IL-17 Markedly Up-Regulates β-Defensin-2 Expression in Human Airway Epithelium via JAK and NF-κB Signaling Pathways¹

Airway epithelium directly interacts with the environment through inhalation and exhalation, and many host defense systems have evolved to eliminate microbial invaders and control infection locally. In addition to providing a physical barrier against infection, the epithelium secretes a variety of antimicrobial substances that can inhibit or neutralize invading pathogens (1, 2, 3, 4). Defensins are one of the two major vertebrate antimicrobial peptide families that provide the chemical shields against a broad spectrum of microorganism infections (5). Based on different arrangements of the six-cysteine motifs, human defensins are categorized into α- and β-defensin subfamilies (6). The α-defensins are produced by neutrophils and intestinal Paneth’s cells, while human β-defensins (hBDs)³ are mostly produced by epithelial cells of the skin and the tracheobronchial tree (7).

All of the known hBDs are cationic peptides. They share a conserved motif, which is composed of six spaced cysteines. The hBD coding sequence is organized into two exons. The N terminus of the translation product is led by a signal peptide, which is eventually cut off to form a propeptide and then a mature peptide. Currently, expression of five hBDs has been identified in airway cells (8). hBD-1 was isolated from human plasma and is expressed in most epithelial cells (9, 10). hBD-2 was originally isolated from human skin and is highly expressed after proinflammatory induction in the lung (11). hBD-3 was found recently through the use of several different approaches, which included a genomics-based PCR search and a traditional peptide purification. hBD-3 could be detected in lung tissue following induction with IL-1 (12, 13, 14). hBD-4, which is also reported to be expressed by lung epithelial cells, was discovered through a direct BLAST search of genome sequences on chromosome 8 (15). Using an ORFeome-based Hidden Markov Model search, we recently identified a novel β-defensin, hBD-6, verified its expression, and confirmed the bactericidal activity of the peptide in human airways (8). hBD-6 was found recently to also be expressed in the epididymis (16). All the β-defensins have a broad spectrum of antimicrobial activity at micromolar concentrations.

hBD-2 represents the first human defensin that is produced by epithelial cells following contact with bacteria, viruses, or cytokines, such as IL-1 and TNF-α (2, 17, 18, 19, 20, 21, 22). Although the nature of the regulation is not completely characterized, both the MAPK signal transduction pathway and the NF-κB transcription factor have been suggested to be involved (23, 24). Using a panel of cytokines that included IL-1α, 1β, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; IFN-γ; GM-CSF; and TNF-α, we report that IL-17 is the most potent cytokine to stimulate hBD-2 expression in well-differentiated primary human tracheobronchial epithelial (TBE) cells. hBD-2 stimulation increased 75-fold after IL-17 treatment as compared with only 5- to 10-fold with IL-1 and TNF-α treatments. This stimulation also occurred at the protein level.

IL-17 is a proinflammatory cytokine originally identified as CTLA-8 (25). It displays 58% homology to the T-lymphotropic Herpesvirus Saimiri gene 13 product (26, 27). Subsequent studies of human IL-17 (hIL-17 or IL-17A) demonstrated exclusive expression of this cytokine by activated T cells, predominantly of the prototypic CD45⁺RO⁺CD4⁺ subtype (28). The other potential source of IL-17 was suggested from a recent mouse lung study that demonstrated the potential role of TLR-4 and IL-23 in mediating the stimulation of IL-17 production by CD4⁺ and CD8⁺ T cells (29). It was reported that IL-17 could regulate pulmonary neutrophil emigration in the context of local bacterial infections (30, 31). Recent studies have led to the discovery of several other IL-17 gene family members, IL-17B, C, D, E, and F, which are thought to have overlapping physiological functions with hIL-17/IL-17A (32, 33). However, the physiological functions of these new IL-17 gene family members are still unknown.

IL-17 has been found to be elevated in a variety of inflammatory conditions such as with asthma and Gram-negative bacterial pneumonia (33). IL-17 stimulates NF-κB activation and also the expression of IL-6, IL-8, ICAM, MIP-2, Gro, and GM-CSF in rodent and human cells (34). In human macrophages, IL-17 stimulated the production of proinflammatory cytokines, such as IL-1β and TNF-α (35). We have recently demonstrated that IL-17 stimulates MUC gene expression partly through a JAK-2-dependent and IL-6 autocrine/paracrine loop in primary human TBE cells (36).

