Mucosal IgA is the most abundantly produced Ig upon colonization of the intestinal tract with commensal organisms in the majority of mammals. The repertoire of these IgA molecules is still largely unknown; a large amount of the mucosal IgA cannot be shown to react with the inducing microorganisms. Analysis of the repertoire of used H chain Ig (VH) genes by H-CDR3 spectrotyping, cloning, and sequencing of VH genes from murine intestinal IgA-producing plasma cells reveals a very restricted usage of VH genes and multiple clonally related sequences. The restricted usage of VH genes is a very consistent observation, and is observed for IgA plasma cells derived from B-1 or conventional B-2 cells from different mouse strains. Clonal patterns from all analyzed VH gene sequences show mainly independently acquired somatic mutations in contrast to the clonal evolution patterns often observed as a consequence of affinity maturation in germinal center reactions in peripheral lymphoid organs and Peyer’s patches. Our data suggest a model of clonal expansion in which many mucosal IgA-producing B cells develop in the absence of affinity maturation. The affinity of most produced IgA might not be the most critical factor for its possible function to control the commensal organisms, but simply the abundance of large amounts of IgA that can bind with relatively unselected affinity to redundant epitopes on such organisms.

The lamina propria (LP)3 of the intestinal tract of most mammalian species contains the largest number of plasma cells in the whole body. Most of these plasma cells produce IgA. This IgA is actively transported through the intestinal epithelium into the gut as secretory IgA (sIgA). The function of sIgA within the gut lumen is largely unknown. One favored mode of action of sIgA is to prevent adhesion of microorganisms to the gut epithelium and thus promote exclusion from the gut (immune exclusion) (1, 2). Both in humans and in experimental animals nearly all of the commensal gut organisms are coated with sIgA (3, 4). Despite this IgA coating, a relatively stable commensal ecosystem can survive in the gut and is considered to be beneficial for the host.

The presence of commensal microorganisms is important for the induction of IgA production, because germfree animals that do not contain microorganisms lack intestinal IgA (5). Introduction of commensal microorganisms into formerly germfree animals leads to the rapid onset of IgA production (6, 7). Recently, Macpherson et al. (8) showed that even in mice lacking T cells, some IgA can be specifically induced by introducing new microorganisms into the intestinal tract. However, not all of the IgA that is induced by particular microorganisms reacts with those microbes. This bystander or natural IgA can account for >90% of all the gut IgA, even in animals monoassociated with one single species of commensal microorganisms (7). The ratio of Ag-specific vs natural IgA depends on the inducing microorganisms (9). The specificity repertoire of this natural IgA is largely unknown.

One pathway for B cells to become IgA plasma cells is by induction of germinal center (GC) reactions in the Peyer’s patches (PP) and isolated lymphoid follicles (ILF) that are present along the small intestinal tract. At these sites, B cells are activated and induced to switch to IgA. Activated B cells leave the PP to migrate via mesenteric lymph nodes and the thoracic duct to the LP of the small intestine to become IgA plasma cells. Class switching possibly also takes place outside of the PPs in the LP (10). IgA+ plasma cells located in the LP express both activation-induced cytidine deaminase and transcripts from circular DNA that has been looped out during class switch recombination, making it very likely they had just completed class switch recombination. However, the presence of ILF within the LP as inductive sites cannot be excluded. In addition, lymphotoxin-α-deficient mice (which lack organized lymphoid structures such as PP and mesenteric lymph nodes) reconstituted with bone marrow from normal mice reveal normal amounts of intestinal IgA (11). This indicates that the presence of lymphoid structures such as mesenteric lymph nodes and PP is not necessary for the generation of IgA+ B cells.

In mice, B-1 cells also contribute to IgA production in the gut (12). B-1 cells differ in phenotype and function from conventional (CNV) B-2 cells. The IgM Abs produced by B-1 cells are often encoded by unmutated Ig VH genes (13) and are frequently reactive with autoantigens and carbohydrate (thymus-independent type 2) Ags of microorganisms (8, 14). The physiological contribution of B-1 and B-2 cells to the intestinal IgA is still largely unknown. Different experimental models showed a B-1 cell contribution varying from 1% (15) to >50% (12).

B-1 cells are not present in PP. Peritoneal B-1 cells may switch in situ, because germline I-Cα transcripts were detected in peritoneal B-1 cells (16). The exact anatomical site and the factors required for B-1 cells to switch to IgA are still open for discussion. Macpherson et al. (8) have proposed that B-1 cells can contribute to IgA production even in TCR β,δ knockout mice, but transfer of purified B-1 cells without T cells into SCID mice does not lead to significant IgA production (17). The chemokines CCL25 and CCL28 can act as attractants for both B-1 and B-2 IgA Ab-secreting cells (18, 19). IL-5, IL-6, IL-10, and IL-15 stimulate plasma cell differentiation and expression of IgA (20, 21).

Although sIgA specific for mucosal pathogens such as Vibrio cholerae (22), Salmonella typhimurium (23), and rotavirus (24) can protect in vivo against such infections, the exact role of sIgA in protection against mucosal pathogens has recently been challenged. Mice deficient in sIgA (IgA−/−, J chain−/−, poly-IgR−/−) showed efficient vaccine-induced protection against some respiratory viral mucosal pathogens (22, 25, 26, 27).

Because of the great diversity of microorganisms present in the gut, the repertoire of IgA Abs is expected to be very diverse. The repertoire of IgA VH genes in adult humans suggests a wide dissemination of clonally expanded B cells, usually with high numbers of somatic mutations (28, 29). To evaluate the IgA repertoire in the mouse, an IgA RT-PCR was developed to analyze the variation in H chain CDR3 (H-CDR3) lengths among IgA-producing intestinal B cells. The IgA repertoire expressed by intestinal IgA-producing plasmablasts was analyzed in several strains of mice, of which some had genetic defects resulting in either predominantly B-1 or B-2 cells.

BALB/c and C57BL/6 mice were obtained from The Jackson Laboratory. CBA/N and CBA/Ca mice were obtained from Harlan Nederland, and the A/J and A/WySnJ mice were kindly provided by M. Cancro, University of Pennsylvania. BALB/c, C57BL/6, CBA/N, CBA/Ca, A/J, and A/WySnJ mice were used to obtain small intestine and spleen samples. Mice were kept under CNV conditions. PP were surgically removed from the small intestine and analyzed separately. Approximately 1-cm-long parts of the ileum and one-third of the spleen were embedded into TissueTek OCT medium (Sakura Finetek) and snap frozen (−80°C) for cryostat sectioning, and the remainder of the duodenum and ileum was used for bulk RNA isolation.

RNA was isolated by the TRIzol method (Invitrogen Life Technologies), according to the manufacturer’s instructions, from PP, the small intestine cleared of PP (hereafter called LP), sorted splenic B cells (IgDhighIgMlow), and from different numbers (1, 2, 3, 4, 5, 6, 7) of 7-μm LP cryostat sections. cDNA was produced by using random hexamer primers (Amersham Biosciences), and integrity of the cDNA was controlled by β-actin PCR, using an upstream (5′-CCTAAGGCCAACCGTGAAAAG-3′) primer and a downstream (5′-TCTTCATGGTGCTAGGAGCCA-3′) primer. Spectrotype VH gene PCR were done with an upstream IGHV5 (PC7183) VH gene family-specific framework region 3 (FR3) primer (5′-ACAGTCTGAGGTCTGAGGACAC-3′) or an IGHV1 (J558) VH gene family-specific FR3 primer (5′-GCCTGACATCTGAGGACTCT-3′) in combination with a downstream 5′FAM-labeled IgA C region primer (5′-CTCAGGCCATTCAGAGTACA-3′). The downstream primer was labeled with the fluorescent label FAM for the purpose of detecting the different PCR fragments during gel electrophoresis. For cloning, a universal VH gene primer (5′-AGGTSMARCTGCAGSAGTCWGG-3′) (30) was used in combination with the previously mentioned IgA C region primer. A total of 1 or 2 μl of cDNA was amplified by PCR in a 25 μl reaction mixture containing 0.6 μM upstream primer, 0.6 μM IgA C region primer, 20 mM Tris-HCl (pH 8.4), 50 mM KCL, 1.5 mM MgCl2, 2.5 U TaqDNA polymerase (Invitrogen Life Technologies), and 0.2 mM each of dGTP, dATP, dTTP, and dCTP. The PCR amplification program consisted of 30 cycles of 30 s at 94°C (2 min in first cycle), 1 min at 58°C, and 1 min at 72°C. The program was followed by 10 min at 72°C to allow extension of all products. IgM VH genes were amplified from FACS-sorted (IgDhigh, IgMlow) recirculating follicular (RF) B cells (from spleen of the same BALB/c mice) using a downstream FAM-labeled common IgM C region primer (5′-CCCTGGATGACTTCAGTGTTG-3′). For spectrotype analysis, PCR products were analyzed by gel electrophoresis on a Megabase-1000 system (Amersham Biosciences).

IgA VH genes were cloned and sequenced from PCR products derived from LP of CNV C57BL/6, BALB/c, CBA/N, CBA/Ca, A/J, and A/WySnJ mice. PCR products were cloned directly into pCR4 TOPO vector (Invitrogen Life Technologies) and sequenced using an automated sequencing device, as described (31). Before cloning, the PCR fragment of interest was cut out of the agarose gel and purified using the agarose gel extraction kit (Qiagen), according to the manufacturers’ instructions.

