Tumor cells are typically poorly immunogenic. The same mechanisms that evolved to avoid the induction of immune responses against self tissues, and, hence, autoimmune disease, also have to be overcome for immune therapy of cancer. Toll-like receptor-activating microbial products such as CpG motif containing DNA are among the primary stimuli that the immune system uses to distinguish between infectious nonself (that is to be attacked) and noninfectious self (that must not be attacked). We tested in a murine RMA lymphoma/C57BL/6 model whether providing the infectious nonself context in a tumor–by injecting CpG-oligodeoxynucleotides directly into the tumor–would elicit a protective antitumor response. Complete remission of established solid tumors was achieved in immune competent mice, but not in T cell/B cell-deficient RAG-1 knockout mice. Intratumor injection of CpG-oligodeoxynucleotides was shown to induce a tumor-specific CD4+ and CD8+ T cell response of the type 1 effector class, and T cells adoptively transferred the protection to RAG-1 knockout mice. The data show that intratumor injection of CpG-oligodeoxynucleotides is a promising strategy for rendering tumors immunogenic.

Although until recently, tumors had been thought to be a nonrewarding target for immune therapy, recently it has become clear that tumor cells do express Ags that can be targeted for therapeutic purposes. Some of these Ags are unique to the tumor, such as viral Ags, mutated, or aberrantly processed proteins, other tumor Ags can be normal differentiation Ags that are presented on the MHC molecules of the tumor at an increased density relative to the corresponding mature cell type (1). Despite their potential antigenicity, most tumors grow in the body apparently without eliciting a protective immune response. One primary reason for the negligence of the immune system is the fact that most tumors arise and grow in extralymphatic tissues (2). Naive T cells, the precursor cells for the antitumor attack, do not readily home to the immune periphery. Expressing the lymph node-homing receptor, L-selectin (CD62), they recirculate between the blood and the secondary lymphoid tissues, sparing the extralymphatic tissues (3). Moreover, even if naive T cells are recruited to the immune periphery, for example by the local chemokine expression associated with inflammation, the encounter of the naive T cells with (tumor) Ags in the immune periphery is likely to induce tolerance rather than an immune response (4, 5, 6, 7). Finally, even if naive T cells engage in an immune response against a tumor, the type of response will decide whether immune protection results, or whether the T cells facilitate tumor growth, for example by secreting IL-4, a cytokine that promotes angiogenesis (8).

The interplay between the innate immune system and T cells determines the type of immune response engaged. Ag encounter by the naive T cell in a noninfectious context that is caused, for example, by sterile tissue injury, is prone to lead to a type 2 T cell response. The cytokines released by type 2 T cells that inactivate macrophages and promote angiogenesis (9) might not represent the response of choice for combating tumors. In contrast, Ag encounter in an infectious context is prone to induce a proinflammatory type 1 T cell response (9, 10, 11) that entails macrophage activation in addition to direct T cell-mediated effector functions. The infectious context is generated by the activation of cells of the innate immune system via Toll-like receptors that recognize molecular patterns frequently associated with microorganisms (12, 13). By using Toll like receptor-9, dendritic cells, macrophages, and NK cells can recognize CpG-oligodeoxynucleotides (ODN) 3 that are common in bacterial DNA (14). CpG-ODN induces in these cells the production of chemokines and cytokines, and the up-regulation of T cell costimulatory cell surface molecules (15, 16, 17, 18). Thus, CpG-ODN has emerged as potent type 1-polarizing adjuvants (10, 18, 19). Therefore, we hypothesized that the intratumor injection of CpG-ODN would abolish the immune privilege of tumors by recruiting and activating local dendritic cells, and the induction of IL-12 production (20, 21, 22) should guide the emerging antitumor T cell response along the type 1 pathway, engaging a tumor-destructive class of effector cells. We tested this hypothesis in the well-defined murine model of RMA lymphoma (23) that grows as a solid tumor in syngeneic C57BL/6 mice.

RMA lymphoma (23) was kindly provided by Dr. C. Harding (Case Western Reserve University, Cleveland, OH). B16 melanoma (B16M) cells (24) and EL-4 T cell lymphoma were obtained from American Type Culture Collection (Manassas, VA). The tumor cells were cultured in RPMI 1640 supplemented with 10% FCS and 1% l-glutamine. C57BL/6 and RAG-1−/− mice on a C57BL/6 background were purchased from The Jackson Laboratory (Bar Harbor, ME) and maintained at the animal facility (Case Western Reserve University) under specific pathogen-free conditions. For RMA tumor challenge, a total of 3 million RMA cells were injected s.c. in the flank in a volume of 200 μl of PBS. By day 5 the tumor reached a diameter of ∼4 mm. Intratumor injections with CpG-ODN or control ODN were performed at this time point, unless specified otherwise. In untreated mice, initial experiments revealed that lethal tumor growth was reached on about day 30; therefore, in accordance with Institutional Animal Care and Use Committee guidelines, mice were sacrificed when the tumor reached a diameter of 25 mm (days 23- 25). Tumor diameter was measured every 3 days. For the B16M challenge, mice were injected in a tail vein with 200,000 B16M cells in 500 μl of PBS, a dose that is lethal in 100% of mice. The survival rate was monitored daily. All treatments complied with institutional guidelines.

