Dysferlin is expressed in skeletal and cardiac muscles. However, dysferlin deficiency results in skeletal muscle weakness, but spares the heart. We compared intraindividual mRNA expression profiles of cardiac and skeletal muscle in dysferlin-deficient SJL/J mice and found down-regulation of the complement inhibitor, decay-accelerating factor/CD55, in skeletal muscle only. This finding was confirmed on mRNA and protein levels in two additional dysferlin-deficient mouse strains, A/J mice and Dysf−/− mice, as well as in patients with dysferlin-deficient muscular dystrophy. In vitro, the absence of CD55 led to an increased susceptibility of human myotubes to complement attack. Evidence is provided that decay-accelerating factor/CD55 is regulated via the myostatin-SMAD pathway. In conclusion, a novel mechanism of muscle fiber injury in dysferlin-deficient muscular dystrophy is demonstrated, possibly opening therapeutic avenues in this to date untreatable disorder.

Dysferlin is a 230-kDa membrane-spanning protein consisting of a single C-terminal transmembrane domain and six C2 domains (1). In normal muscle, sarcolemma injuries lead to accumulation of dysferlin-enriched membrane patches and resealing of the membrane in the presence of Ca2+. Dysferlin deficiency results in defective membrane repair mechanisms (2, 3). An impaired interaction between dysferlin and annexins A1 and A2 has been discussed as a possible mechanism (3). Although dysferlin is expressed in human skeletal and cardiac muscles (1), mutations in the encoding gene (DYSF) lead only to skeletal muscle phenotypes without myocardial involvement, namely limb girdle muscular dystrophy 2B (LGMD2B)4 and Miyoshi myopathy (4). This dichotomy might be due to a protective mechanism present in heart or, alternatively, to a selective loss of protective pathways in skeletal muscle. We therefore compared gene expression profiles in myocardial and skeletal muscle tissues of dysferlin-deficient SJL/J mice.

Several mouse models exist with mutations in Dysf (5). The SJL/J mouse harbors a splice site mutation that results in a deletion corresponding to human exon 45 (6). SJL/J mice have long served as a model for autoimmune diseases, such as experimental allergic encephalomyelitis and myositis. The development of lymphomas is typically observed in older age. Therefore, it has been discussed whether other genetic disorders, apart from dysferlin deficiency, might play a role in SJL/J, and more defined models were engineered (7, 8). A mouse with a 12-kb deletion at the 3′ end leading to complete loss of dysferlin was designed. In this study the observation of a defective membrane repair mechanism in dysferlin deficiency has been made (2). The A/J mouse has a unique ETn retrotransposon insertion within intron 4 (9). For another targeted disruption of dysferlin, the highly conserved C2E domain was replaced by a neomycin gene, resulting in a Dysf−/− mouse (9). All these mice develop progressive muscular dystrophy after 2 mo of age. Interestingly, all mice also display different degrees of inflammatory changes in skeletal muscle.

In previous investigations, activation of the complement cascade has been identified on the surface of nonnecrotic muscle fibers in some patients with LGMD (10) and, in particular, in dysferlinopathies (11). Deposition of membrane attack complex (MAC) on nonnecrotic muscle fibers in muscular dystrophies was surprising, in particular because this mechanism does not play a role in inflammatory muscle diseases (10). The complement system consists of >30 plasma and cell surface proteins. It is activated by three different pathways, named classical, alternative, and lectin pathway, respectively (12, 13). All pathways require the proteolytic cleavage of C3, followed by the last phase of the complement cascade that leads to the formation of the C5b9-MAC. To provide an immediate defense against infection, there is a constant low level of C3 activation in the alternative pathway, a background “tick-over” (14). To prevent uncontrolled rapid amplification of the complement cascade and complement-mediated damage of self, numerous soluble and membrane-bound complement inhibitory and regulatory proteins have evolved. Among the membrane-bound inhibitors are decay-accelerating factor (DAF/CD55), membrane cofactor protein (CD46), and CD59 (15).

In this study we show that murine and human dysferlin-deficient muscle fibers lack the complement inhibitory factor, CD55/DAF. As a consequence, dysferlin-deficient nonnecrotic muscle cells express C5b9-MAC and are more susceptible to complement-mediated lysis in vitro.

Female SJL/J mice and C57BL/6 mice were purchased from Charles River Laboratories. The microarray experiments were performed in mice 32–34 wk of age. At this age, SJL/J mice showed marked histological signs of muscular dystrophy. Lymphomas were not detected. Muscle sections for immunohistochemistry were obtained from SJL/J mice at 12, 16, 20, 28, and 32 wk of age. For each age group, three mice were examined. Muscle sections from A/J and Dysf−/− mice were obtained at 16 wk of age. All experiments were approved by local committees.

RNA was extracted from mouse right quadriceps muscle, the left and right ventricles of mouse heart, and human skeletal muscle using TRIzol reagent (Invitrogen Life Technologies). Total RNA was treated by deoxyribonuclease I (Invitrogen Life Technologies) and was purified using the RNeasy Mini Kit (Qiagen).

Nonpooled microarray experiments were performed with cRNA prepared from quadriceps muscles and left ventricles of five SJL/J and five C57BL/6 mice using GeneChip Murine Genome U74Av2 (Affymetrix). Eight micrograms of RNA was transcribed in double-stranded cDNA using a cDNA Synthesis System (Roche). cRNA was produced by MEGAscript High Yield Transcription Kit (Ambion) and was labeled with biotin-11-CTP and biotin-16-UTP nucleotides (PerkinElmer). Arrays were hybridized with 16 μg of fragmentized biotinylated cRNA at 45°C and 60 rpm for 16 h in a GeneChip Hybridization Oven 640 (Affymetrix), washed and stained on GeneChip Fluidics Station 400, and scanned in GeneArray scanner 2500 (Affymetrix).

The resulting signals were processed using Affymetrix MicroArray Suite 5.0 software (MAS5.0) with a target intensity of 200. After standard data quality checks, we used the MAS5.0 expression signal values of each dataset for statistical analysis. Probe sets showing an absent call throughout all comparison groups were removed. A Nalimov test with a threshold of p < 0.001 was used to exclude outliers. Student’s t test (unpaired, two-tailed assumed unequal variance) was used to check the differences between two selected experimental groups.

cDNA was synthesized from 5 μg of total RNA using PowerScript reverse transcriptase (BD Clontech) and an oligo(dT)18 primer. Real-time PCR experiments were performed using TaqMan chemistry on ABI PRISM 7700 Sequence Detection System (Applied Biosystems). Each reaction was performed in a singleplex format and contained TaqMan Universal PCR Master Mix (Applied Biosystems), 900 nM forward and reverse primers, and 200 nM TaqMan probe (BioTez). An annealing/extension temperature of 58°C and 40 cycles were used. Primer/probe sets were designed using Primer Express 1.5 software (Applied Biosystems; Table I). For every sample, three independent runs in triplicate were performed, and the relative change in gene expression was quantified by the comparative threshold cycle method (16). Unpaired two-tail unequal variance t test with a significance threshold of p < 0.05 was used to compare the individual changes in threshold cycle values of the control and experimental group.

