Two fully human mAbs specific for epitopes dependent on intact carboxylate groups on the C6 carbon of the mannuronic acid components of Pseudomonas aeruginosa alginate were found to promote phagocytic killing of both mucoid and nonmucoid strains as well as protection against both types of strains in a mouse model of acute pneumonia. The specificity of the mAbs for alginate was determined by ELISA and killing assays. Some strains of P. aeruginosa did not make detectable alginate in vitro, but in vivo protection against lethal pneumonia was obtained and shown to be due to rapid induction of expression of alginate in the murine lung. No protection against strains genetically unable to make alginate was achieved. These mAbs have potential to be passive therapeutic reagents for all strains of P. aeruginosa and the results document that alginate is a target for the proper type of protective Ab even when expressed at low levels on phenotypically nonmucoid strains.

The over-production of the cell surface polysaccharide alginate (also called mucoid exopolysaccharide) (MEP)5 leading to phenotypically mucoid colonies of Pseudomonas aeruginosa is closely associated with isolates recovered from the respiratory tract of cystic fibrosis (CF) patients. Mucoid strains are also obtained from patients with chronic P. aeruginosa urinary tract infections (1). Clinical nonmucoid isolates are primarily obtained from the blood, respiratory or urinary tracts of immunocompromised hosts. Mucoid P. aeruginosa will infect over 80% of CF patients (2). P. aeruginosa infection in CF is initiated early in life (3, 4) but respiratory decline is clearly associated with the emergence of the alginate over-producing mucoid strains (5, 6). Despite a potent host immune response, the organism persists for years, is never cleared, and ultimately is responsible for the majority of the morbidity and early mortality seen in CF.

A small percentage of older (>12 years) CF patients escape chronic infection with P. aeruginosa by acquiring phagocyte-dependent killing Ab specific to the alginate Ag (7, 8). Although nonkilling and nonprotective alginate-specific Abs do develop in CF patients (7) and these Abs activate complement, there is little deposition of the C3 opsonins C3b and iC3b onto the alginate on the outer cell surface (9). In contrast, the alginate-specific Abs that mediate killing deposit high levels of these complement-derived opsonins (9), which are absolutely required for efficient phagocytosis and killing of mucoid P. aeruginosa (10).

Despite numerous attempts at active immunization of humans with alginate or alginate conjugate vaccines (11, 12, 13) it has been difficult to consistently elicit phagocyte-dependent killing and protective Abs in the majority of vaccinates, including healthy human plasma donors (14). This may reflect an essential property of the alginate Ag, wherein any protective epitopes are poorly immunogenic, allowing chronic infection to persist in the otherwise immunocompetent CF host. Thus, to provide alginate-specific immunity in individuals at risk for P. aeruginosa infection, it may be necessary to use passive immunotherapy with mAbs derived from a rare individual that can respond effectively to alginate with phagocyte-dependent killing or protective Ab.

To date, murine mAbs and polyclonal Abs to alginate that mediate killing of mucoid strains of P. aeruginosa and protect animals against infection are specific to epitopes formed by acetylation of the C2 and C3 hydroxyl groups of the mannuronic acid constituents of alginate (15, 16). We report on the generation and characterization of fully human mAbs to alginate that not only mediate killing and protect against infection with highly mucoid CF isolates of P. aeruginosa, but also can kill and protect against nonmucoid, low alginate-producing strains (17, 18) in a murine model of acute pneumonia (19). The nonmucoid strains included some isolated from the blood of bacteremic patients and the throats of CF patients during the initial stages of infection. The protective human mAbs are directed against epitopes formed by the carboxylic acid components of the alginate molecule, an antigenic specificity that is distinct from that previously characterized for mAbs and polyclonal antisera that have killing and protective activity for mucoid (15), but not nonmucoid strains (20).

PAO1 (sensitive to chloramphenicol) and PA14 were provided by Dr. M. Vasil (University of Colorado Health Sciences Center, Denver, CO) and Dr. F. Ausubel (Harvard Medical School, Boston, MA), respectively. Production of strain PAO1 expressing the ExoU cytotoxin was previously described (19). PAO1 and PA14 strains unable to produce alginate due to in-frame interruptions in the algD gene essential for alginate synthesis (ΔalgD strains) were provided by Dr. D. Ohman and Dr. S.-J. Suh (Virginia Commonwealth University, Richmond, VA) (21) and Dr. P. Yorgey (Harvard Medical School, Boston, MA) (22), respectively. Clinical isolates of mucoid P. aeruginosa from CF patients were obtained from microbiology laboratories around the United States. Clinical isolates of nonmucoid P. aeruginosa from CF patients early in the course of the disease were obtained from Children’s Hospital (Boston, MA) or provided by Dr. J. Burns (Children’s Hospital, Seattle, WA) (3). Clinical isolates from patients with P. aeruginosa bacteremia were provided by Dr. R. Ramphal (University of Florida, Gainesville, FL).

A single volunteer was immunized s.c. with 100 μg of a previously described preparation of purified alginate (or MEP) (13). Seven days later, PBMCs were isolated from 50 ml of blood using Ficoll Hypaque sedimentation and B cells stimulated by overnight exposure to EBV produced from the B95.8 cell line as described (23). After 24 h, the cells were washed and dispersed into 96-well plates at a concentration of 1 × 106 PBMC/well in 100 μl of growth media (RPMI 1640 supplemented with 20% FBS) containing 10% lymphocyte conditioned medium (LyCM, prepared from human PBMC stimulated for 48 h with PHA). After 5 days, an additional 100 μl of growth media supplemented with 10% LyCM was added. EBV stimulated cells were then fed weekly by removal of 100 μl of spent media and the addition of 100 μl of growth media supplemented with 10% LyCM. When the wells were densely seeded as evidenced by growth over 80% of the bottom of the well and the appearance of a pH change in the media indicative of cellular growth, the cultures were screened for production of specific Ab to P. aeruginosa alginate by ELISA as described below.

The cells from single individual wells giving a positive reaction for Ab were then dispersed into 48 wells of a tissue culture plate and after several days of growth the supernatants tested for reactivity with specific alginate Ag. Cultures that continued to test positive were then fused with a human-mouse myeloma cell line, HMMA 2.5, to generate hybridomas as previously described (24). After fusion, cells were cultured in microwell plates with growth medium (RPMI 1640 supplemented with 20% FBS and hypoxanthine-aminopterin-thymidine and oubain) for selection of fused cells. These cultures were fed at weekly intervals and screened by ELISA for Ab production. Hybridomas were cloned at a density of 1 cell/well, wells with positive growth screened by ELISA for specific Ab and wells containing positive Ab-producing hybridomas expanded into wells in tissue culture plates of increasing volume then flasks of increasing volume to obtain cloned cell lines. Three hybridomas, designated F428, F429, and F431, producing human IgA Abs with λL chains that were positive for binding to alginate were chosen for further study.