The ODN were purchased from Oligos Etc. (Wilsonville, OR). The sequences of ODN that were phosphorothioate-modified throughout are for CpG-ODN 1826: TCCATGACGTTCCTGACGTT and for non-CpG (nCpG)-ODN 1745: TCCAATGAGCTTCCTGAGTCT, as they have been previously defined (10). ODN were dissolved in sterile PBS, aliquoted, and then stored at −20°C until used. On day 5 of RMA injection, the tumor was injected with either 20 μg of CpG in 200 μl of PBS, 20 μg of nCpG in the same volume, or 200 μl of PBS alone. The injections were repeated identically on days 8 and 11.

The assay was performed as previously described (25). Briefly, spleens were removed 20 days after tumor injection and single cell suspensions were prepared. Cells from three animals per group were pooled. Splenocytes were restimulated with the Ag in tissue culture as follows. Spleen cells (1 × 106) were cultured with 2 × 104 irradiated (10,000 rad) RMA cells in 1% l-glutamine-supplemented HL-1 medium (BioWhittaker, Walkersville, MD) in 24-well flat-bottom plates. After 5 days of culture, the cytotoxicity of the effector cells was assayed on RMA labeled with Na51CrO4 (Amersham, Arlington Heights, IL). The percent-specific lysis was calculated as: ((experimental 51Cr release − spontaneous 51Cr release)/(maximum 51Cr release − spontaneous 51Cr release) × 100), where the spontaneous release is the radioactivity of target cells in the absence of effectors (background) and maximum release is the radioactivity detected after treatment of the target cells with 5% Triton X-100 (Fisher Scientific, Fair Lawn, NJ).

CD3+ cells were obtained by negative selection, passing erythrocyte-depleted spleen cells (by osmotic lysis) through murine CD3+ T cell enrichment columns (R&D Systems, Minneapolis, MN). CD4+ cells and CD8+ cells were obtained by negative selection, passing erythrocyte-depleted spleen cells through murine CD4+ or CD8+ T cell enrichment columns (R&D Systems). The efficacy of enrichment was controlled by FACS analysis staining with labeled anti-CD4, anti-CD8, and anti-CD3 Abs (all from BD PharMingen, San Diego, CA). More than 95% enrichment for the desired phenotype was obtained. All cell fractions were plated at 2 × 105 cells/well and tested in ELISPOT assays (described as below) with 5 × 105 irradiated C57BL/6 APCs.

These assays were performed as previously described (26). Briefly, ImmunoSpot M200 plates (Cellular Technology, Cleveland, OH) were coated overnight at 4°C with the cytokine-specific capture Abs specified below. The plates were washed three times with PBS, then blocked with 1% BSA in PBS for 2 h at room temperature. After washing, freshly isolated splenocytes were plated at 106 cells/well in serum-free HL-1 medium, supplemented with l-glutamine, in the presence or absence of 10,000 rad irradiated RMA, B16M, or EL-4 tumor cells at a concentration of 2 × 104/well. For blocking, additional anti-CD4 Ab (GK1.5) or anti-CD8 Ab (S3-6.72) was added at the concentrations specified (see Fig. 2 C). As a positive control, anti-CD3 (2C11) at 3 μg/ml was used. After 24 (for IFN-γ and IL-2) or 48 h (for IL-4 and IL-5) of cell culture in the incubator, the cells were removed by washing first three times with PBS and then four times with PBS containing 0.05% Tween (PBST). Then the biotinylated detection Abs were added and incubated at 4°C overnight. The plates were then washed three times with PBST and subsequently streptavidin-HRP conjugate (DAKO, Carpinteria, CA) was added at a 1/2000 dilution, incubated for 2 h at room temperature, and removed by washing twice with PBS and PBST. The spots were visualized by adding HRP substrate 3-amino-9-ethylcarbozole (Pierce, Rockford, IL). The plates were then washed with distilled water, air dried and analyzed the next day with the Series 1 ImmunoSpot Analyzer (Cellular Technology) customized for analyzing ELISPOTS at single cell resolution (26). We used the following combinations of capture mAbs for the cytokines tested: IFN-γ (R46A2; 5 μg/ml), IL-2 (JES6-1A12; 5 μg/ml), IL-4 (11B11; 3 μg/ml), and IL-5 (TRFK5; 2 μg/ml). For their detection the mAbs IFN-γ (XMG1.1 biotin; 1 μg/ml), IL-2 (JES6-5H4-biotin; 3 μg/ml), IL-4 (BVD6-24G2-biotin; 4 μg/ml), and IL-5 (TRFK4-biotin; 4 μg/ml) were used.

FIGURE 2.

