During B lymphocyte development, Ig heavy and L chain genes are assembled by V(D)J recombination. Individual V, D, and J genes rearrange at very different frequencies in vivo, and the natural variation in recombination signal sequence does not account for all of these differences. Because a permissive chromatin structure is necessary for the accessibility of VH genes for VH to DJH recombination, we hypothesized that gene rearrangement frequency might be influenced by the extent of histone modifications. Indeed, we found in freshly isolated pro-B cells from μMT mice a positive correlation between the level of enrichment of VHS107 genes in the acetylated histone fractions as assayed by chromatin immunoprecipitation, and their relative rearrangement frequency in vivo. In the VH7183 family, the very frequently rearranging VH81X gene showed the highest association with acetylated histones, especially in the newborn. Together, our data show that the extent of histone modifications in pro-B cells should be considered as a mechanism by which accessibility and the rearrangement level of individual VH genes is regulated.

The vast diversity of the immune repertoire is generated during lymphocyte development by assembly of Ag receptor gene segments in a process termed V(D)J recombination. In B cell precursors, there is a precise order of rearrangement of the gene segments, with DH to JH rearrangement occurring before VH to DJH rearrangement, and H chain rearranging before L chain. In addition, there is lineage specificity in V(D)J recombination. Even though the same recombination-activating gene (RAG) enzymes perform V(D)J recombination in both lineages, only T cells rearrange TCR gene segments, and only B cells rearrange Ig segments (1).

According to the accessibility model, specific molecular mechanisms should exist in developing lymphocytes that make the appropriate TCR or Ig regions accessible to the common recombinase activity in a lineage- and stage-specific manner (2, 3). Although it has been demonstrated that cis-acting elements within the TCR and the Ig loci, including enhancers and promoters, play crucial roles in recombination by helping to establish the locus and gene segment-specific accessibility (4, 5, 6), the precise molecular nature of the DNA or chromatin epigenetic modifications that are responsible for the change in accessibility status of Ig genes is still not fully understood. Chromatin exists in a highly compacted structure in the eukaryotic nucleus, and it has long been accepted that this structure functions as a barrier to gene expression. In general, transcriptionally inactive genes are methylated, show low levels of sensitivity to DNase I digestion, and are associated with hypoacetylated histones (7, 8), and this is the status of Ig and TCR genes in nonlymphoid cells.

Several studies have demonstrated that demethylation of the H and L chain genes occurs during B cell development, and is associated with onset of V(D)J recombination (9, 10, 11, 12). In addition, DNase I analysis has shown that initiation of V(D)J recombination at the Ig loci is preceded by an increase in nuclease sensitivity of V and J segments (13). More recently, other studies have demonstrated that loci active in V(D)J recombination contain nucleosomes with acetylated histone proteins (14, 15, 16, 17), and enhancement of histone acetylation levels in a pro-B cell line by treatment with inhibitors of histone deacetylase increases κ recombination activity (18).

It has been shown by several groups, including our own, that VH genes rearrange at different frequencies (19). Natural variation in the composition of the recombination signal sequence (RSS)3 is part of the reason for this differential rearrangement, but it does not explain all of the nonrandom rearrangement (19). For example, our laboratory has shown that the large VH7183 family is composed of many genes that have identical RSS, yet they rearrange at different frequencies in vivo (20). Thus, it is clear that factors others than RSS efficiency must play an important role in controlling recombination frequency in vivo.

Because induction of histone acetylation has been associated with induction of accessibility to rearrangement for V genes, we postulated that the extent of histone acetylation may be higher for the more frequently rearranging VH genes. We therefore examined histone acetylation and methylation by chromatin immunoprecipitation (ChIP), using freshly isolated B220+ pro-B cells. We found a positive correlation between the extent of the association with acetylated histones and relative rearrangement frequency in the VHS107 and VH7183 families. Thus, in the present work, we give the first in vivo demonstration that the extent of acetylation of histone proteins is one of the mechanisms by which V(D)J rearrangement frequency of individual VH genes may be regulated.

The μMT mice (21) were initially obtained from The Jackson Laboratory, and subsequently bred and maintained in specific pathogenic-free animal facilities at The Scripps Research Institute (La Jolla, CA). Experiments were approved and performed according to the regulatory standards of the Institutional Animal Care and Use Committee.

Bone marrow (BM) cells were isolated from 6-wk-old μMT mice by flushing the femur and tibia with 10% fetal serum in PBS. Newborn liver cells were obtained from <16-h-old μMT mice. For the majority of experiments, B220+ cells were purified using anti-mouse CD45R Ab-coated magnetic microbeads (Miltenyi Biotec). Then, the B220+ fraction was stained with PE-conjugated anti-B220 Ab (eBioscience). In other experiments, B220+ cells were pre-enriched by first staining BM or liver cells with PE-conjugated B220 Ab, followed by purification using anti-PE microbeads (Miltenyi Biotec). In both cases, viable pro-B cells (B220+) were sorted by flow cytometry. Thymocytes were obtained from 4- to 6-wk-old μMT mice. NIH 3T3 fibroblasts were maintained in DMEM (Invitrogen Life Technologies) supplemented with 10% FBS.

B220+ cells from adult BM and newborn liver μMT mice were isolated as described above, and genomic DNA was prepared using QIAamp DNA Mini Kit (Qiagen). Primers used to determine the rearrangement frequency of individual VHS107 and VH7183 genes have been described previously (20, 22). PCR products were ligated into the T/A cloning vector pCR 2.1-TOPO (Invitrogen Life Technologies), and positive clones were sequenced using the ABI PRISM 3100 DNA analyzer (Applied Biosystems).

