates in the presence of increasing concentrations of sCD14. Supernatant was collected after 18 h and assayed for IL-8 by ELISA. Shown is a representative of at least three independent experiments. Similar results were found when supernatant was assayed for IL-6 (data not shown). Significance is noted as follows: ∗, p < 0.0001; †, p < 0.001 (stimulated vs unstimulated).

Close modal

To confirm a physiologic role for sCD14 in genital tract infections, we looked for the presence of this molecule in cervical mucus of women and in semen of men. Of 10 samples of mucosal secretions collected from the cervix, only one had sCD14 detectable at a concentration of 194.2 ng/ml. However, all cervical samples were diluted in the range of 10- to 40-fold during the collection process, which could account for the inability to detect relatively low levels of the protein (<10–20 ng/ml) that might still be physiologically relevant under some conditions. In contrast, seminal plasma contained abundant sCD14, with levels approximating half those in serum (Fig. 5).

FIGURE 5.

sCD14 is detectable in seminal plasma. Samples of seminal plasma and cervical secretions (n = 10 for each) were assayed for sCD14 by ELISA as described in Materials and Methods. Levels of sCD14 in normal serum (n = 11) are shown for comparison. The bars indicate the medians (middleline) and 25th (upper line) and 75th (lower line) percentiles.

FIGURE 5.

sCD14 is detectable in seminal plasma. Samples of seminal plasma and cervical secretions (n = 10 for each) were assayed for sCD14 by ELISA as described in Materials and Methods. Levels of sCD14 in normal serum (n = 11) are shown for comparison. The bars indicate the medians (middleline) and 25th (upper line) and 75th (lower line) percentiles.

Close modal

Various components of the bacterial cell wall are capable of activating the proinflammatory response. In the case of Gram-negative bacteria, LPS, or more specifically the lipid A core of LPS, is believed to be the molecule responsible for the biological toxicity (63). However, other components of the Gram-negative cell wall, such as proteins, lipoproteins, peptidoglycan, porins, and a variety of phospholipids, have been shown in other settings to activate of the inflammatory response. Furthermore, an LPS-deficient mutant of Neisseria meningitidis has been shown to be a potent inflammatory stimulus (64).

Because endocervical epithelial cells lacked the known components of the LPS signaling complex, specifically TLR4 and MD2, we suspected that they would be unresponsive to LPS. To test this, cells were incubated with increasing amounts of LPS and other purified bacterial products and assessed for IL-8 and IL-6 release. Considering the requirement of sCD14 for LPS responses in cells lacking membrane CD14, medium was supplemented with recombinant sCD14 (54, 55, 56). As demonstrated in Fig. 6,A, the immortalized endocervical epithelial cells failed to increase IL-8 secretion in response to protein-free preparations of endotoxin derived from N. gonorrhoeae and E. coli. They also failed to translocate the transcription factor NF-κB as assayed by the EMSA upon LPS stimulation (data not shown). In contrast, they responded quite well to other bacterial preparations, including synthetic bacterial lipopeptides from T. pallidum (47-L) and M. fermentans (sMALP-2), sPG, and HKLM. All these preparations have been shown previously to be ligands for TLR2 (23, 24, 25, 26, 27, 29), or TLR2 in concert with TLR6 (30). Likewise, primary endocervical epithelial cells were activated by gonococcal lysates and the TLR2 ligands 47-L and sMALP-2, but were unresponsive to the two LPS preparations tested (Fig. 6 B). Primary ectocervical epithelial cells were also LPS unresponsive (data not shown).

FIGURE 6.

Endocervical epithelial cells are unresponsive to LPS. End1/E6E7 (A) and primary endocervical (B) cells were plated in serum-free medium supplemented with 200 ng/ml sCD14 and stimulated overnight with the following: 4 ng/ml human TNF-α, 1 μg/ml N. gonorrhoeae LOS (GC LOS) or E. coli LPS (EC LPS), 5 μg/ml synthetic lipopeptide 47-L, 20 nM synthetic lipopeptide sMALP-2, 5 μg/ml sPG, or 108 CFU/ml HKLM. Supernatant was collected after 18 h and assayed for IL-8. The results represent at least three independent experiments. ND, None detected. Results were confirmed in primary endocervical epithelial cells from a second donor. Primary ectocervical epithelial cells were also unresponsive to LPS (data not shown).

FIGURE 6.

