Arginase I expression in the liver must remain constant throughout life to eliminate excess nitrogen via the urea cycle. In contrast, arginase I expression in macrophages is silent until signals from Th2 cytokines such as IL-4 and IL-13 are received and the mRNA is then induced four to five orders of magnitude. Arginase I is hypothesized to play a regulatory and potentially pathogenic role in diseases such as asthma, parasitic, bacterial, and worm infections by modulating NO levels and promoting fibrosis. We show that Th2-inducible arginase I expression in mouse macrophages is controlled by an enhancer that lies −3 kb from the basal promoter. PU.1, IL-4-induced STAT6, and C/EBPβ assemble at the enhancer and await the effect of another STAT6-regulated protein(s) that must be synthesized de novo. Identification of a powerful extrahepatic regulatory enhancer for arginase I provides potential to manipulate arginase I activity in immune cells while sparing liver urea cycle function.

Arginase I is a central metabolic enzyme of liver function, catalyzing the nitrogen elimination step of the Krebs urea cycle (1). In this context, arginase I expression must remain constant throughout life. Genetic abnormalities in the genes that encode the urea cycle enzymes, including arginase I, are associated with a variety of pathological conditions related to the failure to eliminate nitrogen from the body (1). In contrast, arginase I expression is also found in nonhepatic cells (2, 3, 4) including cells of the hemopoietic system (2, 5), most significantly in macrophages (2, 5). The biological function of arginase I in macrophages is the subject of intense research, related predominantly to its anticipated role in regulating NO production from activated macrophages: arginine being the common substrate for both arginase I and the NO synthases (1, 6, 7). In vitro studies have established that arginase I can deplete arginine from macrophages and from the milieu, leaving none available for NO synthases to generate NO (8, 9). This process is complex and not strictly dependent on substrate competition but also involves translational control of NO synthase expression (10). The complexity of the competition between NO synthases and arginase I is speculated to have crucial in vivo roles in diseases where NO levels must be tightly controlled. Of further significance are the secondary metabolites of arginase I, primarily ornithine, that can feed into pathways favoring collagen biosynthesis, and hence fibrosis. Ornithine is also the precursor of polyamines, essential molecules that have a plethora of biological activities (1, 2).

We were interested in the regulatory steps that lead to arginase I expression in macrophages. The rationale for this investigation is linked to the development of future agonists or antagonists of arginase I in diseases where the role of the enzyme is implicated in pathogenesis. It would be unlikely that direct agonists or antagonists of arginase I would have any useful pharmacological role because of toxicity associated with inhibition or exacerbation of liver arginase I function. Therefore, we chose to investigate the upstream regulatory steps that control arginase I gene expression in macrophages with the concept that these pathways could eventually be regulated pharmacologically.

Unlike liver arginase I whose expression is constant throughout postnatal life (1, 11), macrophage arginase I expression is tightly regulated. In resting murine macrophages, arginase I levels are undetectable at the mRNA, protein, and enzymatic levels (5, 9). However, once exposed to cytokines that stimulate STAT6 activity (IL-4 and IL-13), arginase I mRNA, protein, and enzymatic levels are up-regulated four to five orders of magnitude (5, 9). The STAT6-mediated control of arginase I expression has also been revealed in diseases dominated by Th2 responses including helminth, parasitic infections, and asthma (12, 13, 14, 15, 16, 17). The tight control over arginase I expression has led to the implication that it is crucially linked to pathologic sequelae in these diseases. We have previously shown that STAT6 is essential for IL-4/IL-13-mediated arginase I expression and that STAT6 regulates the expression of another gene(s) that is required for expression (9). In this study, we define the regulatory mechanisms involved in this process. We show that the regulation of arginase I in macrophages is controlled by a complex enhancer element located 3-kb upstream of the transcription start site. Surprisingly, the enhancer is regulated both directly and indirectly by STAT6 and a series of other transcription factors that assemble in a temporal manner to induce arginase I gene expression.

RAW macrophages were obtained from the American Type Culture Collection (Manassas, VA) and maintained in RPMI 1640 with 10% FBS, penicillin/streptomycin, and minimal nonessential amino acids (complete RPMI). Mouse IL-4 and IL-10 were purchased from BD Biosciences/PharMingen (San Diego, CA) and resuspended to 1 μg/ml in complete RPMI before use. Final cytokine concentrations used are described in detail in Results specific for each experiment. Luciferase reporter constructs and reagents for the analysis of luciferase expression were purchased from Promega (Madison, WI). Abs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and were used for chromatin immunoprecipitation or EMSA supershift reactions at a 1/100 dilution. The Abs are as follows: anti-STAT6 (M200 rabbit, S20 rabbit, M20 goat), anti-IFN regulatory factor-4 (IRF-4)5 (M17 goat), anti-PU.1 (T21 rabbit), anti-C/EBPβ (C19, rabbit), anti-CBP (A22, rabbit). Anti-acetylated H3, anti-acetylated H4, and anti-hyperacetylated H4 rabbit polyclonal Abs were from Upstate Biotechnology (Waltham, MA). An additional anti-STAT6 rabbit polyclonal Ab (18) was a gift of Dr. J. Ihle (Department of Biochemistry, St. Jude Children’s Research Hospital). For immunoprecipitations with goat Abs, a rabbit anti-goat Ab (Pierce, Rockford, IL) was added at a final dilution of 1/1000 before capture of Ig conjugates with protein A.

Total RNA was isolated from macrophages using TRIzol (Invitrogen, Carlsbad, CA) as described (19, 20). RNA was separated on formaldehyde agarose gels and blotted to Hybond N membranes (Amersham Pharmacia Biotech, Piscataway, NJ) for Northern analysis as described (9). Real time RT-PCR was performed as described in detail using Superscript II (Invitrogen) for reverse transcription and FAM-labeled probes (20) listed in Table I.

Table I.