ChIPs were performed according to Upstate Biotechnology’s protocol, with minor modifications. Approximately 4 × 106 cells were crosslinked by adding formaldehyde to a final concentration of 1% to the medium for 15 min at room temperature. The reaction was stopped by adding 0.125 M glycine and incubation for 5 min at room temperature. Subsequent steps were performed at 4°C. Fixed cells were harvested by centrifugation (1,000 rpm for 10 min), washed twice in cold PBS buffer containing 1 mM PMSF and 0.1% protease inhibitor mixture for mammalian extracts (Sigma-Aldrich), and resuspended in cell lysis buffer containing 1 mM PMSF and 0.1% protease inhibitor mixture. After 10-min incubation on ice, lysed cells were centrifuged at 3,000 rpm for 10 min to pellet the nuclei. The nuclear pellet was resuspended in SDS lysis buffer containing 1 mM PMSF and 0.1% protease inhibitor mixture and incubated 10 min on ice. The nuclear suspension was sonicated, and debris was removed by centrifugation (14,000 rpm, 10 min). The chromatin solution was diluted 10-fold in ChIP dilution buffer containing 1 mM PMSF and 0.1% protease inhibitor mixture, and precleared with salmon sperm DNA-protein A agarose beads (Upstate Biotechnology) for 1 h at 4°C. After centrifugation, 500 μl of the supernatant was saved to be used as input DNA, and the rest of the supernatant was incubated overnight at 4°C with 5 μg Ab/106 cells. Upstate Biotechnology’s Abs used included anti-acetylated H3 at lysines K9 and K14 (catalog no. 06-599), anti-acetylated H4 at lysines K5, K8, K12, and K16 (catalog no. 06-866), and anti-dimethylated H3 at lysine 4 (catalog no. 07-030).

Immune complexes were collected with salmon sperm DNA-protein A agarose beads for 1 h at 4°C. Following washes and elution, Ab-bound DNA (i.e., DNA associated with the specific histone modification under study) and input DNA (DNA not incubated with any Ab) were reverse crosslinked by heating at 65°C overnight. DNA was recovered after proteinase K treatment, 2 phenol/chloroform/isoamylalcohol and one chloroform extractions, and isopropanol precipitation. Finally, DNA was dissolved in 1× Tris/EDTA buffer and stored at 4°C until use.

Real-time PCR was performed using the Quantitec SYBR PCR Kit (Qiagen) and the ABI Prism 7700 Sequence Detection System (Applied Biosystems). The input DNA and the immunoprecipitated (bound) DNA were first quantified using PicoGreen dye (Invitrogen Life Technologies). The input DNA was diluted in 1× TE to match the concentration of bound DNA. The real-time PCR was conducted using 0.2 ng of DNA at 95°C for 15 min, followed by 45 cycles at 94°C for 15 s, 60°C for 30 s, and 72°C for 30 s. Data were collected at 72°C. A melting curve analysis step was built at the end of the cycling program to verify quality of the PCR products. The sequences of the primers used and their location are described in Table I. The specificity of each PCR was first confirmed by sequencing the amplified product.

Table I.

Primer sets used in ChIP assays

Primer SequencePosition (bp)a
VHS107 family   
V1 AGACTGGAGTGGATTGCTGCAAG +130 to +152 
 ATGACGTCCTCTCACTGTGTGC +304 to +325 
V11 AGGCACTTGAGTGGTTGGGTTTT +128 to +150 
 TTGTGTCTAGGCTCACACTGAAGTA +316 to +339 
V13 CAGCCTCCAGGGAAGTCACC +115 to +134 
 TTGTGTCTAGGCTCACACTGAAGTA +318 to +341 
V1 regions   
 5′-Promoter TCCTACATGAGTACACCCTCCCC −640 to −618 
 GGATTGAAGTTGTAGAGAGTGAAG −385 to −362 
 3′-Flanking CTTGTACAATGTGAGTCATTGTTG +849 to +872 
 GATAGAAGCCCTTACACATGTGGTGACA +1144 to +1171 
 Intergenic TTCTGAGGAACTGCCAGACTGATTTCCAG +2743 to +2771 
 AACAATGCTCAGCATCCTTATTCATCAGAG +2923 to +2952 
VH7183 family   
V81X AATCCAATGAATACGAATTCCCTTC +68 to +92 
 CTCCGCGCCCCCTGCTGGTCCT +351 to +372 
7183 (−81XTGTGCAGCCTCTGGATTCACT +64 to +84 
 CTCCGCGCCCCCTGCTGGTCCT +351 to +372 
VHJ558 family   
J558 GTGAAGATGTCCTGCAAGGCTTCT +52 to +75 
 GGATTTGTCTGCAGTCAGTGTGGCCTTG +198 to +225 
Controls   
Actin AGGCATGGAGTCCTGTGGTATC +527 to +548 
 AGCCACAGGTCCTAAGGCCAG +736 to +756 
 β2-microglobulinb GCGGTCCCAGGCTGAACGACCAG −305 to −283 
 CCAGTCTCCTAGCTGTTAATGCTGAACT −158 to −131 
Neuregulin CTCTGCATGGTAATGCACTGTGAG −53 to −30 
 AGAGGCAGAGGCTTACTAGACAAG +248 to +271 
Primer SequencePosition (bp)a
VHS107 family   
V1 AGACTGGAGTGGATTGCTGCAAG +130 to +152 
 ATGACGTCCTCTCACTGTGTGC +304 to +325 
V11 AGGCACTTGAGTGGTTGGGTTTT +128 to +150 
 TTGTGTCTAGGCTCACACTGAAGTA +316 to +339 
V13 CAGCCTCCAGGGAAGTCACC +115 to +134 
 TTGTGTCTAGGCTCACACTGAAGTA +318 to +341 
V1 regions   
 5′-Promoter TCCTACATGAGTACACCCTCCCC −640 to −618 
 GGATTGAAGTTGTAGAGAGTGAAG −385 to −362 
 3′-Flanking CTTGTACAATGTGAGTCATTGTTG +849 to +872 
 GATAGAAGCCCTTACACATGTGGTGACA +1144 to +1171 
 Intergenic TTCTGAGGAACTGCCAGACTGATTTCCAG +2743 to +2771 
 AACAATGCTCAGCATCCTTATTCATCAGAG +2923 to +2952 
VH7183 family   
V81X AATCCAATGAATACGAATTCCCTTC +68 to +92 
 CTCCGCGCCCCCTGCTGGTCCT +351 to +372 
7183 (−81XTGTGCAGCCTCTGGATTCACT +64 to +84 
 CTCCGCGCCCCCTGCTGGTCCT +351 to +372 
VHJ558 family   
J558 GTGAAGATGTCCTGCAAGGCTTCT +52 to +75 
 GGATTTGTCTGCAGTCAGTGTGGCCTTG +198 to +225 
Controls   
Actin AGGCATGGAGTCCTGTGGTATC +527 to +548 
 AGCCACAGGTCCTAAGGCCAG +736 to +756 
 β2-microglobulinb GCGGTCCCAGGCTGAACGACCAG −305 to −283 
 CCAGTCTCCTAGCTGTTAATGCTGAACT −158 to −131 
Neuregulin CTCTGCATGGTAATGCACTGTGAG −53 to −30 
 AGAGGCAGAGGCTTACTAGACAAG +248 to +271 
a