Table I.

Primer and probe sequences used for TaqMan RT-PCR

Gene ProductForward PrimerReverse PrimerProbeRef. Sequence
Mouse     
 PBGD GCACGATCCTGAAACTCTGC TCCTTCCAGGTGCCTCAGAA FAM-TCGCTGCATTGCTGAAAGGGCT-TAMRA NM_013551 
 DAF1 GTACAGGAACCCCCTCAACG TGAGGAGTTGGTTGGTCTCC FAM-CAGAAACCCACAACAGAAAGTGTTCCAAAT-TAMRA NM_010016 
 DAF2 ACAGGAATCCCCTCAACGC CTGAGGAGTTGGTTGGTCTCC FAM-CAGAAACCCACAACAGAAAGTGTTCCAAATCC-TAMRA NM_007827 
 Myostatin AGGTGACAGACACACCCAAGA GATTCCGTGGAGTGCTCATC FAM-TCCCGGAGAGACTTTGGGCTTGACTG-TAMRA NM_010834 
 CARP GGACTGGTCATTACGAGTGCG CCTTGGCATTGAGATCAGCC FAM-TGAGCACCTCATCGCCTGCG-TAMRA NM_013468 
 SMAD2 CCCATTCCTGTTCTGGTTCA AGCCAGCAGTGCAACTTTTT FAM-AGCAGTACAGCAGAATGACGTCGTGC-TAMRA NM_010754 
 SMAD3 GGGCCTACTGTCCAATGTCA CCCAATGTGTCGCCTTGTA FAM-CCGGAATGCAGCCGTGGAAC-TAMRA NM_016769 
 SMAD4 CTGGACAGAGAAGCTGGCC ACGCGCTTGGGTAGATCTT FAM-AGCACCTGGCGACGCTGTTCA-TAMRA NM_008540 
Human     
 β2MG ACTGAAAAAGATGAGTATGCCTGC CATCTTCAAACCTCCATGATGCT FAM-TGAACCATGTGACTTTGTCACAGCCCA-TAMRA NM_004048 
 DAF/CD55 AAGTAATCTTTGGCTGTAAGGCA TTCACCAGCATGTTTTACCTTTAA FAM-TTTCATCTTTCCTTCGGGTTGGCAAA-TAMRA NM_000574 
 Myostatin TGCTGTAACCTTCCCAGGAC GGTGTGTCTGTTACCTTGACCTC FAM-AGGAGAAGATGGGCTGAATCCGTTTTT-TAMRA NM_005259 
 EGR1 TTCACGTCTTGGTGCCTTTT CCCTCACAATTGCACATGTCA FAM-TGATGCGCCTTGCTGATGGC-TAMRA NM_001964 
 CARP AAGTTGCTCAGCACAGCGCT TGCTCCGCGCACTCATAGT FAM-CATGTGGCGGTGAGGACTGGC-TAMRA NM_014391 
 SMAD2 TGTTTTAGTGCCCTGCTGC GCTCACAAGATGGGTAGTGGA FAM-CTTCCAGACTTTGTGCTGTCCAGTAATTATGTC-TAMRA NM_005901 
 SMAD3 GGGCACAGCCAGTTCTGAA TTGGTGTTTCTGGATGCTGA FAM-TTGGTGGAGGGTGTAGTGGCTTTTTGG-TAMRA NM_005902 
 SMAD4 CAGCCGTGGCAGGAAAC GCTGACAGACTGATAGCTGGAGC FAM-TCCCTGGCCCAGGATCAGTAGGTGGA-TAMRA NM_005359 
Gene ProductForward PrimerReverse PrimerProbeRef. Sequence
Mouse     
 PBGD GCACGATCCTGAAACTCTGC TCCTTCCAGGTGCCTCAGAA FAM-TCGCTGCATTGCTGAAAGGGCT-TAMRA NM_013551 
 DAF1 GTACAGGAACCCCCTCAACG TGAGGAGTTGGTTGGTCTCC FAM-CAGAAACCCACAACAGAAAGTGTTCCAAAT-TAMRA NM_010016 
 DAF2 ACAGGAATCCCCTCAACGC CTGAGGAGTTGGTTGGTCTCC FAM-CAGAAACCCACAACAGAAAGTGTTCCAAATCC-TAMRA NM_007827 
 Myostatin AGGTGACAGACACACCCAAGA GATTCCGTGGAGTGCTCATC FAM-TCCCGGAGAGACTTTGGGCTTGACTG-TAMRA NM_010834 
 CARP GGACTGGTCATTACGAGTGCG CCTTGGCATTGAGATCAGCC FAM-TGAGCACCTCATCGCCTGCG-TAMRA NM_013468 
 SMAD2 CCCATTCCTGTTCTGGTTCA AGCCAGCAGTGCAACTTTTT FAM-AGCAGTACAGCAGAATGACGTCGTGC-TAMRA NM_010754 
 SMAD3 GGGCCTACTGTCCAATGTCA CCCAATGTGTCGCCTTGTA FAM-CCGGAATGCAGCCGTGGAAC-TAMRA NM_016769 
 SMAD4 CTGGACAGAGAAGCTGGCC ACGCGCTTGGGTAGATCTT FAM-AGCACCTGGCGACGCTGTTCA-TAMRA NM_008540 
Human     
 β2MG ACTGAAAAAGATGAGTATGCCTGC CATCTTCAAACCTCCATGATGCT FAM-TGAACCATGTGACTTTGTCACAGCCCA-TAMRA NM_004048 
 DAF/CD55 AAGTAATCTTTGGCTGTAAGGCA TTCACCAGCATGTTTTACCTTTAA FAM-TTTCATCTTTCCTTCGGGTTGGCAAA-TAMRA NM_000574 
 Myostatin TGCTGTAACCTTCCCAGGAC GGTGTGTCTGTTACCTTGACCTC FAM-AGGAGAAGATGGGCTGAATCCGTTTTT-TAMRA NM_005259 
 EGR1 TTCACGTCTTGGTGCCTTTT CCCTCACAATTGCACATGTCA FAM-TGATGCGCCTTGCTGATGGC-TAMRA NM_001964 
 CARP AAGTTGCTCAGCACAGCGCT TGCTCCGCGCACTCATAGT FAM-CATGTGGCGGTGAGGACTGGC-TAMRA NM_014391 
 SMAD2 TGTTTTAGTGCCCTGCTGC GCTCACAAGATGGGTAGTGGA FAM-CTTCCAGACTTTGTGCTGTCCAGTAATTATGTC-TAMRA NM_005901 
 SMAD3 GGGCACAGCCAGTTCTGAA TTGGTGTTTCTGGATGCTGA FAM-TTGGTGGAGGGTGTAGTGGCTTTTTGG-TAMRA NM_005902 
 SMAD4 CAGCCGTGGCAGGAAAC GCTGACAGACTGATAGCTGGAGC FAM-TCCCTGGCCCAGGATCAGTAGGTGGA-TAMRA NM_005359 