Cryostat sections adjacent to the sections used for RNA analysis were stained with a peroxidase (PO)-labeled goat anti-mouse IgA Ab. PO activity was revealed by 3-amino-9-ethylcarbazole containing 0.01% H2O2. For orientation, nuclei were counterstained with hematoxylin.

VH sequences were compared with each other and with germline sequences in the European Molecular Biology Laboratory database (〈www.ebi.ac.uk〉, pp. 8, 12, 29), the International Immunogenetics information system (IMGT) database (〈http://imgt.cines.fr/〉, pp. 8, 12, 29), and published IGHV1 (J558) VH genes (32). Replacement over silent (R/S) ratios for FR and CDR were determined, as described (33). The Taq-polymerase error rate was calculated to be 1:1014 (22 errors in 22,309 nt) on the basis of all sequenced IgA C regions. Clonal relationship among sequences derived from the same mouse was defined as having identical V-D-J junctions.

CDR3 length spectrotyping is a method that is based on the length variability of the CDR3 due to the use of different D and J genes and to insertion or deletion of nucleotides during the V(D)J rearrangement process. If a PCR is performed using primers for FR3 and a C region on a polyclonal B cell population, a Gaussian distribution of different fragment sizes is expected, which can be visualized by automated fragment length analysis (34, 35). This method has been used to determine the average H-CDR3 length among polyclonal IgM-producing B cell populations in the rat (33). We confirmed such random distribution among IgM+ RF-B cells in the mouse. Fig. 1 shows polyclonal patterns of H-CDR3 lengths among the IgM molecules. Subsequently, the distribution and average of the H-CDR3 lengths of IgA VH-D-JH rearrangements from Ab-producing cells in the LP of the small intestine and from the PP of conventionally reared C57BL/6 and BALB/c mice were analyzed. VH gene primers for both the IGHV5 (PC7183) and the IGHV1 (J558) VH gene FR3 family were used. Because it has been calculated that in conventionally reared mice ∼108 IgA-producing plasmablasts are present within the LP of the small intestine (36), a similar polyclonal distribution among these IgA-producing plasmablasts was expected. To our surprise, H-CDR3 spectrotypes from PP and LP from both mouse strains reveal a distribution of the peak intensities of H-CDR3 lengths that differs from a Gaussian distribution in all IgA samples analyzed (Fig. 2), in contrast to the H-CDR3 spectrotypes of IgM+ splenic RF-B cells from the same BALB/c and C57BL/6 mice. This non-Gaussian distribution will be referred to as restricted repertoire in the remainder of this work. The restricted repertoire in the LP samples in both the IGHV5 (PC7183) and the largest mouse VH gene family IGHV1 (J558), which contains at least 50% of the VH genes, was very unexpected, because our samples contain many IgA plasma cells (36).

FIGURE 1.

Spectrotype analysis of IgM VH genes. IgM VH from the PC7183 and J558 VH family were amplified from splenic RF-B cells originating from BALB/c and C57BL/6 mice. Two mice of each strain were analyzed, of which one is shown.

FIGURE 1.

Spectrotype analysis of IgM VH genes. IgM VH from the PC7183 and J558 VH family were amplified from splenic RF-B cells originating from BALB/c and C57BL/6 mice. Two mice of each strain were analyzed, of which one is shown.

Close modal
FIGURE 2.

Spectrotype analysis of IgA VH genes. IgA VH genes from the PC7183 VH family were amplified from two BALB/c and C57BL/6 mice from different samples: RNA from Peyer’s patches (upper row), from four cryostat sections of the LP (middle row), and from whole small intestinal LP of the same mice (bottom row).

FIGURE 2.

Spectrotype analysis of IgA VH genes. IgA VH genes from the PC7183 VH family were amplified from two BALB/c and C57BL/6 mice from different samples: RNA from Peyer’s patches (upper row), from four cryostat sections of the LP (middle row), and from whole small intestinal LP of the same mice (bottom row).

Close modal

Another surprising finding is the similarity between the patterns observed in the PP and the LP samples within one mouse. Each mouse has its own unique spectrotype pattern, and this pattern is conserved between the LP and PP.

To further extend these observations and to eliminate possible contributions of ILF to the spectrotype analysis from LP samples, we analyzed cDNA samples that were directly obtained from cryostat sections of the small intestine from the same mice used for the original RNA isolations. The same pattern as obtained from PP and LP from the same mouse was found. The similar patterns between the spectrotypes derived from cryostat sections and from the total LP when derived from the same mouse show that the amount of IgA cDNA is not the limiting factor in the spectrotype analysis of total LP. In parallel, adjacent sections were stained with anti-IgA, and they show the abundance of IgA plasma cells in those sections, and the absence of ILFs (Fig. 3).

FIGURE 3.

Total IgA stains of small intestine. Cryostat sections are from BALB/c (A) and C57BL/6 (B). IgA plasma cells were stained (brown) by goat anti-mouse IgA PO, followed by 3-amino-9-ethylcarbazole substrate, and nuclei were counterstained (blue) by hematoxylin.

FIGURE 3.

Total IgA stains of small intestine. Cryostat sections are from BALB/c (A) and C57BL/6 (B). IgA plasma cells were stained (brown) by goat anti-mouse IgA PO, followed by 3-amino-9-ethylcarbazole substrate, and nuclei were counterstained (blue) by hematoxylin.

Close modal

To analyze whether the observed restriction in H-CDR3 spectrotypes is found in both B-1 and B-2 cell-derived IgA plasma cells, H-CDR3 spectrotype analysis was performed on cDNA samples that were obtained from the LP of conventionally reared CBA/N, CBA/Ca, A/J, and A/WySnJ mice. CBA/N mice carry a mutation (xid) in the Btk gene, leading to a lack of B-1 cells, while CBA/Ca mice are their normal controls (37). The A/WySnJ mice carry a ∼4.7-kb gene insertion that disrupts the 3′ end of the BR3 gene (Bcmd mutation) (38, 39), resulting in a peripheral B cell deficiency. Moreover, this Bcmd mutation reduces the life span and pool size of peripheral B-2 cells, but has no effect on peripheral B-1 cells. The A/J mice are their normal controls. Similar to the control mice, both B-1 and B-2 cell-enriched mice (A/WySnJ and CBA/N, respectively) show a restricted H-CDR3 spectrotype pattern of IgA (Fig. 4). The A/WySnJ and A/J mice show more diversity in H-CDR3 length than the CBA mice and the previously mentioned BALB/c and C57BL/6 mice. Despite this higher diversity in the A/J and A/WySnJ strains, all analyses show no normal (Gaussian) distribution of H-CDR3 lengths in their spectrotypes. Furthermore, each spectrotype appears to be unique for each mouse separately.

FIGURE 4.

Spectrotype analysis of IgA VH genes. Top, The analysis of whole LP samples of A/WySnJ (left) and A/J (right) mice. Bottom, Analysis of eight cryostat sections of the LP from CBA/N (left) and CBA/ca (right) mice. Analysis was performed for both the J558 and PC7183 VH gene family for three separate mice in each group.

FIGURE 4.

Spectrotype analysis of IgA VH genes. Top, The analysis of whole LP samples of A/WySnJ (left) and A/J (right) mice. Bottom, Analysis of eight cryostat sections of the LP from CBA/N (left) and CBA/ca (right) mice. Analysis was performed for both the J558 and PC7183 VH gene family for three separate mice in each group.

Close modal

To confirm and extend these observations, VH-D-JH rearrangements from LP samples of the conventionally reared BALB/c, C57BL/6, A/WySnJ, A/J, CBA/N, and CBA/Ca mice were amplified by RT-PCR, cloned, and sequenced. A universal VH gene primer combined with a Cα exon1 primer was used for this cloning experiment to amplify all possible VH gene families (30). From each sample, 9–13 VH genes were analyzed, resulting in analysis of a total of 61 VH genes. In each sample, except for the A/WySnJ and A/J mice, we observe multiple VH sequences that have identical VH-D-JH joining sequences and thus represent clonally related sequences. This confirms the restricted repertoire as revealed by H-CDR3 length spectrotyping. The number of clonally related sequences varies from two to three clonally related members (Table I). Among these clonally related sequences, differences (greater than Taq error) are found within the VH genes. The seven clones represent 26% of the total amount of sequences.

Table I.