Characterization of immunity induced by intratumor injections. A, Cytotoxicity measured in chromium release assay. C57BL/6 mice were injected with 3 million RMA cells s.c. One group (n = 3) received intratumor injection of CpG-ODN; another group (n = 3) was injected with PBS, the third group of tumor-injected mice remained untreated. Naive mice served as additional specificity control. The groups are specified by symbols. Twenty days later, spleen cells were isolated, those within a group pooled and rechallenged in culture with irradiated RMA cells. Five days later, cytotoxicity was measured against Na51CrO4-labeled RMA target cells. The specific lysis measured at different E:T cell ratios is shown. The data were reproduced in an independent experiment. B, IFN-γ recall response measured in ELISPOT assay. Mice were treated as described in the legend for A. Pooled spleen cells (n = 4) of the treatment groups specified were challenged with irradiated RMA cells or B16M tumor cells as specified and tested directly ex vivo in an IFN-γ ELISPOT assay of 24 h duration. The number of spots generated by the 1 million spleen cells plated per well was counted by image analysis. The mean and SD of spot numbers in four replicate wells are shown after subtracting the respective spot numbers in the medium controls (<10 per million). The data were reproduced in three independent experiments. C, Anti-CD4 and anti-CD8 Ab blocking of the RMA-induced IFN-γ recall response in mice whose tumors have been injected with CpG-ODN. The CpG-ODN treatment group from B was tested in an IFN-γ ELISPOT assay as described in B, now including the indicated concentrations of anti-CD4 or anti-CD8 Ab. The data were reproduced twice. D, Recall response in T cell subpopulations of CpG:RMA-injected mice. The RMA tumor was induced and treated with CpG as described in A. On day 5 after CpG injection, unfractionated spleen cells or purified CD3+, CD4+, and CD8+ cell fractions were tested for reactivity to RMA, and as a specificity control, against EL-4. The cell fractions were tested with and without added syngeneic naive spleen cells functioning as APC. Mean and SD of spot counts in triplicate wells are shown.

FIGURE 2.

Characterization of immunity induced by intratumor injections. A, Cytotoxicity measured in chromium release assay. C57BL/6 mice were injected with 3 million RMA cells s.c. One group (n = 3) received intratumor injection of CpG-ODN; another group (n = 3) was injected with PBS, the third group of tumor-injected mice remained untreated. Naive mice served as additional specificity control. The groups are specified by symbols. Twenty days later, spleen cells were isolated, those within a group pooled and rechallenged in culture with irradiated RMA cells. Five days later, cytotoxicity was measured against Na51CrO4-labeled RMA target cells. The specific lysis measured at different E:T cell ratios is shown. The data were reproduced in an independent experiment. B, IFN-γ recall response measured in ELISPOT assay. Mice were treated as described in the legend for A. Pooled spleen cells (n = 4) of the treatment groups specified were challenged with irradiated RMA cells or B16M tumor cells as specified and tested directly ex vivo in an IFN-γ ELISPOT assay of 24 h duration. The number of spots generated by the 1 million spleen cells plated per well was counted by image analysis. The mean and SD of spot numbers in four replicate wells are shown after subtracting the respective spot numbers in the medium controls (<10 per million). The data were reproduced in three independent experiments. C, Anti-CD4 and anti-CD8 Ab blocking of the RMA-induced IFN-γ recall response in mice whose tumors have been injected with CpG-ODN. The CpG-ODN treatment group from B was tested in an IFN-γ ELISPOT assay as described in B, now including the indicated concentrations of anti-CD4 or anti-CD8 Ab. The data were reproduced twice. D, Recall response in T cell subpopulations of CpG:RMA-injected mice. The RMA tumor was induced and treated with CpG as described in A. On day 5 after CpG injection, unfractionated spleen cells or purified CD3+, CD4+, and CD8+ cell fractions were tested for reactivity to RMA, and as a specificity control, against EL-4. The cell fractions were tested with and without added syngeneic naive spleen cells functioning as APC. Mean and SD of spot counts in triplicate wells are shown.

Close modal

Injection of tumor Ags as subunit vaccines using CpG-ODN as the adjuvant can trigger protective antitumor immunity (27, 28, 29). However, this approach requires that the tumor Ag is known, which typically does not apply for the clinical setting where tumor Ags vary with each type of tumor, and even within an individual’s tumor. Can CpG-ODN as a single agent, injected in the tumor itself, convert the respective tumor into a cellular vaccine eliciting a protective immune response against the unique array of Ags present on this particular tumor? In a previous report (30) it was shown that injection of CpG-ODN into a neuroblastoma causes the remission of this tumor in nude mice that lack CD4+ and CD8+ lymphocytes. Therefore, this effect seemed to be NK cell- rather than T cell-dependent. Although indirect evidence surfaced that this strategy can also be used to induce clonally expandable adoptive immunity (31) we set out to formally prove this therapeutic principle. We injected RMA lymphoma cells s.c. into immunocompetent, syngeneic C57BL/6 mice and into immunodeficient, congenic RAG-1 knockout (KO) mice. The deposition of 3 million RMA cells resulted in local tumor growth that was similar in both types of mice (Fig. 1). Therefore, RMA was neither sufficiently immunogenic to induce a protective immune response in the immune competent mice, nor was it sufficiently NK cell-sensitive to be significantly inhibited by the increased NK cell activity in the RAG-1 KO mice.

FIGURE 1.