H chain and L chain variable region genes were cloned from the three IgA-producing hybridomas using PCR. mRNA was isolated from the hybridomas, reverse transcribed to cDNA and then PCR amplification conducted as described (25) using forward primers for six conserved leader sequences of the 5′ end of the human IGHV genes (Table I) along with a single 3′ reverse primer complementary to the beginning of the 5′ end of the IGHA gene (Table I). Similarly, PCR amplification of the IGLV gene was accomplished using seven forward primers for the 5′ end of conserved leader sequences for the human IGLV genes along with a single 3′ reverse primer complementary to the 5′ end of the human IGLC gene (Table I). The primers were designed to incorporate restriction sites for insertion into the TCAE 6.2 vector (26) as we have previously described for insertion of PCR products into the closely related TCAE 5.3 vector (25). PCR products were cloned into the pCR2.1 vector, transformed into Escherichia coli as described (25) and plasmids isolated from three to five clones of each PCR product, which were then analyzed by restriction enzyme analysis to indicate that a particular clone had inserted DNA of the expected size. Three to five clones of each IGHV-D-J and IGLV-J gene were then chosen for sequence analysis. Results indicated the cloning of two distinct IGHV-D-J and two distinct IGLV-J genes from hybridomas F428, F429, and F431. One of the clones from the group giving 3 of 3 or 4 of 5 identical sequences for each IGHV-D-J and IGLV-J product was used to insert into the TCAE 6.2 vector for production of four recombinant human IgG1 Abs, representing all four combinations of the two IGHV-D-J and two IGLV-J genes. These included the original three combinations of IGHV-D-J and IGLV-J in hybridomas F428, F429, and F431 and the fourth possible combination in a clone designated Fcomb.

Table I.

Sequences of primers used to clone variable regions of mAbs to P. aeruginosa alginate

H chain V region, 5′ forward primers
VH1LDRHU CCATGGACTGGACCTGGA 
VH2LDRHU ATGGACATACTTTGTTCCAC 
VH3LDRHU CCATGGAGYYKGGGCTGAGC 
VH4LDRHU ATGAACAYCTGTGGTTCTT 
VH5LDRHU ATGGGGTCAACCGCCATCCT 
VH6LDRHU ATGTCTGTCTCCTTCCTCAT 
H chain N terminus of IgA constant region, 3′ reverse primer CAGCGGGAAGACCTTGG 
λ L chain V region, 5′ forward primers 
λ sigma1 AGATCTCTCACCATGGCCRGCTTCCCTCTCCTC 
λ sigma2 AGATCTCTCACCATGACCTGCTTCCCTCTCCTC 
λ sigma3 AGATCTCTCACCATGGCCTGGGCTCTGCT 
λ sigma4 AGATCTCTCACCATGACTTGGATCCCTCTCTTC 
λ sigma5 AGATCTCTCACCATGGCATGGATCCCTCTCTTC 
λ sigma6 AGATCTCTCACCATGGCCTGGACCCCTCTCTGG 
λ sigma7 AGATCTCTCACCATGGCCTGGATGATGCTTCTC 
L chain, N terminus of λ-chain constant region, 3′ reverse primer GGAGGGCGGGAACAGAGTGAC 
H chain V region, 5′ forward primers
VH1LDRHU CCATGGACTGGACCTGGA 
VH2LDRHU ATGGACATACTTTGTTCCAC 
VH3LDRHU CCATGGAGYYKGGGCTGAGC 
VH4LDRHU ATGAACAYCTGTGGTTCTT 
VH5LDRHU ATGGGGTCAACCGCCATCCT 
VH6LDRHU ATGTCTGTCTCCTTCCTCAT 
H chain N terminus of IgA constant region, 3′ reverse primer CAGCGGGAAGACCTTGG 
λ L chain V region, 5′ forward primers 
λ sigma1 AGATCTCTCACCATGGCCRGCTTCCCTCTCCTC 
λ sigma2 AGATCTCTCACCATGACCTGCTTCCCTCTCCTC 
λ sigma3 AGATCTCTCACCATGGCCTGGGCTCTGCT 
λ sigma4 AGATCTCTCACCATGACTTGGATCCCTCTCTTC 
λ sigma5 AGATCTCTCACCATGGCATGGATCCCTCTCTTC 
λ sigma6 AGATCTCTCACCATGGCCTGGACCCCTCTCTGG 
λ sigma7 AGATCTCTCACCATGGCCTGGATGATGCTTCTC 
L chain, N terminus of λ-chain constant region, 3′ reverse primer GGAGGGCGGGAACAGAGTGAC 

Analysis of the germline gene usage of the cloned IGHV, IGHD, IGHJ, IGLV, and IGLJ genes was conducted using IMGT/V QUEST (http://imgt.cines.fr:8104/cgibin/IMGTdnap.jv?livret=0&Option=humanIg).

Vector TCAE 6.2 is similar to the previously described vector TCAE 5.3 (26) except TCAE 6.2 contains the genomic sequence of the human IGLC constant region in place of the human IGKC constant region. Plasmids containing the two entire IGHV-D-J sequences were digested with NheI and Mlu, the desired fragment isolated by gel electrophoresis and ligated into TCAE 6.2 digested with the same restriction enzymes for in-frame insertion 5′ to the human IGHG1 constant region gene. After electroporation into E. coli, plasmids were recovered and the inserted DNA checked by sequence analysis of a PCR product to insure the proper DNA sequences was contained in the vector. Next, plasmids containing the two entire IGLV-J clones were digested with BsiWI and DraIII, the desired DNA fragments recovered by gel electrophoresis and ligated into similarly digested TCAE 6.2 plasmids to yield a gene in-frame with the human IGLC constant region gene that already contained one of the two IGHV-D-J genes obtained from the original three hybridomas. The constructed plasmids were electroporated into E. coli, recombinant plasmids isolated and again the inserted DNA was checked by sequence analysis for verification that the desired IGLV-J DNA sequences had been properly introduced.

The four constructed plasmids were transfected into the DG44 line of Chinese hamster ovary cells using DNA-liposome mediated transfection as described (25). DG44 lacks both chromosomal copies of the dihydrofolate reductase (dhfr) gene whereas vector TCAE 6.2 contains this gene, allowing for selection and amplification of cells containing transfected DNA in the presence of methotrexate, which is detoxified by the dhfr gene. Cells were initially grown in F12 medium with 10% FBS and 400 μg of G418 per milliliter and clones established by limiting dilution plating in 96-well tissue culture plates. Wells with clonal growth were checked for the production of the recombinant IgG1 Ab as described (25), using ELISA plates coated with anti-human IgG as a capture Ab, supernatants from DG44 clones, and detection with an anti-human IGLC-specific secondary Ab. The clones positive for the greatest reactivity of the recombinant Ab were then screened for binding to alginate isolated from P. aeruginosa mucoid strain 2192 as described (20). Selected clones producing high-levels of Ag-specific Ab were grown up in progressively larger volumes. Once stable Ab-producing clones were established, the cells were grown in progressively decreasing concentrations of FBS until they were replicating well in serum-free medium.

To amplify the dhfr and associated genes for Ab production, clones were replated in 96-well tissue culture plates in the presence of 5 nM methotrexate. Cultures were scaled up into T75 flasks, supernatants screened for Ab production, and further amplification of dhfr and Ig sequences conducted by increasing the concentration of methotrexate to 50 nM, then to 500 nM in serum-free F12 medium. Recombinant Ab was isolated from bulk cultures grown either in tissue culture flasks or a 2-liter spinner flask contained in a 5% CO2 incubator by running the clarified (by centrifugation) cell-free supernatants directly onto a protein G column and eluting the bound Ab with 0.1 M glycine buffer, pH 2.7.