In the present study, initially through microarray gene expression profile analysis, we identify a selective activation of hBD-2 expression by IL-17. Further studies with a panel of cytokines demonstrate that IL-17 is the most potent cytokine that stimulates hBD-2 expression. This stimulation appears to occur at the transcriptional level through JAK/NF-κB-dependent, and IL-1- and IL-6-independent mechanisms.

Recombinant human IL-1α, 1β, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; TNF-α; IFN-γ; GM-CSF; IL-1R antagonist; and IL-17R Ab were purchased from R&D Systems (Minneapolis, MN). Mammalian cells secreting recombinant IL-17A, B, C, D, and E in conditioned medium were obtained from ProteinBank (San Diego, CA). Helenalin, sulfasalazine, AG490, and JAK inhibitor I were purchased from Calbiochem-Novabiochem (San Diego, CA).

Human tracheobronchial tissues were obtained from the University of California Medical Center (Sacramento, CA) with patient consent, and also from National Disease Research Interchange (Philadelphia, PA). The University Human Subjects Review Committee approved all procedures involved in tissue procurement. Tissues were collected only from patients without known respiratory tract diseases. Primary cultures derived from these airway tissues have been established before (37, 38). Protease-dissociated TBE cells were plated on a collagen gel substratum-coated Transwell (Corning Costar, Corning, NY) chamber (25 mm) at 1–2 × 10⁴ cells/cm², in a Ham’s F12/DMEM (1:1) supplemented with insulin (5 μg/ml), transferrin (5 μg/ml), epidermal growth factor (10 ng/ml), dexamethasone (0.1 μM), cholera toxin (10 ng/ml), bovine hypothalamus extract (15 μg/ml), BSA (0.5 mg/ml), and all-trans-retinoic acid (30 nM). After 1 wk in an immersed culture condition, these primary TBE cultures were transferred to an air-liquid interface (biphasic) culture condition. HBE1 cell line is an immortalized line of normal human airway epithelial cells (39). HBE1 cells were cultured under four different conditions: 1) plastic tissue culture surface (TC), 2) Transwell chamber with air-liquid interface condition (BI), 3) collagen gel-coated surface (CG), and 4) collagen gel-coated Transwell chamber with an air-liquid interface condition (BI-CG).

Recombinant human cytokines were dissolved in PBS with 1% BSA and added directly to both the apical and basal sides of medium of the primary TBE cultures (0–100 ng/ml). The control treatments had the same amount of PBS-1% BSA added. In the receptor antagonist studies, the antagonists (40, 200, and 1000 ng/ml) were added to the cultures 30 min before IL-17 treatment. Helenalin, sulfasalazine, AG490, and JAK inhibitor I were dissolved in DMSO, and they were also added to the culture 30 min before IL-17 treatment. The optimal dose for each of the selected inhibitors was determined based on the current literature and by following the manufacturer’s recommendations. A dye exclusion assay with trypan blue was used to test the cell viability of cultured cells treated with each chemical. No obvious cytotoxicity (<0.5%) was found in cultures treated with these chemicals at the doses used.

RNA was extracted from cultures using RNA TRIzol reagent (Invitrogen, Carlsbad, CA), according to the manufacturer’s protocol. Affymetrix GeneChip HuGene-U133A oligonucleotide microarrays (Santa Clara, CA) were used to profile gene expression patterns of TBE cells after IL-6 and IL-17 treatments. An initial 30 μg of RNA of each sample was sent to the University of California, Davis Microarray Core Facility (Sacramento, CA). Image data were further analyzed by statistical analysis tools written in R through the Bioconductor project (http://www.bioconductor.org).