Intratumor injection induces remission of RMA in WT but not in RAG-1KO mice. A, C57BL/6 mice were injected with 3 million RMA cells into the right flank, s.c. Five days later, mice received either an intratumor injection of 20 μg of CpG-ODN (n = 20 mice), 20 μg of nCpG (n = 5 mice), or PBS (n = 4 mice), as specified by the symbols. The injections were repeated on days 8 and 11 (indicated by arrows). According to institutional guidelines, mice were sacrificed when the tumor diameter reached 25 mm (∗). Data points represent the mean tumor diameter per group. B, RAG-1 KO mice were injected in the same way (four mice in each group). Tumor diameters were measured every third day. The result of one experiment is shown in each panel. For WT mice, the data were reproduced with identical results in nine independent experiments, involving a total of 70, 53, and 23 mice in the CpG-ODN, nCpG-ODN, and PBS groups, respectively. The experiment shown in B was reproduced twice with identical results.

FIGURE 1.

Intratumor injection induces remission of RMA in WT but not in RAG-1KO mice. A, C57BL/6 mice were injected with 3 million RMA cells into the right flank, s.c. Five days later, mice received either an intratumor injection of 20 μg of CpG-ODN (n = 20 mice), 20 μg of nCpG (n = 5 mice), or PBS (n = 4 mice), as specified by the symbols. The injections were repeated on days 8 and 11 (indicated by arrows). According to institutional guidelines, mice were sacrificed when the tumor diameter reached 25 mm (∗). Data points represent the mean tumor diameter per group. B, RAG-1 KO mice were injected in the same way (four mice in each group). Tumor diameters were measured every third day. The result of one experiment is shown in each panel. For WT mice, the data were reproduced with identical results in nine independent experiments, involving a total of 70, 53, and 23 mice in the CpG-ODN, nCpG-ODN, and PBS groups, respectively. The experiment shown in B was reproduced twice with identical results.

Close modal

Five days after the injection of RMA cells, the diameter of the local tumor reached ∼4 mm. At this time, CpG-ODN, nCpG-ODN, or PBS was injected directly into the tumor, and the injection was repeated on days 8 and 11. In the wild-type (WT) mice, CpG-ODN injection resulted in the complete remission of the tumor in 19 of 20 mice, with no recurrence during an observation period of 120 days (Fig. 1,A). This protection was also seen when the first CpG-ODN injection was done on day 7 in WT mice (data not shown). CpG-ODN did not exert any protective effect in RAG-1 KO mice, suggesting that NK cell activation cannot account in this model for the tumor regression seen (Fig. 1 B). Tumor regression was not induced in either type of mice by nCpG-ODN or PBS treatment, which implies specific mechanisms induced by CpG-ODN.

We first tested whether the RMA tumor induces an immune response on its own. Twenty days following the s.c. injection of 3 million RMA cells into C57BL/6 mice, spleen cells were isolated and tested in a classic chromium release assay (Fig. 2,A). Borderline (∼10%) specific lysis of RMA cells was observed in the mice whose tumor had been microinjected with PBS, and whose spleen cells had been rechallenged with RMA cells ex vivo, 5 days before actual measurements of cytolysis. No specific lysis (<3%) was seen when spleen cells of naive mice were tested 5 days after the ex vivo challenge with RMA cells. Therefore, it appears that the (MHC class II-negative, class I-positive) RMA cells constitutively induced a weak cytotoxic (CD8+) T cell response that, however, was not of sufficient magnitude, class, or quality to control the growth of the tumor in vivo. In contrast, in CpG-ODN-treated mice ∼30% lysis of RMA cells was seen in the chromium release assay (Fig. 2,A), showing that this treatment promoted the magnitude of the constitutively developing cytolytic immune response against the tumor, correlating with the tumor regression observed in Fig. 1 A. In a previous study (32), CpG-ODN were used to successfully prime tumor-specific T cells in vitro; the tumor used (A-20 B cell lymphoma) was MHC class II-positive and therefore capable of recruiting CD4+ cell help on its own. We show here that the in situ injection of CpG-ODN has adjuvant effects on CD8+ cell immunity in vivo against an MHC class II-negative tumor.

We also performed direct ex vivo ELISPOT assays to measure the actual frequencies (26) and cytokine signatures of the tumor-specific T cells induced in vivo (Fig. 2,B). When rechallenged with RMA tumor, the spleen cells of the WT C57BL/6 mice whose s.c. tumor was PBS-injected did not produce IFN-γ at an increased frequency (<3 of 106) compared with the spleen cells of naive C57BL/6 mice. Also, the measurements of IL-4 and IL-5 at single cell resolution (26) did not provide evidence for the induction of cytokine-producing T cells in tumor-bearing mice in the absence of ODN treatment (data not shown). The frequencies of RMA-induced IFN-γ-producing spleen cells were in the 10 of 106 frequency range in nCpG-ODN-treated mice (Fig. 1,B), consistent with weak adjuvanicity of such ODN (28). No induction of IL-4 or of IL-5 was seen over background, suggesting that the nCpG-induced response was of type 1. In contrast, RMA induced vigorous IFN-γ production (in the 100 of 106 frequency range) in the WT mice whose tumor was injected with CpG-ODN (Fig. 1,B), with no IL-4 and IL-5 production detected over background (data not shown). This IFN-γ recall response was tumor-specific, not being elicited by B16M cells (Fig. 2,B). This response was inhibited by anti-CD4 or anti-CD8 Abs (Fig. 2,C); and the reactivity was recovered in the CD4+ and in the CD8+ fraction of CD3+ cells (Fig. 2,D). Although the CD4+ cell response was dependent on added APC, the CD8+ cell response was only partially dependent. The data clearly show priming of CD4+ and CD8+ cells. The specificity of these recall responses was established using syngeneic third party tumor cells; B16M (Fig. 2,B) and EL-4 (Fig. 2,D) did not induce IFN-γ producing cells. (In Fig. 2 D, data are shown for CD8+ cells only; unseparated spleen cells, purified CD3+ or CD4+ cells while responding to RMA, did not respond to EL-4, data not shown).