Oligonucleotides used in this study

OligoSiteDirection or PurposePartner/TargetSequenceLocation
375 Mlu← 031 CGCACGCGTAAGCGCTCCTTGTATGGGTG −3741/−3760 
376 Mlu→ 377 TCACGCGTATTGCCAGGAATATACCAGA −3789/−3808 
377 Mlu← 376 CGCACGCGTTGGCCTCAGAACATCTAAG −3307/−3325 
378 Mlu→ 379 TCACGCGTCGCTGTGAAAGGATCTATCA −3367/−3386 
379 Mlu← 378 CGCACGCGTAAAGTGGCACAACTCACGTA −2890/−2909 
380 Mlu→ 032 TCACGCGTGGGCCATGGTATGTGT −3168/−3183 
387 Mlu← 378 CGCACGCGTGAGTCAGACTGGGGTGTCAG −3216/−3235 
388 Mlu→ 389 TCACGCGTGACAGTCCTTTGTGAAGACT −3268/−3287 
389 Mlu← 388 CGCACGCGTCCCTTTACTCTGTGTGATT −3127/−3145 
390 Mlu← 380 CGCACGCGTGCTCTCTGACTTCCTTATTG −3020/−3039 
391 Mlu→ 392 or 379 TCACGCGTGGTAGCCGACGAGAG −3053/−3067 
392 Mlu← 391 CGCACGCGTAGTGGCACAACTCACGTACA −2861/−2880 
393 Mlu→ 394 TCACGCGTTGTACGTGAGTTGTGCC −2895/−2911 
394 Mlu← 393 CGCACGCGTTCAGTGCACAAGTCCAGTTG −2766/−2765 
395 Mlu→ 032 TCACGCGTGAACAGGCAAACAATACGAT −2799/−2818 
402 MluLinker  CGCGCTTTGTTAGGAAGTGAGGCATTGTTCAGACTTCCTTATGC −2950/−2898 
403 MluLinker  CGCGGCATAAGGAAGTCTGAACAATGCCTCACTTCCTAACAAAG −2950/−2898 
404 MluLinker  CGCGCTTTGTTATTTTGTGAGGCATTGTTCAGACAAAATTATGC −2950/−2989 
405 MluLinker  CGCGGCATAATTTTGTCTGAACAATGCCTCACAAAATAACAAAG −2950/−2989 
408 MluLinker  CGCGCAGAAGGCTTTGTCAGCAGGGCAAGACTATACTTTG −2985/−3020 
409 MluLinker  CGCGCAAAGTATAGTCTTGCCCTGCTGACAAAGCCTTCTG −2985/−3020 
410 MluLinker  CGCGATGCTTTCTTATGAACAGGCTGTATTAGCCAACAGTCCTGTC −2912/−2954 
411 MluLinker  CGCGGACAGGACTGTTGGCTAATACAGCCTGTTCATAAGAAAGCAT −2912/−2954 
419 Mlu→ 392, 422 TCACGCGTCAGAAGGCTTTGTCAGCAG −3002/−3020 
420 Mlu→ 422, 392 TCACGCGTCTATACTTTGTTAGGAAGTG −2975/−2994 
421 Mlu→ 392 TCACGCGTGTTCAGACTTCCTTATGC −2950/−2967 
422 Mlu← 391, 419, 420 TCACGCGTGTTGGCTAATACAGCCTG −2924/−2938 
423  Mutant  GGCAAGACTATACTTTGTTACTCAGTGAGGCATTGT −2966/−3001 
424  Mutant  ACAATGCCTCACTGAGTAACAAAGTATAGTCTTGCC −2966/−3001 
425  Mutant  AGGCATTGTTCAGACCTCATTATGCTTTCTTAT −2942/−2974 
426  Mutant  ATAAGAAAGCATAATGAGGTCTGAACAATGCCT −2942/−2974 
427  Mutant  ACTTCCTTATGCTGCGCTATGAACAGGCTGTATTA −2927/−2961 
428  Mutant  TAATACAGCCTGTTCATAGCGCAGCATAAGGAAGT −2927/−2961 
447  Mutant  CATTGTTCAGACTTCCGGATGCTTTCTTATGAACAG −2936/−2971 
448  Mutant  CTGTTCATAAGAAAGCATCCGGAAGTCTGAACAATG −2936/−2971 
449  Mutant  AGCTCATCTTCAATAACTCAGTCAGAGAGCAGAAGG −3014/−3049 
450  Mutant  CCTTCTGCTCTCTGACTGAGTTATTGAAGATGAGCT −3014/−3049 
451  Mutant  AGAGACCAGCTCATCTTCCCTCCGGAAGTCAGAGAGCAGAAG −3015/−3056 
452  Mutant  CTTCTGCTCTCTGACTTCCGGAGGGAAGATGAGCTGGTCTCT −3015/−3056 
021 Xho←  CGCCTCGAGGCTGCATGTGCTCGG −31/−45 
022 Mlu→ 021 CGCACGCGTAGAACTGCTTTGGGTTGTCA −639/−657 
023 Mlu→ 021 CGCACGCGTAAATGGGTTCTTCGGGTCA −1045/−1063 
024 Mlu→ 021 CGCACGCGTAATGTAAGGTCAAGCGATTT −2346/−2365 
025 Mlu→ 021 CGCACGCGTAGATTGCCAGGAATATACCA −3791/−3810 
026 Mlu→ 021 CGCACGCGTCATAAGGGTATGCGTTAATC −6416/−6435 
027 Mlu→ 021 CGCACGCGTCCCAATGAAGAAGCTAGAGA −8235/−8254 
028 Mlu→ 021 CGCACGCGTCTGATACCCAAATAGTTCCT −10672/−10691 
031 Mlu→ 032 TCACGCGTGCGAGCCTTCCCGTAG −4277/−4292 
032 Mlu← 031 CGCACGCGTCCATACACACGACGGTTCCA −2640/−2659 
033 Mlu→ 034 CGCACGCGTGGTAAGGGCCACTAGGACTT −7460/−7479 
034 Mlu← 033 CGCACGCGTACAGAGTFFFCAGCTACGG −4264/−4282 
035 Mlu→ 036 CGCACGCGTCCCACCACAGAGAACCCTA −10094/−10113 
036 Mlu← 035 TGCACGCGTATGGTGGTCATGTCAACTGC −7575/−7594 
037 Mlu→ 038 CGCACGCGTCCATCGGCTCACCTCTATC Outside contig 
038 Mlu← 037 CGCACGCGTTGAAGGGATTTGGGTATGGA −10283/−10322 
039 Mlu→ 040 CGCACGCGTGTTTGGCTGAGAACTATGTT Outside contig 
040 Mlu← 039 CGCACGCGTGTCTVCTCATTGGCTAGGA Outside contig 
396  EMSA  CAGAAGGCTTTGTCAGCAGGGCAAGACTATACTTTG  
397  EMSA  CAAAGTATAGTCTTGCCCTGCTGACAAAGCCTTCTG  
398  EMSA  CTTTGTTAGGAAGTGAGGCATTGTTCAGACTTCCTTATGC  
399  EMSA  GCATAAGGAAGTCTGAACAATGCCTCACTTCCTAACAAAG  
400  EMSA  ATGCTTTCTTATGAACAGGCTGTATTAGCCAACAGTCCTGTC  
401  EMSA  GACAGGACTGTTGGCTAATACAGCCTGTTCATAAGAAAGCAT  
470  EMSA  CAGAAGGCggTGTCAGCAGGGCAAGACTATACTTTG  
471  EMSA  CAAAGTATAGTCTTGCCCTGCTGACAccGCCTTCTG  
472  EMSA  CTTTGTTAGttAGTGAGGCATTGTTCAGACTTCCTTATGC  
473  EMSA  GCATAAGGAAGTCTGAACAATGCCTCACTaaCTAACAAAG  
474  EMSA  CTTTGTTAGGAAGTGAGGCATTGTTCAGACTaaCTTATGC  
475  EMSA  GCATAAGttAGTCTGAACAATGCCTCACTTCCTAACAAAG  
476  EMSA  ATGCTaatTTATGAACAGGCTGTATTAGCCAACAGTCCTGTC  
477  EMSA  GACAGGACTGTTGGCTAATACAGCCTGTTCATAAattAGCAT  
478  EMSA  ATGCTTTCTTATGAACAGGCTGTATTAtttAACAGTCCTGTC  
479  EMSA  GACAGGACTGTTaaaTAATACAGCCTGTTCATAAGAAAGCAT  
319  ChIP KC GGAGTTCGGACTTTCGGGAAG  
320  ChIP KC GTGCTCAGGGCGAGGTG  
321  ChIP IL-12p40 GGAAAGGTGGCCCAGATACAC  
322  ChIP IL-12p40 TGAATAGAGGCGGCAATG  
RL75  RT-PCR Arginase I ACAGTCTGGCAGTTGGAAGCATC  
RL76  RT-PCR Arginase I GGGAGTCCCCAGGAGAATCCT  
RL83  RT-PCR Actin ACCCACACTGTGCCCATCTAC  
RL84  RT-PCR Actin AGCCAAGTCCAGACGCAGG  
RL85  Probe  AGGGCTATGCTCTCCCTCACGCCA  