Endocervical epithelial cells are unresponsive to LPS. End1/E6E7 (A) and primary endocervical (B) cells were plated in serum-free medium supplemented with 200 ng/ml sCD14 and stimulated overnight with the following: 4 ng/ml human TNF-α, 1 μg/ml N. gonorrhoeae LOS (GC LOS) or E. coli LPS (EC LPS), 5 μg/ml synthetic lipopeptide 47-L, 20 nM synthetic lipopeptide sMALP-2, 5 μg/ml sPG, or 108 CFU/ml HKLM. Supernatant was collected after 18 h and assayed for IL-8. The results represent at least three independent experiments. ND, None detected. Results were confirmed in primary endocervical epithelial cells from a second donor. Primary ectocervical epithelial cells were also unresponsive to LPS (data not shown).

Close modal

The C-terminal domain of MyD88 has been shown to act as a dominant-negative inhibitor of NF-κB activation by both IL-1 (65) and many of the TLRs (46). We hypothesized that such a MyD88-DN mutant would block the N. gonorrhoeae-induced NF-κB activation that we observed in our epithelial cells. To test this idea, we used an NF-κB-dependent ELAM-luciferase reporter. Cells were transiently cotransfected with the reporter plasmid and either the expression plasmid containing the dominant-negative MyD88 construct or a control vector. Cells were then stimulated with increasing concentrations of the gonococcal lysates and assayed for activation of the luciferase reporter. As shown in Fig. 7, overexpression of the dominant-negative MyD88 blocked gonococcal-induced activation of the luciferase reporter as well as that of IL-1β, which uses the same intracellular signals as the TLRs. In contrast to MyD88, we were unable to see consistent inhibition of the crude lysates with either a TLR2 dominant-negative construct or TLR2-blocking Abs, suggesting that the ligands in the gonococcal lysates responsible for the cellular activation were using more than one TLR in the MyD88-dependent activation (data not shown).

FIGURE 7.

TLR proteins mediate the activation of endocervical epithelial cells by N. gonorrhoeae. End1/E6E7 cells were transiently cotransfected with an expression plasmid encoding a dominant-negative MyD88 mutant or empty vector and with a luciferase reporter plasmid. Cells were then stimulated with increasing concentrations of gonococcal lysates or IL-1 and assayed for luciferase activity as described in the text. Shown above is a representative of at least three independent experiments. Significance is noted as follows: ∗, p = 0.0001; †, p = 0.001 (MyD88DN vs control).

FIGURE 7.

TLR proteins mediate the activation of endocervical epithelial cells by N. gonorrhoeae. End1/E6E7 cells were transiently cotransfected with an expression plasmid encoding a dominant-negative MyD88 mutant or empty vector and with a luciferase reporter plasmid. Cells were then stimulated with increasing concentrations of gonococcal lysates or IL-1 and assayed for luciferase activity as described in the text. Shown above is a representative of at least three independent experiments. Significance is noted as follows: ∗, p = 0.0001; †, p = 0.001 (MyD88DN vs control).

Close modal

We hypothesized that the absence of TLR4 and MD2 was responsible for the LPS unresponsiveness by epithelial cells in the lower female genital tract. To test this hypothesis, we transiently cotransfected the endocervical epithelial cell line with the ELAM-luciferase reporter plasmid and the expression plasmids containing the genes for human TLR4 and MD2. Cells were then stimulated with both N. gonorrhoeae LOS and E. coli LPS, in the presence of sCD14 and assayed for activation of the luciferase reporter. As predicted, we found that the combination of TLR4 and MD2 conferred responsiveness to the two different LPS preparations, while expression of TLR4 or MD2 alone did not (Fig. 8).

FIGURE 8.

Expression of TLR4 and MD2 together restores LPS responsiveness. End1/E6E7 cells were transiently cotransfected with an expression plasmid encoding TLR4, MD2, both, or an empty vector, along with the luciferase reporter plasmid. Cells were then stimulated with 1 μg/ml endotoxin prepared from either N. gonorrhoeae (GC LOS) or E. coli (EC LPS). Lysates were assayed for luciferase activity as described in the text. Shown above is a representative of two independent experiments. Significance is noted as follows: ∗, p = 0.001 for LOS and LPS vs unstimulated.

FIGURE 8.

Expression of TLR4 and MD2 together restores LPS responsiveness. End1/E6E7 cells were transiently cotransfected with an expression plasmid encoding TLR4, MD2, both, or an empty vector, along with the luciferase reporter plasmid. Cells were then stimulated with 1 μg/ml endotoxin prepared from either N. gonorrhoeae (GC LOS) or E. coli (EC LPS). Lysates were assayed for luciferase activity as described in the text. Shown above is a representative of two independent experiments. Significance is noted as follows: ∗, p = 0.001 for LOS and LPS vs unstimulated.