Numbering relative to the start of the coding region (+1).

b

Primers for β2-microglobulin were taken from Chowdhury and Sen (16 ).

Enrichment of active genes in our ChIP preparations was assessed by real-time PCR using primers for active genes (actin and β2-microglobulin), and for an inactive gene (neuregulin).

Data is presented as relative to actin values for each amplified DNA sequence, which was determined as follows: 2^ [(Ct input sample − Ct bound sample) − (Ct input actin − Ct bound actin)], where Ct is the cycle threshold.

Real-time PCRs were performed two to three times per ChIP preparation. All data used in figures are expressed as the mean values of three to six independent ChIP preparations ± SEM. The Mann-Whitney U test was used for statistical evaluation of the results.

The μMT mice (21) have a targeted disruption of a membrane exon of the gene encoding the IgM constant region, resulting in a complete block of B cell development at the pro-B cell step. Therefore, this strain of mice is an ideal model to analyze the initial rearrangement frequency of VH genes.

The VHS107 family has three functional members, V1, V11, and V13. We previously described that in newborn liver B220+ pro-B cells from μMT mice, V1 rearranges five times more often than V11, and V11 rearranges 7.7-fold more often than V13 (22). In this study, we performed a similar analysis in adult BM B220+ pro-B cells from μMT mice to determine whether the rearrangement frequency of individual members changes from newborn to adult B220+ cells. We isolated newborn liver and adult BM B220+ pro-B cells from μMT mice and amplified the VHS107 genes as described previously (22). The sequencing of additional 15 clones from newborn B220+ pro-B cells did not change the differential rearrangement frequency previously observed within the members of the VHS107 family (Fig. 1). In addition, sequencing of 45 clones from adult BM B220+ pro-B cells showed approximately the same rearrangement frequency pattern as observed in newborn liver pro-B cells (V1>V11>V13) (Fig. 1). Thus, this unequal rearrangement pattern is stable throughout ontogeny.

FIGURE 1.

In vivo relative rearrangement frequency of the three VHS107 genes. PCRs with family-specific primers were done on DNA from newborn liver and adult BM B220+ pro-B cells from μMT mice, and the PCR products were cloned and sequenced. Results are expressed as the percentage of the total number of the VHS107 family rearrangements.

FIGURE 1.

In vivo relative rearrangement frequency of the three VHS107 genes. PCRs with family-specific primers were done on DNA from newborn liver and adult BM B220+ pro-B cells from μMT mice, and the PCR products were cloned and sequenced. Results are expressed as the percentage of the total number of the VHS107 family rearrangements.

Close modal

Next, we wanted to test our hypothesis that the extent of histone modifications may correlate with rearrangement frequency in vivo. ChIP assays using Abs to acetylated histone H3, acetylated histone H4, or histone H3 dimethylated at lysine 4 (H3/K4) were performed on freshly isolated B220+ pro-B cells from adult BM and newborn liver from μMT mice. Primers unique for individual members of the VHS107 family were used in real-time PCR. The forward primers were located in the coding region, and the reverse primers were situated 3′ of their RSS. Thus, only unrearranged genes were assayed.

In adult BM B220+ pro-B cells, we found a positive correlation between the rearrangement frequency of the VHS107 family members, and their level of enrichment in the DNA immunoprecipitated with Abs against acetylated histones H3 and H4, and dimethylated H3/K4 (Fig. 2, A–C). V1 has 3- and 2.4-fold higher levels of histone H3 and H4 acetylation, respectively, compared with V11 (p < 0.10 and p < 0.05, respectively; Fig. 2, A and B). Furthermore, V11 has 2.5- and 2.9-fold higher levels of histone H3 and H4 acetylation, respectively, compared with V13 (p < 0.05 and p < 0.02, respectively). For dimethylated H3/K4, V1 was 6.2-fold more enriched in the immunoprecipitated fraction than V11, and V11 was 2.7-fold more enriched than V13 (p < 0.10; Fig. 2,C). In newborn B220+ cells, the rearrangement frequency also correlated with association with acetylated histone H3 (Fig. 2,D). V1 has 1.8- and 2.2-fold higher levels of histone H3 acetylation associated with its RSS region than that of V11 and V13, respectively. Although we could not find a significant difference between V1 and V11 in our anti-acetylated H4-ChIP preparations (Fig. 2 E), V11 was ∼2-fold more enriched in the immunoprecipitated fraction than V13 (p < 0.10).

FIGURE 2.

Analysis of histone acetylation and methylation in the VHS107 family. ChIP assays were performed on adult BM pro-B cells from μMT mice using Abs to acetylated H3 (A), acetylated H4 (B), or histone H3 dimethylated at lysine 4 (H3/K4) (C). ChIP assays were also performed on newborn liver pro-B cells from μMT mice using Abs to either acetylated H3 (D) or acetylated H4 (E). Analysis was performed by real-time PCR. Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of 3–5 independent ChIP preparations.

FIGURE 2.

Analysis of histone acetylation and methylation in the VHS107 family. ChIP assays were performed on adult BM pro-B cells from μMT mice using Abs to acetylated H3 (A), acetylated H4 (B), or histone H3 dimethylated at lysine 4 (H3/K4) (C). ChIP assays were also performed on newborn liver pro-B cells from μMT mice using Abs to either acetylated H3 (D) or acetylated H4 (E). Analysis was performed by real-time PCR. Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of 3–5 independent ChIP preparations.