OligoSiteDirection or PurposePartner/TargetSequenceLocation
375 Mlu← 031 CGCACGCGTAAGCGCTCCTTGTATGGGTG −3741/−3760 
376 Mlu→ 377 TCACGCGTATTGCCAGGAATATACCAGA −3789/−3808 
377 Mlu← 376 CGCACGCGTTGGCCTCAGAACATCTAAG −3307/−3325 
378 Mlu→ 379 TCACGCGTCGCTGTGAAAGGATCTATCA −3367/−3386 
379 Mlu← 378 CGCACGCGTAAAGTGGCACAACTCACGTA −2890/−2909 
380 Mlu→ 032 TCACGCGTGGGCCATGGTATGTGT −3168/−3183 
387 Mlu← 378 CGCACGCGTGAGTCAGACTGGGGTGTCAG −3216/−3235 
388 Mlu→ 389 TCACGCGTGACAGTCCTTTGTGAAGACT −3268/−3287 
389 Mlu← 388 CGCACGCGTCCCTTTACTCTGTGTGATT −3127/−3145 
390 Mlu← 380 CGCACGCGTGCTCTCTGACTTCCTTATTG −3020/−3039 
391 Mlu→ 392 or 379 TCACGCGTGGTAGCCGACGAGAG −3053/−3067 
392 Mlu← 391 CGCACGCGTAGTGGCACAACTCACGTACA −2861/−2880 
393 Mlu→ 394 TCACGCGTTGTACGTGAGTTGTGCC −2895/−2911 
394 Mlu← 393 CGCACGCGTTCAGTGCACAAGTCCAGTTG −2766/−2765 
395 Mlu→ 032 TCACGCGTGAACAGGCAAACAATACGAT −2799/−2818 
402 MluLinker  CGCGCTTTGTTAGGAAGTGAGGCATTGTTCAGACTTCCTTATGC −2950/−2898 
403 MluLinker  CGCGGCATAAGGAAGTCTGAACAATGCCTCACTTCCTAACAAAG −2950/−2898 
404 MluLinker  CGCGCTTTGTTATTTTGTGAGGCATTGTTCAGACAAAATTATGC −2950/−2989 
405 MluLinker  CGCGGCATAATTTTGTCTGAACAATGCCTCACAAAATAACAAAG −2950/−2989 
408 MluLinker  CGCGCAGAAGGCTTTGTCAGCAGGGCAAGACTATACTTTG −2985/−3020 
409 MluLinker  CGCGCAAAGTATAGTCTTGCCCTGCTGACAAAGCCTTCTG −2985/−3020 
410 MluLinker  CGCGATGCTTTCTTATGAACAGGCTGTATTAGCCAACAGTCCTGTC −2912/−2954 
411 MluLinker  CGCGGACAGGACTGTTGGCTAATACAGCCTGTTCATAAGAAAGCAT −2912/−2954 
419 Mlu→ 392, 422 TCACGCGTCAGAAGGCTTTGTCAGCAG −3002/−3020 
420 Mlu→ 422, 392 TCACGCGTCTATACTTTGTTAGGAAGTG −2975/−2994 
421 Mlu→ 392 TCACGCGTGTTCAGACTTCCTTATGC −2950/−2967 
422 Mlu← 391, 419, 420 TCACGCGTGTTGGCTAATACAGCCTG −2924/−2938 
423  Mutant  GGCAAGACTATACTTTGTTACTCAGTGAGGCATTGT −2966/−3001 
424  Mutant  ACAATGCCTCACTGAGTAACAAAGTATAGTCTTGCC −2966/−3001 
425  Mutant  AGGCATTGTTCAGACCTCATTATGCTTTCTTAT −2942/−2974 
426  Mutant  ATAAGAAAGCATAATGAGGTCTGAACAATGCCT −2942/−2974 
427  Mutant  ACTTCCTTATGCTGCGCTATGAACAGGCTGTATTA −2927/−2961 
428  Mutant  TAATACAGCCTGTTCATAGCGCAGCATAAGGAAGT −2927/−2961 
447  Mutant  CATTGTTCAGACTTCCGGATGCTTTCTTATGAACAG −2936/−2971 
448  Mutant  CTGTTCATAAGAAAGCATCCGGAAGTCTGAACAATG −2936/−2971 
449  Mutant  AGCTCATCTTCAATAACTCAGTCAGAGAGCAGAAGG −3014/−3049 
450  Mutant  CCTTCTGCTCTCTGACTGAGTTATTGAAGATGAGCT −3014/−3049 
451  Mutant  AGAGACCAGCTCATCTTCCCTCCGGAAGTCAGAGAGCAGAAG −3015/−3056 
452  Mutant  CTTCTGCTCTCTGACTTCCGGAGGGAAGATGAGCTGGTCTCT −3015/−3056 
021 Xho←  CGCCTCGAGGCTGCATGTGCTCGG −31/−45 
022 Mlu→ 021 CGCACGCGTAGAACTGCTTTGGGTTGTCA −639/−657 
023 Mlu→ 021 CGCACGCGTAAATGGGTTCTTCGGGTCA −1045/−1063 
024 Mlu→ 021 CGCACGCGTAATGTAAGGTCAAGCGATTT −2346/−2365 
025 Mlu→ 021 CGCACGCGTAGATTGCCAGGAATATACCA −3791/−3810 
026 Mlu→ 021 CGCACGCGTCATAAGGGTATGCGTTAATC −6416/−6435 
027 Mlu→ 021 CGCACGCGTCCCAATGAAGAAGCTAGAGA −8235/−8254 
028 Mlu→ 021 CGCACGCGTCTGATACCCAAATAGTTCCT −10672/−10691 
031 Mlu→ 032 TCACGCGTGCGAGCCTTCCCGTAG −4277/−4292 
032 Mlu← 031 CGCACGCGTCCATACACACGACGGTTCCA −2640/−2659 
033 Mlu→ 034 CGCACGCGTGGTAAGGGCCACTAGGACTT −7460/−7479 
034 Mlu← 033 CGCACGCGTACAGAGTFFFCAGCTACGG −4264/−4282 
035 Mlu→ 036 CGCACGCGTCCCACCACAGAGAACCCTA −10094/−10113 
036 Mlu← 035 TGCACGCGTATGGTGGTCATGTCAACTGC −7575/−7594 
037 Mlu→ 038 CGCACGCGTCCATCGGCTCACCTCTATC Outside contig 
038 Mlu← 037 CGCACGCGTTGAAGGGATTTGGGTATGGA −10283/−10322 
039 Mlu→ 040 CGCACGCGTGTTTGGCTGAGAACTATGTT Outside contig 
040 Mlu← 039 CGCACGCGTGTCTVCTCATTGGCTAGGA Outside contig 
396  EMSA  CAGAAGGCTTTGTCAGCAGGGCAAGACTATACTTTG  
397  EMSA  CAAAGTATAGTCTTGCCCTGCTGACAAAGCCTTCTG  
398  EMSA  CTTTGTTAGGAAGTGAGGCATTGTTCAGACTTCCTTATGC  
399  EMSA  GCATAAGGAAGTCTGAACAATGCCTCACTTCCTAACAAAG  
400  EMSA  ATGCTTTCTTATGAACAGGCTGTATTAGCCAACAGTCCTGTC  
401  EMSA  GACAGGACTGTTGGCTAATACAGCCTGTTCATAAGAAAGCAT  
470  EMSA  CAGAAGGCggTGTCAGCAGGGCAAGACTATACTTTG  
471  EMSA  CAAAGTATAGTCTTGCCCTGCTGACAccGCCTTCTG  
472  EMSA  CTTTGTTAGttAGTGAGGCATTGTTCAGACTTCCTTATGC  
473  EMSA  GCATAAGGAAGTCTGAACAATGCCTCACTaaCTAACAAAG  
474  EMSA  CTTTGTTAGGAAGTGAGGCATTGTTCAGACTaaCTTATGC  
475  EMSA  GCATAAGttAGTCTGAACAATGCCTCACTTCCTAACAAAG  
476  EMSA  ATGCTaatTTATGAACAGGCTGTATTAGCCAACAGTCCTGTC  
477  EMSA  GACAGGACTGTTGGCTAATACAGCCTGTTCATAAattAGCAT  
478  EMSA  ATGCTTTCTTATGAACAGGCTGTATTAtttAACAGTCCTGTC  
479  EMSA  GACAGGACTGTTaaaTAATACAGCCTGTTCATAAGAAAGCAT  
319  ChIP KC GGAGTTCGGACTTTCGGGAAG  
320  ChIP KC GTGCTCAGGGCGAGGTG  
321  ChIP IL-12p40 GGAAAGGTGGCCCAGATACAC  
322  ChIP IL-12p40 TGAATAGAGGCGGCAATG  
RL75  RT-PCR Arginase I ACAGTCTGGCAGTTGGAAGCATC  
RL76  RT-PCR Arginase I GGGAGTCCCCAGGAGAATCCT  
RL83  RT-PCR Actin ACCCACACTGTGCCCATCTAC  
RL84  RT-PCR Actin AGCCAAGTCCAGACGCAGG  
RL85  Probe  AGGGCTATGCTCTCCCTCACGCCA  