We performed adoptive transfer experiments to clearly define the effector cells that mediate the CpG-ODN-induced tumor remission. Spleen cells of mice whose RMA tumor was CpG-ODN-treated were injected into RAG-1 KO mice, 70 million cells per recipient. One day after the adoptive transfer, the recipient mice were challenged s.c. with 3 million RMA cells, and the growth of the tumor was recorded. For the first 10 days tumor growth was observed, followed by complete remission by day 20 (Fig. 3,A). In contrast, the tumor grew uninhibited in RAG-1 KO mice that received 70 million spleen cells from naive mice; the tumor growth curves were superimposable with those of untreated RAG-1 mice (Fig. 3,A vs Fig. 1,B). CD3+ cells (35 million cells per recipient) from WT mice whose tumors were CpG-ODN-injected also adoptively transferred protection to RAG-1 KO mice against a challenge with 3 million RMA cells (Fig. 3,A). The protection afforded by the adoptive transfer was specific for the RMA tumor because it did not affect the survival rate of such mice after B16M challenge (Fig. 3 B).

FIGURE 3.

Immunity induced by intratumor CpG-ODN injection is specific, systemic, and mediated by T cells. A, Tumor protection is T cell-mediated. WT C57BL/6 mice with RMA tumor were injected with CpG-ODN as specified in the Fig. 1 legend. Thirty days after injecting the tumor, either unfractionated spleen cells (70 million cells, •) or purified CD3+ cells from spleens of such mice (35 million cells, ▴) were injected i.p. into RAG-1 KO mice. Control RAG-1 KO mice received spleen cells of naive WT mice (70 million, ○). The recipient RAG-1KO mice were challenged s.c. with 3 million RMA cells 24 h later. □, CD8 KO mice were injected with RMA and CpG following the protocol described in Fig. 1. The diameter of the tumor at the injection site was measured every third day. B, Adoptively transferred protection is tumor-specific. Spleen cells of RMA:CpG-treated C57BL/6 mice or of naive C57BL/6 control mice were transferred into RAG-1 KO recipients as specified in A. The recipient mice were challenged i.v. with 200,000 B16M cells and the survival rate was recorded. C, Long-term tumor protection at a distant site. C57BL/6 mice were inoculated s.c. with RMA on the right flank, and their tumors were injected with CpG-ODN as above (▴) RMA-inoculated C57BL/6 mice whose tumor was injected with PBS functioned as controls for the primary injection (•). On day 30, the CpG-ODN-injected mice whose primary tumor went into complete remission were rechallenged with 3 million RMA cells on the contralateral flank (without injecting CpG-ODN at the secondary site). As a control for the secondary RMA injection, naive C57BL/6 mice were injected with RMA in the left flank (▵). The experiment was reproduced once with the same result.

FIGURE 3.

Immunity induced by intratumor CpG-ODN injection is specific, systemic, and mediated by T cells. A, Tumor protection is T cell-mediated. WT C57BL/6 mice with RMA tumor were injected with CpG-ODN as specified in the Fig. 1 legend. Thirty days after injecting the tumor, either unfractionated spleen cells (70 million cells, •) or purified CD3+ cells from spleens of such mice (35 million cells, ▴) were injected i.p. into RAG-1 KO mice. Control RAG-1 KO mice received spleen cells of naive WT mice (70 million, ○). The recipient RAG-1KO mice were challenged s.c. with 3 million RMA cells 24 h later. □, CD8 KO mice were injected with RMA and CpG following the protocol described in Fig. 1. The diameter of the tumor at the injection site was measured every third day. B, Adoptively transferred protection is tumor-specific. Spleen cells of RMA:CpG-treated C57BL/6 mice or of naive C57BL/6 control mice were transferred into RAG-1 KO recipients as specified in A. The recipient mice were challenged i.v. with 200,000 B16M cells and the survival rate was recorded. C, Long-term tumor protection at a distant site. C57BL/6 mice were inoculated s.c. with RMA on the right flank, and their tumors were injected with CpG-ODN as above (▴) RMA-inoculated C57BL/6 mice whose tumor was injected with PBS functioned as controls for the primary injection (•). On day 30, the CpG-ODN-injected mice whose primary tumor went into complete remission were rechallenged with 3 million RMA cells on the contralateral flank (without injecting CpG-ODN at the secondary site). As a control for the secondary RMA injection, naive C57BL/6 mice were injected with RMA in the left flank (▵). The experiment was reproduced once with the same result.