Five micrograms of total RNA was reverse transcribed with Moloney murine leukemia virus-reverse transcriptase (Promega, Madison, WI) by oligo(dT) primers for 90 min at 42°C in 20 μl and then further diluted to 100 μl with water for the following procedures. A total of 2 μl of diluted cDNA was analyzed using 2× SYBR green PCR master mix (Applied Biosystems, Foster City, CA) by an ABI 5700 or ABI PRISM 7900HT Sequence Detection System (Applied Biosystems), following the manufacturer’s protocol. Gene-specific primers were designed according to the sequences to cover the conserved peptide sequence regions. PCR primers used were: hBD-1, forward, CAGTCGCCATGAGAACTTCCT, and reverse, CTGCTGACGCAATTGTAATGA; hBD-2, forward, GCCTCTTCCAGGTGTTTTTG, and reverse, GAGACCACAGGTGCCAATTT; hBD-3, forward, GGTGAAGCCTAGCAGCTATGAG, and reverse, CGCCTCTGACTCTGCAATAAT; mouse β-defensin-3 (mBD-3), forward, GTCTCCACCTGCAGCTTTTAG, and reverse, ACTGCCAATCTGACGAGTGTT; β-actin, forward, AGAAAATCTGGCACCACACC, and reverse, GGGGTGTTGAAGGTCTCAAA; and GAPDH, forward, CAATGACCCCTTCATTGACC, and reverse, GACAAGCTTCCCGTTCTCAG. The PCR was conducted in 96-well optical reaction plates, and each well contained a 50 μl reaction mixture that contained 25 μl of the SYBR green PCR master mix, 1 μl of each forward and reverse primer, 21 μl of water, and 2 μl of cDNA samples. The SYBR green dye was measured at 530 nm during the extension phase. The threshold cycle (Ct) value reflects the cycle number at which the fluorescence generated within a reaction crosses a given threshold. The Ct value assigned to each well thus reflects the point during the reaction at which a sufficient number of amplicons have been accumulated. The relative mRNA amount in each sample was calculated based on its Ct in comparison with the Ct of housekeeping genes, such as β-actin and GAPDH. The results were presented as 2ˆ (Ct of housekeeping gene – Ct of hBD-2), an arbitrary unit. The purity of amplified product was determined as a single peak of the dissociation curve. Real-time PCR was conducted in duplicate for each sample, and the mean value was calculated. This procedure was performed in two or three independent experiments.

Goat polyclonal Ab to hBD-2 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Synthetic mature hBD-2 (GIG DPV TCL KSG AIC HPV FCP RRY KQI GTC GLP GTK CCK KP) and DEFB-106 (FFD EKC NKL KGT CKN NCG KNE ELI ALC QKF LKC CRT IQP CGS IID) (8) peptides (Alpha Diagnostic International, San Antonio, TX) were dissolved in 0.01% acetic acid with 0.2% BSA (Sigma-Aldrich, St. Louis, MO). A single Western blot band was detected with the synthetic mature hBD-2 peptide, but not the DEFB-106 peptide, by the commercial anti-hBD-2 polyclonal Ab (data not shown). For a competitive ELISA, hBD-2 was coated in immunoassay microplates (Immulon 2 HB; Fisher Scientific, Pittsburgh, PA) at 200 ng/well in coating buffer (0.1 M sodium bicarbonate/carbonate and 0.02% sodium azide, pH 9.6) overnight at 4°C. Plates were washed once with the washing solution, PBS/Tween 20 (0.05%) buffer (pH 7.4), and nonspecific binding sites were blocked by incubation with PBS/Tween 20/3% BSA buffer for 30 min at room temperature. Plates were further washed twice with the PBS-Tween washing solution (200 μl/well). A standard 1/1000 dilution of primary goat anti-hBD-2 Ab competition mixture containing different amounts of referenced hBD-2 peptide (0–50 ng/mixture) and samples of culture medium prepared from these airway cell cultures was added to each well (200 μl/well), and incubated at 37°C for 2 h. After four more washings, 200 μl/well of 1/1000 dilution of alkaline phosphatase-conjugated anti-goat IgG secondary Ab (Vector Laboratories, Burlingame, CA) was added to each well, and the incubation was continued at 37°C for 1 h. Wells were washed five times, and 200 μl/well of a 1 mg/ml solution of p-nitrophenyl phosphate (Sigma-Aldrich) in substrate buffer (10% diethanolanine and 0.02% sodium azide, pH 9.8) was added for color development (20–40 min at room temperature). The plate was read at 405 nm for the absorbance. Unknown samples were preassayed at three different dilutions to assure that the data were within the linear range of the competition by referenced hBD-2. The results indicated a sensitivity of the competitive ELISA for referenced hBD-2 at 10 ng/well. The results were averaged from triplicate wells of one representative experiment from three independent assays. There was no detectable cross-reaction with the DEFB-106 peptide with this anti-hBD-2 Ab (data not shown).