Probes from the proximal region of the arginase I promoter were used to screen a mouse 129 PAC library supplied by the Human Genome Mapping Project Resource Centre (Hinxton, U.K.). Four clones (510-F22, 513-G17, 522-M2, and 526-J2) were identified. Bacteria were grown in 25 μg/ml kanamycin according to the supplier’s instructions. Plasmid DNA was isolated according to the supplier’s instructions. The presence of the arginase I promoter was confirmed by PCR using oligonucleotides specific for regions within the promoter. Oligonucleotides to amplify the promoter fragments, introduce mutations, and perform EMSA are detailed in Table I including the position of each oligonucleotide relative to the A residue in the initiation codon of the arginase I gene. The detailed description of the murine arginase I locus can be found at: www.ensembl.org/Mus_musculus/geneview?gene = ENSMUSG00000019987.

Promoter fragments were cloned into the pGL3-basic vector (Promega) using the restriction sites detailed in Table I. Site-directed mutagenesis was performed using the Stratagene (La Jolla, CA) Quik-Change procedure according to the manufacturer’s instructions. All mutations were made in the −31/−3810 construct. In all cases, each mutation was constructed and analyzed completely independently twice.

RAW cells were grown in complete RPMI. Cells were harvested by gentle scraping, centrifuged (200 × g, 8 min) and washed once with PBS. Cells were resuspended in Optimem (Invitrogen) at a density of 1 × 107 cells per ml. Cells (0.5 ml) were gently mixed with 10 μg of plasmid DNA and electroporated at 250 V, 975 μF in 0.4-cm cuvettes. Each transfection was made up to 6 ml with complete RPMI and plated at 1 ml/well in 12-well plates. Following overnight incubation at 37°C, the medium was replaced (1 ml) and the cells were allowed to rest for 2–3 h. Cells (duplicate wells) were left untreated or stimulated with IL-4 or IL-4 and IL-10 for 16–20 h. Reporter activity was performed with the Promega reagents according to the manufacturer’s instructions and luciferase activity was measured using a luminometer set to a 10-s measurement time.

Stable RAW cell lines containing luciferase reporter constructs were derived by linearizing each plasmid with Mlu I immediately 5′ to the beginning of the arginase I 5′ genomic fragments. These plasmids were cotransfected by electroporation as described above with XhoI-linearized pCDNA1 at a 10:1 ratio. After selection in 250 μg/ml G418 over a 2-wk period, lines were plated and stimulated with IL-4 or IL-4 and IL-10 and assayed for luciferase activity 14 h later.

ChIP was performed as described by the manufacturer of the ChIP reagents (Upstate Biotechnology), with the following modifications. RAW cells were grown in complete RPMI on 10-cm plates until there were ∼4 × 106 cells per plate. Two plates were assigned per time point and stimulation condition. Cells attached to the plate were stimulated with IL-4 (10 ng/ml) for various times (typically 0, 1, 2, and 6 h). One plate was retained for accurate counting of cell numbers. Cells were fixed by incubation in 1% formaldehyde for 10 min at room temperature and then washed twice with PBS containing PMSF as described in the Upstate Biotechnology protocol. Cells were scraped from the plates and pelleted by centrifugation (200 × g, 10 min) and then resuspended in SDS lysis buffer (Upstate Biotechnology) and protein-DNA complexes fragmented by sonication using a Misonix Sonicator 3000 (Farmingdale, NY) set at 80% power, 6°C constant temperature for 8 × 30 s sonication cycles. These conditions were empirically established to give fragmentation of DNA with a mean length of 500–800 bp. Insoluble material was removed by centrifugation at 15,000 × g for 10 min. The lysate was then precleared with salmon sperm-saturated protein A-agarose slurry (Upstate Biotechnology) at a ratio of 50 μl per 2 × 106 cell equivalents for 2 h at 4°C. The agarose conjugates were removed by centrifugation and supernatants were incubated with polyclonal Abs to transcription factors as detailed in Materials and Methods. For anti-STAT6 immunoprecipitations, each Ab listed in the Materials and Methods was tested and the M200 Ab was found to be superior in these assays. Accordingly, the M200 Ab was used for all subsequent experiments. Following overnight incubation at 4°C, salmon sperm-saturated protein A-agarose was added at a ratio of 30 μl/ml lysate and incubated at 4°C with gentle rocking for 2 h. Immunoprecipitated material was washed and eluted exactly according to the Upstate Biotechnology protocol. DNA cross-links were reversed by incubation with 20 μl of 5 M NaCl/500 μl eluted material for 4 h at 65°C. DNA was extracted with phenol/chloroform and then precipitated. DNA from each immunoprecipitation was resuspended in 50 μl of 10 mM Tris, pH 8.0, 1 mM EDTA and subjected to PCR analysis for the arginase I enhancer using primers 391 and 379 (Table I) using conditions empirically determined to amplify the amplicons before reaching the plateau (generally 25–26 cycles). Negative control reactions for background were performed with primers specific for the IL-12p40 and KC promoters that do not recruit STAT6 (Table I). Positive control reactions were performed using the “input” samples to the immunoprecipitation reactions that had their cross-links reversed according to the Upstate Biotechnology protocol.

EMSAs reactions were performed as described in detail (21, 22) using 5 μg of nuclear extract and oligonucleotide probes detailed in Table I and the Fig. 5 legend. Supershift reactions were performed using 1 μg of each Ab as detailed in Materials and Methods. Complexes were resolved on 1% Tris-borate-EDTA acrylamide gels.

FIGURE 5.

Factors that bind to the arginase I enhancer. a and b, ChIP experiments were performed with RAW cells treated with IL-4 for the times indicated (0–4 h). Lysates from fixed and sonicated cells were immunoprecipitated with Abs to IRF-4, STAT6, C/EBPβ, and PU.1. Immunoprecipitated material was assayed by PCR for the arginase I enhancer using primers 379 and 391. Data are representative of seven independent experiments. c and d, ChIP experiments were performed to detect acetylated histones at the enhancer. Abs to acetylated histones H4 (Ac-H4), hyperacetylated H4 (Hyp-Ac-H4), and H3 (Ac-H3) were used (c) along with control immunoprecipitations for STAT6 (d) to show the IL-4-mediated recruitment of this factor for a given experiment. Data are representative of two independent experiments. e and f, EMSA analysis of complexes that can bind to regions of the arginase I enhancer. Labeled duplex probes spanning the enhancer (e, oligonucleotides 398 and 399; f, oligonucleotides 400 and 401) were incubated with nuclear extracts from IL-4-stimulated RAW cells and subjected to EMSA analysis. Preliminary experiments established the identity of nonspecific (NS) bands in these reactions. Polyclonal Abs were used to supershift PU.1 (PU.1 SS) in e. In some reactions, a 100-fold excess of cold competitor oligonucleotide duplex was added (Comp.). EMSA data is representative of four independent experiments. g–i, DNase I hypersensitivity mapping in the region of the enhancer. g, Map of the experimental design showing the location of the enhancer and probe. Complete digestion with EcoRI and EcoRV generates a 5.4-kb fragment. h, Control total RNA isolation and Northern blotting to confirm the induction of the arginase I mRNA in the same cells used for hypersensitivity mapping. i, DNase I hypersensitivity mapping following IL-4 treatment for 2 or 4 h. Nuclei were isolated from stimulated RAW cells and exposed to dilutions of DNase I for 20 min. DNA was isolated and digested to completion with EcoRI and EcoRV and analyzed by Southern blotting. Note the presence of the expected 5.4-kb fragment detected by the probe along with background hydridization (∗). Arrows indicate the presence of potential fragments hypersensitive to DNase I digestion at ∼3, 1.9, and 0.8 kb. The location of the enhancer is −2890/−3067 relative to the initiation codon. Note that IL-4 treatment does not affect the appearance of any hypersensitive sites in this region.

FIGURE 5.