Patients were followed in the Neuromuscular Unit of Department of Neurology, Charité University Hospital (Berlin, Germany). Genomic sequencing of DYSF was performed if LGMD2B was suspected clinically and by immunohistochemistry and/or Western blotting. Patients included in this study gave their written informed consent. All studies were performed according to Declaration of Helsinki principles.

Murine DAF was detected with polyclonal rat anti-mouse Ab (MDI) (17); human CD55 was detected with SM1141PS (Acris Antibodies). Anti-human C5b9 mAb (DakoCytomation) was applied for MAC detection. Anti-phospho-MADR2 mAb against phosphorylated SMAD2 was obtained from EMD Biosciences. Double-immunofluorescent staining for SMAD protein (FITC) and nuclear membrane protein lamin A/C (Novocastra; Cy3) were examined using a two-photon microscope (Leica).

Myoblast/myotube cultures and complement attack assays were performed according to published protocols (18, 19). Myoblasts were grown in SMG-Medium (Promo Cell) supplemented with Promo Cell Supplement Mix, gentamicin (40 μg/ml; Invitrogen Life Technologies), 2 mM glutamine, and 10% FCS. Myoblasts were transferred on 96-well plates and grown to near confluence. Differentiation into myotubes was induced with DMEM containing 2% heat-inactivated horse serum. For complement attack assays, wells were incubated in sexplicate for 30 min with normal human serum diluted 1/5 and 1/20 in Veronal buffer (Hollborn & Söhne) containing 1% BSA. Half the wells were preincubated with anti-human CD55 mAb (5 μg/ml). Propidium iodide (PI; 0.5 μg/ml) was added to assess killing. The total number of myotubes was compared with PI-positive cells using a fluorescent tissue culture microscope (Leica) and by FACS analysis.

We used the GeneChip Murine Genome U74Av2 array to compare the gene expression profiles of skeletal and cardiac muscles of SJL/J mice with dysferlin deficiency to those of C57BL/6 control mice. Analysis of gene expression in the nonpooled skeletal muscle of SJL/J vs control mice revealed 291 differentially expressed genes at a threshold of p < 0.001 (see Supplementary Table I online).

DAF1 was 5-fold down-regulated in skeletal muscle of SJL/J compared with skeletal muscle of C57/BL6 mice, with a significance of p = 0.0000009. In contrast, in left cardiac ventricle, we found a mild 1.5-fold up-regulation. Similar results were observed with DAF2 (8.2-fold down-regulation in skeletal muscle, p = 0.0027; 4-fold up-regulation in heart). Therefore, analyzed intraindividually, these two complement inhibitory factors, corresponding to human CD55, are significantly differentially expressed in skeletal muscle and heart. CD59, another well-described inhibitor of complement activation, was not differentially expressed (Table II). There was no significant difference in the expression of complement receptor 1, complement component factor H, or factor H-like 1 in skeletal muscles of dysferlin-deficient and control mice (Table II). The differential expression of DAF1 and DAF2 was validated by TaqMan RT-PCR and revealed a 4-fold down-regulation of DAF1 (p = 0.005) and a 2-fold down-regulation of DAF2 (p = 0.003; Fig. 1). The mild up-regulation of cardiac DAF was confirmed independently for the left and right ventricles (not shown).

Table II.

mRNA expression of regulatory proteins of the complement system in SJL/J mice

Skeletal MuscleDirectionap ValueHeart (LV)aDirectionp ValueAccession No.
Fold changeFold change
Decay accelerating factor 1 −5.2 Down 0.0000009 1.5 Up 0.000003 NM_010016 
Decay accelerating factor 2 −8.2 Down 0.0027 Up 0.0018 NM_007827 
C1 inhibitor 1.3 NC 0.11 1.8 Up 0.005 NM_009776 
Complement receptor 1 1.5 NC 0.08 1.6 Up 0.0012 NM_010740 
Complement component factor h 1.9 NC 0.23 2.1 Up 0.00002 NM_009888 
Complement component factor H-like 1 1.3 NC 0.06 2.1 Up 0.0046 NM_015780 
CD59a Ag (protectin) 1.7 NC 0.21 −0.9 NC 0.34 NM_007652 
Skeletal MuscleDirectionap ValueHeart (LV)aDirectionp ValueAccession No.
Fold changeFold change
Decay accelerating factor 1 −5.2 Down 0.0000009 1.5 Up 0.000003 NM_010016 
Decay accelerating factor 2 −8.2 Down 0.0027 Up 0.0018 NM_007827 
C1 inhibitor 1.3 NC 0.11 1.8 Up 0.005 NM_009776 
Complement receptor 1 1.5 NC 0.08 1.6 Up 0.0012 NM_010740 
Complement component factor h 1.9 NC 0.23 2.1 Up 0.00002 NM_009888 
Complement component factor H-like 1 1.3 NC 0.06 2.1 Up 0.0046 NM_015780 
CD59a Ag (protectin) 1.7 NC 0.21 −0.9 NC 0.34 NM_007652 
a

LV, Left ventricle; NC, not significantly changed.

FIGURE 1.

TaqMan RT-PCR amplification plots of DAF/CD55. A and C, DAF1 (A) and DAF2 (C) expression in skeletal muscle (M. quadriceps) of a 30-wk-old SJL/J mouse compared with a C57BL/6 control mouse of the same age (Ctrl). E, DAF/CD55 expression in skeletal muscle of a patient with LGMD2B (patient 4, Table III) compared with a healthy control. Housekeeping genes porphobilinogen deaminase (B and D) and β2-microglobulin (F) were used as internal standards.

FIGURE 1.