Close modal

We conclude that in adult pro-B cells, there is a correlation between the extent of histone H3 and H4 acetylation and H3/K4 dimethylation, and relative rearrangement frequency for the three VH genes in the VHS107 family, and this is also the case for acetylated H3 in newborn pro-B cells.

We wanted to assess whether histone proteins H3 and H4 associated with V1-flanking regions were acetylated or dimethylated to the same degree as the histones surrounding the RSS and coding regions. For this analysis, three different regions (5′-promoter, 142–421 bp upstream of leader; 3′-flanking region, 504–822 bp downstream of the RSS; and intergenic region, 2.4–2.6 kb downstream of the RSS) flanking the V1 gene were analyzed in adult BM B220+ pro-B cells. Histone H3 and H4 acetylation, as well as H3/K4 dimethylation reached their highest value around the coding region and RSS, decreasing dramatically within 1 kb 5′ and 550 bp 3′ of the RSS (Fig. 3, A–C). This data shows that the extent of histone modifications associated with accessible chromatin is localized to the rearranging gene.

FIGURE 3.

Acetylation and methylation patterns of histones H3 and H4 associated with flanking regions of the V1 gene in pro-B cells from adult μMT mice. ChIP assays were performed using Abs to acetylated H3 (A), acetylated H4 (B), or dimethylated H3/K4 (C). Real-time PCR was performed using primers designed to amplify four different V1 regions (5′-promoter, coding and RSS, 3′-flanking and intergenic). Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of five independent ChIP preparations.

FIGURE 3.

Acetylation and methylation patterns of histones H3 and H4 associated with flanking regions of the V1 gene in pro-B cells from adult μMT mice. ChIP assays were performed using Abs to acetylated H3 (A), acetylated H4 (B), or dimethylated H3/K4 (C). Real-time PCR was performed using primers designed to amplify four different V1 regions (5′-promoter, coding and RSS, 3′-flanking and intergenic). Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of five independent ChIP preparations.

Close modal

It has been well documented that VH81X, a member of VH7183 family, is the most frequently rearranging VH segment in fetal life (23, 24, 25, 26). We have previously shown that in newborn B220+ pro B-cells from μMT mice, VH81X clearly dominates the VH7183 repertoire, comprising 59% of the rearrangements (20). In this study, we performed a similar analysis in B220+ adult BM cells to determine the rearrangement frequency of VH81X with respect to the rest of VH7183 family members.

Rearranged VH7183 genes from adult BM B220+ pro B-cells from μMT mice were amplified, cloned, and sequenced. Of 31 clones derived from adult BM B220+ pro-B cells, VH81X accounted for 35% of the rearrangements in the VH7183 family (data not shown). The remainder of the VH7183 genes showed similar relative rearrangement frequency as in the newborn (data not shown). Although these data indicated that VH81X rearranges more often than any other VH7183 gene in both newborn and adult B220+ cells, the relative rearrangement frequency of the VH81X gene was much higher in neonatal than in adult B220+ pro-B cells.

To test our hypothesis that the level of enrichment of acetylated histones surrounding VH81X will be higher than that of the rest of the VH7183 family members, ChIP assays were performed and analyzed by real-time PCR using primers that specifically amplified the VH81X gene and primers that amplified the rest of the VH7183 family members, excluding the VH81X gene. The forward primers were located in the coding region, and the common reverse primer was located 37 bp downstream of the nonamer.

In adult pro-B cells from μMT mice, VH81X has 2.4- and 2-fold higher level of histone H3 and H4 acetylation, respectively, compared with the rest of family members (p < 0.02 and p < 0.05, respectively; Fig. 4, A and B). Interestingly, in newborn pro-B cells from μMT mice, there was even more preferential association of the VH81X gene with acetylated histone H3, 4.2-fold higher than that of the rest of family members (p < 0.10; Fig. 4,C). However, we could not detect a significant difference between VH81X and the rest of VH7183 family members in the acetylated H4-immunoprecipitated fraction in newborn liver pro-B cells (Fig. 4 D). Thus, VH81X has a higher level of histone H3 acetylation associated with its RSS region than that of the rest of the VH7183 genes, and this differential association is much greater in the newborn, correlating with its very high rearrangement frequency.

FIGURE 4.

Analysis of histone acetylation in the VH7183 family. ChIP assays were performed on adult BM pro-B cells from μMT mice using Abs to either acetylated H3 (A), or acetylated H4 (B). ChIP assays were also performed on newborn liver pro-B cells from μMT mice using Abs to either acetylated H3 (C) or acetylated H4 (D). Analysis was performed by real-time PCR. Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of 4–6 independent ChIP preparations.

FIGURE 4.

Analysis of histone acetylation in the VH7183 family. ChIP assays were performed on adult BM pro-B cells from μMT mice using Abs to either acetylated H3 (A), or acetylated H4 (B). ChIP assays were also performed on newborn liver pro-B cells from μMT mice using Abs to either acetylated H3 (C) or acetylated H4 (D). Analysis was performed by real-time PCR. Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of 4–6 independent ChIP preparations.

Close modal

The large VHJ558 family, which is the most distal family in the VH locus, was included in our global analysis of the histone acetylation and methylation status in adult and newborn B220+ pro-B cells. VHJ558 genes undergo rearrangement much less frequently in fetal and neonatal pro-B cells than in adults (27). Because the status of histone proteins associated with the VHJ558 family has not been analyzed in freshly isolated neonatal pro-B cells, we examined this VH family by ChIP assay using newborn liver and also adult BM pro-B cells from μMT mice. For our real-time-PCR analysis, we designed a pair of primers that would amplify most of the VHJ558 family members, with primers located in FR1 and FR3.