Factors that bind to the arginase I enhancer. a and b, ChIP experiments were performed with RAW cells treated with IL-4 for the times indicated (0–4 h). Lysates from fixed and sonicated cells were immunoprecipitated with Abs to IRF-4, STAT6, C/EBPβ, and PU.1. Immunoprecipitated material was assayed by PCR for the arginase I enhancer using primers 379 and 391. Data are representative of seven independent experiments. c and d, ChIP experiments were performed to detect acetylated histones at the enhancer. Abs to acetylated histones H4 (Ac-H4), hyperacetylated H4 (Hyp-Ac-H4), and H3 (Ac-H3) were used (c) along with control immunoprecipitations for STAT6 (d) to show the IL-4-mediated recruitment of this factor for a given experiment. Data are representative of two independent experiments. e and f, EMSA analysis of complexes that can bind to regions of the arginase I enhancer. Labeled duplex probes spanning the enhancer (e, oligonucleotides 398 and 399; f, oligonucleotides 400 and 401) were incubated with nuclear extracts from IL-4-stimulated RAW cells and subjected to EMSA analysis. Preliminary experiments established the identity of nonspecific (NS) bands in these reactions. Polyclonal Abs were used to supershift PU.1 (PU.1 SS) in e. In some reactions, a 100-fold excess of cold competitor oligonucleotide duplex was added (Comp.). EMSA data is representative of four independent experiments. g–i, DNase I hypersensitivity mapping in the region of the enhancer. g, Map of the experimental design showing the location of the enhancer and probe. Complete digestion with EcoRI and EcoRV generates a 5.4-kb fragment. h, Control total RNA isolation and Northern blotting to confirm the induction of the arginase I mRNA in the same cells used for hypersensitivity mapping. i, DNase I hypersensitivity mapping following IL-4 treatment for 2 or 4 h. Nuclei were isolated from stimulated RAW cells and exposed to dilutions of DNase I for 20 min. DNA was isolated and digested to completion with EcoRI and EcoRV and analyzed by Southern blotting. Note the presence of the expected 5.4-kb fragment detected by the probe along with background hydridization (∗). Arrows indicate the presence of potential fragments hypersensitive to DNase I digestion at ∼3, 1.9, and 0.8 kb. The location of the enhancer is −2890/−3067 relative to the initiation codon. Note that IL-4 treatment does not affect the appearance of any hypersensitive sites in this region.

Close modal

RAW cells were stimulated for 2 or 4 h with 10 ng/ml IL-4. Nuclei were isolated from ∼250 × 106 cells by resuspension in lysis buffer (10 mM Tris, pH 7.5, 10 mM NaCl, 3 mM MgCl2, 1 mM PMSF, 0.05% Nonidet P-40). Additional Nonidet P-40 was added to the lysis buffer to a final concentration of 0.1% to achieve cell membrane lysis. The nuclei were then gently resuspended in DNase I digestion buffer (40 mM Tris, pH 7.9, 10 mM NaCl, 6 mM MgCl2, 10 mM CaCl2) to ∼20 × 106 nuclei/ml. Aliquots of nuclei were incubated with a dilution range of highly purified DNase I (Amersham Pharmacia Biotech) over 0–2000 U/ml for 20 min at 37°C. DNA was isolated by first digesting nuclei and associated proteins with proteinase K (100 μg/ml) in SDS lysis buffer (100 mM Tris, pH 8.5, 5 mM EDTA, 0.2% SDS, 200 mM NaCl) at 55°C for 2 h. DNA was then precipitated with isopropanol and resuspended in 10 mM Tris, pH 8.0, 1 mM EDTA to a final concentration of 1 μg/μl. Ten micrograms were digested to completion overnight with EcoRI and EcoRV. Samples were resolved on a 0.7% agarose gel, transferred to Hybond N+ membranes, and hybridized with a 1.8-kb probe from the arginase I promoter encompassing the −2890/−3386 region that contains the enhancer element. Southern blots were washed at high stringency (0.1% SDS, 0.1× SSC, 65°C) for 3 h and exposed to film.

To study the regulation of arginase I gene expression in macrophages through techniques such as promoter dissection, a transfectable system was essential. Primary macrophages are unsuitable for this purpose because they cannot be readily transfected. Therefore, we turned to the RAW macrophage cell line as a model system. Using Northern blotting and real-time RT-PCR, we first asked whether IL-4 and IL-13 induced arginase I mRNA expression as we had found previously in primary macrophages (9). The results show that arginase I mRNA was strongly induced in a time-dependent manner (Fig. 1). Neither IL-10 nor LPS induced arginase I mRNA alone but IL-10 was synergistic with both IL-4 and IL-13 in inducing the mRNA, precisely as reported in primary macrophages (5, 9). Importantly, IL-4 or IL-13 induced a four to five orders-of-magnitude increase in arginase I mRNA levels with the same kinetics as in primary macrophages (5, 9). Taken together, the results argue that RAW cells were a suitable model to search for STAT6-responsive regulatory regions within the arginase I promoter.

FIGURE 1.

Induction of arginase I expression in RAW macrophages. a, RAW cells were treated with the stimulants shown at the top of the figure for 3, 10, or 20 h. RNA was extracted and separated by denaturing gel electrophoresis. Arginase I mRNA levels were detected by Northern blotting using a mouse arginase I cDNA probe. b, RNA was extracted from RAW cells treated as shown in a. Arginase I mRNA levels were quantified using real-time RT-PCR and normalized to 10,000 copies of actin mRNA. Data are representative of three independent experiments.

FIGURE 1.

Induction of arginase I expression in RAW macrophages. a, RAW cells were treated with the stimulants shown at the top of the figure for 3, 10, or 20 h. RNA was extracted and separated by denaturing gel electrophoresis. Arginase I mRNA levels were detected by Northern blotting using a mouse arginase I cDNA probe. b, RNA was extracted from RAW cells treated as shown in a. Arginase I mRNA levels were quantified using real-time RT-PCR and normalized to 10,000 copies of actin mRNA. Data are representative of three independent experiments.

Close modal

Extensive studies have characterized the rat and human arginase I promoters to define the regulatory elements that control the precise, coordinate expression of the urea cycle encoding genes (11, 23, 24, 25, 26). However, little is known about the mouse arginase I promoter. Preliminary studies established that regions immediately upstream of the anticipated transcriptional start site were constitutively active in luciferase reporter assays in HepG2 cells, a human hepatoma cell line (A.-L. Pauleau, unpublished data). However, none of these constructs was responsive to IL-4 when transfected into RAW cells suggesting that the IL-4-responsive region was not located in the proximal promoter region (data not shown).

We next cloned the mouse arginase I promoter region from mouse PAC clones containing the entire arginase I locus. Fragments encompassing ∼6 kb relative to the initiation codon were cloned upstream of a luciferase reporter vector and transfected into RAW cells to test their response to IL-4, and, synergistically with IL-1 Constructs containing ∼4 or ∼6 kb regions upstream of the transcriptional start site were strongly responsive to IL-4 or IL-4 and IL-10 (Fig. 2). The −31/−3810 construct induced a 42-fold increase above background luciferase activity that was further augmented by IL-10. These results suggested that the IL-4 responsive element was present within this sequence. Systematic dissection of this region led to a 159-bp sequence sufficient to induce reporter activity in response to IL-4 (Fig. 2). In these constructs, putative IL-4-responsive regions were fused to basal arginase I promoter fragments represented by the −31/−657 and −31/−2356 regions of the promoter. These constructs by themselves were unresponsive to IL-4 until fused to fragments containing the 159-bp sequence. Qualitatively similar results were obtained using stable RAW cell lines that were generated by cotransfecting linearized versions of these plasmids and then stimulating with IL-4 or IL-4 and IL-10 and assaying for luciferase activity (data not shown).

FIGURE 2.