TaqMan RT-PCR amplification plots of DAF/CD55. A and C, DAF1 (A) and DAF2 (C) expression in skeletal muscle (M. quadriceps) of a 30-wk-old SJL/J mouse compared with a C57BL/6 control mouse of the same age (Ctrl). E, DAF/CD55 expression in skeletal muscle of a patient with LGMD2B (patient 4, Table III) compared with a healthy control. Housekeeping genes porphobilinogen deaminase (B and D) and β2-microglobulin (F) were used as internal standards.

Close modal

In accordance with the results obtained by microarray and TaqMan RT-PCR, the DAF/CD55 protein was absent by immunohistochemical staining of SJL/J quadriceps muscle, but was readily detectable on the sarcolemma of C57BL/6 control muscle (Fig. 2, A and D). A decrease in DAF/CD55 was found in SJL/J mice of all age groups (12, 16, 20, 28, and 32 wk; at least two mice per age group were tested), indicating that CD55 down-regulation is not merely a consequence of age and progressive dystrophic changes in muscle. Skeletal muscle tissues obtained from two additional dysferlin-deficient mouse strains (A/J and Dysf−/−) at 16 wk of age also revealed the absence of DAF/CD55 (Fig. 2, B and C). Protein expression of DAF/CD55 in SJL/J myocardial tissue was not different from that in C57/BL6 control mice (Fig. 2, E and F).

FIGURE 2.

DAF/CD55 protein expression in dysferlin deficiency. Immunofluorescence staining using anti-DAF/CD55 Abs. A–D, Murine skeletal muscle. A–D have the same scale as indicated in B. E and F, Murine cardiac muscle. E and F have the same scale as indicated in F. G and H, Human skeletal muscle. G and H have the same scale as indicated in H. A, SJL/J, wk 28; B, A/J wk 16; C, Dysf−/−, wk 16; D, C57BL/6; E, SJL/J; F, C57BL/6; G, LGMD2B patient 2 (Table III); H, control skeletal muscle without detectable neuromuscular disorder.

FIGURE 2.

DAF/CD55 protein expression in dysferlin deficiency. Immunofluorescence staining using anti-DAF/CD55 Abs. A–D, Murine skeletal muscle. A–D have the same scale as indicated in B. E and F, Murine cardiac muscle. E and F have the same scale as indicated in F. G and H, Human skeletal muscle. G and H have the same scale as indicated in H. A, SJL/J, wk 28; B, A/J wk 16; C, Dysf−/−, wk 16; D, C57BL/6; E, SJL/J; F, C57BL/6; G, LGMD2B patient 2 (Table III); H, control skeletal muscle without detectable neuromuscular disorder.

Close modal

We next studied skeletal muscle from four patients with dysferlin-deficient muscular dystrophy (LGMD2B). The diagnosis of LGMD2B was confirmed by the absence of dysferlin in immunohistochemical staining, in Western blot analysis, and by genomic sequencing of DYSF (Table III). All patients had reduced sarcolemmal CD55 expression compared with normal skeletal muscle (Fig. 2, G and H). The degree of down-regulation of CD55 varied between patients, from trace staining to complete absence. Staining for CD46 and CD59, two other complement inhibitory molecules, was normal in all patients and controls (not shown).

Table III.

Patients with limb girdle muscular dystrophy 2Ba

PatientGeneAgeSexAllelesMutation
DYSF 52 Homozygous c.4022T > C 
DYSF 43 Heterozygous c.855 + 1delG 
    Heterozygous c.895G > A 
DYSF 39 Heterozygous c.855 + 1delG 
    Heterozygous c.895G > A 
DYSF 32 Heterozygous c.1448C > A 
    Heterozygous c.6350T > A 
PatientGeneAgeSexAllelesMutation
DYSF 52 Homozygous c.4022T > C 
DYSF 43 Heterozygous c.855 + 1delG 
    Heterozygous c.895G > A 
DYSF 39 Heterozygous c.855 + 1delG 
    Heterozygous c.895G > A 
DYSF 32 Heterozygous c.1448C > A 
    Heterozygous c.6350T > A 
a

The mutations are submitted to the Leiden Muscular Dystrophy Database (〈http://dmd.nl〉). The MIAME-compliant microarray data are available at 〈www.ncbi.nlm.nih.gov/geo〉 under accession no. GSE2507.

The expression of DAF/CD55 in human skeletal muscle was also analyzed at the RNA level by TaqMan analysis. Compared with four control specimens from healthy individuals, DAF/CD55 mRNA in LGMD2B was 2.1-fold reduced (Fig. 1, E and F).

Functionally, the absence of CD55 should lead to an increased sensitivity against complement-mediated lysis. Human myotube cultures obtained from normal (n = 2) and dysferlin-deficient human skeletal muscle (n = 3; at least two independent experiments per patient) were established and exposed to complement-mediated lysis. Lysed and dead cells were identified by PI uptake. Normal human myotubes were resistant to complement-mediated lysis (Fig. 3, A and B). This effect could be partially inhibited by preincubation with anti-CD55 Ab (Fig. 3,C). On the contrary, myoblasts and myotubes obtained from patients with dysferlin deficiency were highly susceptible to complement attack (Fig. 3, A and D). The percentage of lysed cells was not altered by the addition of anti-CD55 mAb (Fig. 3 E).

FIGURE 3.

Complement lysis assay and binding of C5b9-MAC to nonnecrotic muscle cells. A, Quantification of PI uptake of myotubes after exposure to complement (ratio of PI-positive cells after exposure to complement to Veronal buffer control). n, number of wells counted. Normal human (B and C) and dysferlin-deficient (D and E) human myoblasts after exposure to complement (B and D) and after preincubation with anti-CD55 Ab and subsequent exposure to complement (C and E). F and G, Serial sections of quadriceps muscle in LGMD2B (patient 1), demonstrating dystrophic changes with increase in connective tissue and pathological variation in fiber size (Gomori-TriChrome stain). There was sarcolemmal expression of C5b9-MAC on nonnecrotic muscle fibers. Staining was performed with anti-C5b9 mAb and Cy3-labeled donkey anti-mouse Ab.

FIGURE 3.

Complement lysis assay and binding of C5b9-MAC to nonnecrotic muscle cells. A, Quantification of PI uptake of myotubes after exposure to complement (ratio of PI-positive cells after exposure to complement to Veronal buffer control). n, number of wells counted. Normal human (B and C) and dysferlin-deficient (D and E) human myoblasts after exposure to complement (B and D) and after preincubation with anti-CD55 Ab and subsequent exposure to complement (C and E). F and G, Serial sections of quadriceps muscle in LGMD2B (patient 1), demonstrating dystrophic changes with increase in connective tissue and pathological variation in fiber size (Gomori-TriChrome stain). There was sarcolemmal expression of C5b9-MAC on nonnecrotic muscle fibers. Staining was performed with anti-C5b9 mAb and Cy3-labeled donkey anti-mouse Ab.