Close modal

The epithelium of the lower female genital tract is a dynamic tissue, changing under the influence of hormones, age, pregnancy, and other factors. While the stratified squamous epithelia of the human vagina and ectocervix are exposed to the complex microenvironment of the vagina, the columnar epithelium of the endocervix is generally considered a sterile site, in part due to the cervical mucus that filters bacteria and other debris while allowing sperm to ascend to the upper genital tract. However, this barrier can readily be crossed by a variety of infectious agents, in particular N. gonorrhoeae and Chlamydia trachomatis, typically leading to cervicitis. The lower female genital tract can also become contaminated with Gram-negative organisms secondary to the presence of rectal flora in the perineal area. Thus, it is essential that the normal cervical epithelium have the capacity to recognize and respond to ascending pathogens while at the same time avoiding a state of chronic inflammation that might disrupt the epithelial barrier. The sequelae of such chronic inflammation in the female genital tract would be highly detrimental to the host and include increased transmission of sexually transmitted diseases, especially HIV (7), and increased risk of preterm delivery (66).

Our results demonstrate that epithelial cells in the lower genital tract have evolved a unique mechanism for the recognition of Gram-negative pathogens. In contrast to professional phagocytic cells, the epithelial cells of the mucosal surface lack the key components of the LPS response machinery, TLR4 and MD2, and, consistent with this, lack cytokine responsiveness to purified LPS preparations. Epithelial cells in other mucosal sites have also been shown to have various degrees of LPS responsiveness. Perhaps most confusing are the data on gastrointestinal epithelial cells, where the ability of LPS to up-regulate proinflammatory cytokines appears to vary with the cell line tested (67, 68, 69, 70). In addition, airway epithelial cells have demonstrated sensitivity to LPS by NF-κB activation, cytokine production, and up-regulation of various defense molecules (71, 72, 73, 74), and LPS has been shown to simulated cytokine expression by human gingival epithelial cells (75, 76, 77). None of these studies identified host cell surface moieties linked to epithelial-LPS interactions.

Although considerable effort has been aimed at the elucidation of TLR signaling in professional immune cells, the roles of various TLR-related molecules in mucosal epithelial cell recognition of bacterial components remain poorly understood, with gastrointestinal epithelial cells having been studied the most extensively. For example, colon cancer cell lines as well as intestinal epithelial cells derived from patients with idiopathic inflammatory bowel disease have been reported to express functional TLR4 (78). In contrast, epithelial cells in normal adult intestinal tissue appear to be TLR4 deficient by immunohistochemistry (79), and it has been reported that several intestinal epithelial cell lines lack TLR4 and MD2, accounting for their LPS hyporesponsiveness (80). In addition, Asai et al. (81) recently reported that gingival epithelial cells also fail to express TLR4 and respond to Gram-negative bacteria via TLR2 ligands.

Our findings are the first to characterize the expression of the known TLRs in normal, nontumorigenic epithelial cells and the first to examine the expression in the mucosal surface of the female genital tract. The similarity between our data and the recent reports on digestive tract epithelium by Abreu et al. (80) and Asai et al. (81) suggests that nonsterile mucosa has evolved a unique mechanism for bacterial recognition that differs from that used in sterile sites. The unique TLR expression pattern, in particular the lack of TLR4 and the associated molecule MD2, suggests that the cervicovaginal epithelium is capable of responding to Gram-negative pathogens in the absence of endotoxin recognition. This is in contrast to the mechanism used by phagocytes (15, 17, 82), dendritic cells (83), and endothelial cells (51, 84), which express TLR4 and are highly sensitive to LPS activation through the Toll/IL-1 signaling pathway.

We can only speculate about the possible evolutionary pressure that would lead to such differential expression of TLR4. It has been suggested that the lack of TLR4 expression in intestinal epithelial cells might prevent the constant proinflammatory gene activation that could occur with exposure to normal enteric flora and might account for some of the chronic intestinal inflammation associated with disorders such as inflammatory bowel disease (78, 79, 80). The lower female genital tract also has a complex ecosystem, and it is possible that a similar model might exist in this compartment as well. Certainly, a threshold of sensitivity to bacterial components in the genital tract is required to avoid unnecessary inflammation. While inflammation is essential for clearing bacterial infections, excessive inflammation is particularly detrimental to the defense function of the mucosal surface. For example, it has been shown that inflammation increases the risk of sexual transmission of pathogens such as HIV-1 (7).

Our results also suggest that sCD14 has an LPS/TLR4-independent role in the genital tract epithelial cell responses to Gram-negative bacteria, enhancing the proinflammatory cytokine response to live bacteria and bacterial lysates. Even low concentrations of sCD14 (1–10 ng/ml) that would be below the detection limit of our assay because of sample dilution have effects on the cytokine response when the inoculum of bacteria is high. Furthermore, high concentrations of sCD14, as might be found during menses or following intercourse, may act to fortify the host defense under conditions of increased risk of infection by augmenting the inflammatory cytokine response. The precise molecular mechanism by which sCD14 enhances TLR-mediated cellular responses to bacterial membranes is unclear. Others have shown that membrane CD14 can facilitate signaling via TLR2 ligands including lipoproteins (62, 85) and peptidoglycan (23, 24). An enhancing effect of sCD14 was also found by Asai and colleagues regarding Porphyromonasgingivalis fimbrial lipoproteins and TLR2 (81). Our data go further to suggest that sCD14 is capable of enhancing the proinflammatory response not only to purified ligand, but also to bacterial lysates and live bacteria. This could be accomplished either by directly presenting ligand to a TLR or by increasing the availability of ligands by interactions with the bacterial membrane.