A DNA fragment containing the proximal 2.2 kb of the hBD-2 promoter region (−2210 to +24) was amplified from PstI-digested genomic DNA by PCR with the following primers: GTTGCTAGCCTTTGGGACTTCCCCAGCTATG (forward primer with NheI tail) and TTTAAGCTTTGGCTGATGGCTGGGAGCTT (reverse primer with HindIII tail). The amplified product was subcloned into a pGL-3 vector (Promega) with firefly luciferase reporter gene to generate hBD2-2210/Luc plasmid. The authenticity of the clone was confirmed and reconfirmed by DNA sequencing.

HBE1 cells were seeded into 24-well plates at a density of 5 × 10⁴ cells/well. One day after plating, cells were transfected with 0.3 μg of hBD2-2210/Luc plasmid DNA and 50 ng of Renilla luciferase expression vector pRL-TK (Promega) using FuGENE 6-based gene transfer protocol (Roche Diagnostic Systems, Indianapolis, IN), according to the manufacturer’s instruction. Eighteen hours after the transfection, cells were treated with various concentrations of IL-17, and cell extracts were prepared for reporter gene assays 24 h after the cytokine treatment. The reporter gene assays were conducted with the Dual-Glo Luciferase Assay System (Promega), according to the manufacturer’s protocol. The relative hBD-2 promoter activities were expressed as relative light units after normalization to the control, Renilla luciferase activity. The results were averaged from triplicate wells of three separate experiments.

Data are expressed as mean ± SE. The number of repeats for each experiment is described under Results and also in the figure legends. Group differences were calculated by ANOVA, and p values <0.05 were considered significant.

Our recent work has demonstrated that, among a panel of cytokines, both IL-6 and IL-17 are the most potent mediators to stimulate mucin gene expression in primary human TBE cells (36). As an extension of this work, Affymetrix microarray analysis was conducted to profile the gene expression patterns in cells treated with these cytokines. As shown in Fig. 1, the three-dimensional scatter plot of the array data showed that IL-17 pronouncedly stimulated both hBD-2 and MIP-3α, but not other antimicrobial genes, hBD-1 and various α-defensins by IL-17, whereas IL-6 had little influence on these genes. MIP-3α was recently shown to have antimicrobial activity (40). According to these data, the magnitude of the induction for both hBD-2 and MIP-3α is similar, although the basal level of hBD-2 is 7-fold higher than MIP-3α. Because of this analysis, this study focused on hBD-2 expression. In the microarray data set, we also observed that IL-17 induced the elevation of IL-8 and G-CSF expression. There was a >2-fold induction of IL-8 and a >3-fold induction of G-CSF, although these induction levels were small compared with the >8-fold induction of hBD-2 and MIP-3α (data not shown). Our data confirm the induction of IL-8 and G-CSF by IL-17 (34).

To further evaluate induction of hBD-2, primary TBE cells were treated with a panel of cytokines (10 ng/ml), including IL-1α, 1β, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; IFN-γ; GM-CSF; and TNF-α. Real-time RT-PCR analysis was conducted for hBD-2 expression in these cytokine-treated samples. As shown in Fig. 2, hBD-2 message was elevated in TBE cells by IL-1α, IL-1β, IL-6, IL-17, and TNF-α, whereas other cytokines had little influence. Inductions of hBD-2 by IL-1α, IL-1β, and TNF-α treatment are consistent with previous reports (17, 18, 41). The observed moderate induction by IL-6 has not been reported before. Overnight (16-h) treatment of airway epithelial cells with IL-17 consistently resulted in a >70-fold induction of hBD-2 message. Treatments of airway cells with IL-2, 3, 4, 8, 9, 10, 11, 12, and 13, even at higher doses (50 ng/ml), did not result in increased hBD-2 message (data not shown). We did not observe any cytokine-induced cytotoxicity. Cell viability, assessed by the trypan blue exclusion method, routinely was greater than 95%.