CDR3 regions of IgA VH sequencesa

SequenceIGHVH-CDR3CDR3b length
IGHV 92nIGHDnIGHJ 102
A1 TGT GCAAGA  AGGGACTATAG GTTCG ACGACGCTATGGACTAC 13 
A2 TGT TCAAGA GGGG AATATG AGG GGTTTGCTTAC 10 
A3/A5 TGT GCAAGA..  GAGGGTT TTTT TTACTATGCTATGGACTAC 12 
A4 TGT GCAAGA.. ATTACTACGGTAGTAGC CCTT CCTGGTTTGCTTAC 14 
A6 TGT GCTAGC.. ACTACGGTAGTAG  TTAC 
A8 TGT GCTGTA..  CCCCCTT  ATTACTATACTATGGACTAC 11 
A9 TGT GCAAAT..  TACTACGGTAGTAGCT CTGGTTTGCTTAC 12 
A10/A11 TGT ACACGA.. GA TACTACGGTAGTAGCT GAGG ATTACTATGCTATGGACTAC 16 
B1 TGT GCAAGA.. CGACGGGGGAC GT CTGGTTTGCTTAC 11 
B2/B7 TGT GCAAGA.. GA CTACTATAGTA  ACTACTTTGACTAC 11 
B3/B6/B9 TGT GCAAGA.. CG CTACGGTAGT CTT TACTGGTACTTCGATGTC 13 
B4 TGT ACCAGA.. CGCC TTTATTACTACGGTA GTAG CCTTGACTAC 13 
B5 TGT GCAAGA.. GGGGGG TACTATGGTAAC ACTTCTATGCTATGGACTAC 15 
AJ1 TGT GCAAGA.. GGGCCCC TCC TGACTAC 
AJ3 TGT GCAAGC..  TATGGTGGTAGCT CTACTTTGACTAC 11 
AJ4 TGT GCACGA.. TC TAGTAAT CGGGG TATGGACTAC 10 
AJ7 TGT GCCAGG.. AG CTGGG GGAGTGATC ACTACTTTGACTAC 12 
AJ10 TGT GCAAGA.. TATTGGGATGG TTACTACG AGGGTGT TATGGACTAC 14 
AJ14 TGT GCACGA.. CA TAGT GACTACC TTGACTAC 
AJ15 TGT GCAAGA.. GGGGCATTAAGTA ACTACG TCT CCTGGTTTGCTTAT 14 
AJ16 TGT GCAAGA.. GAGG ATGGTA CCACCTGGTT CTTCGATGTC 12 
AJ17 TGC GCAAGA..  GAAGCCTCTG GGACGGGG GCTATGGACTAC 12 
AJ18 TGT GCTAGT.. GGACTTATAATA  ACTACCTTGACTAC 11 
WJ1 TGT GCCACC.. TTAG CTAACTGGGAC GGGG ACTTTGACTAC 12 
WJ3 TGT GCAAGA.. TTGG ATGATG  ATTACTACGCTATGGACTAC 12 
WJ4 TGT GCAAGA.. AGGGGAGGGC TCTATTATAGTA  ACTACAATGCTATGGACTAC 16 
WJ6 TGT GCACGG..  TATAGTA ACG ACTATGCTATGGACTAC 11 
WJ8 TGT GCAAGA.. GAG GGGA GTGGTGGTCT TATGGACTAC 11 
WJ9 TGT TCTAGA..  GGGA GTGAC TTTGCTTAC 
WJ11 TGT GTAAGA.. GAGAA CTATTATAGTAATT  ATGATGATGCTATGGACTAC 15 
WJ12 TGT GCTAGG.. ACTATGGTGGTAGCT ACAAGGG TGCTATGGACTAC 14 
WJ17 TGT ACCAGG.. GCTG TACTATGCTATGGACTAC 10 
CA5/CA10 TGT GCAAGA.. TTGGGTGGC GCTCGGGCTAC TATACTATGGACTAC 14 
CA6 TGT GCAAGA.. AGGGTAACTCC TT CTATGCTATGGACTAC 12 
CA8 TGT GCAAGA.. AGGGG CAATGGTA AAGGTGGG GCTATAGACTAC 13 
CA13 TGT GCAAGA..  CAGCTCGGGCTAC GAGG TATGGACTAC 11 
CA14 TGT GTAAGG.. GAGGGG TATTACGATGGTTAT  TGGTACTTCGATGTC 14 
CA17 TGT ACCCGG..  GGGCC TC GGTACTTCGATGTC 
CA19 TGT GCCCAA..  CTGGGAC AA GGCTAC 
CA20 TGT GCAACA..  TATGGTGACTAC GAGGG CTATGCTATGGACTGC 13 
CA21 TGT GCAAGA.. TGG TACTTCGATGGTAGC GGGGTACTTCT TTAT 13 
CA23 TGT GCAAGA..  TCTGGTAACTAC AT TTACTCTGCTATGGACTAC 13 
CA25 TGT GCAAGA.. GGAGTAACT CTCT CTATGCTATGGACTAC 12 
CA26 TGT ACAAGA.. CGC GACAGTTCGGGCT ACGA GTTTGGTTAC 12 
CX29 TGT ACTACA..  CTCGG GTCTAC 
CX32 TGT GCAAGA.. TCGGGGGG CTACTATAGTTACTATGGTTACGAC GTGGA GTTTGCTCAC 18 
CX33/CX35/CX37 TGT GCCTCC.. GG GCTCGGGCTAC GTG ACTTTGACCAC 11 
CX34 TGT TCTATT..  TTGT  ATCACTATGTTATGGACTAC 10 
CX36 TGT ACAAGA..  TATAGTAACT CTACTTTGACTAC 10 
CX38/CX44 TGT ACTACT..  CTTAG  TGCCTCC 
CX41 TGT ACAAGA.. GGGATGGCTATGAAGGCCT CCTACTATACTA AGTC GTTTAGTTAC 17 
CX46 TGT GCAAGA..  TCTTATTACGATGCTAAC  TACTACTTTGACTAC 13 
SequenceIGHVH-CDR3CDR3b length
IGHV 92nIGHDnIGHJ 102
A1 TGT GCAAGA  AGGGACTATAG GTTCG ACGACGCTATGGACTAC 13 
A2 TGT TCAAGA GGGG AATATG AGG GGTTTGCTTAC 10 
A3/A5 TGT GCAAGA..  GAGGGTT TTTT TTACTATGCTATGGACTAC 12 
A4 TGT GCAAGA.. ATTACTACGGTAGTAGC CCTT CCTGGTTTGCTTAC 14 
A6 TGT GCTAGC.. ACTACGGTAGTAG  TTAC 
A8 TGT GCTGTA..  CCCCCTT  ATTACTATACTATGGACTAC 11 
A9 TGT GCAAAT..  TACTACGGTAGTAGCT CTGGTTTGCTTAC 12 
A10/A11 TGT ACACGA.. GA TACTACGGTAGTAGCT GAGG ATTACTATGCTATGGACTAC 16 
B1 TGT GCAAGA.. CGACGGGGGAC GT CTGGTTTGCTTAC 11 
B2/B7 TGT GCAAGA.. GA CTACTATAGTA  ACTACTTTGACTAC 11 
B3/B6/B9 TGT GCAAGA.. CG CTACGGTAGT CTT TACTGGTACTTCGATGTC 13 
B4 TGT ACCAGA.. CGCC TTTATTACTACGGTA GTAG CCTTGACTAC 13 
B5 TGT GCAAGA.. GGGGGG TACTATGGTAAC ACTTCTATGCTATGGACTAC 15 
AJ1 TGT GCAAGA.. GGGCCCC TCC TGACTAC 
AJ3 TGT GCAAGC..  TATGGTGGTAGCT CTACTTTGACTAC 11 
AJ4 TGT GCACGA.. TC TAGTAAT CGGGG TATGGACTAC 10 
AJ7 TGT GCCAGG.. AG CTGGG GGAGTGATC ACTACTTTGACTAC 12 
AJ10 TGT GCAAGA.. TATTGGGATGG TTACTACG AGGGTGT TATGGACTAC 14 
AJ14 TGT GCACGA.. CA TAGT GACTACC TTGACTAC 
AJ15 TGT GCAAGA.. GGGGCATTAAGTA ACTACG TCT CCTGGTTTGCTTAT 14 
AJ16 TGT GCAAGA.. GAGG ATGGTA CCACCTGGTT CTTCGATGTC 12 
AJ17 TGC GCAAGA..  GAAGCCTCTG GGACGGGG GCTATGGACTAC 12 
AJ18 TGT GCTAGT.. GGACTTATAATA  ACTACCTTGACTAC 11 
WJ1 TGT GCCACC.. TTAG CTAACTGGGAC GGGG ACTTTGACTAC 12 
WJ3 TGT GCAAGA.. TTGG ATGATG  ATTACTACGCTATGGACTAC 12 
WJ4 TGT GCAAGA.. AGGGGAGGGC TCTATTATAGTA  ACTACAATGCTATGGACTAC 16 
WJ6 TGT GCACGG..  TATAGTA ACG ACTATGCTATGGACTAC 11 
WJ8 TGT GCAAGA.. GAG GGGA GTGGTGGTCT TATGGACTAC 11 
WJ9 TGT TCTAGA..  GGGA GTGAC TTTGCTTAC 
WJ11 TGT GTAAGA.. GAGAA CTATTATAGTAATT  ATGATGATGCTATGGACTAC 15 
WJ12 TGT GCTAGG.. ACTATGGTGGTAGCT ACAAGGG TGCTATGGACTAC 14 
WJ17 TGT ACCAGG.. GCTG TACTATGCTATGGACTAC 10 
CA5/CA10 TGT GCAAGA.. TTGGGTGGC GCTCGGGCTAC TATACTATGGACTAC 14 
CA6 TGT GCAAGA.. AGGGTAACTCC TT CTATGCTATGGACTAC 12 
CA8 TGT GCAAGA.. AGGGG CAATGGTA AAGGTGGG GCTATAGACTAC 13 
CA13 TGT GCAAGA..  CAGCTCGGGCTAC GAGG TATGGACTAC 11 
CA14 TGT GTAAGG.. GAGGGG TATTACGATGGTTAT  TGGTACTTCGATGTC 14 
CA17 TGT ACCCGG..  GGGCC TC GGTACTTCGATGTC 
CA19 TGT GCCCAA..  CTGGGAC AA GGCTAC 
CA20 TGT GCAACA..  TATGGTGACTAC GAGGG CTATGCTATGGACTGC 13 
CA21 TGT GCAAGA.. TGG TACTTCGATGGTAGC GGGGTACTTCT TTAT 13 
CA23 TGT GCAAGA..  TCTGGTAACTAC AT TTACTCTGCTATGGACTAC 13 
CA25 TGT GCAAGA.. GGAGTAACT CTCT CTATGCTATGGACTAC 12 
CA26 TGT ACAAGA.. CGC GACAGTTCGGGCT ACGA GTTTGGTTAC 12 
CX29 TGT ACTACA..  CTCGG GTCTAC 
CX32 TGT GCAAGA.. TCGGGGGG CTACTATAGTTACTATGGTTACGAC GTGGA GTTTGCTCAC 18 
CX33/CX35/CX37 TGT GCCTCC.. GG GCTCGGGCTAC GTG ACTTTGACCAC 11 
CX34 TGT TCTATT..  TTGT  ATCACTATGTTATGGACTAC 10 
CX36 TGT ACAAGA..  TATAGTAACT CTACTTTGACTAC 10 
CX38/CX44 TGT ACTACT..  CTTAG  TGCCTCC 
CX41 TGT ACAAGA.. GGGATGGCTATGAAGGCCT CCTACTATACTA AGTC GTTTAGTTAC 17 
CX46 TGT GCAAGA..  TCTTATTACGATGCTAAC  TACTACTTTGACTAC 13 
a