Identification of the IL-4-responsive element of the arginase I promoter. a, Initial constructs were made from PAC clones containing the entire arginase I locus. Constructs are numbered according to their position relative to the A residue in the initiation codon of mouse arginase I. a–c, Progressive reduction to isolate the arginase I enhancer. For clarity, a selection of plasmids used to isolate the enhancer is shown. In each case, black shading indicates plasmids that were IL-4-responsive in transfection assays. Numbering to the right indicates that distal elements of the promoter (e.g., + −2640/−4292) were fused to the −31/−657 (data not shown) or −31/−2365 plasmids which provide the information necessary for basal transcription, including the TATA element and transcriptional start site. Hatched lines indicate that a region was directly cloned 5′ to the −31/−2365 fragment and are shown aligned to the larger fragments depicted in a. RAW cells were transiently transfected and then stimulated with IL-4 or IL-4 and IL-10 for 16–20 h and assayed for luciferase activity as described in Materials and Methods. Fold induction relative to transfected cells left untreated is shown on the ordinate. Data are representative of multiple experiments used to define the IL-4-responsive region where fragments were cloned into the −31/−657 or −31/−2365 plasmids in either orientation.

FIGURE 2.

Identification of the IL-4-responsive element of the arginase I promoter. a, Initial constructs were made from PAC clones containing the entire arginase I locus. Constructs are numbered according to their position relative to the A residue in the initiation codon of mouse arginase I. a–c, Progressive reduction to isolate the arginase I enhancer. For clarity, a selection of plasmids used to isolate the enhancer is shown. In each case, black shading indicates plasmids that were IL-4-responsive in transfection assays. Numbering to the right indicates that distal elements of the promoter (e.g., + −2640/−4292) were fused to the −31/−657 (data not shown) or −31/−2365 plasmids which provide the information necessary for basal transcription, including the TATA element and transcriptional start site. Hatched lines indicate that a region was directly cloned 5′ to the −31/−2365 fragment and are shown aligned to the larger fragments depicted in a. RAW cells were transiently transfected and then stimulated with IL-4 or IL-4 and IL-10 for 16–20 h and assayed for luciferase activity as described in Materials and Methods. Fold induction relative to transfected cells left untreated is shown on the ordinate. Data are representative of multiple experiments used to define the IL-4-responsive region where fragments were cloned into the −31/−657 or −31/−2365 plasmids in either orientation.

Close modal

We also mapped the transcription initiation site of the macrophage-induced arginase I mRNA relative to the liver mRNA. Using Northern blotting, primer extension and 5′ RACE, we found that the arginase I mRNA begins in a region within 10 bp of the rat liver transcription start site previously mapped by Mori and colleagues (data not shown, and Ref.25). This suggests that the IL-4 responsive region was unlikely to act as an alternative promoter in macrophages.

While creating the constructs to characterize the IL-4-responsive region, we noticed that the element could be cloned into reporter constructs in either orientation or independent of the location from the start site of the reporter. This suggested that the 159-bp fragment may act as a classically defined enhancer element. To experimentally test this possibility, we cloned the 159-bp fragment downstream of the polyadenylation site in luciferase constructs driven by the strong SV40 promoter, or two non-IL-4-responsive arginase I proximal promoter fragments (Fig. 3). When these constructs were transfected into RAW cells and stimulated with IL-4, the 159-bp fragment increased IL-4 responsiveness. This was also true for enhancing the activity of the SV40 promoter, whose basal activity is extremely high, 3- to 6-fold (Fig. 3 a). For the −31/−657 or −31/−2365 constructs, basal activity of these promoters is low and augmented slightly by the addition of IL-4 but robustly induced when the 159-bp fragment is cloned downstream. These results define the IL-4-responsive element of the arginase I promoter as an enhancer.

FIGURE 3.

The IL-4-responsive region of the arginase I promoter is an enhancer. The IL-4-responsive fragment −2890/−3067 was cloned downstream of the polyadenylation signal in each plasmid as shown in a–c as a test of enhancer activity. RAW cells were transiently transfected and then stimulated with IL-4 or IL-4 and IL-10 for 16–20 h and assayed for luciferase activity as described in Materials and Methods. Fold induction relative to transfected cells left untreated is shown on the ordinate. Note that enhancer activity in the pGL3-promoter vector (a) is lower because the basal activity of this plasmid is extremely high as a result of the strong SV40 promoter element.

FIGURE 3.

The IL-4-responsive region of the arginase I promoter is an enhancer. The IL-4-responsive fragment −2890/−3067 was cloned downstream of the polyadenylation signal in each plasmid as shown in a–c as a test of enhancer activity. RAW cells were transiently transfected and then stimulated with IL-4 or IL-4 and IL-10 for 16–20 h and assayed for luciferase activity as described in Materials and Methods. Fold induction relative to transfected cells left untreated is shown on the ordinate. Note that enhancer activity in the pGL3-promoter vector (a) is lower because the basal activity of this plasmid is extremely high as a result of the strong SV40 promoter element.

Close modal

In silico analysis of the enhancer using programs designed to predict transcription factor binding sites (e.g., TransFac) suggested the presence of multiple putative binding sites for transcription factors including C/EBPβ, PU.1, and STAT6 (Fig. 4,a). To ascertain the importance of these sites, we initially attempted to further reduce the size of the enhancer by creating fragments progressively reduced in size from either end. Surprisingly, none of these fragments displayed IL-4 responsiveness suggesting that the enhancer could not be minimized in this manner (data not shown). We then created plasmids containing mutations in each putative transcription factor binding site or adjacent sequences in the case of the putative PU.1 sites with the rationale that PU.1 forms tight complexes with proteins such as IRF-4 that we had identified in microarray screens and considered potentially important in regulation of the enhancer (see Discussion). All mutations were made in the −31/−3810 plasmid that contains the enhancer, the basal promoter, and the transcription start site. Each mutant lost its ability to induce reporter expression in response to IL-4 or IL-4 and IL-10 although mutations in the putative STAT6 binding site completely abrogated reporter activity while mutations at other sites (e.g., mutants B and E) retained some inducibility (Fig. 4 b). Similar results were found using stable RAW cell lines generated by transfecting linearized versions of these plasmids. This data, combined with the inability to reduce the overall size of the enhancer suggested that IL-4-mediated regulation of arginase I gene regulation was more complex than expected and required the assembly of a variety of transcription factors to the enhancer.

FIGURE 4.

Mutagenesis analysis of the arginase I enhancer. Mutations were introduced into the −31/−3810 plasmid using site-directed mutagenesis. Mutations, labeled A through G, were constructed as shown (a). Each mutant was made twice, independently, and the results from one series of experiments are shown. Mutants were transfected into RAW cells, stimulated with IL-4 or IL-4 + IL-10 and assayed for luciferase activity (b). Fold induction relative to transfected cells left untreated is shown on the ordinate. The position of the EMSA probes used in Fig. 5 are shown underlined.

FIGURE 4.

Mutagenesis analysis of the arginase I enhancer. Mutations were introduced into the −31/−3810 plasmid using site-directed mutagenesis. Mutations, labeled A through G, were constructed as shown (a). Each mutant was made twice, independently, and the results from one series of experiments are shown. Mutants were transfected into RAW cells, stimulated with IL-4 or IL-4 + IL-10 and assayed for luciferase activity (b). Fold induction relative to transfected cells left untreated is shown on the ordinate. The position of the EMSA probes used in Fig. 5 are shown underlined.