The distal VHJ558 family showed higher association with acetylated histone H3 in adult than in newborn pro-B cells (p < 0.10; Fig. 5,A), which correlates with the high rearrangement frequency of VHJ558 genes in adult pro-B cells. However, when comparing the extent of H3 and H4 acetylation surrounding different VH genes in newborn liver pro-B cells, the VHJ558 family was more associated with acetylated H3 than any of the proximal VH genes other than VH81X, which showed the highest association with acetylated histone H3 (Fig. 5,A). Furthermore, there was a higher association of acetylated H4 with distal than with proximal VH genes in both adult BM and newborn liver pro-B cells (Fig. 5,B). In addition, in adult pro-B cells, the VHJ558 family had a much higher association with dimethylated H3/K4 than the other VH genes analyzed (Fig. 5 C).

FIGURE 5.

Analysis of the acetylation and methylation patterns of histones H3 and H4 associated with many VH genes. ChIP assays were performed on newborn liver and adult BM pro-B cells from μMT mice using Abs to acetylated H3 (A) or acetylated H4 (B). C, Dimethylated H3/K4 ChIP assays were performed on adult BM pro-B cells from μMT. Analysis was performed by real-time PCR. Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of 3–6 independent ChIP preparations. Data on VHS107 and VH7183 genes are from Figs. 2 and 4. Genes are displayed in their 5′ to 3′ orientation into the IgH locus.

FIGURE 5.

Analysis of the acetylation and methylation patterns of histones H3 and H4 associated with many VH genes. ChIP assays were performed on newborn liver and adult BM pro-B cells from μMT mice using Abs to acetylated H3 (A) or acetylated H4 (B). C, Dimethylated H3/K4 ChIP assays were performed on adult BM pro-B cells from μMT. Analysis was performed by real-time PCR. Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of 3–6 independent ChIP preparations. Data on VHS107 and VH7183 genes are from Figs. 2 and 4. Genes are displayed in their 5′ to 3′ orientation into the IgH locus.

Close modal

We conclude that the extent of histone H3 acetylation among VH genes is more comparable in newborn than in adult pro-B cells. Unlike in the newborn, in the adult the most notable difference is the very high level of H3 acetylation and H3/K4 dimethylation of the distal VHJ558 family, and, to a much lesser extent, V1. Thus, in general, the extent of histone modifications correlates with the relative rearrangement frequency in vivo.

To demonstrate the lineage specificity of the acetylation of histones associated with VH genes, we performed ChIP on freshly isolated μMT thymocytes and on cultured NIH 3T3 fibroblasts. We found that 3T3 cells displayed little acetylation of histones associated with any of the VH genes analyzed (Fig. 6, A and B). Furthermore, although thymocytes showed a slightly increased level of H3 acetylation as compared with NIH 3T3 cells, they were still hypoacetylated compared with pro-B cells. Thus, induction of hyperacetylation is specific to the B lineage. In addition, this comparative study demonstrated that it is only in pro-B cells where the level of association of individual VH members with acetylated histones correlates with their rearrangement frequency (Fig. 6, A and B).

FIGURE 6.

Analysis of histone H3 acetylation associated with many VH genes in three cell types. ChIP assays were performed on adult BM pro-B cells, total thymocytes, and 3T3 fibroblast. VHS107 (A) and VH7183 (B) family members were assayed for their enrichment in the anti-acetylated H3-immunoprecipitated fraction. Analysis was performed by real-time PCR. Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of 2–6 independent ChIP preparations.

FIGURE 6.

Analysis of histone H3 acetylation associated with many VH genes in three cell types. ChIP assays were performed on adult BM pro-B cells, total thymocytes, and 3T3 fibroblast. VHS107 (A) and VH7183 (B) family members were assayed for their enrichment in the anti-acetylated H3-immunoprecipitated fraction. Analysis was performed by real-time PCR. Data is expressed relative to the positive control actin gene (actin = 1). Results represent the mean ± SEM of 2–6 independent ChIP preparations.

Close modal

To elucidate the epigenetic mechanisms regulating accessibility of individual VH genes to V(D)J recombination, we investigated the modification status of histone proteins associated with specific VH genes in pro-B cells. We had already shown that the three functional members of the VHS107 family have very different rearrangement frequencies in vivo, with V1 rearranging five times more than V11, and V13 rearranging 40 times less frequently than V1 (22). Although their RSS share the same heptamer and nonamer (28), we have previously determined that the difference in recombination frequency between V1 and V11 could partially be due to differences in the spacer sequence (29). However, other factors in addition to RSS efficiency must affect rearrangement frequency because the closely related V11 and V13 genes rearrange at very different frequencies, and their RSS are identical, including the spacer (22, 29). In addition, we previously showed that the promoters of V11 and V13 are similar in strength, as measured by luciferase assays in the presence and absence of the intronic H chain enhancer (22). Furthermore, we showed that the steady-state level of germline transcripts was infrequent for all three VHS107 genes in vivo, precluding precise quantitation of the relative frequency of transcripts from the individual genes (22).

Another VH gene family in which RSS differences do not account for rearrangement frequency is the large VH7183 gene family. Although sequencing of the RSS of all 20 VH7183 family members indicated that several have identical RSS (20), genes with identical RSS rearranged at very different frequencies in vivo. The VH7183 gene family contains VH81X, a gene that rearranges at an extraordinarily high frequency, especially in fetal life. VH81X is the most 3′ functional VH gene, and shares the same consensus heptamer with other family members, although it has a unique spacer sequence. However, we previously demonstrated that the very high rearrangement frequency of VH81X is not due to its RSS (20). Therefore, it is clear that factors other than RSS efficiency must play a role in controlling VH gene recombination frequencies.

Increasing evidence that acetylation of histone proteins H3 and H4 and dimethylation of histone H3 at lysine 4 are associated with active chromatin led us to hypothesize that genes that rearrange more frequently within a VH family may be more enriched in histones that have active posttranslational modifications. Consistent with this idea, we show in freshly isolated pro-B cells a positive correlation between rearrangement frequency among the VHS107 and VH7183 family members and their level of enrichment in acetylated histone fractions. For the VHS107 family, we found that in adult BM pro-B cells the extent of association with acetylated histones H3 and H4, as well as dimethylated H3/K4, was higher with the highly rearranging V1 gene than with V11 gene. This result indicates that in addition to the contribution of the RSS spacer sequence in the higher rearrangement frequency of V1 over V11, association with acetylated H3 and H4, as well as dimethylated H3/K4, may also play a role in the unequal rearrangement frequency of these two VHS107 genes. Our data also suggest that the difference in recombination frequency between V11 and V13 in adult pro-B cells could be influenced by a preferential association of V11 with acetylated H3 and H4, and dimethylated H3/K4 histones. Our data in this study uncover the first difference between V11 and V13 genes in adult pro-B cells.