Numbering is according to IMGT. Clonally related sequences with identical H-CDR3 regions are shown as group. A, BALB/c (accession numbers AJ833570-AJ833579); B, C57BL/6 (AJ833580-AJ833587); AJ, A/J (AJ833588-AJ833597); WJ, A/WySnJ (AJ833598-AJ833606); CA, CBA/ca (AJ833607-AJ833619); CX, CBA/N (AJ833620-AJ833630).

b

CDR3 length is given in amino acids.

The restricted nature of the repertoire is strengthened by the multiple usage of particular VH genes. Similar germline VH gene usage is, for instance, found in C57BL/6 mice (five of eight sequences used VH gene J00354). Another example is VH gene S58456, which is used by two clonally unrelated sequences derived from a BALB/c mouse. Most VH genes belong to the large IGHV1 (J558) VH gene family, but also members of the IGHV2 (Q52), IGHV3 (36–60), IGHV5 (PC7183), IGHV6 (J606), and IGHV14 (SM7) VH gene families were identified (Table II).

Table II.

Overview of the occurrence of somatic mutations in IgA VH sequencesa

SequenceOriginIGVH Group (Family)IGHD RegionIGHJ RegionGermline SequenceMutation Frequency %Observed R/S H-FRExpected R/S H-FRp H-FRObserved R/S H-CDRExpected R/S H-CDRp H-CDR
A1 BALB/c IGHV1 (J558) IGHD-SP2.x IGHJ4 AF119008 1.9 2 (2/1) 3.51 0.196 ∞ (2/0) 4.11 0.135 
A2 BALB/c IGHV1 (J558) IGHD-SP2.2 IGHJ3 24.8 5.8 5 (10/2) 3.39 0.205 ∞ (3/0) 3.86 0.213 
A3 BALB/c IGHV1 (J558) IGHD-SP2.9 IGHJ4 AF206025       
A5 BALB/c IGHV1 (J558) IGHD-SP2.9 IGHJ4 AF206025       
A4 BALB/c IGHV1 (J558) IGHD-FL16.1 IGHJ3 M25110       
A6 BALB/c IGHV14 (SM7) IGHD-FL16.1 IGHJ2 S58456 1.2 2 (2/1) 3.16 0.438 0 (0/0) 3.70 0.626 
A8 BALB/c IGHV14 (SM7) IGHD-Q52 IGHJ4 S58456 <1       
A9 BALB/c IGHV1 (J558) IGHD-FL16.1 IGHJ3 AF537061 <1       
A10 BALB/c IGHV1 (J558) IGHD-FL16.1 IGHJ4 S82857 1.2 1 (1/1) 3.26 0.264 ∞ (1/0) 3.82 0.319 
A11 BALB/c IGHV1 (J558) IGHD-FL16.1 IGHJ4 S82857 1.5 2 (2/1) 3.26 0.330 ∞ (1/0) 3.82 0.363 
B1 C57BL IGHV1 (J558) IGHD-Q52 IGHJ3 AF455931 1.6 1 (1/1) 3.28 0.132 ∞ (2/0) 3.82 0.095 
B2 C57BL IGHV1 (J558) IGHD-SP2.X IGHJ2 J00534 9.6 1.7 (10/6) 3.36 0.011 2 (6/3) 3.60 0.082 
B7 C57BL IGHV1 (J558) IGHD-SP2.X IGHJ2 J00534 2.3 0.3 (1/3) 3.36 0.027 ∞ (2/0) 3.60 0.167 
B3 C57BL IGHV1 (J558) IGHD-FL16.1 IGHJ1 J00534 1.5 ∞ (2/0) 3.36 0.327 ∞ (2/0) 3.60 0.091 
B6 C57BL IGHV1 (J558) IGHD-FL16.1 IGHJ1 J00534 1.5 0 (0/3) 3.36 0.019 ∞ (1/0) 3.60 0.361 
B9 C57BL IGHV1 (J558) IGHD-FL16.1 IGHJ1 J00534 1.2 ∞ (2/0) 3.36 0.440 ∞ (1/0) 3.60 0.316 
B4 C57BL IGHV14 (SM7) IGHD-FL16.1 IGHJ2 Vpd12 <1       
B5 C57BL IGHV1 (J558) IGHD-SP2.7 IGHJ4 S73918 5.0 6 (6/1) 3.29 0.106 5 (5/1) 3.35 0.022 
AJ1 A/J IGHV1 (J558) IGHD-ST4 IGHJ2 MMU78488 8.8 4 (12/3) 3.52 0.088 7 (7/1) 3.22 0.023 
AJ3 A/J IGHV3 (36–50) IGHD-FL16.1 IGHJ2 AF118953 <1       
AJ4 A/J IGHV (J558) IGHD-FL16.1 IGHJ4 AF021871 7.7 2.5 (6/2) 3.42 0.086 ∞ (6/0) 3.09 0.034 
AJ7 A/J IGHV2 (Q52) IGHD-FL16.2 IGHJ2 AF546728 <1       
AJ10 A/J IGHV1 (J558) IGHD-FL16.1 IGHJ4 MMU240293 13.0 3.3 (13/4) 3.40 0.002 3 (12/4) 3.82 0.002 
AJ14 A/J IGHV3 (36–60) IGHD-SP2.9 IGHJ2 MMIGHAHE <1       
AJ15 A/J IGHV1 (J558) IGHD-FL16.2 IGHJ3 AF455931 4.3 0.3 (2/6) 3.28 0.003 ∞ (3/0) 3.82 0.148 
AJ16 A/J IGHV1 (J558) IGHD-SP2.8 IGHJ1 MMVH4G2 9.2 3 (12/4) 3.41 0.069 7 (7/1) 3.18 0.028 
AJ17 A/J IGHV1 (J558) IGHD-ST4 IGHJ4 AY182534 2.3 1.5 (3/1) 3.39 0.253 ∞ (1/0) 3.89 0.398 
AJ18 A/J IGHV14 (SM7) IGHD-SP2.8 IGHJ2 AF546729 5.8 6 (12/2) 3.16 0.080 ∞ (1/0) 3.70 0.243 
WJ1 A/WySnJ IGHV2 (Q52) IGHD-Q52 IGHJ2 MM2F7VDJ       
WJ3 A/WySnJ IGHV1 (J558) IGHD-SP2.9 IGHJ4 AF546711 3.1 6 (6/1) 3.20 0.232 ∞ (1/0) 3.03 0.390 
WJ4 A/WySnJ IGHV1 (J558) IGHD-SP2.x IGHJ4 MMU69538 1.9 1 (1/1) 3.63 0.145 ∞ (2/0) 3.69 0.125 
WJ6 A/WySnJ IGHV3 (36–60) IGHD-SP2.x IGHJ4 MMIGHAHE       
WJ8 A/WySnJ IGHV5 (PC7183) IGHD-Q52 IGHJ4 AY171938 4.6 1.5 (6/4) 3.14 0.159 ∞ (2/0) 3.71 0.290 
WJ9 A/WySnJ IGHV14 (SM7) IGHD-Q52 IGHJ3 AY172425 3.5 4 (4/1) 3.30 0.141 ∞ (4/0) 4.31 0.028 
WJ11 A/WySnJ IGHV1 (J558) IGHD-SP2.x IGHJ4 MMU242623 5.4 1.8 (7/4) 3.08 0.142 ∞ (3/0) 3.67 0.197 
WJ12 A/WySnJ IGHV14 (SM7) IGHD-FL16.1 IGHJ4 AF546729 2.7 6 (6/1) 3.16 0.151 ∞ (0/0) 3.70 0.335 
WJ17 A/WySnJ IGHV6 (J606) IGHD-ST4 IGHJ4 AF178607 3.8 ∞ (4/0) 3.44 0.095 ∞ (6/0) 4.07 0.002 
Ca05 CBA/ca IGHV1 (J558) IGHD-ST4 IGHJ4 AF045503 5.0 4 (8/2) 3.31 0.222 ∞ (3/0) 3.35 0.177 
Ca10 CBA/ca IGHV1 (J558) IGHD-ST4 IGHJ4 AF045503 5.4 4.5 (9/2) 3.31 0.216 ∞ (3/0) 3.35 0.193 
Ca06 CBA/ca IGHV1 (J558) IGHD-SP2.8 IGHJ4 D14634 1.9 ∞ (1/0) 3.28 0.062 ∞ (4/0) 3.86 0.002 
Ca08 CBA/ca IGHV1 (J558) IGHD-SP2.7 IGHJ4 L17134 3.1 6 (6/1) 3.71 0.252 ∞ (1/0) 3.39 0.389 
Ca13 CBA/ca IGHV1 (J558) IGHD-ST4 IGHJ4 AF276282 2.3 ∞ (3/0) 3.46 0.251 ∞ (3/0) 3.86 0.039 
Ca14 CBA/ca IGHV1 (J558) IGHD-FL16.1 IGHJ1 M20831 4.2 0.3 (2/6) 3.58 0.002 ∞ (3/0) 3.32 0.138 
Ca17 CBA/ca IGHV14 (SM7) IGHD-Q52 IGHJ1 AC073589 3.1 2.5 (5/2) 3.12 0.281 ∞ (1/0) 4.38 0.385 
Ca19 CBA/ca IGHV1 (J558) IGHD-Q52 IGHJ4 MMU26470 1.5 0 (0/1) 3.31 0.019 ∞ (3/0) 3.39 0.010 
Ca20 CBA/ca IGHV1 (J558) IGHD-SP2.8 IGHJ4 Z22071 3.45 1.5 (3/2) 3.58 0.049 ∞ (4/0) 3.28 0.023 
Ca21 CBA/ca IGHV1 (J558) IGHD-FL16.1 IGHJ3 MM26989 4.6 2.3 (7/3) 3.42 0.216 1 (1/1) 3.42 0.316 
Ca23 CBA/ca IGHV1 (J558) IGHD-SP2.8 IGHJ4 AF163742 <1       
Ca25 CBA/ca IGHV1 (J558) IGHD-SP2.9 IGHJ4 D14634 1.2 ∞ (1/0) 3.28 0.263 ∞ (2/0) 3.86 0.055 
Ca26 CBA/ca IGHV1 (J558) IGHD-ST4 IGHJ3 AF303842 6.1 2.7 (8/3) 3.68 0.100 ∞ (5/0) 3.39 0.047 
Cx29 CBA/N IGHV14 (SMT) IGHJ2 U27008 5.8 4.5 (9/2) 3.14 0.204 1 (2/2) 4.04 0.287 
Cx32 CBA/N IGHV1 (J558) IGHD-SP2.x/SP2.6 IGHJ2 D00307 2.3 ∞ (4/0) 3.42 0.324 ∞ (2/0) 3.39 0.164 
Cx33 CBA/N IGHV1 (J558) IGHD-ST4 IGHJ2 D14634 6.9 1.8 (7/4) 3.28 0.024 2.5 (5/2) 3.86 0.073 
Cx35 CBA/N IGHV1 (J558) IGHD-ST4 IGHJ2 D14634 4.6 1.3 (4/3) 3.28 0.029 ∞ (5/0) 3.86 0.017 
Cx37 CBA/N IGHV1 (J558) IGHD-ST4 IGHJ2 D14634 6.5 1.4 (7/5) 3.28 0.040 ∞ (5/0) 3.86 0.062 
Cx34 CBA/N IGHV14 (SM7) IGHD-Q52 IGHJ4 BC003878 4.6 2 (6/3) 3.21 0.156 0.5 (1/2) 4.04 0.306 