Exchange of the IGHG1 gene in the recombinant plasmid containing the combination of IGHV-D-J and IGLV-J genes originally found in hybridoma F429 for H chain constant region genes IGHG2, IGHG3, or IGHG4, was conducted as previously described (25). Transfection of DG44 cells with these constructs was also as previously described and summarized (25), as was production of recombinant IgG2, IgG3, and IgG4 Ab.

ELISA, using purified or reduced P. aeruginosa alginate or polymannuronic acid as coating Ags and all subsequent steps, were conducted as previously described (18, 20). Similarly, phagocyte-dependent killing assays were conducted as described (11, 20) using the recombinant mAbs as Ab sources and infant rabbit serum as a complement source. Although statistically significant (p < 0.05) killing at a level of a 20–40% reduction in surviving cfu can be obtained, reductions of <40% are not considered of biologic significance as they are not associated with protective efficacy, so all determinations of a significant killing activity were based on killing >40% of P. aeruginosa cells and a statistical analysis using a t test comparing tubes with human mAb to alginate with tubes containing a control IgG1 myeloma (Sigma-Aldrich, St. Louis, MO).

Mice were either 6- to 8-wk-old C3H/HeN or C57/Bl6 females. To deliver high quantities of the recombinant human mAbs to the murine lung, mice were anesthetized by i.p. injection of ketamine (20–30 mg/kg) and xylazine (5 mg/kg) and 10–50 μl of a 1 mg/ml concentration of either the IgG1 mAb to alginate or a control human IgG1 myeloma (Sigma-Aldrich) mAb placed on the nares until 10–50 μg of Ab were instilled. This dose was initially given as a single bolus 4 h before infection. In subsequent experiments, 50 μg was delivered at 48, 24, or 4 h before infection in various combinations to deliver total doses of 50–150 μg of recombinant or control mAb per mouse. Intranasal infection of anesthetized mice to produce an acute pneumonia using lethal concentrations of different P. aeruginosa strains contained in 20 μl was as described (19, 27). Mice were followed until moribund, when they were sacrificed, or dead, and all such outcomes were counted as lethal events.

As most mucoid isolates of P. aeruginosa do not cause a lethal lung infection except at very high inocula, a clearance model was used to evaluate the recombinant human mAb for in vivo activity against these strains. Intranasal delivery of 100 μg of recombinant or control IgG1 mAb in two 50-μg doses at 24 and 4 h before infection was as described above. Intranasal infection with the mucoid strains was also as described. Infected mice were sacrificed at 2, 4, or 24 h postinfection, both lungs removed, weighed, homogenized and the homogenate diluted and plated for determinations of cfu/gm lung tissue as described (19, 27).

Values for p indicating the significance of the differences in survival in the acute pneumonia model were calculated using Fisher’s exact test. Values for p for the differences in cfu/gm lung tissue in the pulmonary clearance model were determined by a t test.

We initially obtained three IgA secreting hybridomas designated F428, F429, and F431 that bound to purified alginate in an ELISA. The complete H chain and L chain Ab V regions were cloned and sequenced from cDNA prepared from mRNA being produced by these three hybridomas. Analysis of the nucleotide and amino acid sequences indicated that clones F428 and F429 contained the same H chain V region but different L chain V region, whereas clone F431 had a distinct H chain V region but shared the L chain V region of clone F428 (GenBank accession numbers: AY62666, IGLV-J of mAbs F428 and F431; AY626662, IGLV-J of mAb F429; AY626663, IGHV-D-J of mAbs F428 and F429; and AY626664, IGHV-D-J of mAb F431). The germline IGHV, IGHD, IGHJ, IGLV, and IGLJ genes used to produce these two different H and L chains were determined by sequence alignment analysis (Table II). The cloned V regions were then inserted in the TCAE 6.2 vector to produce four different human IgG1 Ab clones, representing the three original clones and a fourth clone, designated Fcomb, which expressed the H chain V region of mAb F431 and L chain V region of mAb F429.

Table II.

Germline gene usage of three IgA hybridomas secreting mAbs to P. aeruginosa alginate

HybridomaGermline Genes in V Regiona
H or L chainVariableDiversityJoining
F428H IGHV4–39 IGHD3–10 IGHJ4 
F428L IGLV1–51  IGLJ1 
F429H IGHV4–39 IGHD3–10 IGHJ4 
F429L IGLV1–51  IGLJ3 
F431H IGHV4–39 IGHD6–25 IGHJ5 
F431L IGLV1–51  IGLJ1 
HybridomaGermline Genes in V Regiona
H or L chainVariableDiversityJoining
F428H IGHV4–39 IGHD3–10 IGHJ4 
F428L IGLV1–51  IGLJ1 
F429H IGHV4–39 IGHD3–10 IGHJ4 
F429L IGLV1–51  IGLJ3 
F431H IGHV4–39 IGHD6–25 IGHJ5 
F431L IGLV1–51  IGLJ1 
a

Assignment obtained from http://imgt.cines.fr:8104/cgibin/IMGTdnap.jv?livret=0&Option=humanIg.

All four of the purified human IgG1 mAbs had comparable binding to alginate isolated from a single mucoid strain (2192) of P. aeruginosa (data not shown). However, after further analysis it was found that specific IGHV and IGLV regions in mAb F429 had broader overall Ag-binding activity when this particular mAb was screened using alginate isolated from eight different mucoid strains (Fig. 1 A).

FIGURE 1.

Antigenic binding properties of human mAbs to P. aeruginosa alginate and related Ags. A, Binding of mAb F429γ1 to alginate from eight different mucoid strains (number next to symbol for binding curve) of P. aeruginosa. B, Binding of mAb F429γ1 and control IgG1 myeloma to alginate from P. aeruginosa strain 2192, polymannuronic acid and polymannuronic acid acetylated on the hydroxyl groups. C, Binding of mAb F429γ1 to intact and carbodiimide reduced P. aeruginosa alginate or polymannuronic acid. D, Comparative binding of four human mAbs to intact and reduced polymannuronic acid (indicated by form of Ag).

FIGURE 1.

Antigenic binding properties of human mAbs to P. aeruginosa alginate and related Ags. A, Binding of mAb F429γ1 to alginate from eight different mucoid strains (number next to symbol for binding curve) of P. aeruginosa. B, Binding of mAb F429γ1 and control IgG1 myeloma to alginate from P. aeruginosa strain 2192, polymannuronic acid and polymannuronic acid acetylated on the hydroxyl groups. C, Binding of mAb F429γ1 to intact and carbodiimide reduced P. aeruginosa alginate or polymannuronic acid. D, Comparative binding of four human mAbs to intact and reduced polymannuronic acid (indicated by form of Ag).

Close modal

Analysis of the epitopic specificity of mAb F429 as an IgG1 Ab showed no difference in mAb binding to native or deacetylated alginate from P. aeruginosa strain 2192 (data not shown), a finding distinct from prior results with polyclonal Ab raised to an alginate-KLH conjugate vaccine (20). To determine whether the epitopic specificity for this mAb was directed to the blocks of polymannuronic acid present in alginate (28) we used purified polymannuronic acid in an ELISA and found strong binding of mAb F429 to this Ag, which was not further increased by introduction of acetate groups (Fig. 1,B). A control human IgG1 myeloma did not bind to any of the tested Ags. To determine whether the carboxyl groups on the C6 carbon forming the uronic acid moiety were involved in mAb binding, both native alginate from P. aeruginosa and polymannuronic acid were treated with water soluble carbodiimide to reduce the carboxyl groups, and this resulted in decreased binding of mAb F429 to both Ags (Fig. 1,C). When the other three mAbs were tested with intact and reduced polymannuronic acid, mAb F428, which shares the H chain with mAb F429, had the same pattern of reactivity whereas mAbs F431 and Fcomb did not bind well to either intact or reduced polymannuronic acid (Fig. 1 D). Thus, mAbs F428 and F429 showed antigenic specificity for an epitope involving intact carboxyl groups on the C6 carbon within the blocks of mannuronic acids found in P. aeruginosa alginate.