The stimulation of hBD-2 expression was further tested with different IL-17 variants. Mammalian cell-secreted recombinant IL-17A, B, C, D, and E conditioned medium was obtained from a commercial source, and the effects of these secretory products on hBD-2 expression were examined. For comparison, rhIL-17, used in the experiments described above, was included in this study. As shown in Fig. 3, only rhIL-17 and IL-17A conditioned medium was able to stimulate hBD-2 expression after both 24- and 72-h incubation, whereas other IL-17 variants had no effect. These results confirm the specificity of the IL-17A variant in the induction of hBD-2 expression.

To test the evolutionary conservation of IL-17-induced hBD-2 expression, the expressions of mouse homologues, mBD-3 and mBD-4, by mouse primary tracheal epithelial cells were analyzed by real-time RT-PCR. C57BL/6 mouse tracheal epithelial cells were isolated and cultured under an air-liquid interface condition, similar to that of human primary TBE cells, for 2 wk. IL-17 at 10 ng/ml was added to these cultures, and RNA was harvested 24 h later for real-time RT-PCR quantification, as described in Materials and Methods. Baseline mBD-4 expression was very low, and there was no IL-17 stimulation (data not included). However, IL-17 was able to significantly stimulate mBD-3 message in primary mouse tracheal epithelial cells (Fig. 4). This result is consistent with a recent report demonstrating increased mBD-3 expression, but not mBD-4 expression in mouse cells after bacterial challenge (42, 43). This result provides further support that IL-17 has a significant effect on hBD-2/mBD-3 expression.

The effects of IL-17 on hBD-2 gene expression were dose dependent (Fig. 5). IL-17 concentrations as low as 1 ng/ml elicited significant stimulation of hBD-2 gene expression in primary TBE cells after 48 h of treatment. Peak stimulation occurred at 50 ng/ml dose, with no further increase at 100 ng/ml level. Importantly, IL-17 had no effects on hBD-1 and hBD-3 expressions at all the concentrations tested (1–100 ng/ml).

Time course studies revealed that the effect of IL-17 on hBD-2 gene expression was also time dependent (Fig. 6). A significant level of stimulation of hBD-2 message by IL-17 (20 ng/ml) was seen within 3 h, and a maximum stimulation was seen at 12 h. This maximal stimulation was maintained for the duration of this time course. Remarkably, up to 100-fold stimulation was seen at 48 h after treatment. IL-17 had no effects on hBD-1 and hBD-3 expression at any time point.

A competitive ELISA revealed that hBD-2 gene induction was associated with a significant increase in levels of hBD-2 peptide compared with control medium both after 24-h treatment with IL-17 in biphasic cultured primary human TBE cells and after 1 wk treatment with IL-17 in biphasic cultured HBE1 cells (Fig. 7,B). Secretion of hBD-2 peptide was significantly increased from epithelial cells exposed to IL-17 compared with those without IL-17 treatment. Although the dose study of mRNA production (Fig. 5) shows a significant induction starting from 10 ng/ml IL-17 in TBE cells, IL-17-induced protein release was not detected at lower doses (data not shown). However, a long-term 10 ng/ml IL-17 treatment in biphasic HBE1 cells shows a significant induction of the apical hBD-2 peptide release.

To further determine whether the observed effect of IL-17 on hBD-2 expression was due to a transcriptional activation, study of the effect of IL-17 on hBD-2 promoter activity was conducted in HBE1 cells using a transient transfection approach with hBD2-2210/Luc chimeric construct DNA. The HBE1 cell line was used simply because it is difficult to carry out gene transfer on primary TBE cells. We also grew HBE1 cells under four different culture conditions: 1) TC, 2) CG, 3) BI, or 4) BI-CG. As shown in Fig. 8, HBE1 cells grown under various culture conditions all responded to IL-17 (10 ng/ml) for elevated hBD-2 expression. These results support the notion that we can study hBD-2 gene expression on this cell line under various culture conditions, including the less differentiated TC condition.

To elucidate the promoter activity, HBE1 cells were plated on a TC dish, and transfection was conducted, as described in the text. As shown in Fig. 9, there was a dose-dependent increase in the relative hBD-2 promoter-based luciferase activity by IL-17. At 5 ng/ml level, IL-17 had a significant effect on the hBD-2 promoter activity, and this effect was maximized at 100 ng/ml level. These results were consistent with the mRNA data, further supporting a transcriptional mechanism of IL-17 in the regulation of hBD-2 expression.