Close modal

ChIP and EMSA reactions were performed to characterize the factors that can bind to the enhancer. In untreated RAW cells, STAT6, and C/EBPβ were weakly detected at the enhancer (Fig. 5,a). Following IL-4 treatment, however, STAT6, C/EBPβ, and the coactivator CREB binding protein were recruited to the enhancer in a time-dependent manner. Correlative data from EMSA binding reactions also showed that IL-4-inducible complexes bound to oligonucleotide probes encompassing the putative STAT6 and C/EBPβ sites (Fig. 5,f). Most interestingly, ChIP experiments showed that STAT6 itself is recruited to the enhancer which suggests that this factor plays two distinct functions in arginase I regulation: STAT6 directly binds the enhancer as shown here, but also directs the regulation of one or more other genes that are crucial for arginase expression (9). This indirect role of STAT6 was revealed in our previous work showing that cycloheximide blocks arginase I expression induced by IL-4. ChIP analysis also showed that PU.1 was constitutively bound to the enhancer (Fig. 5,b). Within the enhancer, the most likely binding sites for PU.1 are the GGAA motifs (Fig. 4). Site-directed mutagenesis of these sites substantially reduced enhancer activity (Fig. 4). Thus, PU.1 could serve as a factor that coordinates factor assembly at the enhancer. The ChIP data also correlated with supershift EMSA results definitively showing that PU.1 bound to an oligonucleotide probe encompassing the putative PU.1 binding sites (Fig. 5,e). Finally, we performed additional ChIP experiments to ask whether chromatin at the enhancer was in a closed or open configuration based on the levels of acetylated histones (Fig. 5,c). The results showed that acetylated and hyperacetylated histone H4 and acetylated H3 were readily immunoprecipitated from unstimulated cells, indicating that the arginase I enhancer is most likely in an open configuration awaiting signals for rapid transcriptional activation. These results were correlated with DNase I hypersensitivity assays (Fig. 5, g–i) that showed that IL-4 does not regulate the inducible formation of hypersensitive sites around the region of the enhancer. There were three hypersensitive sites detected within a 5.4-kb region of the enhancer (Fig. 5, g and i) that potentially represent regions in and around the enhancer that are more accessible to DNase I digestion. Therefore, the results support the notion that the DNA in this region is likely in a configuration readily accessible to the IL-4-regulated factors that stimulate arginase I transcription.

We have identified the mechanism of macrophage-specific arginase I expression. The results show that an enhancer located ∼3 kb from the transcriptional start site is responsive to signals delivered from the Th2 cytokine IL-4, via STAT6. However, the regulation of the enhancer is complex, because STAT6 both directly binds to the enhancer, and directs the synthesis of other genes required for arginase I expression. Furthermore, we found that multiple factors assemble at the enhancer, a property in keeping with other enhancer elements.

Arginase I expression in the liver is constitutive and must be maintained constantly, and coordinately, with the other enzymes that make up the urea cycle (1, 2). The basal, hepatocyte regulation of the genes encoding the urea cycle enzymes have been extensively dissected (11, 23, 24, 25, 26, 27). In contrast, the expression of the arginase I gene in macrophages is silent until the cells are stimulated with IL-4 or IL-13. Both of these cytokines activate STAT6 that is essential for many of the signal transduction events downstream of the IL-4 or IL-13 receptors. Although previous studies have shown that a variety of signals can regulate macrophage arginase I expression, IL-4 and IL-13 are by far the most potent. We began to search for the IL-4-regulated region of the arginase I promoter using the studies of Mori and colleagues (24, 25) as a guide. These investigators have dissected the regulatory regions involved in the hepatocyte-specific expression of the arginase I gene in rats and humans. When fused to reporter constructs and transfected into macrophages, arginase I promoter constructs containing the previously identified hepatocyte-specific regulatory regions were not responsive to IL-4. Therefore, we searched upstream of the transcriptional start site and eventually identified a small region, ∼3 kb from the start site that conferred IL-4-responsiveness upon arginase I basal promoter fragments. This region acted as a true enhancer element: it was functional independent of distance from the start site and was active in either orientation. The arginase I enhancer could not be reduced in size, and mutations introduced into putative transcription factor binding sites all affected activity. The activity of the enhancer was completely abrogated when a mutation in the putative STAT6 binding site was introduced, data that is consistent with the findings of Morris and colleagues (2) who reported that they identified a STAT6 site in a similar locale. ChIP experiments and EMSA analysis showed that STAT6 was directly recruited to the enhancer. This finding was surprising considering that our previous data suggested that STAT6 functioned by directing the expression of another gene(s) whose activity was required for arginase I mRNA expression. Therefore, STAT6 appears to have two functions, both direct and indirect (Fig. 6). This scenario is reminiscent of the IL-4 regulation of the polymeric Ig receptor gene where STAT6 also appears to have a dual function (28). Other factors that bind to the enhancer include PU.1, a crucial transcription factor in macrophage development and biology, C/EBPβ and the coactivator CBP. Mutations in the putative binding sites for PU.1 and C/EBPβ also reduced the activity of the enhancer. Overall, it appears that multiple factors form a complex at the enhancer and likely assemble in the correct temporal order. Thus, STAT6 directly binds, along with PU.1, CBP, C/EBPβ, and possibly other components, and this complex awaits the STAT6-regulated production of another factor that establishes transcriptional regulation of the locus.

FIGURE 6.

Model for the macrophage-specific regulation of arginase I gene expression. In this model, STAT6 has both direct and indirect roles. The STAT6-mediated induction of factor X that assembles at the promoter is speculative.

FIGURE 6.

Model for the macrophage-specific regulation of arginase I gene expression. In this model, STAT6 has both direct and indirect roles. The STAT6-mediated induction of factor X that assembles at the promoter is speculative.

Close modal

To search for the STAT6-regulated factor(s), we have used two types of microarray approaches. The first, an Affymetrix screen (Santa Clara, CA), was designed to focus on the identification of IL-4-regulated genes. In this pool of genes, we expected to identify transcription factors that could then be tested as candidate factors for regulating the enhancer. In this group, two mRNAs were identified, Krox-20 and IRF-4, whose induction was confirmed by Northern and immunoblotting analysis. Krox-20 had previously been identified as IL-4 regulated in B cells (29). However, transfection experiments failed to confirm any role for this factor in arginase I regulation (data not shown). IRF-4 was appealing because it forms a complex with PU.1 that is understood in atomic detail (30), and plays an important role in regulating IL-4 responses (31, 32, 33, 34). However, macrophages from IRF-4−/− mice had completely normal IL-4-mediated induction of arginase I (data not shown). We also designed a microarray screen taking advantage of the fact that cycloheximide blocks induction of arginase I mRNA when macrophages are stimulated with IL-4. Macrophages were treated with IL-4 with or without cycloheximide for various times and mRNA expression was measured on M20 arrays that contain ∼20,000 cDNAs. Here, we were searching for genes that were induced by IL-4 in the presence or absence of cycloheximide. Genes that require new protein synthesis to be induced (e.g., arginase I) would not be present in the samples treated with cycloheximide. In this screen, we identified a candidate transcription factor, ATF1. However, the induction of this protein was weak and not dependent on STAT6 (data not shown). At this stage, it is not possible to definitively determine whether STAT6 induces a transcription factor. It is possible that STAT6 regulates other processes required for transcription of the arginase I gene, including chromatin-dependent factors. In addition, we cannot definitively exclude the possibility that cycloheximide regulates the degradation of a factor(s) that assembles at the enhancer. This effect would preclude indirect effects of STAT6 on other genes.

Direct pharmacological manipulation of arginase I in diseases where macrophage activity is implicated will most likely be impossible because of liver toxicity associated with the disruption of the urea cycle. For example, if arginase I activity promotes fibrosis in schistosomiasis (12, 14, 35) or accentuates asthmatic reactions (13), then our ability to regulate arginase I activity only in macrophages would be an appealing target. This report defines the basis for macrophage specificity and suggests that the control of the regulation of the arginase I enhancer could be targeted while sparing constitutive expression of arginase I in the liver.

We thank Jay Morris, Deepak Kaushal, and Lorne Rose for microarray analysis, Philippe Bois for discussion and assistance with genomic analysis of the arginase I loci, Tom Wynn for critical appraisal of the manuscript, and Chris Guglielmo and Kevin Baldovich for their initial work on arginase I regulation.

1

This work was supported by National Institutes of Health Cancer Center CORE P30 CA 21765, and by ALSAC.

5

Abbreviations used in this paper: IRF, IFN regulatory factor; ChIP, chromatin immunoprecipitation; CBP, CREB binding protein.