All four of the mAbs showed good phagocytic killing against a panel of mucoid strains (data not shown) but mAb F429γ1 had the best overall activity (Fig. 2,A) and mAb F428γ1 had comparable activity (data not shown). Lower concentrations of mAb F429γ1 than those shown in Fig. 2 had appropriately diminished killing activity (data not shown). Surprisingly, when tested against a panel of nonmucoid strains isolated from CF patients early in the course of infection, there was excellent killing of these strains by mAb F429γ1 (Fig. 2 A). mAbs F431 and Fcomb, which bound poorly to polymannuronic acid, were essentially unable to kill nonmucoid P. aeruginosa strains (data not shown). When mAb F429 was tested against P. aeruginosa strains PA14 and PAO1, known to express low levels of alginate in vitro (29), there was very little phagocytic killing.

FIGURE 2.

Phagocyte-dependent killing activity of mAb F429 against P. aeruginosa strains. A, Killing at a mAb concentration of 4–25 μg/ml for four mucoid clinical isolates from CF patients, five nonmucoid clinical isolates from CF patients, and two laboratory strains, PA14 and PAO1. B, Killing at the indicated mAb concentration of four isolates of P. aeruginosa from the blood. C, Killing of mucoid strain 324 by mAb F429 of four different human IgG isotypes. Bars represent means of quadruplicate determinations and error bars, where shown, represent SEM. When error bars are not shown, SEM was <5%. Killing >40% statistically significant at p < 0.05, biologically significant protection as defined by a correlation with protective immunity generally seen in sera manifesting killing >40%.

FIGURE 2.

Phagocyte-dependent killing activity of mAb F429 against P. aeruginosa strains. A, Killing at a mAb concentration of 4–25 μg/ml for four mucoid clinical isolates from CF patients, five nonmucoid clinical isolates from CF patients, and two laboratory strains, PA14 and PAO1. B, Killing at the indicated mAb concentration of four isolates of P. aeruginosa from the blood. C, Killing of mucoid strain 324 by mAb F429 of four different human IgG isotypes. Bars represent means of quadruplicate determinations and error bars, where shown, represent SEM. When error bars are not shown, SEM was <5%. Killing >40% statistically significant at p < 0.05, biologically significant protection as defined by a correlation with protective immunity generally seen in sera manifesting killing >40%.

Close modal

To determine whether nonmucoid clinical isolates of P. aeruginosa from another tissue were similarly susceptible to killing by mAb F429γ1, we tested four P. aeruginosa isolates from blood. All were killed at a high level by mAb F429γ1 (Fig. 2 B).

The IGHG1 gene for mAb F429γ1 was changed to IGHG2, IGHG3, and IGHG4 to produce human IgG2, IgG3, and IgG4 mAbs with the same IGHV-D-J and IGLV-J genes. Determination of the binding of the mAbs of these four isotypes to P. aeruginosa alginate by ELISA using an IGLC-specific secondary Ab showed essentially identical binding of all four mAbs, indicating no effect of the Fc component of the IGHC region on Ag binding. When the mAbs were evaluated for killing of mucoid P. aeruginosa strain 324, IgG1 and IgG3 mAbs mediated the best killing, whereas the IgG2 mAb had less activity and the IgG4 mAb was virtually without killing activity (Fig. 2 C). As phagocyte-dependent killing of P. aeruginosa by Ab to alginate is completely complement dependent (10), the differences in phagocytic killing likely relate to the complement-activating properties of the mAbs of the different IgG isotypes.

As mAb F429 mediated killing of nonmucoid, LPS smooth isolates of P. aeruginosa that are virulent in an acute lung infection model (19) we first evaluated whether the mAb was also protective against in vivo infection. Preliminary studies showed that to achieve sufficient levels of the mAb within the lung early in infection it had to be delivered intranasally, whereas i.p. delivery of 50 μg of the mAbs did not result in sufficient levels in the infected lungs within 3 h of bacterial inoculation to exert an appreciable decline in microbial numbers (data not shown). We thus evaluated the protective efficacy of a single dose of mAb F429γ1 against challenge with strain N13, an early nonmucoid clinical isolate from a CF patient. As shown in Table III, doses of 100 and 50 μg/mouse given 4 h before infection provided complete protection against infection when compared with mice given an irrelevant human IgG1 myeloma. High-level protection was also achieved with mAb F428γ1, which shares the same H chain and antigenic specificity for intact but not reduced polymannuronic acid with mAb F429γ1. Doses of 25 μg of mAb F429γ1/mouse (Table III) or less (data not shown) were without efficacy. mAbs (100 μg) F431 and Fcomb delivered intranasally, which do not bind well to the polymannuronic acid Ag, were not protective.

Table III.

Protection against lethal pneumonia in mice by mAbs to P. aeruginosa alginate

Challenge Dose (CFU/Mouse) Mouse StrainChallenge Strain of P. aeruginosa (Source)mAb GivenmAb Dose (μg) Per MouseSurvivors/Total: ControlsaSurvivors/Total:mAbp Valueb
5 × 107 N13 (CF) F429γ1 100 0/6 6/6 0.001 
C3H/HeN   50 0/6 6/6 0.001 
   25 0/6 0/6 NSc 
  F428γ1 100 0/10 8/10 <0.0001 
  F431γ1 100 0/6 0/6 NS 
  Fcombγ1 100 0/6 0/6 NS 
2 × 108 PAO1 (Lab) F429γ1 150 0/6 4/6 0.03 
C3H/HeN PAO1Δalg  0/6 0/6 NS 
2 × 107 PAO1 (Lab) F429γ1 100 0/5 5/5 0.004 
C57BL/6 PAO1Δalg  0/6 0/6 NS 
3 × 108 PA14 (Burn) F429γ1 100 0/6 5/5 0.002 
4 × 107 C3H/HeN PA14Δalg  0/6 0/6 NS 
2 × 107 C3H/HeN PAO1 ExoU+ (Lab) F429γ1 100 0/5 6/6 0.002 
4 × 107 C3H/HeN N6 (CF) F429γ1 100 0/6 6/6 0.001 
6 × 107 C3H/HeN B312 (Blood) F429γ1 150 0/6 6/6 0.001 
6 × 107 C57BL/6 1B1874-2 (Blood) F429γ1 100 0/6 6/6 0.001 
Challenge Dose (CFU/Mouse) Mouse StrainChallenge Strain of P. aeruginosa (Source)mAb GivenmAb Dose (μg) Per MouseSurvivors/Total: ControlsaSurvivors/Total:mAbp Valueb
5 × 107 N13 (CF) F429γ1 100 0/6 6/6 0.001 
C3H/HeN   50 0/6 6/6 0.001 
   25 0/6 0/6 NSc 
  F428γ1 100 0/10 8/10 <0.0001 
  F431γ1 100 0/6 0/6 NS 
  Fcombγ1 100 0/6 0/6 NS 
2 × 108 PAO1 (Lab) F429γ1 150 0/6 4/6 0.03 
C3H/HeN PAO1Δalg  0/6 0/6 NS 
2 × 107 PAO1 (Lab) F429γ1 100 0/5 5/5 0.004 
C57BL/6 PAO1Δalg  0/6 0/6 NS 
3 × 108 PA14 (Burn) F429γ1 100 0/6 5/5 0.002 
4 × 107 C3H/HeN PA14Δalg  0/6 0/6 NS 
2 × 107 C3H/HeN PAO1 ExoU+ (Lab) F429γ1 100 0/5 6/6 0.002 
4 × 107 C3H/HeN N6 (CF) F429γ1 100 0/6 6/6 0.001 
6 × 107 C3H/HeN B312 (Blood) F429γ1 150 0/6 6/6 0.001 
6 × 107 C57BL/6 1B1874-2 (Blood) F429γ1 100 0/6 6/6 0.001 
a

Controls given an equal amount of a human IgG1 myeloma.

b

p Value determined by Fisher’s exact test.

c

NS, not significant (p > 0.05).