In the newborn, however, the extent of histone H3 and H4 acetylation was not significantly different between V1 and V11, and the high rearrangement frequency of V11 over V13 correlated only with the association of V11 with acetylated histone H4. Thus, additional factors may be responsible for the differential rearrangement frequency within VHS107 family members in newborn pro-B cells.

In the present work, we also showed that the high rearrangement frequency of VH81X with respect to the rest of VH7183 family members could be influenced by its very high association with acetylated histone H3. That association was even more pronounced in newborn than in adult pro-B cells, which concurs with the extremely high rearrangement frequency of VH81X early in ontogeny. However, we did not observe much dimethylation of H3/K4 on any of the VH7183 family members. Our data therefore indicates that the extent of histone acetylation could be a factor in promoting accessibility of VH81X for rearrangement.

In our global analysis of the modification status of histone proteins associated with other VH genes, we found that in adult pro-B cells, the acetylation of H3 and H4 is much higher in the distal VHJ558 genes than in any of the proximal VH genes tested. It has been previously described that the DH-proximal and DH-distal VH gene segments reside in distinct regulatory environments (30, 31, 32, 33, 34, 35). Our data showing high levels of H3 acetylation associated with the distal VHJ558 family in adult pro-B cells agree with two previous reports in which adult BM cells from RAG-deficient mice were used (16, 17). However, both groups cultured BM cells with IL-7, a cytokine which up-regulates acetylation of histones associated with the VHJ558 family, but has no effect on proximal VH genes. Furthermore, in RAG-deficient mice, no VH genes were associated with acetylated histones in the absence of IL-7 (16). Thus, direct analysis of freshly isolated pro-B cells from mice, which express functional RAG proteins as we did in this study, is preferable to determine the in vivo acetylation status of histone proteins surrounding VH genes. Chowdhury and Sen (16) also analyzed adult pro-B cells isolated from BALB/c mice and showed lower relative levels of histone acetylation associated with VHJ558 genes than we did in this study. The difference may be due to the fact that we used μMT mice, in which B cell development is blocked at the pro-B cell stage, possibly resulting in increased distal VH gene rearrangement.

We report in this study the first analysis of the histone acetylation status in freshly isolated newborn pro-B cells. In agreement with the lower use of the distal VHJ558 genes early in ontogeny, we found much lower association of acetylated H3 and H4 with VHJ558 genes in newborn as compared with adult pro-B cells. The only other study performed on neonatal cells was done with RAG−/− fetal liver pro-B cells after culture with IL-7, but the status of VH genes in the absence of IL-7 culture was not determined (17).

Using a novel system in which V(D)J recombination was induced in the nonlymphoid cell line BOSC after transient transfection with E2A or EBF, we have previously shown that Ig loci are not opened globally but recombination is localized to individual genes, with neighboring genes remaining inaccessible (36). We hypothesized that this was due to localized induction of histone post-translational modifications. Thus, we wanted to investigate whether the high association of modified histone proteins with the V1 gene was extended over flanking DNA or localized to the gene itself. We found a much higher association of acetylated histones and dimethylated H3/K4 surrounding the coding region and RSS of the V1 gene than the 5′- or 3′-flanking DNA or intergenic regions. This result agrees with a previous observation in which histone H4 acetylation was higher in VH gene segments and usually did not extend into intergenic regions (17). Thus, this observation gives a molecular basis for our previously observed localized induction of recombination.

Some studies (31, 37, 38, 39) have shown that acetylation of histones is not sufficient for induction of accessibility leading to rearrangement, suggesting that other epigenetic modifications could also be important for fully inducing accessibility resulting in V(D)J recombination. For example, H4 phosphorylation at serine 1 has been shown to be associated with the VH81X gene in pro-B cell lines (40), and thus this modification may also contribute to the high rearrangement frequency of VH81X. In addition to the well-documented role of DNA methylation and histone modifications in promoting V(D)J recombination, antisense intergenic transcription, as well as nucleosome positioning at RSS have been proposed as additional mechanisms (41, 42, 43, 44). Furthermore, new reports have provided evidence for at least two roles of the transcription factor Pax5: facilitating rearrangement of distal VH genes by inducing IgH locus contraction (45), and also in removing H3 methylation at lysine 9, a marker of repressed chromatin, in the VH locus, making VH genes accessible for VH to DJH recombination (46). Thus, it is likely that accessibility to V(D)J recombination during early B cell development is controlled by several factors.

There are at least two explanations for the observations presented in this study. The accessibility of individual VH genes could be determined by the relative number of acetylated lysines on histones associated with individual VH genes, and/or by the proportion of pro-B cells carrying a particular VH gene in an active chromatin environment. The later proposal has been reinforced by the observation that the activation of germline κ transcription occurs only in a small fraction of otherwise apparently homogeneous pre-B cells (47). Furthermore, preliminary ChIP data in our laboratory indicate that only a small fraction of VκI genes are acetylated in BOSC cells after transfection with E2A, yet the frequency of induced recombination of those genes was high, suggesting that the VκI genes associated with acetylated histones are the ones accessible for rearrangement (P. Goebel, M. Cherrier, and A. J. Feeney, unpublished data). Thus, we propose that it is most likely that an increased proportion of pro-B cells have acetylated histone proteins surrounding frequently (e.g., V1 and 81X) vs infrequently rearranging genes.

Taken together, our data show that the extent of acetylation of histone proteins is one of the mechanisms by which V(D)J rearrangement frequency of individual VH genes may be regulated in vivo, opening the field for further investigations of epigenetic modifications governing the preferential accessibility of individual VH genes within a family for V(D)J recombination during normal B cell development.