Cx36 CBA/N IGHV5 (PC7183) IGHD-SP2.x IGHJ2 Z22132 3.8 0.5 (1/2) 3.07 0.001 6 (6/1) 3.85 0.001 
Cx38 CBA/N IGHV14 (SM7) IGHDFL16.1 IGHJ2 Z33491 4.6 3 (6/2) 3.14 0.159 ∞ (4/0) 4.50 0.069 
Cx44 CBA/N IGHV14 (SM7) IGHDFL16.1 IGHJ2 Z33491 3.8 7 (7/1) 3.14 0.231 ∞ (2/0) 4.50 0.276 
Cx41 CBA/N IGHV1 (J558) IGHD-SP2.x IGHJ2 E07912 4.6 1.3 (5/4) 3.57 0.069 ∞ (3/0) 3.42 0.159 
Cx46 CBA/N IGHV14 (SM7) IGHD-FL16.1 IGHJ2 U27008 3.1 0.8 (3/4) 3.14 0.107 ∞ (1/0) 4.04 0.386 
SequenceOriginIGVH Group (Family)IGHD RegionIGHJ RegionGermline SequenceMutation Frequency %Observed R/S H-FRExpected R/S H-FRp H-FRObserved R/S H-CDRExpected R/S H-CDRp H-CDR
A1 BALB/c IGHV1 (J558) IGHD-SP2.x IGHJ4 AF119008 1.9 2 (2/1) 3.51 0.196 ∞ (2/0) 4.11 0.135 
A2 BALB/c IGHV1 (J558) IGHD-SP2.2 IGHJ3 24.8 5.8 5 (10/2) 3.39 0.205 ∞ (3/0) 3.86 0.213 
A3 BALB/c IGHV1 (J558) IGHD-SP2.9 IGHJ4 AF206025       
A5 BALB/c IGHV1 (J558) IGHD-SP2.9 IGHJ4 AF206025       
A4 BALB/c IGHV1 (J558) IGHD-FL16.1 IGHJ3 M25110       
A6 BALB/c IGHV14 (SM7) IGHD-FL16.1 IGHJ2 S58456 1.2 2 (2/1) 3.16 0.438 0 (0/0) 3.70 0.626 
A8 BALB/c IGHV14 (SM7) IGHD-Q52 IGHJ4 S58456 <1       
A9 BALB/c IGHV1 (J558) IGHD-FL16.1 IGHJ3 AF537061 <1       
A10 BALB/c IGHV1 (J558) IGHD-FL16.1 IGHJ4 S82857 1.2 1 (1/1) 3.26 0.264 ∞ (1/0) 3.82 0.319 
A11 BALB/c IGHV1 (J558) IGHD-FL16.1 IGHJ4 S82857 1.5 2 (2/1) 3.26 0.330 ∞ (1/0) 3.82 0.363 
B1 C57BL IGHV1 (J558) IGHD-Q52 IGHJ3 AF455931 1.6 1 (1/1) 3.28 0.132 ∞ (2/0) 3.82 0.095 
B2 C57BL IGHV1 (J558) IGHD-SP2.X IGHJ2 J00534 9.6 1.7 (10/6) 3.36 0.011 2 (6/3) 3.60 0.082 
B7 C57BL IGHV1 (J558) IGHD-SP2.X IGHJ2 J00534 2.3 0.3 (1/3) 3.36 0.027 ∞ (2/0) 3.60 0.167 
B3 C57BL IGHV1 (J558) IGHD-FL16.1 IGHJ1 J00534 1.5 ∞ (2/0) 3.36 0.327 ∞ (2/0) 3.60 0.091 
B6 C57BL IGHV1 (J558) IGHD-FL16.1 IGHJ1 J00534 1.5 0 (0/3) 3.36 0.019 ∞ (1/0) 3.60 0.361 
B9 C57BL IGHV1 (J558) IGHD-FL16.1 IGHJ1 J00534 1.2 ∞ (2/0) 3.36 0.440 ∞ (1/0) 3.60 0.316 
B4 C57BL IGHV14 (SM7) IGHD-FL16.1 IGHJ2 Vpd12 <1       
B5 C57BL IGHV1 (J558) IGHD-SP2.7 IGHJ4 S73918 5.0 6 (6/1) 3.29 0.106 5 (5/1) 3.35 0.022 
AJ1 A/J IGHV1 (J558) IGHD-ST4 IGHJ2 MMU78488 8.8 4 (12/3) 3.52 0.088 7 (7/1) 3.22 0.023 
AJ3 A/J IGHV3 (36–50) IGHD-FL16.1 IGHJ2 AF118953 <1       
AJ4 A/J IGHV (J558) IGHD-FL16.1 IGHJ4 AF021871 7.7 2.5 (6/2) 3.42 0.086 ∞ (6/0) 3.09 0.034 
AJ7 A/J IGHV2 (Q52) IGHD-FL16.2 IGHJ2 AF546728 <1       
AJ10 A/J IGHV1 (J558) IGHD-FL16.1 IGHJ4 MMU240293 13.0 3.3 (13/4) 3.40 0.002 3 (12/4) 3.82 0.002 
AJ14 A/J IGHV3 (36–60) IGHD-SP2.9 IGHJ2 MMIGHAHE <1       
AJ15 A/J IGHV1 (J558) IGHD-FL16.2 IGHJ3 AF455931 4.3 0.3 (2/6) 3.28 0.003 ∞ (3/0) 3.82 0.148 
AJ16 A/J IGHV1 (J558) IGHD-SP2.8 IGHJ1 MMVH4G2 9.2 3 (12/4) 3.41 0.069 7 (7/1) 3.18 0.028 
AJ17 A/J IGHV1 (J558) IGHD-ST4 IGHJ4 AY182534 2.3 1.5 (3/1) 3.39 0.253 ∞ (1/0) 3.89 0.398 
AJ18 A/J IGHV14 (SM7) IGHD-SP2.8 IGHJ2 AF546729 5.8 6 (12/2) 3.16 0.080 ∞ (1/0) 3.70 0.243 
WJ1 A/WySnJ IGHV2 (Q52) IGHD-Q52 IGHJ2 MM2F7VDJ       
WJ3 A/WySnJ IGHV1 (J558) IGHD-SP2.9 IGHJ4 AF546711 3.1 6 (6/1) 3.20 0.232 ∞ (1/0) 3.03 0.390 
WJ4 A/WySnJ IGHV1 (J558) IGHD-SP2.x IGHJ4 MMU69538 1.9 1 (1/1) 3.63 0.145 ∞ (2/0) 3.69 0.125 
WJ6 A/WySnJ IGHV3 (36–60) IGHD-SP2.x IGHJ4 MMIGHAHE       
WJ8 A/WySnJ IGHV5 (PC7183) IGHD-Q52 IGHJ4 AY171938 4.6 1.5 (6/4) 3.14 0.159 ∞ (2/0) 3.71 0.290 
WJ9 A/WySnJ IGHV14 (SM7) IGHD-Q52 IGHJ3 AY172425 3.5 4 (4/1) 3.30 0.141 ∞ (4/0) 4.31 0.028 
WJ11 A/WySnJ IGHV1 (J558) IGHD-SP2.x IGHJ4 MMU242623 5.4 1.8 (7/4) 3.08 0.142 ∞ (3/0) 3.67 0.197 
WJ12 A/WySnJ IGHV14 (SM7) IGHD-FL16.1 IGHJ4 AF546729 2.7 6 (6/1) 3.16 0.151 ∞ (0/0) 3.70 0.335 
WJ17 A/WySnJ IGHV6 (J606) IGHD-ST4 IGHJ4 AF178607 3.8 ∞ (4/0) 3.44 0.095 ∞ (6/0) 4.07 0.002 
Ca05 CBA/ca IGHV1 (J558) IGHD-ST4 IGHJ4 AF045503 5.0 4 (8/2) 3.31 0.222 ∞ (3/0) 3.35 0.177 
Ca10 CBA/ca IGHV1 (J558) IGHD-ST4 IGHJ4 AF045503 5.4 4.5 (9/2) 3.31 0.216 ∞ (3/0) 3.35 0.193 
Ca06 CBA/ca IGHV1 (J558) IGHD-SP2.8 IGHJ4 D14634 1.9 ∞ (1/0) 3.28 0.062 ∞ (4/0) 3.86 0.002 
Ca08 CBA/ca IGHV1 (J558) IGHD-SP2.7 IGHJ4 L17134 3.1 6 (6/1) 3.71 0.252 ∞ (1/0) 3.39 0.389 
Ca13 CBA/ca IGHV1 (J558) IGHD-ST4 IGHJ4 AF276282 2.3 ∞ (3/0) 3.46 0.251 ∞ (3/0) 3.86 0.039 
Ca14 CBA/ca IGHV1 (J558) IGHD-FL16.1 IGHJ1 M20831 4.2 0.3 (2/6) 3.58 0.002 ∞ (3/0) 3.32 0.138 
Ca17 CBA/ca IGHV14 (SM7) IGHD-Q52 IGHJ1 AC073589 3.1 2.5 (5/2) 3.12 0.281 ∞ (1/0) 4.38 0.385 
Ca19 CBA/ca IGHV1 (J558) IGHD-Q52 IGHJ4 MMU26470 1.5 0 (0/1) 3.31 0.019 ∞ (3/0) 3.39 0.010 
Ca20 CBA/ca IGHV1 (J558) IGHD-SP2.8 IGHJ4 Z22071 3.45 1.5 (3/2) 3.58 0.049 ∞ (4/0) 3.28 0.023 
Ca21 CBA/ca IGHV1 (J558) IGHD-FL16.1 IGHJ3 MM26989 4.6 2.3 (7/3) 3.42 0.216 1 (1/1) 3.42 0.316 
Ca23 CBA/ca IGHV1 (J558) IGHD-SP2.8 IGHJ4 AF163742 <1       
Ca25 CBA/ca IGHV1 (J558) IGHD-SP2.9 IGHJ4 D14634 1.2 ∞ (1/0) 3.28 0.263 ∞ (2/0) 3.86 0.055 
Ca26 CBA/ca IGHV1 (J558) IGHD-ST4 IGHJ3 AF303842 6.1 2.7 (8/3) 3.68 0.100 ∞ (5/0) 3.39 0.047 
Cx29 CBA/N IGHV14 (SMT) IGHJ2 U27008 5.8 4.5 (9/2) 3.14 0.204 1 (2/2) 4.04 0.287 
Cx32 CBA/N IGHV1 (J558) IGHD-SP2.x/SP2.6 IGHJ2 D00307 2.3 ∞ (4/0) 3.42 0.324 ∞ (2/0) 3.39 0.164 
Cx33 CBA/N IGHV1 (J558) IGHD-ST4 IGHJ2 D14634 6.9 1.8 (7/4) 3.28 0.024 2.5 (5/2) 3.86 0.073 
Cx35 CBA/N IGHV1 (J558) IGHD-ST4 IGHJ2 D14634 4.6 1.3 (4/3) 3.28 0.029 ∞ (5/0) 3.86 0.017 
Cx37 CBA/N IGHV1 (J558) IGHD-ST4 IGHJ2 D14634 6.5 1.4 (7/5) 3.28 0.040 ∞ (5/0) 3.86 0.062 
Cx34 CBA/N IGHV14 (SM7) IGHD-Q52 IGHJ4 BC003878 4.6 2 (6/3) 3.21 0.156 0.5 (1/2) 4.04 0.306 
Cx36 CBA/N IGHV5 (PC7183) IGHD-SP2.x IGHJ2 Z22132 3.8 0.5 (1/2) 3.07 0.001 6 (6/1) 3.85 0.001 
Cx38 CBA/N IGHV14 (SM7) IGHDFL16.1 IGHJ2 Z33491 4.6 3 (6/2) 3.14 0.159 ∞ (4/0) 4.50 0.069 
Cx44 CBA/N IGHV14 (SM7) IGHDFL16.1 IGHJ2 Z33491 3.8 7 (7/1) 3.14 0.231 ∞ (2/0) 4.50 0.276 
Cx41 CBA/N IGHV1 (J558) IGHD-SP2.x IGHJ2 E07912 4.6 1.3 (5/4) 3.57 0.069 ∞ (3/0) 3.42 0.159 
Cx46 CBA/N IGHV14 (SM7) IGHD-FL16.1 IGHJ2 U27008 3.1 0.8 (3/4) 3.14 0.107 ∞ (1/0) 4.04 0.386 
a