1
Wu, G., S. M. Morris, Jr.
1998
. Arginine metabolism: nitric oxide and beyond.
Biochem. J.
336
:
1
.
2
Morris, S. M..
2002
. Regulation of enzymes of the urea cycle and arginine metabolism.
Annu. Rev. Nutr.
22
:
87
.
3
Wei, L. H., A. T. Jacobs, S. M. Morris, Jr, L. J. Ignarro.
2000
. IL-4 and IL-13 upregulate arginase I expression by cAMP and JAK/STAT6 pathways in vascular smooth muscle cells.
Am. J. Physiol.
279
:
C248
.
4
Wei, L. H., G. Wu, S. M. Morris, Jr, L. J. Ignarro.
2001
. Elevated arginase I expression in rat aortic smooth muscle cells increases cell proliferation.
Proc. Natl. Acad. Sci. USA
98
:
9260
.
5
Munder, M., K. Eichmann, J. M. Moran, F. Centeno, G. Soler, M. Modolell.
1999
. Th1/Th2-regulated expression of arginase isoforms in murine macrophages and dendritic cells.
J. Immunol.
163
:
3771
.
6
Bogdan, C., M. Rollinghoff, A. Diefenbach.
2000
. Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity.
Curr. Opin. Immunol.
12
:
64
.
7
Bogdan, C..
2001
. Nitric oxide and the immune response.
Nat. Immunol.
2
:
907
.
8
Modolell, M., I. M. Corraliza, F. Link, G. Soler, K. Eichmann.
1995
. Reciprocal regulation of the nitric oxide synthase/arginase balance in mouse bone marrow-derived macrophages by TH1 and TH2 cytokines.
Eur. J. Immunol.
25
:
1101
.
9
Rutschman, R., R. Lang, M. Hesse, J. N. Ihle, T. A. Wynn, P. J. Murray.
2001
. Cutting edge: Stat6-dependent substrate depletion regulates nitric oxide production.
J. Immunol.
166
:
2173
.
10
Lee, J., H. Ryu, R. J. Ferrante, S. M. Morris, Jr, R. R. Ratan.
2003
. Translational control of inducible nitric oxide synthase expression by arginine can explain the arginine paradox.
Proc. Natl. Acad. Sci. USA
100
:
4843
.
11
Mori, M., T. Murakami, Y. Haraguchi, A. Nishiyori, M. Takiguchi.
1991
. Structure and expression of genes for urea cycle enzymes.
Contrib. Nephrol.
92
:
218
.
12
Hesse, M., M. Modolell, A. C. La Flamme, M. Schito, J. M. Fuentes, A. W. Cheever, E. J. Pearce, T. A. Wynn.
2001
. Differential regulation of nitric oxide synthase-2 and arginase-1 by type 1/type 2 cytokines in vivo: granulomatous pathology is shaped by the pattern of l-arginine metabolism.
J. Immunol.
167
:
6533
.
13
Zimmermann, N., N. E. King, J. Laporte, M. Yang, A. Mishra, S. M. Pope, E. E. Muntel, D. P. Witte, A. A. Pegg, P. S. Foster, et al
2003
. Dissection of experimental asthma with DNA microarray analysis identifies arginase in asthma pathogenesis.
J. Clin. Invest.
111
:
1863
.
14
Wynn, T. A..
2003
. IL-13 effector functions.
Annu. Rev. Immunol.
21
:
425
.
15
Vincendeau, P., A. P. Gobert, S. Daulouede, D. Moynet, M. D. Mossalayi.
2003
. Arginases in parasitic diseases.
Trends Parasitol.
19
:
9
.
16
Iniesta, V., L. C. Gomez-Nieto, I. Corraliza.
2001
. The inhibition of arginase by N(ω)-hydroxy-l-arginine controls the growth of Leishmania inside macrophages.
J. Exp. Med.
193
:
777
.
17
Iniesta, V., L. C. Gomez-Nieto, I. Molano, A. Mohedano, J. Carcelen, C. Miron, C. Alonso, I. Corraliza.
2002
. Arginase I induction in macrophages, triggered by Th2-type cytokines, supports the growth of intracellular Leishmania parasites.
Parasite Immunol.
24
:
113
.
18
Shimoda, K., J. van Deursen, M. Y. Sangster, S. R. Sarawar, R. T. Carson, R. A. Tripp, C. Chu, F. W. Quelle, T. Nosaka, D. A. Vignali, et al
1996
. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene.
Nature
380
:
630
.
19
Lang, R., R. L. Rutschman, D. R. Greaves, P. J. Murray.
2002
. Autocrine deactivation of macrophages in transgenic mice constitutively overexpressing IL-10 under control of the human CD68 promoter.
J. Immunol.
168
:
3402
.
20
Lang, R., D. Patel, J. J. Morris, R. L. Rutschman, P. J. Murray.
2002
. Shaping gene expression in activated and resting primary macrophages by IL-10.
J. Immunol.
169
:
2253
.
21
Panopoulos, A. D., D. Bartos, L. Zhang, S. S. Watowich.
2002
. Control of myeloid-specific integrin αMβ2 (CD11b/CD18) expression by cytokines is regulated by Stat3-dependent activation of PU. 1.
J. Biol. Chem.
277
:
19001
.
22
Wooten, D. K., X. Xie, D. Bartos, R. A. Busche, G. D. Longmore, S. S. Watowich.
2000
. Cytokine signaling through Stat3 activates integrins, promotes adhesion, and induces growth arrest in the myeloid cell line 32D.
J. Biol. Chem.
275
:
26566
.
23
Mori, M., T. Gotoh, A. Nagasaki, M. Takiguchi, T. Sonoki.
1998
. Regulation of the urea cycle enzyme genes in nitric oxide synthesis.
J. Inherited Metab. Dis.
21
:(Suppl. 1):
59
.
24
Takiguchi, M., Y. Haraguchi, M. Mori.
1988
. Human liver-type arginase gene: structure of the gene and analysis of the promoter region.
Nucleic Acids Res.
16
:
8789
.
25
Takiguchi, M., M. Mori.
1991
. In vitro analysis of the rat liver-type arginase promoter.
J. Biol. Chem.
266
:
9186
.
26
Takiguchi, M., M. Mori.
1995
. Transcriptional regulation of genes for ornithine cycle enzymes.
Biochem. J.
312
:
649
.
27
Mori, M., T. Gotoh.
2000
. Regulation of nitric oxide production by arginine metabolic enzymes.
Biochem. Biophys. Res. Commun.
275
:
715
.
28
Schjerven, H., P. Brandtzaeg, F. E. Johansen.
2000
. Mechanism of IL-4-mediated up-regulation of the polymeric Ig receptor: role of STAT6 in cell type-specific delayed transcriptional response.
J. Immunol.
165
:
3898
.
29
Schroder, A. J., P. Pavlidis, A. Arimura, D. Capece, P. B. Rothman.
2002
. Cutting edge: STAT6 serves as a positive and negative regulator of gene expression in IL-4-stimulated B lymphocytes.
J. Immunol.
168
:
996
.
30
Escalante, C. R., A. L. Brass, J. M. Pongubala, E. Shatova, L. Shen, H. Singh, A. K. Aggarwal.
2002
. Crystal structure of PU. 1/IRF-4/DNA ternary complex.
Mol. Cell
10
:
1097
.
31
Tominaga, N., K. Ohkusu-Tsukada, H. Udono, R. Abe, T. Matsuyama, K. Yui.
2003
. Development of Th1 and not Th2 immune responses in mice lacking IFN-regulatory factor-4.
Int. Immunol.
15
:
1
.
32
Gupta, S., M. Jiang, A. Anthony, A. B. Pernis.
1999
. Lineage-specific modulation of interleukin 4 signaling by interferon regulatory factor 4.
J. Exp. Med.
190
:
1837
.
33
Fanzo, J. C., C. M. Hu, S. Y. Jang, A. B. Pernis.
2003
. Regulation of lymphocyte apoptosis by interferon regulatory factor 4 (IRF-4).
J. Exp. Med.
197
:
303
.
34
Hu, C. M., S. Y. Jang, J. C. Fanzo, A. B. Pernis.
2002
. Modulation of T cell cytokine production by interferon regulatory factor-4.
J. Biol. Chem.
277
:
49238
.
35
Sandor, M., J. V. Weinstock, T. A. Wynn.
2003
. Granulomas in schistosome and mycobacterial infections: a model of local immune responses.
Trends Immunol.
24
:
44
.