Close modal

Protection mediated by T cells should be systemic, extending to a rechallenge with the tumor at a distant site in the original host. To test this hypothesis, WT mice were first injected with 3 million RMA cells in the right flank and the remission of the primary tumor was induced by the intratumor injection of CpG-ODN, as before. On day 30, the same mice were reinjected with 3 million RMA cells, now on the left flank. Unlike in the adoptive transfers where an initial tumor growth was seen, in these rechallenged mice detectable tumor growth was not established at all at the secondary site, and the mice remained tumor free for the subsequent 60 days of the observation period (Fig. 3 C). In a parallel approach we induced two tumors in mice by injecting tumor cells simultaneously in each flank. The tumor of only one side was injected with CpG. In addition to the injected tumor, also the noninjected tumor regressed with several days delay (data not shown).

Our data clearly show that when injected into the tumor, CpG-ODN exert a type-1 adjuvant effect converting the tumor itself into a cellular vaccine that elicits a tumor-destructive T cell response. This effect of CpG-ODN is likely to be mediated by a series of different mechanisms (33). First, CpG-ODN induce local cytokine and chemokine expression (15, 20, 22, 34), which in turn facilitates the recruitment and activation of cells of the innate immune system to the site. Among these cells, NK cells are likely to become activated, and their cytokine response to CpG might contribute to the T cell priming. Although cells of the innate immune system including NK cells can exert antitumor effector functions, they did not seem to play a major role in the effector phase of our model because CpG-ODN did not exert antitumor effects in RAG-1 KO mice.

As part of the activation of the innate immune system, CpG-ODN induce dendritic cells to mature and migrate from the tissue to regional lymph nodes, where they present Ags acquired in the tissue (20, 35, 36). Such dendritic cells that ingested tumor cells are likely to induce the T cell response that we have detected after CpG-ODN injection; the emergence of a CD4+ cell response in addition to CD8+ cells (Fig. 2,C) strongly argues for such cross-priming (37, 38, 39). When we tested purified CD4+ cells, the recall response to the tumor could be detected only in the presence of added APC arguing for indirect recognition (Fig. 2,D). However, the data obtained on CD8 KO mice showed that CD4+ cells alone were not capable of rejecting the tumor (Fig. 3 A) and that CD8+ cells are required.

During the intratumor injection of CpG-ODN, the needle puncture might result in some tumor cell death. Because apoptosis/necrosis can increase the uptake of tumors by dendritic cells, this injury might contribute to the immunogenicity observed. However, cell injury clearly cannot explain our findings because PBS or nCpG injections into the tumor did not prime a protective response (Figs. 1,A and 3,C). PBS or nCpG injections also did not induce IFN-γ-producing T cells (Fig. 2 B).

Therefore, while the constitutively growing tumor neither induced detectable type 1 or type 2 differentiation of tumor-specific T cells, nor did intratumor injection of PBS or nCPG trigger a response, the in situ injection of CpG-ODN engaged a high frequency type 1 polarized memory/effector T cell immunity. The fact that in PBS-injected, tumor-bearing mice moderate killing of RMA cells was seen in the absence of significant IFN-γ production (Fig. 2, A vs B) is likely to result from insufficient engagement of tumor-specific CD4 help in these mice (40); tumor-specific type 1 CD4+ cells are clearly detectable in the CpG-ODN-treated mice (Fig. 2, C and D). They seem to provide the T cell help for the type 1 differentiation of the tumor-specific CD8+ cells. The induction of this helper cell response might therefore also be a critical mechanism of the adjuvant effect of the CpG-ODN in immunity against this MHC class II-negative tumor. Recent data suggest that CD4 cell help is critical in the priming phase of CD8 cell immunity, while the effector memory cells might be less CD4 cell-dependent (41, 42, 43).

Intratumor CpG-ODN injections should be an appealing therapeutic approach, because with minimally invasive injections, CpG-ODN could be deposited essentially at any site of the body, in any tumor, of any size, including inoperable tumors. This form of treatment should apply to any tumor type or any patient, bypassing the antigenic divergence of tumors. Following intratumor CpG-ODN injection, the T cell system will customize the response to the array of Ags expressed on the respective tumor.

We thank Dr. Don Anthony for insightful discussions, and David Martini for expert technical assistance.

1

This work was supported by grants (to M.T.L.) from the National Institutes of Health (AI-47756). A.S.L., H.K., and B.V.S. are fellows of the Studienstiftung des Deutschen Volkes. B.O.B. was supported by Deutsche Forschungsgemeinschaft Sonderforschungsbereich 518 and Bundesministerium fuer Bildung, Wissenschaft, Forschung und Technologie.

3

Abbreviations used in this paper: ODN, oligodeoxynucleotide; KO, knockout; WT, wild type; nCpG, non-CpG.