Clonally related sequences are placed directly underneath each other and are indicated by a thick borderline. Germline sequences are defined as described as such within the IMGT database, the J558 VH gene database (32 ), or the EMBL database or when identical (<2 nucleotide differences) VH genes can be found in at least two independently derived sequences. Observed and expected replacement/silent mutations ratios are calculated for aa 10–104 as described before (33 ). The probability (p) that an excess or scarcity of replacement mutations in H-CDR or H-FR results solely from chance is negated by the significantly low probability values (p < 0.05, shown in bold) calculated according to the binomial distribution.

VH gene sequences were compared with each other and with germline sequences in the European Molecular Biology Laboratory database (〈www.ebi.ac.uk〉, pp. 8, 12, 29), the IMGT database (〈http://imgt.cines.fr/〉, pp. 8, 12, 29), and published IGHV1 (J558) VH genes (32). Among the sequences, the mutation frequency varied between 0 and 13% (0–28 mutations), and there were 12 germline-encoded sequences.

Among clonally related sequences, the pattern of somatic mutations was analyzed by comparison with known germline VH sequences and analysis of shared somatic mutations. In the clonally related sequences, a pattern of somatic evolution is found that was different than observed during affinity maturation in GC. In GC, B cells are selected that accumulate mutations that favor binding to the selecting Ag, resulting in B cells that have Abs with higher affinity for the selecting Ag (40). In our clonal trees, however, the majority of somatic mutations are not shared among clonally related sequences (Fig. 5). R/S ratios for FR and CDR were determined, as described (33), and most sequences (41 of 61) show no significant differences in their CDR and FR from what would have been expected from random distributed mutations (Table II). Of the sequences that do show a significant deviation from the expected ratio, 12 deviations are in the FR and 13 in the CDR (41).

FIGURE 5.

Alignment of clonally related IgA VHDJH sequence-derived VH genes from C57BL/6 and CBA/N mice and genealogical trees deduced from the mutations observed in the VH genes of these clones. Sequences of the germline gene are shown on top. Dashes indicate identical nucleotides, and gaps resulting from IMGT subdivision are marked by dots. Replacement mutations are shown in bold/underscored characters.

FIGURE 5.

Alignment of clonally related IgA VHDJH sequence-derived VH genes from C57BL/6 and CBA/N mice and genealogical trees deduced from the mutations observed in the VH genes of these clones. Sequences of the germline gene are shown on top. Dashes indicate identical nucleotides, and gaps resulting from IMGT subdivision are marked by dots. Replacement mutations are shown in bold/underscored characters.