Close modal

In immunohistochemistry, the presence of the C5b9 MAC on the surface of nonnecrotic muscle fibers was demonstrated in four of four muscle specimens obtained from dysferlin-deficient patients (Fig. 3, F and G).

To elucidate possible regulatory mechanisms of DAF/CD55 in dysferlin deficiency, we concluded that if DAF/CD55 down-regulation in dysferlin deficiency only plays a role in skeletal muscle, but not in heart, there should be genes that 1) are differentially expressed in dysferlin-deficient skeletal muscle and cardiac tissue and 2) regulate DAF/CD55. Indeed, within the microarray data obtained from dysferlin-deficient SJL/J mice, a small group of differentially expressed and potentially regulatory genes was identified: myostatin, SMAD2, SMAD3, SMAD4, cardiac ankyrin repeat protein (CARP), and early growth response 1 (EGR1). Therefore, the expression of these genes was quantified in skeletal and cardiac tissues by TaqMan RT-PCR in SJL/J mice and also in skeletal muscle from patients with dysferlin-deficient muscular dystrophy. In both mice and patients, compared with controls, myostatin, SMAD3, and SMAD4 were significantly down-regulated in skeletal muscle (Fig. 4,A). In the heart, SMAD and myostatin were not differentially expressed in SJL/J and C57BL/6 mice (not shown). On the protein level, because of the availability of Abs, only phosphorylated SMAD2 was investigated, and it could be shown to also be markedly reduced in LGMD2B (Fig. 4,B) compared with normal controls (Fig. 4,C). CARP and EGR1 were strikingly up-regulated in skeletal muscle (Fig. 4 A) and were reduced in heart (down-regulation of 2.5- and 4-fold in left and right ventricles, respectively).

FIGURE 4.

Expression of regulatory factors in skeletal muscle of dysferlin-deficient patients and SJL/J mice (aged 20–30 wk). A, Unpooled TaqMan analysis of myostatin, SMAD3, SMAD4, CARP, and EGR1 (only human). The y-axis demonstrates the fold change compared with healthy individuals and C57BL/6 mice, respectively. B and C, Double-immunofluorescent staining of SMAD2 protein (FITC) and nuclear membrane with anti-lamin A/C mAb (Cy3) on dysferlin-deficient (patient 4, Table III; B) and normal (C) human skeletal muscle.

FIGURE 4.

Expression of regulatory factors in skeletal muscle of dysferlin-deficient patients and SJL/J mice (aged 20–30 wk). A, Unpooled TaqMan analysis of myostatin, SMAD3, SMAD4, CARP, and EGR1 (only human). The y-axis demonstrates the fold change compared with healthy individuals and C57BL/6 mice, respectively. B and C, Double-immunofluorescent staining of SMAD2 protein (FITC) and nuclear membrane with anti-lamin A/C mAb (Cy3) on dysferlin-deficient (patient 4, Table III; B) and normal (C) human skeletal muscle.

Close modal

To investigate whether any of these identified, differentially expressed, regulatory genes might influence DAF/CD55 expression, the DAF/CD55 promoter sequence (20) was analyzed for transcription factor binding sites using the MATInspector program (Genomatix) (21). This analysis revealed a binding site for the SMAD complex, GTCTgggct (22, 23, 24), indicating that SMAD might influence DAF/CD55 expression. Among the 291 differentially expressed genes in skeletal muscle, we could not identify other SMAD-regulated genes that are known to have significance for muscular dystrophies.

The objective of our study was the investigation of differential pathways in cardiac and skeletal muscles that protect one tissue and render the other susceptible to damage within a single organism. This approach might help to identify relevant pathways and possible candidates for therapeutic intervention. Dysferlin-deficient muscular dystrophy appeared to be a suitable model for this approach, because dysferlin is expressed in skeletal and cardiac muscles, but, clinically, the heart is thought to be unaffected in LGMD2B (25, 26). We demonstrate down-regulation of DAF/CD55 on mRNA and protein levels in dysferlin-deficient mice and LGMD2B patients, leading to activation of the MAC of the complement cascade on skeletal muscle cells. In vitro, dysferlin-deficient human myotubes are highly susceptible to complement attack, whereas normal human myoblasts/myotubes are not (19). The underlying mechanism appears to be a lack of myostatin, leading to down-regulation of SMAD proteins, with a negative effect on DAF/CD55 expression.

DAF/CD55 inhibits complement activation by interfering with C3 and C5 in the classical and alternative pathway (27). It is absent in paroxysmal nocturnal hemoglobinuria (28, 29), contributing to an increased sensitivity of RBC and platelets to complement attack (30). Transgenic expression of DAF/CD55 is used in xenotransplantation to prevent complement-mediated hyperacute rejection (31). Interestingly, DAF/CD55 also suppresses T cell immunity, either locally or systemically (32). It is well known that some muscular dystrophies, such as dysferlin-deficient muscular dystrophy, studied in this report, or facioscapulohumeral muscular dystrophy, might exhibit inflammatory changes in muscle that may cause histological confusion with primary inflammatory muscle diseases such as polymyositis (33, 34, 35, 36). A local lack of DAF/CD55 may contribute to these changes.

Several possibilities exist about the mechanism of DAF/CD55 down-regulation in dysferlin deficiency. DAF/CD55 is a GPI-anchored protein (37). The absence of sarcolemmal CD55/DAF might therefore be secondary to GPI anchor deficiency. This is well documented in paroxysmal nocturnal hemoglobinuria (38, 39) and was also proposed in diabetic retinopathy in humans and rats (40), but in dysferlin deficiency, down-regulation of DAF/CD55 in skeletal muscle does not seem to be dependent on the GPI anchoring of DAF protein; DAF/CD55 is reduced not only on the protein level but also, strikingly, on the mRNA level. This cannot be caused by the release of CD55 from the membrane by GPI-specific phospholipase D or C (41, 42). Furthermore, DAF2 that is not GPI anchored but a transmembrane murine protein (43) was also down-regulated. The fact that DAF/CD55 down-regulation could be demonstrated in SJL/J mice of all age groups between 12 and 34 wk excludes the possibility that this phenomenon is merely a consequence of muscle degeneration and regeneration. Other muscular dystrophies and inflammatory myopathies with prominent necrotic and regenerating changes do not display the C5b9 MAC on the surface of nonnecrotic muscle fibers (10).