Thus, while TLR4 may be essential for the response to Gram-negative pathogens during bacteremia and sepsis, other TLRs may be more important for the recognition of Gram-negative bacteria at specific sites, such as the mucosal surface of the female genital tract. A better understanding of the regulation of TLR expression and its influence on bacterial recognition may provide insight into the pathogenesis of a variety of infectious diseases, in particular the pathophysiology of sexually transmitted diseases and the deleterious sequelae associated with chronic genital tract inflammation.

1

This work was supported by National Institutes of Health Grants R01AI46613 and K08AI01476 (to R.R.I.), 5U19 AI38515 (to A.O.C. and R.R.I.), and P01AI46518 (to D.J.A. and R.N.F.). R.N.F. is supported in part by a Connors Seed Grant for Gender Biology Research. E.L. is supported by the Research Council of Norway and the Norwegian Cancer Society.

3

Abbreviations used in this paper: TLR, Toll-like receptor; HKLM, heat-killed Listeria monocytogenes; LBP, LPS binding protein; LOS, lipooligosaccharide; sCD14, soluble CD14; sMALP-2, synthetic lipopeptide based on the full-length MALP-2; sPG, soluble peptidoglycan.

1
Press, M. F., N. A. Nousek-Goebl, M. Bur, G. L. Greene.
1986
. Estrogen receptor localization in the female genital tract.
Am. J. Pathol.
123
:
280
2
Kutteh, W. H., Z. Moldoveanu, J. Mestecky.
1998
. Mucosal immunity in the female reproductive tract: correlation of immunoglobulins, cytokines, and reproductive hormones in human cervical mucus around the time of ovulation.
AIDS Res. Hum. Retroviruses
14
: (Suppl. 1):
S51
3
Gipson, I. K., S. B. Ho, S. J. Spurr-Michaud, A. S. Tisdale, Q. Zhan, E. Torlakovic, J. Pudney, D. J. Anderson, N. W. Toribara, J. A. Hill, III.
1997
. Mucin genes expressed by human female reproductive tract epithelia.
Biol. Reprod.
56
:
999
4
Gipson, I. K., R. Moccia, S. Spurr-Michaud, P. Argueso, A. R. Gargiulo, J. A. Hill, III, G. D. Offner, H. T. Keutmann.
2001
. The amount of MUC5B mucin in cervical mucus peaks at midcycle.
J. Clin. Endocrinol. Metab.
86
:
594
5
Quayle, A. J., E. M. Porter, A. A. Nussbaum, Y. M. Wang, C. Brabec, K. P. Yip, S. C. Mok.
1998
. Gene expression, immunolocalization, and secretion of human defensin-5 in human female reproductive tract.
Am. J. Pathol.
152
:
1247
6
Anderson, D. J., J. A. Politch, L. D. Tucker, R. Fichorova, F. Haimovici, R. E. Tuomala, K. H. Mayer.
1998
. Quantitation of mediators of inflammation and immunity in genital tract secretions and their relevance to HIV type 1 transmission.
AIDS Res. Hum. Retroviruses
14
: (Suppl. 1):
S43
7
Fichorova, R. N., L. D. Tucker, D. J. Anderson.
2001
. The molecular basis of nonoxynol-9-induced vaginal inflammation and its possible relevance to human immunodeficiency virus type 1 transmission.
J. Infect. Dis.
184
:
418
8
Fichorova, R. N., J. G. Rheinwald, D. J. Anderson.
1997
. Generation of papillomavirus-immortalized cell lines from normal human ectocervical, endocervical, and vaginal epithelium that maintain expression of tissue-specific differentiation proteins.
Biol. Reprod.
57
:
847
9
Fichorova, R. N., D. J. Anderson.
1999
. Differential expression of immunobiological mediators by immortalized human cervical and vaginal epithelial cells.
Biol. Reprod.
60
:
508
10
Fichorova, R. N., P. J. Desai, F. C. Gibson, III, C. A. Genco.
2001
. Distinct proinflammatory host responses to Neisseria gonorrhoeae infection in immortalized human cervical and vaginal epithelial cells.
Infect. Immun.
69
:
5840
11
Rock, F. L., G. Hardiman, J. C. Timans, R. A. Kastelein, J. F. Bazan.
1998
. A family of human receptors structurally related to Drosophila Toll.
Proc. Natl. Acad. Sci. USA
95
:
588
12
Medzhitov, R., P. Preston-Hurlburt, C. A. Janeway, Jr.
1997
. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity.
Nature
388
:
394
13
Morisato, D., K. V. Anderson.
1995
. Signaling pathways that establish the dorsal-ventral pattern of the Drosophila embryo.
Annu. Rev. Genet.
29
:
371
14
Lemaitre, B., E. Nicolas, L. Michaut, J. M. Reichhart, J. A. Hoffmann.
1996
. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults.
Cell
86
:
973
15
Poltorak, A., X. He, I. Smirnova, M.-Y. Liu, C. Van Huffel, X. Du, D. Birdwell, A. Alejos, M. Silva, C. Galanos, et al
1998
. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene.
Science
282
:
2085
16
Chow, J. C., D. W. Young, D. T. Golenbock, W. J. Christ, F. Gusovsky.
1999
. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction.
J. Biol. Chem.
274
:
10689
17
Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, S. Akira.
1999
. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product.
J. Immunol.
162
:
3749
18
Qureshi, S. T., L. Lariviere, G. Leveque, S. Clermont, K. J. Moore, P. Gros, D. Malo.
1999
. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4).
J. Exp. Med.
189
:
615
19
Lien, E., T. K. Means, H. Heine, A. Yoshimura, S. Kusumoto, K. Fukase, M. J. Fenton, M. Oikawa, N. Qureshi, B. Monks, et al
2000
. Toll-like receptor 4 imparts ligand-specific recognition of bacterial lipopolysaccharide.
J. Clin. Invest.
105
:
497
20
Shimazu, R., S. Akashi, H. Ogata, Y. Nagai, K. Fukudome, K. Miyake, M. Kimoto.
1999
. MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4.
J. Exp. Med.
189
:
1777
21
Schromm, A. B., E. Lien, P. Henneke, J. C. Chow, A. Yoshimura, H. Heine, E. Latz, B. G. Monks, D. A. Schwartz, K. Miyake, et al
2001
. molecular genetic analysis of an endotoxin nonresponder mutant cell line: a point mutation in a conserved region of md-2 abolishes endotoxin-induced signaling.
J. Exp. Med.
194
:
79
22
Kirschning, C. J., H. Wesche, T. M. Ayres, M. Rothe.
1998
. Human Toll-like receptor 2 confers responsiveness to bacterial lipopoysaccharide.
J. Exp. Med.
188
:
2091
23
Yoshimura, A., E. Lien, R. R. Ingalls, E. Tuomanen, R. Dziarski, D. Golenbock.
1999
. Recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via toll-like receptor 2.
J. Immunol.
163
:
1
24
Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, C. J. Kirschning.
1999
. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2.
J. Biol. Chem.
274
:
17406
25
Aliprantis, A. O., R. B. Yang, M. R. Mark, S. Suggett, B. Devaux, J. D. Radolf, G. R. Klimpel, P. Godowski, A. Zychlinsky.
1999
. Cell activation and apoptosis by bacterial lipoproteins through Toll-like receptor-2.
Science
285
:
736
26
Hirschfeld, M., C. J. Kirschning, R. Schwandner, H. Wesche, J. H. Weis, R. M. Wooten, J. J. Weis.
1999
. Cutting edge: inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by toll-like receptor 2.
J. Immunol.
163
:
2382
27
Lien, E., T. J. Sellati, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, et al
1999
. Toll-like receptor 2 functions as a pattern recognition receptor for diverse bacterial products.
J. Biol. Chem.
274
:
33419
28
Means, T. K., S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, M. J. Fenton.
1999
. Human toll-like receptors mediate cellular activation by Mycobacterium tuberculosis.
J. Immunol.
163
:
3920
29
Flo, T. H., O. Halaas, E. Lien, L. Ryan, G. Teti, D. T. Golenbock, A. Sundan, T. Espevik.
2000
. Human toll-like receptor 2 mediates monocyte activation by Listeriamonocytogenes, but not by group B streptococci or lipopolysaccharide.
J. Immunol.
164
:
2064
30
Takeuchi, O., T. Kawai, P. F. Muhlradt, M. Morr, J. D. Radolf, A. Zychlinsky, K. Takeda, S. Akira.
2001
. Discrimination of bacterial lipoproteins by Toll-like receptor 6.
Int. Immunol.
13
:
933
31
Bulut, Y., E. Faure, L. Thomas, O. Equils, M. Arditi.
2001