We thank L. Watson, N. Morris, and P. Lao for technical assistance, and K. Mowen, D. Nemazee, and J. Kaye for critical reading of the manuscript.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by a grant from the National Institutes of Health (Grant AI 52313).

3

Abbreviations used in this paper: RSS, recombination signal sequence; ChIP, chromatin immunoprecipitation; BM, bone marrow; Ct, cycle threshold.

1
Bassing, C. H., W. Swat, F. W. Alt.
2002
. The mechanism and regulation of chromosomal V(D)J recombination.
Cell
109
:
S45
.-S55.
2
Yancopoulos, G. D., F. W. Alt.
1985
. Developmentally controlled and tissue-specific expression of unrearranged VH gene segments.
Cell
40
:
271
.-281.
3
Stanhope-Baker, P., K. M. Hudson, A. L. Shaffer, A. Constantinescu, M. S. Schlissel.
1996
. Cell type-specific chromatin structure determines the targeting of V(D)J recombinase activity in vitro.
Cell
85
:
887
.-897.
4
Hempel, W. M., I. Leduc, N. Mathieu, R. K. Tripathi, P. Ferrier.
1998
. Accessibility control of V(D)J recombination: lessons from gene targeting.
Adv. Immunol.
69
:
309
.-352.
5
Sleckman, B. P., J. R. Gorman, F. W. Alt.
1996
. Accessibility control of antigen-receptor variable-region gene assembly: role of cis-acting elements.
Annu. Rev. Immunol.
14
:
459
.-481.
6
Schlissel, M. S., P. Stanhope-Baker.
1997
. Accessibility and the developmental regulation of V(D)J recombination.
Semin. Immunol.
9
:
161
.-170.
7
Travers, A..
1999
. Chromatin modification by DNA tracking.
Proc. Natl. Acad. Sci. USA
96
:
13634
.-13637.
8
Jaenisch, R., A. Bird.
2003
. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals.
Nat. Genet.
33
:
245
.-254.
9
Mather, E. L., R. P. Perry.
1983
. Methylation status and DNase I sensitivity of immunoglobulin genes: changes associated with rearrangement.
Proc. Natl. Acad. Sci. USA
80
:
4689
.-4693.
10
Storb, U., B. Arp.
1983
. Methylation patterns of immunoglobulin genes in lymphoid cells: correlation of expression and differentiation with undermethylation.
Proc. Natl. Acad. Sci. USA
80
:
6642
.-6646.
11
Goodhardt, M., P. Cavelier, N. Doyen, S. Kallenbach, C. Babinet, F. Rougeon.
1993
. Methylation status of immunoglobulin κ gene segments correlates with their recombination potential.
Eur. J. Immunol.
23
:
1789
.-1795.
12
Mostoslavsky, R., N. Singh, A. Kirillov, R. Pelanda, H. Cedar, A. Chess, Y. Bergman.
1998
. κ chain monoallelic demethylation and the establishment of allelic exclusion.
Genes Dev.
12
:
1801
.-1811.
13
Maës, J., L. P. O’Neill, P. Cavelier, B. M. Turner, F. Rougeon, M. Goodhardt.
2001
. Chromatin remodeling at the Ig loci prior to V(D)J recombination.
J. Immunol.
167
:
866
.-874.
14
McBlane, F., J. Boyes.
2000
. Stimulation of V(D)J recombination by histone acetylation.
Curr. Biol.
10
:
483
.-486.
15
McMurry, M. T., M. S. Krangel.
2000
. A role for histone acetylation in the developmental regulation of VDJ recombination.
Science
287
:
495
.-498.
16
Chowdhury, D., R. Sen.
2001
. Stepwise activation of the immunoglobulin μ heavy chain gene locus.
EMBO J.
20
:
6394
.-6403.
17
Johnson, K., C. Angelin-Duclos, S. Park, K. L. Calame.
2003
. Changes in histone acetylation are associated with differences in accessibility of VH gene segments to V-DJ recombination during B-cell ontogeny and development.
Mol. Cell. Biol.
23
:
2438
.-2450.
18
Krangel, M. S..
2003
. Gene segment selection in V(D)J recombination: accessibility and beyond.
Nat. Immunol.
4
:
624
.-630.
19
Feeney, A. J., P. Goebel, C. R. Espinoza.
2004
. Many levels of control of V gene rearrangement frequency.
Immunol. Rev.
200
:
44
.-56.
20
Williams, G. S., A. Martinez, A. Montalbano, A. Tang, A. Mauhar, K. M. Ogwaro, D. Merz, C. Chevillard, R. Riblet, A. J. Feeney.
2001
. Unequal VH gene rearrangement frequency within the large VH7183 gene family is not due to recombination signal sequence variation, and mapping of the genes shows a bias of rearrangement based on chromosomal location.
J. Immunol.
167
:
257
.-263.
21
Kitamura, D., J. Roes, R. Kuhn, K. Rajewsky.
1991
. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin μ chain gene.
Nature
350
:
423
.-426.
22
Love, V. A., G. Lugo, D. Merz, A. J. Feeney.
2000
. Individual VH promoters vary in strength, but the frequency of rearrangement of those VH genes does not correlate with promoter strength nor enhancer-independence.
Mol. Immunol.
37
:
29
.-39.
23
Malynn, B. A., G. D. Yancopoulos, J. E. Barth, C. A. Bona, F. W. Alt.
1990
. Biased expression of JH-proximal VH genes occurs in the newly generated repertoire of neonatal and adult mice.
J. Exp. Med.
171
:
843
.-859.
24
Perlmutter, R. M., J. F. Kearney, S. P. Chang, L. E. Hood.
1985
. Developmentally controlled expression of immunoglobulin VH genes.
Science
227
:
1597
.-1601.
25
Yancopoulos, G. D., S. V. Desiderio, M. Paskind, J. F. Kearney, D. Baltimore, F. W. Alt.