The poor killing of two P. aeruginosa strains, PAO1 and PA14, suggested mAb F429γ1 would not be protective against challenge with these two strains, but, in fact, there was significant protection against lethal pneumonia due to both strains (Table III). Strain PAO1 is not very virulent in C3H/HeN mice, so the protection study was repeated in C57BL/6 mice, which are more susceptible to acute P. aeruginosa pneumonia, requiring a lower dose for full lethality in controls. Complete protection against challenge of C57BL/6 mice with a lethal dose of PAO1 was achieved by 100 μg of mAb F429γ1.

The specificity of the mAb for alginate was shown by testing its protective efficacy against strains PAO1ΔalgD and PA14ΔalgD, which cannot produce alginate. No protection was seen with these strains (Table III), which were tested in the same experiment with the parental strains for which full protection was achieved.

Evaluation of in vivo alginate expression in the lungs of mice immediately after inoculation of strain PAO1 showed no detectable alginate (Fig. 3) (20). However, by 1 h postinfection P. aeruginosa bacteria strongly expressing alginate in vivo were readily observed in lung sections reacted with alginate-specific Abs (Fig. 3). A similar finding of alginate expression 24-h postinfection in the lungs of mice infected with strain PAO1 embedded in agar beads has been found.6 Thus, within 1 h of inoculation, P. aeruginosa alginate appears to be rapidly produced by strain PAO1, and this likely accounts for the in vivo protective efficacy of mAb F429γ1 against this strain, and possibly against strain PA14.

FIGURE 3.

Elaboration of alginate in vivo by P. aeruginosa. Lung tissues from mice infected intranasally with P. aeruginosa strain PAO1, which does not elaborate alginate in vitro, were stained for production of alginate as visualized by immunofluorescence. A, Phase-contrast micrograph representative of images from lungs taken immediately after infection. No fluorescence indicative of alginate elaboration was seen. B–D, Detection of alginate expression in vivo by P. aeruginosa PAO1 1 h postinfection using: mAb F429 (B) or polyclonal Abs to an alginate-KLH conjugate (C and D). A–C, Image magnification was ×400. D, Image magnification was ×1000.

FIGURE 3.

Elaboration of alginate in vivo by P. aeruginosa. Lung tissues from mice infected intranasally with P. aeruginosa strain PAO1, which does not elaborate alginate in vitro, were stained for production of alginate as visualized by immunofluorescence. A, Phase-contrast micrograph representative of images from lungs taken immediately after infection. No fluorescence indicative of alginate elaboration was seen. B–D, Detection of alginate expression in vivo by P. aeruginosa PAO1 1 h postinfection using: mAb F429 (B) or polyclonal Abs to an alginate-KLH conjugate (C and D). A–C, Image magnification was ×400. D, Image magnification was ×1000.

Close modal

Testing the protective efficacy of mAb F429γ1 against four additional nonmucoid P. aeruginosa strains confirmed that this mAb could provide complete protection against lethal doses of nonmucoid strains (Table III), including strain PAO1 ExoU+, a recombinant strain expressing the ExoU cytotoxin that increases the disease morbidity and mortality of P. aeruginosa in both animals (19) and humans (30, 31).

Most mucoid P. aeruginosa strains do not cause lethal infections in mice except at very high doses, due to the fact they are LPS rough strains with virtually no ability to disseminate systemically. Additionally, other models of mucoid P. aeruginosa infection such as embedding the organisms in agar or alginate beads are limited due to the poor ability of most mucoid strains to establish infections in mice. To show that mAb F429 recognized an epitope expressed in vivo by different mucoid strains of P. aeruginosa, we chose to evaluate the ability of this mAb to promote clearance from the lungs of mice of three different clinical isolates of mucoid P. aeruginosa. Mice given 100 μg of mAb F429γ1 intranasally in two 50-μg doses 24 and 4 h before intranasal infection had significantly enhanced clearance of mucoid strain FRD1 after 2, 4, and 18 h of infection compared with mice given a control IgG1 myeloma (Fig. 4). Similarly, at 4 h postinfection, mAb F429γ1 significantly enhanced clearance of mucoid strains 2192 and 8050 (Fig. 4). Thus, the epitope recognized on alginate by mAb F429 was available on mucoid strains in the lungs of mice for effective targeting for immune elimination.

FIGURE 4.

Promotion of clearance of mucoid P. aeruginosa strains from lungs of infected mice by mAb F429γ1. Top, Clearance of strain FRD-1 at 2, 4, and 18 h postinfection. Bottom, Clearance of strains 8050 and 2192 at 4 h postinfection. Numbers with percentage sign (%) representing results with mAb F429γ1 (□) indicate percentage reduction in CFU compared with control IgG1. Values for p determined by unpaired, two-sided t test.

FIGURE 4.

Promotion of clearance of mucoid P. aeruginosa strains from lungs of infected mice by mAb F429γ1. Top, Clearance of strain FRD-1 at 2, 4, and 18 h postinfection. Bottom, Clearance of strains 8050 and 2192 at 4 h postinfection. Numbers with percentage sign (%) representing results with mAb F429γ1 (□) indicate percentage reduction in CFU compared with control IgG1. Values for p determined by unpaired, two-sided t test.

Close modal

Modern molecular genetic techniques are now sufficiently developed to produce high levels of fully human mAbs for evaluation of important immunologic functions. One area of application of this technology is production of protective human mAbs to microbial Ags that do not readily elicit protective Ab. Examples include polysaccharides that are often poorly immunogenic in target populations such as young children (32), proteins that have immunodominant epitopes that are not targets for protective Ab such as occurs in response to HIV infection (33), or Ags that induce a nonprotective Ab isotype such as IgAs that block binding and complement activation by protective IgG (34). In the case of P. aeruginosa, the alginate Ag produced by virtually all strains induces natural Ab in most humans (7), as well as high titers of Ab in chronically infected CF patients (7), but these Abs fail to promote phagocyte-dependent bacterial killing or provide protection against infection. In addition, immunization of humans with purified alginate failed to induce killing Ab in most vaccinated adults (14). By taking advantage of molecular techniques we have shown here that nonprotective IgA Abs made in response to immunization of a human volunteer with alginate could be engineered into IgG Abs that mediated killing of both mucoid and nonmucoid P. aeruginosa strains and protected against lung infections with these strains.