. Cooperation of Toll-like receptor 2 and 6 for cellular activation by soluble tuberculosis factor and Borrelia burgdorferi outer surface protein A lipoprotein: role of Toll-interacting protein and IL-1 receptor signaling molecules in Toll-like receptor 2 signaling.
J. Immunol.
167
:
987
32
Ozinsky, A., D. M. Underhill, J. D. Fontenot, A. M. Hajjar, K. D. Smith, C. B. Wilson, L. Schroeder, A. Aderem.
2000
. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between Toll-like receptors.
Proc. Natl. Acad. Sci. USA
97
:
13766
33
Hajjar, A. M., D. S. O’Mahony, A. Ozinsky, D. M. Underhill, A. Aderem, S. J. Klebanoff, C. B. Wilson.
2001
. Cutting edge: functional interactions between Toll-like receptor (TLR) 2 and TLR1 or TLR6 in response to phenol-soluble modulin.
J. Immunol.
166
:
15
34
Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, et al
2000
. A Toll-like receptor recognizes bacterial DNA.
Nature
408
:
740
35
Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill, A. Aderem.
2001
. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.
Nature
410
:
1099
36
Hardiman, G., F. L. Rock, S. Balasubramanian, R. A. Kastelein, J. F. Bazan.
1996
. Molecular characterization and modular analysis of human MyD88.
Oncogene
13
:
2467
37
Bonnert, T. P., K. E. Garka, P. Parnet, G. Sonoda, J. R. Testa, J. E. Sims.
1997
. The cloning and characterization of human MyD88: a member of an IL-1 receptor related family.
FEBS Lett.
402
:
81
38
Muzio, M., G. Natoli, S. Saccani, M. Levrero, A. Mantovani.
1998
. The human toll signaling pathway: divergence of nuclear factor κB and JNK/SAPK activation upstream of tumor necrosis factor receptor-associated factor 6 (TRAF6).
J. Exp. Med.
187
:
2097
39
Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, S. Akira.
1998
. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function.
Immunity
9
:
143
40
Manthey, C. L., S. N. Vogel.
1994
. Elimination of trace endotoxin protein from rough chemotype LPS.
J. Endotoxin Res.
1
:
84
41
Hirschfeld, M., Y. Ma, J. H. Weis, S. N. Vogel, J. J. Weis.
2000
. Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2.
J. Immunol.
165
:
618
42
Garcia, J., B. Lemercier, S. Roman-Roman, G. Rawadi.
1998
. A Mycoplasmafermentans-derived synthetic lipopeptide induces AP-1 and NF-κB activity and cytokine secretion in macrophages via the activation of mitogen-activated protein kinase pathways.
J. Biol. Chem.
273
:
34391
43
Ossewaarde, J. M., A. de Vries, T. Bestebroer, A. F. Angulo.
1996
. Application of a Mycoplasma group-specific PCR for monitoring decontamination of Mycoplasma-infected Chlamydia sp. strains.
Appl. Environ. Microbiol.
62
:
328
44
Ades, E. W., F. J. Candal, R. A. Swerlick, V. G. George, S. Summers, D. C. Bosse, T. J. Lawley.
1992
. HMEC-1: establishment of an immortalized human microvascular endothelial cell line.
J. Invest. Dermatol.
99
:
683
45
Delude, R. L., M. J. Fenton, R. Savedra, Jr, P. Y. Perera, S. N. Vogel, R. Thieringer, D. T. Golenbock.
1994
. CD14-mediated translocation of nuclear factor-κB induced by LPS does not require tyrosine kinase activity.
J. Biol. Chem.
269
:
22253
46
Means, T. K., B. W. Jones, A. B. Schromm, B. A. Shurtleff, J. A. Smith, J. Keane, D. T. Golenbock, S. N. Vogel, M. J. Fenton.
2001
. Differential effects of a Toll-like receptor antagonist on Mycobacterium tuberculosis-induced macrophage responses.
J. Immunol.
166
:
4074
47
Sussman, D. J., G. Milman.
1984
. Short-term, high-efficiency expression of transfected DNA.
Mol. Cell. Biol.
4
:
1641
48
Liabakk, N. B., E. Lien, A. Sundan, A. Sunde, R. Austgulen, T. Espevik.
1993
. High concentrations of the soluble p55 tumour necrosis factor receptor in human seminal plasma.
Hum. Reprod.
8
:
1837
49
Rohan, L. C., R. P. Edwards, L. A. Kelly, K. A. Colenello, F. P. Bowman, P. A. Crowley-Nowick.
2000
. Optimization of the weck-Cel collection method for quantitation of cytokines in mucosal secretions.