Close modal

The IgA H-CDR3 spectrotype analysis of CNV BALB/c and C57BL/6 mice suggests a large expansion of IgA-producing cells from a limited number of precursor cells. Furthermore, the IgA H-CDR3 repertoire is very similar between the inductive (PP) and effector (LP) site from the same mouse, based on spectrotype analyses. Even when RNA from four 7-μm cryostat sections is used, the same unique pattern can be recognized, suggesting that this coincidence is independent of contributions of B cells from ILF inductive sites. The fact that we find identical spectrotype patterns from whole tissue samples and cryostat sections also indicates that the amount of IgA in our samples is not the limiting factor. One peak in the spectrotype may not represent one single rearrangement in the non-Gaussian distribution pattern, but the distribution pattern among IgA-producing cells is clearly different from the Gaussian normal distribution observed among polyclonal B cell subpopulations, such as follicular splenic B cells. The spectrotype analysis of other strains of mice, the CBA/N, CBA/Ca, A/WySnJ, and A/J mice, shows a similarly restricted H-CDR3 repertoire. The spectrotype pattern of the A/WySnJ and A/J mice seems to be less restricted than that of the other mouse strains, which might be due to strain-specific differences in VH gene diversity or environmental differences. Also, in humans it has been observed that IgA and IgM H-CDR3 repertoires from human colon samples can be restricted (29). In these samples, identical H-CDR3 patterns in two separate colon biopsies were found, whereas the IgA and IgM repertoires from PBMC were completely different (29).

Although it is likely that gut IgA plasmablasts producing the highest levels of mRNA may swamp out the contributions of IgA+ B cells to the pool of amplified cloned VH genes that are expressed, our findings do suggest oligoclonality among these activated productive cells. This finding then still poses the problem of their selective activation. The fact that we find several clonally related sequences in such a small sample supports our findings with the spectrotype analysis in that there is a restricted usage of specific VH genes. Cloning and sequencing experiments on splenicIgM-producing cells did not reveal clonally related sequences at all (data not shown). The mutation pattern of the clonally related IgA VH genes suggests that selection of the cells expressing these genes is probably not driven by selection for the highest affinity, as seen in a typical GC reaction involving B-2 cells. In GC, B cells are positively selected and accumulate mutations that favor binding to the selecting Ag, resulting in B cells that have Abs with high affinity for the selecting Ag (40). However, in our clonal schemes, the majority of the somatic mutations are not shared among clonally related sequences (Fig. 5). Although the observed sequences were derived from the same cloning experiments, the level of somatic mutations within the VH region among sequences that had identical V-D-J rearrangements was clearly higher than expected from our calculated Taq polymerase error of 1:1014. This provides evidence that the cDNA was derived from independent (clonally related) plasmablasts. The observation that most of these somatic mutations were not shared among clonally related sequences strengthened this notion. It is important, however, to keep in mind that the recovered sequences represent only part of the actual clone. Some mutations were shared in the clones derived from the CBA/N mice. A possible explanation may be that the germline gene in this strain has a different sequence than the closest known germline sequence. Alternatively, it is possible that some clonal selection is occurring in the CBA/N mice. Furthermore, most R/S mutation ratios among FR and CDR suggest no significant deviation from the expected ratio by random mutations (41). Similar conclusions about antigenic selection were drawn in a study by Sehgal et al. (42). Together, these findings imply that selection among IgA VH genes is probably not driven by selection for the highest affinity in a typical GC reaction.

There are at least two, not mutually exclusive, explanations for these findings. First, the clones of IgA-producing cells found in the gut develop and expand from a limited number of precursor B cells outside of GC of gut lymphoid tissue; the high number of divisions lead to random, nonshared mutations without induction of the somatic hypermutation process. The restricted nature of the selection is not compatible with polyclonal B cell stimulators such as LPS as a driving force for this expansion, unless other B cell-specific superantigens such as Staphylococcus aureus protein A could selectively expand particular B cells (43).

The second explanation for these findings could be that the IgA B-2 cell precursors are selected within the GC of PP or ILF, but on the basis of other criteria than currently accepted. Normally, Ag selection is driven by competition for a limiting amount of Ag (44, 45). In the case of the continuous presence of Ags derived from gut commensal bacteria in the GC, survival of many B-2 cells without affinity maturation may occur because of the lack of competition. In addition, presentation of arrays of repetitive microbial determinants on the surface of follicular dendritic cells could even lead to T cell-independent selection of these B cells. This could explain why even in TCR β,δ knockout mice an IgA response induced by gut microorganisms could be observed (8). Non-T cell-derived cytokines in these GC could favor the isotype switch to IgA (46). Because B-1 cells are not found in GC of PP and presumably not in those of ILF, these cells must undergo their Ag selection and expansion at other sites. In SCID mice reconstituted with B-1 cells in combination with T cells, we observed large numbers of dividing IgA+ cells in the mesenteric lymph nodes, suggesting that this could be an alternative site for Ag stimulation in these mice (47).

In one of our clones, we observed a very high number of somatic mutations (25 mutations) compared with the original germline VH sequence (Fig. 5). This is in line with the high number of somatic mutations in human gut IgA VH genes (28). This could be explained by chronic stimulation by commensal organisms, which is in accordance with the age-dependent accumulation of somatic mutations in human VH genes (48). Alternatively, we cannot exclude the possibility of VH gene replacement, because the observed highly mutated VH gene shows more similarity to other VH genes than to the original germline VH gene. A third possibility is that this sequence, although it has the same V-D-J joining region, is not part of the same clone and uses a different germline VH gene.

In conclusion, the IgA repertoire that is induced by commensal gut organisms is very restricted. This is true both for B-1 and B-2 cells and may be an inherent property of the mucosal immune system. The affinity of most produced IgA might not be the most critical factor for its function, but simply the abundance of large amounts of IgA that can bind with relatively unselected affinity to redundant epitopes on gut organisms and control these populations. Superimposed on this primary pathway, the B-2 cells have the property to undergo high affinity selection for particular epitopes of virulence factors of pathogenic organisms that are present in limiting amount in the microenvironment of the GC of the PP. This dual model for IgA repertoire selection may explain the peaceful coexistence of commensal organisms that do induce large amounts of natural IgA, while at the same time specific mucosal IgA responses can completely protect against pathogenic microorganisms.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by National Institutes of Health Grant AI37108 (to J.J.C.). M.C.T. was supported by a fellowship from the Swiss National Science Foundation.

3

Abbreviations used in this paper: LP, lamina propria; CNV, conventional; FR, framework region; GC, germinal center; H-CDR3, H chain CDR3; ILF, isolated lymphoid follicle; IMGT, International Immunogenetics information system; PO, peroxidase; PP, Peyer’s patch; RF, recirculating follicular; R/S, replacement over silent; sIgA, secretory IgA.