1984
. Preferential utilization of the most JH-proximal VH gene segments in pre-B-cell lines.
Nature
311
:
727
.-733.
26
Marshall, A. J., G. E. Wu, G. J. Paige.
1996
. Frequency of VH81X usage during B cell development: initial decline in usage is independent of Ig heavy chain cell surface expression.
J. Immunol.
156
:
2077
.-2084.
27
Jeong, H. D., J. M. Teale.
1989
. VH gene family repertoire of resting B cells: preferential use of D-proximal families early in development may be due to distinct B cell subsets.
J. Immunol.
143
:
2752
.-2760.
28
Siu, G., E. A. Springer, H. V. Huang, L. E. Hood, S. T. Crews.
1987
. Structure of the T15 VH gene subfamily: identification of immunoglobulin gene promotor homologies.
J. Immunol.
138
:
4466
.-4471.
29
Montalbano, A., K. M. Ogwaro, A. Tang, A. G. Matthews, M. Larijani, M. A. Oettinger, A. J. Feeney.
2003
. V(D)J recombination frequencies can be profoundly affected by changes in the spacer sequence.
J. Immunol.
171
:
5296
.-5304.
30
Haines, B. B., P. H. Brodeur.
1998
. Accessibility changes across the mouse Igh-V locus during B cell development.
Eur. J. Immunol.
28
:
4228
.-4235.
31
Hesslein, D. G., D. L. Pflugh, D. Chowdhury, A. L. Bothwell, R. Sen, D. G. Schatz.
2003
. Pax5 is required for recombination of transcribed, acetylated, 5′ IgH V gene segments.
Genes Dev.
17
:
37
.-42.
32
Su, I. H., A. Basavaraj, A. N. Krutchinsky, O. Hobert, A. Ullrich, B. T. Chait, A. Tarakhovsky.
2003
. Ezh2 controls B cell development through histone H3 methylation and Igh rearrangement.
Nat. Immunol.
4
:
124
.-131.
33
Corcoran, A. E., A. Riddell, D. Krooshoop, A. R. Venkitaraman.
1998
. Impaired immunoglobulin gene rearrangement in mice lacking the IL-7 receptor.
Nature
391
:
904
.-907.
34
Chowdhury, D., R. Sen.
2003
. Transient IL-7/IL-7R signaling provides a mechanism for feedback inhibition of immunoglobulin heavy chain gene rearrangements.
Immunity
18
:
229
.-241.
35
Roldan, E., M. Fuxa, W. Chong, D. Martinez, M. Novatchkova, M. Busslinger, J. A. Skok.
2005
. Locus ‘decontraction’ and centromeric recruitment contribute to allelic exclusion of the immunoglobulin heavy-chain gene.
Nat. Immunol.
6
:
31
.-41.
36
Goebel, P., N. Janney, J. R. Valenzuela, W. J. Romanow, C. Murre, A. J. Feeney.
2001
. Localized gene-specific induction of accessibility to V(D)J recombination induced by E2A and EBF in non-lymphoid cells.
J. Exp. Med.
194
:
645
.-656.
37
Sikes, M. L., A. Meade, R. Tripathi, M. S. Krangel, E. M. Oltz.
2002
. Regulation of V(D)J recombination: a dominant role for promoter positioning in gene segment accessibility.
Proc. Natl. Acad. Sci. USA
99
:
12309
.-12314.
38
Guo, J., A. Hawwari, H. Li, Z. Sun, S. K. Mahanta, D. R. Littman, M. S. Krangel, Y. W. He.
2002
. Regulation of the TCRα repertoire by the survival window of CD4+CD8+ thymocytes.
Nat. Immunol.
3
:
469
.-476.
39
Jackson, A., H. D. Kondilis, B. Khor, B. P. Sleckman, M. S. Krangel.
2005
. Regulation of T cell receptor β allelic exclusion at a level beyond accessibility.
Nat. Immunol.
2
:
189
.-197.
40
Morshead, K. B., D. N. Ciccone, S. D. Taverna, C. D. Allis, M. A. Oettinger.
2003
. Antigen receptor loci poised for V(D)J rearrangement are broadly associated with BRG1 and flanked by peaks of histone H3 dimethylated at lysine 4.
Proc. Natl. Acad. Sci. USA
100
:
11577
.-11582.
41
Bolland, D. J., A. L. Wood, C. M. Johnston, S. F. Bunting, G. Morgan, L. Chakalova, P. J. Fraser, A. E. Corcoran.
2004
. Antisense intergenic transcription in V(D)J recombination.
Nat. Immunol.
5
:
630
.-637.
42
Baumann, M., A. Mamais, F. McBlane, H. Xiao, J. Boyes.
2003
. Regulation of V(D)J recombination by nucleosome positioning at recombination signal sequences.
EMBO J.
22
:
5197
.-5207.
43
Golding, A., S. Chandler, E. Ballestar, A. P. Wolffe, M. S. Schlissel.
1999
. Nucleosome structure completely inhibits in vitro cleavage by the V(D)J recombinase.
EMBO J.
18
:
3712
.-3723.
44
Kwon, J., K. B. Morshead, J. R. Guyon, R. E. Kingston, M. A. Oettinger.
2000
. Histone acetylation and hSWI/SNF remodeling act in concert to stimulate V(D)J cleavage of nucleosomal DNA.
Mol. Cell
6
:
1037
.-1048.
45
Fuxa, M., J. Skok, A. Souabni, G. Salvagiotto, E. Roldan, M. Busslinger.
2004
. Pax5 induces V-to-DJ rearrangements and locus contraction of the immunoglobulin heavy-chain gene.
Genes Dev.
18
:
411
.-422.
46
Johnson, K., D. L. Pflugh, D. Yu, D. G. Hesslein, K. I. Lin, A. L. Bothwell, A. Thomas-Tikhonenko, D. G. Schatz, K. Calame.
2004
. B cell-specific loss of histone 3 lysine 9 methylation in the VH locus depends on Pax5.
Nat. Immunol.
5
:
853
.-861.
47
Liang, H. E., L. Y. Hsu, D. Cado, M. S. Schlissel.
2004
. Variegated transcriptional activation of the immunoglobulin κ locus in pre-B cells contributes to the allelic exclusion of light-chain expression.
Cell
118
:
19
.-29.