Passive therapy of P. aeruginosa infections with an appropriate mAb holds great promise for prophylactic or even therapeutic interventions in patients at risk for or having acquired infection. These include CF patients early in life before serious infection has set in (35, 36), patients undergoing chemotherapy that increases the risk for P. aeruginosa infection (37, 38), burn patients (39), and patients on respirators where P. aeruginosa ventilator-associated pneumonia remains a major problem (31, 40). Although we found topical delivery of mAb F429γ1 to the lungs of mice was needed for maximal efficacy in protecting against lethal infection with nonmucoid P. aeruginosa strains or promoting clearance of mucoid P. aeruginosa strains, it is still likely that systemic delivery of this or similar mAbs to humans would be efficacious. Bacterial challenge doses in the murine models are high to induce a significant pathologic effect, whereas actual infecting doses in humans are likely much lower and thus more amenable to control with the lower amounts of systemically delivered mAbs derived from the circulation. The humanized mAb palivizumab that is used clinically for prophylaxis against respiratory syncytial virus infection is given at a dose of 15 mg/kg (41), which translates into a dose of ∼375–450 μg of mAb to a 25–30 g mouse. Similarly, a fully human Ab to the severe acute respiratory distress syndrome coronavirus was used at a dose of 10 mg/kg to protect ferrets against infection (42). Thus, our use of 50–150 μg delivered topically to the lung of a 30 g mouse is within the range of mAb doses used in either human clinical medicine or to evaluate human mAbs in animal models of infection.

Several P. aeruginosa-specific hyperimmune i.v. IgG (IVIg) passive therapeutic reagents have been tried in various patient populations over the years. Efficacy against burn wound infection using immune globulin from patients immunized with a cellular extract of P. aeruginosa showed protective efficacy in the early 1980s (43, 44) but this product was not further pursued. A hyperimmune IVIg product prepared from plasma donors immunized with an octavalent P. aeruginosa LPS O-side chain conjugate vaccine (45, 46) showed no protective efficacy in patients in intensive care units (47). This may have been due to low Ab coverage for a sufficient diversity of serologically distinct O-Ags, or possibly to an overall low infection rate precluding an adequate sample size for documentation of the IVIg efficacy. Many immune animal sera and mouse and human mAbs have shown protection in animal models of infection, with Abs having specificity for LPS-O side chains and flagella showing the most activity (48, 49, 50, 51, 52, 53). However, no passive therapy product for P. aeruginosa infection has yet shown efficacy in a full clinical trial.

The results showing that a fully human mAb to P. aeruginosa alginate mediates phagocyte-dependent killing and is protective against both nonmucoid and mucoid strains of P. aeruginosa was unexpected. Although many nonmucoid strains have been shown to produce low levels of alginate in vitro (17, 18), others do not (29) and it was never clear whether the level of alginate expression by nonmucoid strains was sufficient for it to serve as a target for killing and protective Ab. Prior results with polyclonal rabbit Abs to alginate conjugate vaccines indicated nonmucoid strains were poorly killed by such Abs (20). Similarly, we found strains PAO1 and PA14, which produce little to no detectable alginate in vitro, were poorly killed by mAb F429, but nonetheless we could protect against infection with these isolates in the murine acute pneumonia model. This was shown to be due to an increase by 1 h postinfection in alginate expression in vivo by strain PAO1, and presumably the same explanation is operative with strain PA14. Specificity of mAb F429 for alginate was shown by its inability to protect against infection with algD deleted strains of PAO1 and PA14. For the other nonmucoid clinical isolates, sufficient alginate was expressed in vitro for killing by mAb F429 to proceed, and protection against acute pneumonia was achieved. Thus, mAb F429 appears to have high potential utility for protecting against nonmucoid strains typical of nosocomial isolates of P. aeruginosa.

Mucoid strains also expressed the binding epitope of mAb F429 in a proper conformation and density for the Ab to mediate killing of these strains and promote their clearance from mouse lungs. Previously characterized polyclonal antisera raised to purified alginate, alginate conjugates or murine mAbs to alginate appeared to recognize epitopes formed by O-acetyl substituents on the C2 and C3 hydroxyl groups of the mannuronic acid residues (11, 15, 20, 54). However, the protective mAb F429 did not have this antigenic specificity, binding equally well to acetylated and deacetylated alginate. Further investigations showed the mAb bound to blocks of mannuronic acid regardless of the presence of O-acetate substituents, but dependent on an intact carboxyl group on C6 that forms the uronic acid moiety. This specificity may be critical for the killing and protective activity of mAbs F428 and F429 against nonmucoid strains, as these strains are not opsonized by polyclonal antisera raised to an alginate conjugate vaccine in which epitopic specificity is toward acetylated alginate (20).

The apparent broad protective efficacy of mAb F429 against both mucoid and nonmucoid strains of P. aeruginosa raises the potential that this reagent could serve as an effective passive therapeutic reagent for most strains of P. aeruginosa. Essentially all isolates carry the alginate biosynthetic genes, and most clinical nonmucoid isolates produce detectable amounts of alginate in vitro. Interestingly, we did not find that the alginate-deleted strains of PAO1 and PA14 were particularly reduced for virulence in the acute pneumonia model, raising the possibility that alginate-negative variant strains may retain significant virulence potential in this setting. However, alginate was shown to be an essential factor for infecting transgenic CF mice with either nonmucoid or mucoid strains (55) suggesting that in the setting of CF alginate-negative variants would be poorly virulent. Indeed, in this clinical setting the conversion of nonmucoid to mucoid strains signals the onset of increased deterioration in lung function (5, 6), which may indicate that initiation of therapy with a mAb such as F429 when the first nonmucoid isolates of P. aeruginosa are obtained, could help control this variant and prevent emergence of the more pathogenic mucoid variety. Overall, we have produced and characterized a fully human mAb to P. aeruginosa alginate with specificity for an epitope expressed at sufficient density by both mucoid and nonmucoid isolates for the mAb to function as an effective opsonin and protective Ab. Targeting a single conserved epitope with an effective single reagent may provide a cost-effective means for mAb-based passive prophylaxis or therapy of P. aeruginosa infection.

We gratefully acknowledge Mark Duval for technical assistance and Milan Bajmozci for help with confocal microscopy.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was funded by the National Institute of Allergy and Infectious Diseases, National Institutes of Health Grant AI 48917.

5

Abbreviations used in this paper: MEP, mucoid exopolysaccharide; CF, cystic fibrosis; LyCM, lymphocyte conditioned medium; dhfr, dihydrofolate reductase.

6

A. Bragonzi, D. Worlitzsch, G. B. Pier, M. Hentzer, J. B. Andersen, M. Givskov, M. Conese, and G. Döring. Alginate expression by non-mucoid Pseudomonas aeruginosa within infected lungs in patients with cystic fibrosis and in a murine model. Submitted for publication.