The regulation of DAF/CD55 is not fully understood. Several cytokines, such as TNF-α (44, 45), IFN-γ (44), TGF-β (46), vascular endothelial growth factor (47) and basic fibroblast growth factor (48), induce DAF/CD55. Furthermore, CD55 is up-regulated by PGE2 on colon cancer cells (49). We therefore analyzed the promoter sequence of CD55 (20) for putative transcription factor binding sites that are differentially expressed in skeletal and cardiac muscles. Interestingly, the promoter sequence of human CD55 contains a SMAD-binding element. Phosphorylated SMAD2 and -3 proteins combine with SMAD4 and translocate into the nucleus as a result of activation of the activin II receptor by myostatin (22, 23, 24). In this investigation, SMAD2, -3, and -4 are shown to be markedly down-regulated in dysferlin deficiency, and the hypothetical influence on CD55 transcription is intriguing. Additional studies are in progress to identify the exact mechanism by which dysferlin, myostatin, SMAD, and CD55 interact.

Myostatin, or growth and differentiation factor 8, is a member of the TGF-β superfamily (50) and a negative regulator of muscle mass (reviewed in Ref.51). Its effect on muscle cells includes induction of cell arrest (52, 53) and inhibition of differentiation of myoblasts into myotubes (54). It is not resolved whether myostatin predominantly acts as an autocrine or a paracrine factor. In myogenic cell lines, myostatin appears to function in an autocrine fashion (55). The role of endogenous myostatin in muscular dystrophies has not been investigated. However, mutations in the gene encoding myostatin lead to a marked increase in muscle mass (50, 56), demonstrated in myostatin knockout mice, in cattle, and in a single pediatric patient (57, 58, 59). The muscle hypertrophy has raised some hope about the possible suitability of myostatin as a therapeutic target in muscular dystrophies (60).

This study identifies down-regulation of CD55 and subsequent deposition of MAC on nonnecrotic muscle cells as functionally relevant factors of muscle cell injury in dysferlin deficiency. It is tempting to speculate on possible therapeutic options for this to date untreatable disorder. For example, eculizumab, a humanized chimeric Ab against C5, was found to be effective in paroxysmal nocturnal hemoglobinuria (61). More unspecifically, i.v. Igs have been shown to interfere with complement factors C3a and C5a (62, 63) and might inhibit complement activation on muscle cells in dysferlin deficiency.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by research grants from the Humboldt University (to S.S. and K.-J.O.).

2

The mutations are submitted to the Leiden Muscular Dystrophy Database (〈http://dmd.nl〉). The MIAME-compliant microarray data are available at 〈www.ncbi.nlm.nih.gov/geo〉 under accession no. GSE2507.

4

Abbreviations used in this paper: LGMD2B, limb girdle muscular dystrophy 2B; CARP, cardiac ankyrin repeat protein; DAF, decay-accelerating factor; EGR1, early growth response 1; MAC, membrane attack complex; PI, propidium iodide.