To elucidate whether this stimulation goes through the IL-17R A, the neutralizing anti-IL-17R A-specific Ab was used. Various amounts of anti-IL-17R A-specific Ab were applied to primary TBE cells with or without IL-17. Fig. 10 shows a dose-dependent inhibition of IL-17-mediated hBD-2 expression by anti-IL-17R A Ab. At 1 μg/ml level, the inhibition of the IL-17 stimulation was 50%, while the inhibition reached 65% when the Ab was used at 5 μg/ml level. This result suggests the stimulation of hBD-2 expression by IL-17 is via the IL-17R A.

Because IL-17 has been shown to stimulate the secretion of several proinflammatory cytokines, such as IL-1α, 1β, 6, and 8, in a number of cell types, including the human TBE cells (44, 45, 46, 47), some of these secretions may serve as an autocrine/paracrine function, as the IL-6 did for IL-17-mediated mucin gene expression, as shown in our recent publication (36). To rule out this possibility, various neutralizing Abs were used. For IL-8, there was no stimulation of hBD-2 expression by this cytokine, which rules out the possible IL-8 autocrine/paracrine loop in IL-17-mediated stimulation. For IL-1α and IL-1β, IL-1R antagonist at various doses was unable to down-regulate IL-17 stimulation (Fig. 10). A similar negative result was obtained with anti-IL-6-neutralizing Ab (data not shown). These results support the notion that there was no autocrine/paracrine loop mechanism involved in IL-17-mediated hBD-2 expression.

To gain an insight into the possible IL-17-mediated signaling on the regulation of hBD-2 expression, various signaling pathway inhibitors were used. Among these inhibitors, we found JAK inhibitor I and several NF-κB-related inhibitors were the most potent ones to reverse the enhancement. As shown in Fig. 11,A, the reversal of IL-17-mediated hBD-2 expression by JAK inhibitor I was dose dependent. However, the JAK-2-specific inhibitor, AG490, did not diminish IL-17-induced hBD-2 expression (Fig. 11,A). On the contrary, there was a superinduction effect for AG490 at the dose normally reported to be sufficient for the inhibition of JAK-2 until a much higher pharmacological dose was used. Fig. 11,B shows that both helenalin, an inhibitor for the DNA-binding activity of NF-κB p65 subunit, and sulfasalazine, an inhibitor to block nuclear translocation of NF-κB, were very effective in abrogating IL-17-mediated hBD-2 expression. Fig. 11 C, in a preliminary fashion, shows no synergistic effect for the combined treatment of JAK inhibitor I with helenalin or sulfasalazine. These results support the notion that both JAK signaling and the activation of NF-κB are involved in IL-17-mediated hBD-2 expression.

This study describes a novel finding of IL-17 stimulation of hBD-2 expression in human airway epithelial cells. Among a panel of 21 cytokines selected for this study, IL-17 was the most potent stimulatory cytokine, inducing a 75-fold elevation of hBD-2 message. Other cytokines, such as IL-1α, 1β, 6, and TNF-α, also have stimulatory effects, but to a much lesser extent (5- to 20-fold). Inductions of hBD-2 by IL-1α, IL-1β, and TNF-α treatment are consistent with previous reports (17, 18, 41). hBD-2 is expressed in epithelia of many organs, including the airways of the lungs, where the message is found in both surface epithelia and the serous cells of the submucosal glands (17). The known function of hBD-2 in innate immunity is believed to be related to its antimicrobial activity and to its chemotactic effects on immature dendritic cells and memory T cells (48). IL-17, mainly secreted by activated T cells (26, 27), is prominently elevated in the airway lumen after microbial infections (47, 49) and has a proinflammatory role in mediating neutrophil migration (50) and the production of IL-6 and IL-8 (51, 52). IL-17R knockout mice have impaired clearance of microbial infections (49). Thus, the stimulatory effects of IL-17 on hBD-2 expression suggest an important role of IL-17 for either directing or amplifying the airway inflammatory response from innate response processes to adaptive response mechanisms (Fig. 12).