1
Pugashetti, B. K., H. M. Metzger, Jr, L. Vadas, D. S. Feingold.
1982
. Phenotypic differences among clinically isolated mucoid Pseudomonas aeruginosa strains.
J. Clin. Microbiol.
16
:
686
.
2
Cystic Fibrosis Foundation. 2003. Patient registry 2002: annual report, Bethesda, MD.
3
Burns, J. L., R. L. Gibson, S. McNamara, D. Yim, J. Emerson, M. Rosenfeld, P. Hiatt, K. McCoy, R. Castile, A. L. Smith, B. W. Ramsey.
2001
. Longitudinal assessment of Pseudomonas aeruginosa in young children with cystic fibrosis.
J. Infect. Dis.
183
:
444
.
4
Kosorok, M. R., L. Zeng, S. E. West, M. J. Rock, M. L. Splaingard, A. Laxova, C. G. Green, J. Collins, P. M. Farrell.
2001
. Acceleration of lung disease in children with cystic fibrosis after Pseudomonas aeruginosa acquisition.
Pediatr. Pulmonol.
32
:
277
.
5
Pedersen, S. S., N. Hoiby, F. Espersen, C. Koch.
1992
. Role of alginate in infection with mucoid Pseudomonas aeruginosa in cystic fibrosis.
Thorax
47
:
6
.
6
Demko, C. A., P. J. Byard, P. B. Davis.
1995
. Gender differences in cystic fibrosis: Pseudomonas aeruginosa infection.
J. Clin. Epidemiol.
48
:
1041
.
7
Pier, G. B., J. M. Saunders, P. Ames, M. S. Edwards, H. Auerbach, J. Goldfarb, D. P. Speert, S. Hurwitch.
1987
. Opsonophagocytic killing antibody to Pseudomonas aeruginosa mucoid exopolysaccharide in older, non-colonized cystic fibrosis patients.
N. Engl. J. Med.
317
:
793
.
8
Parad, R. B., C. J. Gerard, D. Zurakowski, D. P. Nichols, G. B. Pier.
1999
. Pulmonary outcome in cystic fibrosis is influenced primarily by mucoid Pseudomonas aeruginosa infection and immune status and only modestly by genotype.
Infect. Immun.
67
:
4744
.
9
Pier, G. B., M. Grout, D. DesJardins.
1991
. Complement deposition by antibodies to Pseudomonas aeruginosa mucoid exopolysaccharide (MEP) and by non-MEP specific opsonins.
J. Immunol.
147
:
1869
.
10
Ames, P., D. DesJardins, G. B. Pier.
1985
. Opsonophagocytic killing activity of rabbit antibody to Pseudomonas aeruginosa mucoid exopolysaccharide.
Infect. Immun.
49
:
281
.
11
Garner, C. V., D. DesJardins, G. B. Pier.
1990
. Immunogenic properties of Pseudomonas aeruginosa mucoid exopolysaccharide.
Infect. Immun.
58
:
1835
.
12
Garner, C. V., and G. Pier, B. 1988. Human immune response to Pseudomonas aeruginosa mucoid exopolysaccharide vaccine. Clin. Res. 36:465A.
13
Pier, G. B., D. DesJardins, M. Grout, C. Garner, S. E. Bennett, G. Pekoe, S. A. Fuller, M. O. Thornton, W. S. Harkonen, H. C. Miller.
1994
. Human immune response to Pseudomonas aeruginosa mucoid exopolysaccharide (alginate) vaccine.
Infect. Immun.
62
:
3972
.
14
Fuller, S., M. Propst, L. Gross, S. Krentz, S. Stewart, M. Thornton, G. Pier.
1994
. An immune globulin specific to Pseudomonas aeruginosa mucoid exopolysaccharide (MEP) promotes opsonic killing of isolates from cystic fibrosis (CF) patients.
Abstracts of the 34th Interscience Conference on Antimicrobial Agents and Chemotherapy (Abstr. G7)
23
.
15
Pier, G. B., F. Coleman, M. Grout, M. Franklin, D. E. Ohman.
2001
. Role of alginate O acetylation in resistance of mucoid Pseudomonas aeruginosa to opsonic phagocytosis.
Infect. Immun.
69
:
1895
.
16
Meluleni, G. J., M. Grout, D. J. Evans, G. B. Pier.
1995
. Mucoid Pseudomonas aeruginosa growing in a biofilm in vitro are killed by opsonic antibodies to the mucoid exopolysaccharide capsule but not by antibodies produced during chronic lung infection in cystic fibrosis patients.
J. Immunol.
155
:
2029
.
17
Anastassiou, E. D., A. S. Mintzas, C. Kounavis, G. Dimitracopoulos.
1987
. Alginate production by clinical nonmucoid Pseudomonas aeruginosa.
J. Clin. Microbiol.
25
:
656
.
18
Pier, G. B., D. DesJardins, T. Aguilar, M. Barnard, D. P. Speert.
1986
. Polysaccharide surface antigens expressed by non-mucoid isolates of Pseudomonas aeruginosa from cystic fibrosis patients.
J. Clin. Microbiol.
24
:
189
.
19
Allewelt, M., F. T. Coleman, M. Grout, G. P. Priebe, G. B. Pier.
2000
. Acquisition of expression of the Pseudomonas aeruginosa ExoU cytotoxin leads to increased bacterial virulence in a murine model of acute pneumonia and systemic spread.
Infect. Immun.
68
:
3998
.
20
Theilacker, C., F. Coleman, S. Mueschenborn, M. Grout, G. B. Pier.
2003
. Construction and characterization of a Pseudomonas aeruginosa mucoid exopolysaccharide/alginate conjugate vaccine.
Infect. Immun.
71
:
3875
.
21
Silo-Suh, L., S.-J. Suh, P. A. Sokol, D. E. Ohman.
2002
. A simple alfalfa seedling infection model for Pseudomonas aeruginosa strains associated with cystic fibrosis shows AlgT (sigma-22) and RhlR contribute to pathogenesis.
Proc. Natl. Acad. Sci. USA
99
:
15699
.
22
Yorgey, P., L. G. Rahme, M. W. Tan, F. M. Ausubel.
2001
. The roles of mucD and alginate in the virulence of Pseudomonas aeruginosa in plants, nematodes and mice.
Mol. Microbiol.
41
:
1063
.
23
Posner, M. R., H. S. Elboim, M. B. Tumber.
1990
. Epstein Barr virus transformation of peripheral blood B cells secreting antibodies reactive with cell surface antigens.
Autoimmunity
8
:
149
.
24
Posner, M. R., H. Elboim, D. Santos.
1987
. The construction and use of a human-mouse myeloma analogue suitable for the routine production of hybridomas secreting human monoclonal antibodies.
Hybridoma
6
:
611
.
25
Preston, M. J., A. A. Gerceker, M. E. Reff, G. B. Pier.
1998
. Production and characterization of a set of mouse-human chimeric immunoglobulin G (IgG) subclass and IgA monoclonal antibodies with identical variable regions specific for Pseudomonas aeruginosa serogroup O6 lipopolysaccharide.
Infect. Immun.
66
:
4137
.
26
Reff, M. E., K. Carner, K. S. Chambers, P. C. Chinn, J. E. Leonard, R. Raab, R. A. Newman, N. Hanna, D. R. Anderson.
1994
. Depletion of B cells in vivo by a chimeric mouse human antibody to CD20.
Blood
83
:
435
.
27
Priebe, G. P., G. J. Meluleni, F. T. Coleman, J. B. Goldberg, G. B. Pier.
2003
. Protection against fatal Pseudomonas aeruginosa pneumonia in mice after nasal immunization with a live, attenuated aroA deletion mutant.