Clin. Diagn. Lab. Immunol.
7
:
45
50
Lien, E., P. Aukrust, A. Sundan, F. Muller, S. S. Froland, T. Espevik.
1998
. Elevated levels of serum-soluble CD14 in human immunodeficiency virus type 1 (HIV-1) infection: correlation to disease progression and clinical events.
Blood
92
:
2084
51
Faure, E., O. Equils, P. A. Sieling, L. Thomas, F. X. Zhang, C. J. Kirschning, N. Polentarutti, M. Muzio, M. Arditi.
2000
. Bacterial lipopolysaccharide activates NF-κB through Toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells: differential expression of TLR-4 and TLR-2 in endothelial cells.
J. Biol. Chem.
275
:
11058
52
Kopp, E. B., S. Ghosh.
1995
. NF-κB and rel proteins in innate immunity.
Adv. Immunol.
58
:
1
53
Beagley, K. W., C. O. Elson.
1992
. Cells and cytokines in mucosal immunity and inflammation.
Gastroenterol. Clin. North Am.
21
:
347
54
Frey, E. A., D. S. Miller, T. G. Jahr, A. Sundan, V. Bazil, T. Espevik, B. B. Finlay, S. D. Wright.
1992
. Soluble CD14 participates in the response of cells to lipopolysaccharide.
J. Exp. Med.
176
:
1665
55
Haziot, A., G. W. Rong, J. Silver, S. M. Goyert.
1993
. Recombinant soluble CD14 mediates the activation of endothelial cells by lipopolysaccharide.
J. Immunol.
151
:
1500
56
Pugin, J., C. C. Schurer-Maly, D. Leturcq, A. Moriarty, R. J. Ulevitch, P. S. Tobias.
1993
. Lipopolysaccharide activation of human endothelial and epithelial cells is mediated by lipopolysaccharide-binding protein and soluble CD14.
Proc. Natl. Acad. Sci. USA
90
:
2744
57
Hailman, E., H. S. Lichenstein, M. M. Wurfel, D. S. Miller, D. A. Johnson, M. Kelley, L. A. Busse, M. M. Zukowski, S. D. Wright.
1994
. Lipopolysaccharide (LPS)-binding protein accelerates the binding of LPS to CD14.
J. Exp. Med.
179
:
269
58
Pugin, J., D. Heumann, A. Tomasz, V. V. Kravchenko, Y. Akamatsu, M. Nishijima, M. P. Glauser, P. S. Tobias, R. J. Ulevitch.
1994
. CD14 is a pattern recognition receptor.
Immunity
1
:
509
59
Weidemann, B., H. Brade, E. T. Rietschel, R. Dziarski, V. Bazil, S. Kusumoto, H. D. Flad, A. J. Ulmer.
1994
. Soluble peptidoglycan-induced monokine production can be blocked by anti-CD14 monoclonal antibodies and by lipid A partial structures.
Infect. Immun.
62
:
4709
60
Dziarski, R., R. I. Tapping, P. S. Tobias.
1998
. Binding of bacterial peptidoglycan to CD14.
J. Biol. Chem.
273
:
8680
61
Kusunoki, T., E. Hailman, T. S. Juan, H. S. Lichenstein, S. D. Wright.
1995
. Molecules from Staphylococcus aureus that bind CD14 and stimulate innate immune responses.
J. Exp. Med.
182
:
1673
62
Wooten, R. M., T. B. Morrison, J. H. Weis, S. D. Wright, R. Thieringer, J. J. Weis.
1998
. The role of CD14 in signaling mediated by outer membrane lipoproteins of Borrelia burgdorferi.
J. Immunol.
160
:
5485
63
Raetz, C. R. H..
1990
. Biochemistry of endotoxins.
Annu. Rev. Biochem.
59
:
129
64
Ingalls, R. R., E. Lien, D. T. Golenbock.
2001
. Membrane-associated proteins of a lipopolysaccharide-deficient mutant of Neisseriameningitidis activate the inflammatory response through Toll-like receptor 2.
Infect. Immun.
69
:
2230
65
Wesche, H., W. J. Henzel, W. Shillinglaw, S. Li, Z. Cao.
1997
. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex.
Immunity
7
:
837
66
Yost, N. P., S. M. Cox.
2000
. Infection and preterm labor.
Clin. Obstet. Gynecol.
43
:
759
67
Eckmann, L., H. C. Jung, C. Schurer-Maly, A. Panja, E. Morzycka-Wroblewska, M. F. Kagnoff.
1993
. Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
Gastroenterology
105
:
1689
68
Schuerer-Maly, C. C., L. Eckmann, M. F. Kagnoff, M. T. Falco, F. E. Maly.
1994
. Colonic epithelial cell lines as a source of interleukin-8: stimulation by inflammatory cytokines and bacterial lipopolysaccharide.
Immunology
81
:
85
69
Lahde, M., R. Korhonen, E. Moilanen.
2000