Consistent with this finding, we found that IL-17 can also stimulate MIP-3α expression based on microarray analysis (Fig. 1). IL-17’s stimulation of hBD-2 is quite selective because other hBDs do not seem affected by IL-17. Like hBD-2, MIP-3α has recently been shown to have potent antimicrobial activity (40) and the chemoattract activity for both dendritic and T cells through their CCR6 receptors (53). Although these two peptides have no sequence homology and they belong to two different gene families, they share many similarities in the properties of antimicrobial activities, chemotactic activities, binding to the CCR6 receptor, and now, regulation by IL-17. Although the significance of this finding remains unclarified, the similarities and the redundant activity of hBD-2 and MIP-3α suggest an important role for these molecules in airway innate immunity.

The present studies demonstrate the specificity of IL-17’s effects on hBD-2 and on the mouse homologue, mBD-3. Our data show an IL-17 time- and dose-dependent stimulation of hBD-2 expression in airway epithelial cells. A concentration of IL-17 as low as 1 ng/ml was able to significantly stimulate hBD-2 expression. Other variants of the IL-17 superfamily IL-17 B, C, D, E, and F (32, 33) failed to exhibit any stimulation of hBD-2. This finding was further buttressed by the fact that anti-IL-17R A-neutralizing Ab inhibited the stimulation.

IL-17 has been reported to induce the production of proinflammatory cytokines (47). For example, IL-17 up-regulated IL-1β expression and synthesis in a dose- and time-dependent fashion in human macrophages (35). IL-1β has also been reported to be a major activator of hBD-2 expression in A549 cells cultured with mononuclear phagocytes (24). Furthermore, IL-1α and IL-1β have both been reported to stimulate the expression of hBD-2 in various tissues (19, 54, 55). It is thus reasonable to hypothesize that the IL-17 effect on hBD-2 gene expression be mediated in an autocrine/paracrine manner via locally secreted IL-1. However, because the IL-1R antagonist did not block IL-17 stimulation of hBD-2 expression, it is unlikely that IL-1 could be involved in IL-17-stimulated hBD-2 expression in human airway epithelial cells. Although the present studies show that IL-6 can mildly induce hBD-2 and IL-17 can induce the release of IL-6, treatment of IL-17-treated cells with an anti-IL-6 Ab did not block hBD-2 gene expression. This suggests that the IL-17 effect was not mediated through IL-6. Taken together, hBD-2 gene expression appears to be modulated by IL-17 via a unique pathway that is independent of an IL-1 or IL-6 autocrine/paracrine loop. This IL-17-dependent mechanism could serve to amplify an acquired immune response against a pathogen by directing innate immune mechanisms (such as antimicrobial peptide or chemoattraction of inflammatory cells) toward sites of T lymphocyte activation.

We have earlier shown that IL-17 induced up-regulation of mucin gene MUC5B expression through an IL-6 autocrine/paracrine loop, and the JAK/STAT pathway (36). However, different JAK isotypes appear to be involved in their regulation of MUC5B and hBD-2. In the case of MUC5B, the stimulation by IL-17 was blocked by the JAK2 inhibitor, AG490. However, hBD-2 was not inhibited by this inhibitor, and its induction by IL-17 was actually accentuated by the AG490 treatment. How this induction is augmented by a JAK2 inhibitor is not entirely clear at this point. Although IL-17A has a low affinity with its receptor, various JAK isotypes, such as JAK-1, -2, -3, and Tyk-2, have been demonstrated to interact with IL-17R A on binding to its ligand in human U937 monocytic leukemia cells (56). Our previous and present results, showing the sensitivity of IL-17’s induction of MUC5B and hBD-2 to JAK inhibitors, support the notion that the IL-17R A in airway epithelial cells may interact with various JAK isotypes upon the ligand binding. The sensitivity of hBD-2 expression to a JAK inhibitor I, which is considered to be not a very specific JAK inhibitor, suggests the likely involvement of JAK-1, -2, -3, and/or Tyk-2 in the receptor-mediated signaling regulation (57).