1
Rosenberg, S. A..
2001
. Progress in human tumour immunology and immunotherapy.
Nature
411
:
380
.
2
Ochsenbein, A. F., S. Sierro, B. Odermatt, M. Pericin, U. Karrer, J. Hermans, S. Hemmi, H. Hengartner, R. M. Zinkernagel.
2001
. Roles of tumour localization, second signals and cross priming in cytotoxic T-cell induction.
Nature
411
:
1058
.
3
Mackay, C. R..
1991
. T-cell memory: the connection between function, phenotype and migration pathways.
Immunol. Today
12
:
189
.
4
Matzinger, P..
1994
. Tolerance, danger, and the extended family.
Annu. Rev. Immunol.
12
:
991
.
5
Chen, L., S. Ashe, W. A. Brady, I. Hellstrom, K. E. Hellstrom, J. A. Ledbetter, P. McGowan, P. S. Linsley.
1992
. Costimulation of antitumor immunity by the B7 counterreceptor for the T lymphocyte molecules CD28 and CTLA-4.
Cell
71
:
1093
.
6
Cohen, E. P., T. S. Kim.
1994
. Neoplastic cells that express low levels of MHC class I determinants escape host immunity.
Semin. Cancer Biol.
5
:
419
.
7
Townsend, S. E., J. P. Allison.
1993
. Tumor rejection after direct costimulation of CD8+ T cells by B7-transfected melanoma cells.
Science
259
:
368
.
8
Fukushi, J., T. Morisaki, T. Shono, A. Nishie, H. Torisu, M. Ono, M. Kuwano.
1998
. Novel biological functions of interleukin-4: formation of tube-like structures by vascular endothelial cells in vitro and angiogenesis in vivo.
Biochem. Biophys. Res. Commun.
250
:
444
.
9
Yip, H. C., A. Y. Karulin, M. Tary-Lehmann, M. D. Hesse, H. Radeke, P. S. Heeger, R. P. Trezza, F. P. Heinzel, T. Forsthuber, P. V. Lehmann.
1999
. Adjuvant-guided type-1 and type-2 immunity: infectious/noninfectious dichotomy defines the class of response.
J. Immunol.
162
:
3942
.
10
Chu, R. S., O. S. Targoni, A. M. Krieg, P. V. Lehmann, C. V. Harding.
1997
. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity.
J. Exp. Med.
186
:
1623
.
11
Pape, K. A., A. Khoruts, A. Mondino, M. K. Jenkins.
1997
. Inflammatory cytokines enhance the in vivo clonal expansion and differentiation of antigen-activated CD4+ T cells.
J. Immunol.
159
:
591
.
12
Aderem, A., R. J. Ulevitch.
2000
. Toll-like receptors in the induction of the innate immune response.
Nature
406
:
782
.
13
Ozinsky, A., D. M. Underhill, J. D. Fontenot, A. M. Hajjar, K. D. Smith, C. B. Wilson, L. Schroeder, A. Aderem.
2000
. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between Toll-like receptors.
Proc. Natl. Acad. Sci. USA
97
:
13766
.
14
Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira.
2000
. A Toll-like receptor recognizes bacterial DNA.
Nature
408
:
740
.
15
Lipford, G. B., T. Sparwasser, M. Bauer, S. Zimmermann, E. S. Koch, K. Heeg, H. Wagner.
1997
. Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines.
Eur. J. Immunol.
27
:
3420
.
16
Weiner, G. J..
2000
. The immunobiology and clinical potential of immunostimulatory CpG oligodeoxynucleotides.
J. Leukocyte Biol.
68
:
455
.
17
Stacey, K. J., D. P. Sester, M. J. Sweet, D. A. Hume.
2000
. Macrophage activation by immunostimulatory DNA.
Curr. Top. Microbiol. Immunol.
247
:
41
.
18
Jakob, T., P. S. Walker, A. M. Krieg, M. C. Udey, J. C. Vogel.
1998
. Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA.
J. Immunol.
161
:
3042
.
19
Kim, S. K., G. Ragupathi, C. Musselli, S. J. Choi, Y. S. Park, P. O. Livingston.
1999
. Comparison of the effect of different immunological adjuvants on the antibody and T-cell response to immunization with MUC1-KLH and GD3-KLH conjugate cancer vaccines.
Vaccine
18
:
597
.
20
Jakob, T., P. S. Walker, A. M. Krieg, E. von Stebut, M. C. Udey, J. C. Vogel.
1999
. Bacterial DNA and CpG-containing oligodeoxynucleotides activate cutaneous dendritic cells and induce IL-12 production: implications for the augmentation of Th1 responses.
Int. Arch. Allergy Immunol.
118
:
457
.
21
Klinman, D. M., A. K. Yi, S. L. Beaucage, J. Conover, A. M. Krieg.
1996
. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon γ.
Proc. Natl. Acad. Sci. USA
93
:
2879
.
22
Kranzer, K., M. Bauer, G. B. Lipford, K. Heeg, H. Wagner, R. Lang.
2000
. CpG-oligodeoxynucleotides enhance T-cell receptor-triggered interferon-γ production and up-regulation of CD69 via induction of antigen-presenting cell-derived interferon type I and interleukin-12.
Immunology