. Regulation of nitric oxide production in cultured human T84 intestinal epithelial cells by nuclear factor-κB-dependent induction of inducible nitric oxide synthase after exposure to bacterial endotoxin.
Aliment. Pharmacol. Ther.
14
:
945
70
Ding, S. Z., C. H. Cho, S. K. Lam.
2000
. Regulation of interleukin 6 production in a human gastric epithelial cell line MKN-28.
Cytokine
12
:
1129
71
Becker, M. N., G. Diamond, M. W. Verghese, S. H. Randell.
2000
. CD14-dependent lipopolysaccharide-induced β-defensin-2 expression in human tracheobronchial epithelium.
J. Biol. Chem.
275
:
29731
72
Diamond, G., V. Kaiser, J. Rhodes, J. P. Russell, C. L. Bevins.
2000
. Transcriptional regulation of β-defensin gene expression in tracheal epithelial cells.
Infect. Immun.
68
:
113
73
Beck-Schimmer, B., R. C. Schimmer, R. L. Warner, H. Schmal, G. Nordblom, C. M. Flory, M. E. Lesch, H. P. Friedl, D. J. Schrier, P. A. Ward.
1997
. Expression of lung vascular and airway ICAM-1 after exposure to bacterial lipopolysaccharide.
Am. J. Respir. Cell Mol. Biol.
17
:
344
74
Freitag, A., A. Reimann, I. Wessler, K. Racke.
1996
. Effects of bacterial lipopolysaccharides (LPS) and tumour necrosis factor-α (TNFα) on rat tracheal epithelial cells in culture: morphology, proliferation and induction of nitric oxide (NO) synthase.
Pulm. Pharmacol.
9
:
149
75
Pollanen, M. T., J. I. Salonen, D. Grenier, V. J. Uitto.
2000
. Epithelial cell response to challenge of bacterial lipoteichoic acids and lipopolysaccharides in vitro.
J. Med. Microbiol.
49
:
245
76
Walsh, L. J., G. J. Seymour, P. S. Bird, R. N. Powell.
1985
. Modulation of HLA-DR antigens in the gingival epithelium in vitro by heat-killed Fusobacteriumnucleatum and E. coli lipopolysaccharide.
J. Oral Pathol.
14
:
833
77
Krisanaprakornkit, S., J. R. Kimball, A. Weinberg, R. P. Darveau, B. W. Bainbridge, B. A. Dale.
2000
. Inducible expression of human β-defensin 2 by Fusobacteriumnucleatum in oral epithelial cells: multiple signaling pathways and role of commensal bacteria in innate immunity and the epithelial barrier.
Infect. Immun.
68
:
2907
78
Cario, E., I. M. Rosenberg, S. L. Brandwein, P. L. Beck, H. C. Reinecker, D. K. Podolsky.
2000
. Lipopolysaccharide activates distinct signaling pathways in intestinal epithelial cell lines expressing Toll-like receptors.
J. Immunol.
164
:
966
79
Cario, E., D. K. Podolsky.
2000
. Differential alteration in intestinal epithelial cell expression of Toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease.
Infect. Immun.
68
:
7010
80
Abreu, M. T., P. Vora, E. Faure, L. S. Thomas, E. T. Arnold, M. Arditi.
2001
. Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide.
J. Immunol.
167
:
1609
81
Asai, Y., Y. Ohyama, K. Gen, T. Ogawa.
2001
. Bacterial fimbriae and their peptides activate human gingival epithelial cells through Toll-like receptor 2.
Infect. Immun.
69
:
7387
82
Akashi, S., R. Shimazu, H. Ogata, Y. Nagai, K. Takeda, M. Kimoto, K. Miyake.
2000
. Cutting edge: cell surface expression and lipopolysaccharide signaling via the toll-like receptor 4-MD-2 complex on mouse peritoneal macrophages.
J. Immunol.
164
:
3471
83
Visintin, A., A. Mazzoni, J. H. Spitzer, D. H. Wyllie, S. K. Dower, D. M. Segal.
2001
. Regulation of toll-like receptors in human monocytes and dendritic cells.
J. Immunol.
166
:
249
84
Frantz, S., L. Kobzik, Y. D. Kim, R. Fukazawa, R. Medzhitov, R. T. Lee, R. A. Kelly.
1999
. Toll4 (TLR4) expression in cardiac myocytes in normal and failing myocardium.
J. Clin. Invest.
104
:
271
85
Sellati, T. J., D. A. Bouis, M. J. Caimano, J. A. Feulner, C. Ayers, E. Lien, J. D. Radolf.
1999
. Activation of human monocytic cells by Borreliaburgdorferi and Treponema pallidum is facilitated by CD14 and correlates with surface exposure of spirochetal lipoproteins.
J. Immunol.
163
:
2049