Infect. Immun.
71
:
1453
.
28
Russell, N. J., P. Gacesa.
1988
. Chemistry and biology of the alginate of mucoid strains of Pseudomonas aeruginosa in cystic fibrosis.
Mol. Aspects Med.
10
:
1
.
29
Wozniak, D. J., T. J. Wyckoff, M. Starkey, R. Keyser, P. Azadi, G. A. O’Toole, M. R. Parsek.
2003
. Alginate is not a significant component of the extracellular polysaccharide matrix of PA14 and PAO1 Pseudomonas aeruginosa biofilms.
Proc. Natl. Acad. Sci. USA
100
:
7907
.
30
Roy-Burman, A., R. H. Savel, S. Racine, B. L. Swanson, N. S. Revadigar, J. Fujimoto, T. Sawa, D. W. Frank, J. P. Wiener-Kronish.
2001
. Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections.
J. Infect. Dis.
183
:
1767
.
31
Hauser, A. R., E. Cobb, M. Bodi, D. Mariscal, J. Valles, J. N. Engel, J. Rello.
2002
. Type III protein secretion is associated with poor clinical outcomes in patients with ventilator-associated pneumonia caused by Pseudomonas aeruginosa.
Crit. Care Med.
30
:
521
.
32
Weintraub, A..
2003
. Immunology of bacterial polysaccharide antigens.
Carbohydr. Res.
338
:
2539
.
33
Lopalco, L..
2004
. Humoral immunity in HIV-1 exposure: cause or effect of HIV resistance?.
Curr. HIV Res.
2
:
127
.
34
Jarvis, G. A., J. M. Griffiss.
1991
. Human IgA1 blockade of IgG-initiated lysis of Neisseria meningitidis is a function of antigen-binding fragment binding to the polysaccharide capsule.
J. Immunol.
147
:
1962
.
35
Doring, G., F. Dorner.
1997
. A multicenter vaccine trial using the Pseudomonas aeruginosa flagella vaccine IMMUNO in patients with cystic fibrosis.
Behring. Inst. Mitt.
:
338
.
36
Ratjen, F., G. Doring.
2003
. Cystic fibrosis.
Lancet
361
:
681
.
37
Lai, H. P., P. R. Hsueh, Y. C. Chen, P. I. Lee, C. Y. Lu, M. Y. Lu, W. C. Lin, Y. C. Hsieh, C. Y. Lee, K. H. Lin, L. M. Huang.
2003
. Bacteremia in hematological and oncological children with febrile neutropenia: experience in a tertiary medical center in Taiwan.
J. Microbiol. Immunol. Infect.
36
:
197
.
38
Hamzeh, F., S. S. Kanj, M. Uwaydah.
2000
. Febrile neutropenia in cancer patients in a tertiary care medical center in Lebanon: microbial spectrum and outcome.
J. Med. Liban.
48
:
136
.
39
Pruitt, B. A., Jr, A. T. McManus, S. H. Kim, C. W. Goodwin.
1998
. Burn wound infections: current status.
World J. Surg.
22
:
135
.
40
Ewig, S., A. Torres, M. El-Ebiary, N. Fabregas, C. Hernandez, J. Gonzalez, J. M. Nicolas, L. Soto.
1999
. Bacterial colonization patterns in mechanically ventilated patients with traumatic and medical head injury: incidence, risk factors, and association with ventilator-associated pneumonia.
Am. J. Respir. Crit. Care Med.
159
:
188
.
41
Fenton, C., L. J. Scott, G. L. Plosker.
2004
. Palivizumab: a review of its use as prophylaxis for serious respiratory syncytial virus infection.
Paediatr. Drugs
6
:
177
.
42
ter Meulen, J., A. B. Bakker, E. N. van den Brink, G. J. Weverling, B. E. Martina, B. L. Haagmans, T. Kuiken, J. de Kruif, W. Preiser, W. Spaan, et al
2004
. Human monoclonal antibody as prophylaxis for SARS coronavirus infection in ferrets.
Lancet
363
:
2139
.
43
Jones, R. J., E. A. Roe, J. L. Gupta.
1980
. Controlled trial of Pseudomonas immunoglobulin and vaccine in burn patients.
Lancet
2
:
1263
.
44
Roe, E. A., R. J. Jones.
1983
. Immunization of burned patients against Pseudomonas aeruginosa infection at Safdarjang Hospital, New Delhi.
Rev. Infect. Dis.
5
:
S922
.
45
Cryz, S. J., Jr, E. Furer, J. C. Sadoff, T. Fredeking, J. U. Que, A. S. Cross.
1991
. Production and characterization of a human hyperimmune intravenous immunoglobulin against Pseudomonas aeruginosa and Klebsiella species.
J. Infect. Dis.
163
:
1055
.
46
Cryz, S. J., Jr, J. C. Sadoff, E. Fürer.
1989
. Octavalent Pseudomonas aeruginosa O-polysaccharide-toxin A conjugate vaccine.
Microb. Pathog.
6
:
75
.
47
Donta, S. T., P. Peduzzi, A. S. Cross, J. Sadoff, C. Haakenson, S. J. Cryz, C. Kauffman, S. Bradley, G. Gafford, D. Elliston, et al
1996
. Immunoprophylaxis against Klebsiella and Pseudomonas aeruginosa infections.
J. Infect. Dis.
174
:
537
.
48
Pier, G. B..
2003
. Promises and pitfalls of Pseudomonas aeruginosa lipopolysaccharide as a vaccine antigen.
Carbohydr. Res.
338
:
2549
.
49
Zweerink, H. J., L. J. Detolla, M. C. Gammon, C. F. Hutchison, J. M. Puckett, N. H. Sigal.
1990
. A human monoclonal antibody that protects mice against Pseudomonas-induced pneumonia.
J. Infect. Dis.
162
:
254
.
50
Zweerink, H. J., M. C. Gammon, C. F. Hutchinson, J. J. Jackson, D. Lombardo, K. M. Miner, J. M. Puckett, T. J. Sewell, N. H. Sigal.
1988
. Human monoclonal antibodies that protect mice against challenge with Pseudomonas aeruginosa.
Infect. Immun.
56
:
1873
.
51
Hemachandra, S., K. Kamboj, J. Copfer, G. Pier, L. L. Green, J. R. Schreiber.
2001
. Human monoclonal antibodies against Pseudomonas aeruginosa lipopolysaccharide derived from transgenic mice containing megabase human immunoglobulin loci are opsonic and protective against fatal pseudomonas sepsis.
Infect. Immun.
69
:
2223
.
52
Landsperger, W. J., K. D. Kellywintenberg, T. C. Montie, L. S. Knight, M. B. Hansen, C. C. Huntenburg, M. J. Schneidkraut.
1994
. Inhibition of bacterial motility with human antiflagellar monoclonal antibodies attenuates Pseudomonas aeruginosa-induced pneumonia in the immunocompetent rat.
Infect. Immun.
62
:
4825
.
53
Drake, D., T. C. Montie.
1987
. Protection against Pseudomonas aeruginosa infection by passive transfer of anti-flagella serum.
Can. J. Microbiol.
33
:
755
.
54
Pier, G. B., G. J. Small, H. B. Warren.
1990
. Protection against mucoid Pseudomonas aeruginosa in rodent models of endobronchial infection.
Science
249
:
537
.
55
Coleman, F. T., S. Mueschenborn, G. Meluleni, C. Ray, V. J. Carey, S. O. Vargas, C. L. Cannon, F. M. Ausubel, G. B. Pier.
2003
. Hypersusceptibility of cystic fibrosis mice to chronic Pseudomonas aeruginosa oropharyngeal colonization and lung infection.
Proc. Natl. Acad. Sci. USA
100
:
1949
.