1
Brandtzaeg, P., I. N. Farstad, F. E. Johansen, H. C. Morton, I. N. Norderhaug, T. Yamanaka.
1999
. The B-cell system of human mucosae and exocrine glands.
Immunol. Rev.
171
:
45
.
2
Macpherson, A. J., L. Hunziker, K. McCoy, A. Lamarre.
2001
. IgA responses in the intestinal mucosa against pathogenic and non-pathogenic microorganisms.
Microbes Infect.
3
:
1021
.
3
Bos, N. A., J. J. Cebra, F. G. Kroese.
2000
. B-1 cells and the intestinal microflora.
Curr. Top. Microbiol. Immunol.
252
:
211
.
4
Van der Waaij, L. A., P. C. Limburg, G. Mesander, D. van den Wáaij.
1996
. In vivo IgA coating of anaerobic bacteria in human faeces.
Gut
38
:
348
.
5
Crabbe, P. A., D. R. Nash, H. Bazin, H. Eyssen, J. F. Heremans.
1970
. Immunohistochemical observations on lymphoid tissues from conventional and germ-free mice.
Lab. Invest.
22
:
448
.
6
Shroff, K. E., K. Meslin, J. J. Cebra.
1995
. Commensal enteric bacteria engender a self-limiting humoral mucosal immune response while permanently colonizing the gut.
Infect. Immun.
63
:
3904
.
7
Talham, G. L., H. Q. Jiang, N. A. Bos, J. J. Cebra.
1999
. Segmented filamentous bacteria are potent stimuli of a physiologically normal state of the murine gut mucosal immune system.
Infect. Immun.
67
:
1992
.
8
Macpherson, A. J., D. Gatto, E. Sainsbury, G. R. Harriman, H. Hengartner, R. M. Zinkernagel.
2000
. A primitive T cell-independent mechanism of intestinal mucosal IgA responses to commensal bacteria.
Science
288
:
2222
.
9
Bos, N. A., H. Q. Jiang, J. J. Cebra.
2001
. T cell control of the gut IgA response against commensal bacteria.
Gut
48
:
762
.
10
Fagarasan, S., K. Kinoshita, M. Muramatsu, K. Ikuta, T. Honjo.
2001
. In situ class switching and differentiation to IgA-producing cells in the gut lamina propria.
Nature
413
:
639
.
11
Kang, H. S., R. K. Chin, Y. Wang, P. Yu, J. Wang, K. A. Newell, Y. X. Fu.
2002
. Signaling via LTβR on the lamina propria stromal cells of the gut is required for IgA production.
Nat. Immunol.
3
:
576
.
12
Kroese, F. G., E. C. Butcher, A. M. Stall, P. A. Lalor, S. Adams, L. A. Herzenberg.
1989
. Many of the IgA producing plasma cells in murine gut are derived from self-replenishing precursors in the peritoneal cavity.
Int. Immunol.
1
:
75
.
13
Hayakawa, K., R. R. Hardy.
2000
. Development and function of B-1 cells.
Curr. Opin. Immunol.
12
:
346
.
14
Kroese, F. G., W. A. Ammerlaan, A. B. Kantor.
1993
. Evidence that intestinal IgA plasma cells in μ, κ transgenic mice are derived from B-1 (Ly-1 B) cells.
Int. Immunol.
5
:
1317
.
15
Thurnheer, M. C., A. W. Zuercher, J. J. Cebra, N. A. Bos.
2003
. B1 cells contribute to serum IgM, but not to intestinal IgA, production in gnotobiotic Ig allotype chimeric mice.
J. Immunol.
170
:
4564
.
16
De Waard, R., P. M. Dammers, J. W. Tung, A. B. Kantor, J. A. Wilshire, N. A. Bos, L. A. Herzenberg, F. G. Kroese.
1998
. Presence of germline and full-length IgA RNA transcripts among peritoneal B-1 cells.
Dev. Immunol.
6
:
81
.
17
Jiang, H. Q., M. C. Thurnheer, A. W. Zuercher, N. V. Boiko, N. A. Bos, J. J. Cebra.
2004
. Interactions of commensal gut microbes with subsets of B- and T-cells in the murine host.
Vaccine
22
:
805
.
18
Bowman, E. P., N. A. Kuklin, K. R. Youngman, N. H. Lazarus, E. J. Kunkel, J. Pan, H. B. Greenberg, E. C. Butcher.
2002
. The intestinal chemokine thymus-expressed chemokine (CCL25) attracts IgA antibody-secreting cells.
J. Exp. Med.
195
:
269
.
19
Kunkel, E. J., C. H. Kim, N. H. Lazarus, M. A. Vierra, D. Soler, E. P. Bowman, E. C. Butcher.
2003
. CCR10 expression is a common feature of circulating and mucosal epithelial tissue IgA Ab-secreting cells.
J. Clin. Invest.
111
:
1001
.
20
Bao, S., K. W. Beagley, A. M. Murray, V. Caristo, K. I. Matthaei, I. G. Young, A. J. Husband.
1998
. Intestinal IgA plasma cells of the B1 lineage are IL-5 dependent.
Immunology
94
:
181
.
21
Hiroi, T., M. Yanagita, N. Ohta, G. Sakaue, H. Kiyono.
2000
. IL-15 and IL-15 receptor selectively regulate differentiation of common mucosal immune system-independent B-1 cells for IgA responses.
J. Immunol.
165
:
4329
.
22
Asahi, Y., T. Yoshikawa, I. Watanabe, T. Iwasaki, H. Hasegawa, Y. Sato, S. Shimada, M. Nanno, Y. Matsuoka, M. Ohwaki, et al
2002
. Protection against influenza virus infection in polymeric Ig receptor knockout mice immunized intranasally with adjuvant-combined vaccines.
J. Immunol.
168
:
2930
.
23
Michetti, P., M. J. Mahan, J. M. Slauch, J. J. Mekalanos, M. R. Neutra.
1992
. Monoclonal secretory immunoglobulin A protects mice against oral challenge with the invasive pathogen Salmonella typhimurium.
Infect. Immun.
60
:
1786
.
24
Coffin, S. E., C. A. Moser, S. Cohen, H. F. Clark, P. A. Offit.
1997
. Immunologic correlates of protection against rotavirus challenge after intramuscular immunization of mice.
J. Virol.
71
:
7851
.
25
Mbawuike, I. N., S. Pacheco, C. L. Acuna, K. C. Switzer, Y. Zhang, G. R. Harriman.
1999
. Mucosal immunity to influenza without IgA: an IgA knockout mouse model.
J. Immunol.
162
:
2530
.
26
Epstein, S. L., C. Y. Lo, J. A. Misplon, C. M. Lawson, B. A. Hendrickson, E. E. Max, K. Subbarao.
1997
. Mechanisms of heterosubtypic immunity to lethal influenza A virus infection in fully immunocompetent, T cell-depleted, β2-microglobulin-deficient, and J chain-deficient mice.
J. Immunol.
158
:
1222
.
27
Uren, T. K., F. E. Johansen, O. L. Wijburg, F. Koentgen, P. Brandtzaeg, R. A. Strugnell.
2003
. Role of the polymeric Ig receptor in mucosal B cell homeostasis.
J. Immunol.
170
:
2531
.
28
Dunn-Walters, D. K., L. Boursier, J. Spencer.
1997
. Hypermutation, diversity and dissemination of human intestinal lamina propria plasma cells.
Eur. J. Immunol.
27
:
2959
.
29
Holtmeier, W., A. Hennemann, W. F. Caspary.
2000
. IgA and IgM V(H) repertoires in human colon: evidence for clonally expanded B cells that are widely disseminated.
Gastroenterology
119
:
1253
.
30
Orlandi, R., D. H. Gussow, P. T. Jones, G. Winter.
1989
. Cloning immunoglobulin variable domains for expression by the polymerase chain reaction.
Proc. Natl. Acad. Sci. USA
86
:
3833
.
31
Guikema, J. E., E. Vellenga, J. M. Veeneman, S. Hovenga, M. H. Bakkus, H. Klip, N. A. Bos.
1999
. Multiple myeloma related cells in patients undergoing autologous peripheral blood stem cell transplantation.
Br. J. Haematol.
104
:
748
.
32
Gu, H., D. Tarlinton, W. Muller, K. Rajewsky, I. Forster.
1991
. Most peripheral B cells in mice are ligand selected.
J. Exp. Med.
173
:
1357
.
33
Dammers, P. M., A. Visser, E. R. Popa, P. Nieuwenhuis, F. G. Kroese.
2000
. Most marginal zone B cells in rat express germline encoded Ig VH genes and are ligand selected.
J. Immunol.
165
:
6156
.
34
Linke, B., I. Bolz, A. Fayyazi, M. von Hofen, C. Pott, J. Bertram, W. Hiddemann, M. Kneba.
1997
. Automated high resolution PCR fragment analysis for identification of clonally rearranged immunoglobulin heavy chain genes.
Leukemia
11
:
1055
.
35
Geiger, K. D., U. Klein, A. Brauninger, S. Berger, K. Leder, K. Rajewsky, M. L. Hansmann, R. Kuppers.
2000
. CD5-positive B cells in healthy elderly humans are a polyclonal B cell population.
Eur. J. Immunol.
30
:
2918
.
36
Van der Heijden, P. J., W. Stok, A. T. Bianchi.
1987
. Contribution of immunoglobulin-secreting cells in the murine small intestine to the total ‘background’ immunoglobulin production.
Immunology
62
:
551
.
37
Khan, W. N., F. W. Alt, R. M. Gerstein, B. A. Malynn, I. Larsson, G. Rathbun, L. Davidson, S. Muller, A. B. Kantor, L. A. Herzenberg.
1995
. Defective B cell development and function in Btk-deficient mice.
Immunity
3
:
283
.
38
Lentz, V. M., M. P. Cancro, F. E. Nashold, C. E. Hayes.
1996
. Bcmd governs recruitment of new B cells into the stable peripheral B cell pool in the A/WySnJ mouse.
J. Immunol.
157
:
598
.
39
Lentz, V. M., C. E. Hayes, M. P. Cancro.
1998
. Bcmd decreases the life span of B-2 but not B-1 cells in A/WySnJ mice.
J. Immunol.
160
:
3743
.
40
Berek, C., A. Berger, M. Apel.
1991
. Maturation of the immune response in germinal centers.
Cell
67
:
1121
.
41
Chang, B., P. Casali.
1994
. The CDR1 sequences of a major proportion of human germline Ig VH genes are inherently susceptible to amino acid replacement.
Immunol. Today
15
:
367
.
42
Sehgal, D., H. Obiakor, R. G. Mage.
2002
. Distinct clonal Ig diversification patterns in young appendix compared to antigen-specific splenic clones.
J. Immunol.
168
:
5424
.
43
Silverman, G. J., C. S. Goodyear.
2002
. A model B-cell superantigen and the immunobiology of B lymphocytes.
Clin. Immunol.
102
:
117
.
44
Shih, T. A., E. Meffre, M. Roederer, M. C. Nussenzweig.
2002
. Role of BCR affinity in T cell dependent antibody responses in vivo.
Nat. Immunol.
3
:
570
.
45
Gonzalez-Fernandez, A., C. Milstein.
1993
. Analysis of somatic hypermutation in mouse Peyer’s patches using immunoglobulin κ light-chain transgenes.
Proc. Natl. Acad. Sci. USA
90
:
9862
.
46
Litinskiy, M. B., B. Nardelli, D. M. Hilbert, B. He, A. Schaffer, P. Casali, A. Cerutti.
2002
. DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL.
Nat. Immunol.
3
:
822
.
47
Bos, N. A., J. C. Bun, S. H. Popma, E. R. Cebra, G. J. Deenen, M. J. van der Cammen, F. G. Kroese, J. J. Cebra.
1996
. Monoclonal immunoglobulin A derived from peritoneal B cells is encoded by both germ line and somatically mutated VH genes and is reactive with commensal bacteria.
Infect. Immun.
64
:
616
.
48
Banerjee, M., R. Mehr, A. Belelovsky, J. Spencer, D. K. Dunn-Walters.
2002
. Age- and tissue-specific differences in human germinal center B cell selection revealed by analysis of IgVH gene hypermutation and lineage trees.
Eur. J. Immunol.
32
:
1947
.