Further promoter-reporter gene transfection studies in the immortalized normal human bronchial epithelial cell line HBE1 (39) were conducted to further elucidate the molecular nature of this regulation. This cell line behaves similarly to primary TBE cells in its response to IL-17 for inducing hBD-2 expression. We observed an IL-17-induced stimulation of the hBD-2 promoter activity in these transfected cells. This result supports an increased transcriptional activity as a mechanism for hBD-2 induction. We further demonstrated that inhibitors of NF-κB attenuate IL-17-induced hBD-2 expression. Because IL-17 has been shown to activate NF-κB in other cell types (58, 59, 60), these findings suggest this also occurs in airway epithelial cells and that hBD-2 is activated downstream to NF-κB activation. These results are consistent with other studies showing the importance of NF-κB in the regulation of hBD-2 expression by LPS and by other cytokines (24). Interestingly, in mouse airway epithelial cultures, we observed IL-17-stimulated mBD-3 expression, but not mBD-4. Both mBD-3 and mBD-4 are mouse homologues of hBD-2. However, the sequence analysis reveals the presence of a putative cis-binding site for NF-κB transcriptional factor in the mBD-3 gene, whereas no such putative site can be found in the 5′-flanking region of the mBD-4 gene. This result further strengthens the participation of NF-κB-mediated transcriptional mechanisms in IL-17-enhanced hBD-2 expression.

Taking these data together, we propose an IL-17R A-dependent JAK and NF-κB signaling pathway for the transcriptional induction of hBD-2 gene by IL-17 in airway epithelial cells. Because IL-17 is the most potent cytokine in the stimulation of hBD-2, and because IL-17 elevation has been associated with microbial infections of the airways (34), we propose that such a signaling mechanism may play a role in regulating the adaptive and innate immune responses in the airways (Fig. 12). We hypothesize that during the early stages of an airway bacterial infection, microbial products, such as LPS, bind to nonspecific receptors such as the TLR-4 on epithelial cells to stimulate a low level induction of hBD-2. This innate type of response gives limited protection from bacterial invasion through the antimicrobial and chemotactic activities of hBD-2 (61). Recently, Happel et al. (29) have demonstrated that the IL-17 production by CD4⁺ and CD8⁺ T cells in bacteria-infected mouse lung could be boosted by IL-23 through a TLR-4-dependent pathway. Regardless of the source of IL-17, it can be expected that when these acquired immune responses have had more time to develop, activated T cells arrive to the site of infection and locally release IL-17. A preliminary study has shown the presence of IL-17R A at the basal side of the polarized airway epithelia (data not shown). The locally secreted IL-17 can presumably augment the local airway antibacterial defense via its binding to the IL-17R via a JAK/NF-κB signaling pathway, thus further activating the induction of hBD-2 and/or other chemokines such as MIP-3α in neighboring epithelial cells.

To our knowledge, no studies have previously shown that IL-17 can induce hBD-2 gene expression in airway epithelial cells. Our results add to the growing body of evidence of the important role that cytokines play in regulating hBD-2 gene expression. We believe that the ability of IL-17 to induce hBD-2 gene expression could play an important role in the airway host defense against bacterial pathogens. Because IL-17 is notable for its ability to stimulate IL-6/IL-8 secretion and to regulate neutrophil migration, it would be intriguing to speculate whether it may play a role in inflammatory airway diseases characterized by neutrophil infiltration such as chronic obstructive pulmonary disease and cystic fibrosis (34).

In conclusion, the results from the present study indicate a novel role for IL-17 in directly stimulating hBD-2 gene expression in primary airway epithelial cells. We further demonstrated that IL-17 mediates its effect on hBD-2 mostly through JAK and NF-κB signaling events. Further investigations should address whether the involvement of other pathways, such as MAPK pathways, are also involved in IL-17-mediated hBD-2 gene expression. The present results widen the spectrum of known cytokines that can regulate defensin expression and offer preliminary evidence for a novel IL-17-related mechanism coordinating select innate and adaptive immune responses.

We thank Yu Hua Zhao for her suggestion on performing the competitive ELISA for hBD-2 and the superior cell culture work in providing primary human TBE cell cultures used in the study. We also acknowledge the support from the Microarray Core Lab at University of California Davis Cancer Center for performing the microarray analysis for this study. Drs. Suzette Smiley-Jewell and Carroll E. Cross are thanked for their editing of the manuscript.