1
Anderson, L. V., K. Davison, J. A. Moss, C. Young, M. J. Cullen, J. Walsh, M. A. Johnson, R. Bashir, S. Britton, S. Keers, et al
1999
. Dysferlin is a plasma membrane protein and is expressed early in human development.
Hum. Mol. Genet.
8
:
855
.-861.
2
Bansal, D., K. Miyake, S. S. Vogel, S. Groh, C. C. Chen, R. Williamson, P. L. McNeil, K. P. Campbell.
2003
. Defective membrane repair in dysferlin-deficient muscular dystrophy.
Nature
423
:
168
.-172.
3
Lennon, N. J., A. Kho, B. J. Bacskai, S. L. Perlmutter, B. T. Hyman, R. H. Brown, Jr.
2003
. Dysferlin interacts with annexins A1 and A2 and mediates sarcolemmal wound-healing.
J. Biol. Chem.
278
:
50466
.-50473.
4
Liu, J., M. Aoki, I. Illa, C. Wu, M. Fardeau, C. Angelini, C. Serrano, J. A. Urtizberea, F. Hentati, M. B. Hamida, et al
1998
. Dysferlin, a novel skeletal muscle gene, is mutated in Miyoshi myopathy and limb girdle muscular dystrophy.
Nat. Genet.
20
:
31
.-36.
5
Bittner, R. E., L. V. Anderson, E. Burkhardt, R. Bashir, E. Vafiadaki, S. Ivanova, T. Raffelsberger, I. Maerk, H. Hoger, M. Jung, et al
1999
. Dysferlin deletion in SJL mice (SJL-Dysf) defines a natural model for limb girdle muscular dystrophy 2B.
Nat. Genet.
23
:
141
.-142.
6
Vafiadaki, E., A. Reis, S. Keers, R. Harrison, L. V. Anderson, T. Raffelsberger, S. Ivanova, H. Hoger, R. E. Bittner, K. Bushby, et al
2001
. Cloning of the mouse dysferlin gene and genomic characterization of the SJL-Dysf mutation.
NeuroReport
12
:
625
.-629.
7
Kostek, C. A., J. A. Dominov, J. B. Miller.
2002
. Up-regulation of MHC class I expression accompanies but is not required for spontaneous myopathy in dysferlin-deficient SJL/J mice.
Am. J. Pathol.
160
:
833
.-839.
8
Matsubara, S., T. Kitaguchi, A. Kawata, K. Miyamoto, H. Yagi, S. Hirai.
2001
. Experimental allergic myositis in SJL/J mouse. Reappraisal of immune reaction based on changes after single immunization.
J. Neuroimmunol.
119
:
223
.-230.
9
Ho, M., C. M. Post, L. R. Donahue, H. G. Lidov, R. T. Bronson, H. Goolsby, S. C. Watkins, G. A. Cox, R. H. Brown, Jr.
2004
. Disruption of muscle membrane and phenotype divergence in two novel mouse models of dysferlin deficiency.
Hum. Mol. Genet.
13
:
1999
.-2010.
10
Spuler, S., A. G. Engel.
1998
. Unexpected sarcolemmal complement membrane attack complex deposits on nonnecrotic muscle fibers in muscular dystrophies.
Neurology
50
:
41
.-46.
11
Selcen, D., G. Stilling, A. G. Engel.
2001
. The earliest pathologic alterations in dysferlinopathy.
Neurology
56
:
1472
.-1481.
12
Walport, M. J..
2001
. Complement: second of two parts.
N. Engl. J. Med.
344
:
1140
.-1144.
13
Walport, M. J..
2001
. Complement: first of two parts.
N. Engl. J. Med.
344
:
1058
.-1066.
14
Pangburn, M. K., H. J. Muller-Eberhard.
1984
. The alternative pathway of complement.
Springer Semin. Immunopathol.
7
:
163
.-192.
15
Morgan, B. P..
1999
. Regulation of the complement membrane attack pathway.
Crit. Rev. Immunol.
19
:
173
.-198.
16
Livak, K. J., T. D. Schmittgen.
2001
. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method.
Methods
25
:
402
.-408.
17
Spiller, O. B., C. L. Harris, B. P. Morgan.
1999
. Efficient generation of monoclonal antibodies against surface-expressed proteins by hyperexpression in rodent cells.
J. Immunol. Methods
224
:
51
.-60.
18
Blau, H. M., C. Webster.
1981
. Isolation and characterization of human muscle cells.
Proc. Natl. Acad. Sci. USA
78
:
5623
.-5627.
19
Gasque, P., B. P. Morgan, J. Legoedec, P. Chan, M. Fontaine.
1996
. Human skeletal myoblasts spontaneously activate allogeneic complement but are resistant to killing.
J. Immunol.
156
:
3402
.-3411.
20
Ewulonu, U. K., L. Ravi, M. E. Medof.
1991
. Characterization of the decay-accelerating factor gene promoter region.
Proc. Natl. Acad. Sci. USA
88
:
4675
.-4679.
21
Quandt, K., K. Grote, T. Werner.
1996
. GenomeInspector: a new approach to detect correlation patterns of elements on genomic sequences.
Comput. Appl. Biosci.
12
:
405
.-413.
22
Yingling, J. M., M. B. Datto, C. Wong, J. P. Frederick, N. T. Liberati, X. F. Wang.
1997
. Tumor suppressor Smad4 is a transforming growth factor β-inducible DNA binding protein.
Mol. Cell. Biol.
17
:
7019
.-7028.
23
Zawel, L., J. L. Dai, P. Buckhaults, S. Zhou, K. W. Kinzler, B. Vogelstein, S. E. Kern.
1998
. Human Smad3 and Smad4 are sequence-specific transcription activators.
Mol. Cell
1
:
611
.-617.
24
Dennler, S., S. Itoh, D. Vivien, P. ten Dijke, S. Huet, J. M. Gauthier.
1998
. Direct binding of Smad3 and Smad4 to critical TGFβ-inducible elements in the promoter of human plasminogen activator inhibitor-type 1 gene.
EMBO J.
17
:
3091
.-3100.
25
Bushby, K. M..
2000
. Dysferlin and muscular dystrophy.
Acta Neurol. Belg.
100
:
142
.-145.
26
Laval, S. H., K. M. Bushby.
2004
. Limb-girdle muscular dystrophies–from genetics to molecular pathology.
Neuropathol. Appl. Neurobiol.
30
:
91
.-105.
27
Miwa, T., W. C. Song.
2001
. Membrane complement regulatory proteins: insight from animal studies and relevance to human diseases.
Int. Immunopharmacol.
1
:
445
.-459.
28
Nicholson-Weller, A., J. P. March, S. I. Rosenfeld, K. F. Austen.
1983
. Affected erythrocytes of patients with paroxysmal nocturnal hemoglobinuria are deficient in the complement regulatory protein, decay accelerating factor.
Proc. Natl. Acad. Sci. USA
80
:
5066
.-5070.
29
Pangburn, M. K., R. D. Schreiber, H. J. Muller-Eberhard.
1983
. Deficiency of an erythrocyte membrane protein with complement regulatory activity in paroxysmal nocturnal hemoglobinuria.
Proc. Natl. Acad. Sci. USA
80
:
5430
.-5434.
30
Rosse, W. F., S. Hoffman, M. Campbell, M. Borowitz, J. O. Moore, C. J. Parker.
1991
. The erythrocytes in paroxysmal nocturnal haemoglobinuria of intermediate sensitivity to complement lysis.
Br. J. Haematol.
79
:
99
.-107.
31
McCurry, K. R., D. L. Kooyman, C. G. Alvarado, A. H. Cotterell, M. J. Martin, J. S. Logan, J. L. Platt.
1995
. Human complement regulatory proteins protect swine-to-primate cardiac xenografts from humoral injury.
Nat. Med.
1
:
423
.-427.
32
Liu, J., T. Miwa, B. Hilliard, Y. Chen, J. D. Lambris, A. D. Wells, W. C. Song.
2005
. The complement inhibitory protein DAF (CD55) suppresses T cell immunity in vivo.
J. Exp. Med.
201
:
567
.-577.
33
Confalonieri, P., L. Oliva, F. Andreetta, R. Lorenzoni, P. Dassi, E. Mariani, L. Morandi, M. Mora, F. Cornelio, R. Mantegazza.
2003
. Muscle inflammation and MHC class I up-regulation in muscular dystrophy with lack of dysferlin: an immunopathological study.
J. Neuroimmunol.
142
:
130
.-136.
34
Gallardo, E., R. Rojas-Garcia, N. De Luna, A. Pou, R. H. Brown, Jr, I. Illa.
2001
. Inflammation in dysferlin myopathy: immunohistochemical characterization of 13 patients.