99
:
170
.
23
Ljunggren, H. G., K. Karre.
1985
. Host resistance directed selectively against H-2-deficient lymphoma variants: analysis of the mechanism.
J. Exp. Med.
162
:
1745
.
24
Silagi, S..
1969
. Control of pigment production in mouse melanoma cells in vitro: evocation and maintenance.
J. Cell Biol.
43
:
263
.
25
Tary-Lehmann, M., A. G. Rolink, P. V. Lehmann, Z. A. Nagy, U. Hurtenbach.
1990
. Induction of graft versus host-associated immunodeficiency by CD4+ T cell clones.
J. Immunol.
145
:
2092
.
26
Karulin, A. Y., M. D. Hesse, M. Tary-Lehmann, P. V. Lehmann.
2000
. Single-cytokine-producing CD4 memory cells predominate in type 1 and type 2 immunity.
J. Immunol.
164
:
1862
.
27
Davila, E., E. Celis.
2000
. Repeated administration of cytosine-phosphorothiolated guanine-containing oligonucleotides together with peptide/protein immunization results in enhanced CTL responses with antitumor activity.
J. Immunol.
165
:
539
.
28
Weiner, G. J., H. M. Liu, J. E. Wooldridge, C. E. Dahle, A. M. Krieg.
1997
. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization.
Proc. Natl. Acad. Sci. USA
94
:
10833
.
29
Stern, B. V., B. O. Boehm, M. Tary-Lehmann.
2002
. Vaccination with tumor peptide in CpG adjuvant protects via IFN-γ-dependent CD4 cell immunity.
J. Immunol.
168
:
6099
.
30
Carpentier, A. F., L. Chen, F. Maltonti, J. Y. Delattre.
1999
. Oligodeoxynucleotides containing CpG motifs can induce rejection of a neuroblastoma in mice.
Cancer Res.
59
:
5429
.
31
Carpentier, A. F., J. Xie, K. Mokhtari, J. Y. Delattre.
2000
. Successful treatment of intracranial gliomas in rat by oligodeoxynucleotides containing CpG motifs.
Clin. Cancer Res.
6
:
2469
.
32
Egeter, O., R. Mocikat, K. Ghoreschi, A. Dieckmann, M. Rocken.
2000
. Eradication of disseminated lymphomas with CpG-DNA activated T helper type 1 cells from nontransgenic mice.
Cancer Res.
60
:
1515
.
33
Sun, S., X. Zhang, D. Tough, J. Sprent.
2000
. Multiple effects of immunostimulatory DNA on T cells and the role of type I interferons.
Springer Semin. Immunopathol.
22
:
77
.
34
Lipford, G. B., S. Bendigs, K. Heeg, H. Wagner.
2000
. Poly-guanosine motifs costimulate antigen-reactive CD8 T cells while bacterial CpG-DNA affect T-cell activation via antigen-presenting cell-derived cytokines.
Immunology
101
:
46
.
35
Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, H. Wagner.
1998
. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells.
Eur. J. Immunol.
28
:
2045
.
36
Sparwasser, T., R. M. Vabulas, B. Villmow, G. B. Lipford, H. Wagner.
2000
. Bacterial CpG-DNA activates dendritic cells in vivo: T helper cell- independent cytotoxic T cell responses to soluble proteins.
Eur. J. Immunol.
30
:
3591
.
37
Plautz, G. E., S. Mukai, P. A. Cohen, S. Shu.
2000
. Cross-presentation of tumor antigens to effector T cells is sufficient to mediate effective immunotherapy of established intracranial tumors.
J. Immunol.
165
:
3656
.
38
Bennett, S. R., F. R. Carbone, F. Karamalis, J. F. Miller, W. R. Heath.
1997
. Induction of a CD8+ cytotoxic T lymphocyte response by cross-priming requires cognate CD4+ T cell help.
J. Exp. Med.
186
:
65
.
39
Berard, F., P. Blanco, J. Davoust, E. M. Neidhart-Berard, M. Nouri-Shirazi, N. Taquet, D. Rimoldi, J. C. Cerottini, J. Banchereau, A. K. Palucka.
2000
. Cross-priming of naive CD8 T cells against melanoma antigens using dendritic cells loaded with killed allogeneic melanoma cells.
J. Exp. Med.
192
:
1535
.
40
Marzo, A. L., B. F. Kinnear, R. A. Lake, J. J. Frelinger, E. J. Collins, B. W. Robinson, B. Scott.
2000
. Tumor-specific CD4+ T cells have a major “post-licensing” role in CTL mediated antitumor immunity.
J. Immunol.
165
:
6047
.
41
Shedlock, D. J., J. K. Whitmire, J. Tan, A. S. MacDonald, R. Ahmed, H. Shen.
2003
. Role of CD4 T cell help and costimulation in CD8 T cell responses during Listeria monocytogenes infection.
J. Immunol.
170
:
2053
.
42
Kaech, S. M., R. Ahmed.
2003
. Immunology: CD8 T cells remember with a little help.
Science
300
:
263
.
43
Zajac, A. J., K. Murali-Krishna, J. N. Blattman, R. Ahmed.
1998
. Therapeutic vaccination against chronic viral infection: the importance of cooperation between CD4+ and CD8+ T cells.
Curr. Opin. Immunol.
10
:
444
.