Neurology
57
:
2136
.-2138.
35
Fanin, M., C. Angelini.
2002
. Muscle pathology in dysferlin deficiency.
Neuropathol. Appl. Neurobiol.
28
:
461
.-470.
36
Arahata, K., T. Ishihara, H. Fukunaga, S. Orimo, J. H. Lee, K. Goto, I. Nonaka.
1995
. Inflammatory response in facioscapulohumeral muscular dystrophy (FSHD): immunocytochemical and genetic analyses.
Muscle Nerve
2
:
S56
.-S66.
37
Caras, I. W., G. N. Weddell, M. A. Davitz, V. Nussenzweig, D. W. Martin, Jr.
1987
. Signal for attachment of a phospholipid membrane anchor in decay accelerating factor.
Science
238
:
1280
.-1283.
38
Medof, M. E., T. Kinoshita, R. Silber, V. Nussenzweig.
1985
. Amelioration of lytic abnormalities of paroxysmal nocturnal hemoglobinuria with decay-accelerating factor.
Proc. Natl. Acad. Sci. USA
82
:
2980
.-2984.
39
Kawakami, Z., H. Ninomiya, J. Tomiyama, T. Abe.
1990
. Deficiency of glycosyl-phosphatidylinositol anchored proteins on paroxysmal nocturnal haemoglobinuria (PNH) neutrophils and monocytes: heterogeneous deficiency of decay-accelerating factor (DAF) and CD16 on PNH neutrophils.
Br. J. Haematol.
74
:
508
.-513.
40
Zhang, J., C. Gerhardinger, M. Lorenzi.
2002
. Early complement activation and decreased levels of glycosylphosphatidylinositol-anchored complement inhibitors in human and experimental diabetic retinopathy.
Diabetes
51
:
3499
.-3504.
41
Li, J. Y., K. Hollfelder, K. S. Huang, M. G. Low.
1994
. Structural features of GPI-specific phospholipase D revealed by proteolytic fragmentation and Ca2+ binding studies.
J. Biol. Chem.
269
:
28963
.-28971.
42
Metz, C. N., G. Brunner, N. H. Choi-Muira, H. Nguyen, J. Gabrilove, I. W. Caras, N. Altszuler, D. B. Rifkin, E. L. Wilson, M. A. Davitz.
1994
. Release of GPI-anchored membrane proteins by a cell-associated GPI-specific phospholipase D.
EMBO J.
13
:
1741
.-1751.
43
Spicer, A. P., M. F. Seldin, S. J. Gendler.
1995
. Molecular cloning and chromosomal localization of the mouse decay-accelerating factor genes: duplicated genes encode glycosylphosphatidylinositol-anchored and transmembrane forms.
J. Immunol.
155
:
3079
.-3091.
44
Mason, J. C., H. Yarwood, K. Sugars, B. P. Morgan, K. A. Davies, D. O. Haskard.
1999
. Induction of decay-accelerating factor by cytokines or the membrane-attack complex protects vascular endothelial cells against complement deposition.
Blood
94
:
1673
.-1682.
45
Ahmad, S. R., E. A. Lidington, R. Ohta, N. Okada, M. G. Robson, K. A. Davies, M. Leitges, C. L. Harris, D. O. Haskard, J. C. Mason.
2003
. Decay-accelerating factor induction by tumour necrosis factor-α, through a phosphatidylinositol-3 kinase and protein kinase C-dependent pathway, protects murine vascular endothelial cells against complement deposition.
Immunology
110
:
258
.-268.
46
Cocuzzi, E. T., D. S. Bardenstein, A. Stavitsky, N. Sundarraj, M. E. Medof.
2001
. Upregulation of DAF (CD55) on orbital fibroblasts by cytokines: differential effects of TNF-β and TNF-α.
Curr. Eye Res.
23
:
86
.-92.
47
Mason, J. C., R. Steinberg, E. A. Lidington, A. R. Kinderlerer, M. Ohba, D. O. Haskard.
2004
. Decay-accelerating factor induction on vascular endothelium by vascular endothelial growth factor (VEGF) is mediated via a VEGF receptor-2 (VEGF-R2)- and protein kinase C-α/ε (PKCα/ε)-dependent cytoprotective signaling pathway and is inhibited by cyclosporin A.
J. Biol. Chem.
279
:
41611
.-41618.
48
Mason, J. C., E. A. Lidington, S. R. Ahmad, D. O. Haskard.
2002
. bFGF and VEGF synergistically enhance endothelial cytoprotection via decay-accelerating factor induction.
Am. J. Physiol.
282
:
C578
.-C587.
49
Holla, V. R., D. Wang, J. R. Brown, J. R. Mann, S. Katkuri, R. N. Dubois.
2005
. Prostaglandin E2 regulates the complement inhibitor CD55/decay-accelerating factor in colorectal cancer.
J. Biol. Chem.
280
:
476
.-483.
50
McPherron, A. C., A. M. Lawler, S. J. Lee.
1997
. Regulation of skeletal muscle mass in mice by a new TGF-β superfamily member.
Nature
387
:
83
.-90.
51
Tobin, J. F., A. J. Celeste.
2005
. Myostatin, a negative regulator of muscle mass: implications for muscle degenerative diseases.
Curr. Opin. Pharmacol.
5
:
328
.-332.
52
Thomas, M., B. Langley, C. Berry, M. Sharma, S. Kirk, J. Bass, R. Kambadur.
2000
. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation.
J. Biol. Chem.
275
:
40235
.-40243.
53
McFarlane, C., B. Langley, M. Thomas, A. Hennebry, E. Plummer, G. Nicholas, C. McMahon, M. Sharma, R. Kambadur.
2005
. Proteolytic processing of myostatin is auto-regulated during myogenesis.
Dev. Biol.
283
:
58
.-69.
54
McCroskery, S., M. Thomas, L. Maxwell, M. Sharma, R. Kambadur.
2003
. Myostatin negatively regulates satellite cell activation and self-renewal.
J. Cell Biol.
162
:
1135
.-1147.
55
Rios, R., S. Fernandez-Nocelos, I. Carneiro, V. M. Arce, J. Devesa.
2004
. Differential response to exogenous and endogenous myostatin in myoblasts suggests that myostatin acts as an autocrine factor in vivo.
Endocrinology
145
:
2795
.-2803.
56
Patel, K., H. Amthor.
2005
. The function of myostatin and strategies of myostatin blockade-new hope for therapies aimed at promoting growth of skeletal muscle.
Neuromuscul. Disord.
15
:
117
.-126.
57
McPherron, A. C., S. J. Lee.
1997
. Double muscling in cattle due to mutations in the myostatin gene.
Proc. Natl. Acad. Sci. USA
94
:
12457
.-12461.
58
Kambadur, R., M. Sharma, T. P. Smith, J. J. Bass.
1997
. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle.
Genome Res.
7
:
910
.-916.
59
Schuelke, M., K. R. Wagner, L. E. Stolz, C. Hubner, T. Riebel, W. Komen, T. Braun, J. F. Tobin, S. J. Lee.
2004
. Myostatin mutation associated with gross muscle hypertrophy in a child.
N. Engl. J. Med.
350
:
2682
.-2688.
60
Bogdanovich, S., T. O. Krag, E. R. Barton, L. D. Morris, L. A. Whittemore, R. S. Ahima, T. S. Khurana.
2002
. Functional improvement of dystrophic muscle by myostatin blockade.
Nature
420
:
418
.-421.
61
Hillmen, P., C. Hall, J. C. Marsh, M. Elebute, M. P. Bombara, B. E. Petro, M. J. Cullen, S. J. Richards, S. A. Rollins, C. F. Mojcik, et al
2004
. Effect of eculizumab on hemolysis and transfusion requirements in patients with paroxysmal nocturnal hemoglobinuria.
N. Engl. J. Med.
350
:
552
.-559.
62
Basta, M..
1996
. Modulation of complement-mediated immune damage by intravenous immune globulin.
Clin. Exp. Immunol.
104
:(Suppl. 1):
21
.-25.
63
Basta, M., F. Van Goor, S. Luccioli, E. M. Billings, A. O. Vortmeyer, L. Baranyi, J. Szebeni, C. R. Alving, M. C. Carroll, I. Berkower, et al
2003
. F(ab)′2-mediated neutralization of C3a and C5a anaphylatoxins: a novel effector function of immunoglobulins.
Nat. Med.
9
:
431
.-438.