The recent description of virus-induced fish IFNs has raised questions about the evolution of this complex antiviral system. Identification of the receptor of the zebrafish virus-induced IFN (zIFN) was sought to help resolve these questions. We set up an experimental system to study the zIFN system in the course of a viral infection of zebrafish embryos. In this setting, zIFN was induced by viral infection, and we identified zIFN-dependent induced transcripts. Embryos quickly died from the infection, but zIFN overexpression increased their survival. We took advantage of this experimental system to perform in vivo loss and gain of function analysis of candidate receptors of the class II helical receptor family and identified zCRFB1 and zCRFB5 as the two subunits of the zebrafish IFN receptor. Based on the organization of the zIFN gene and the protein structure of the identified receptor components, the virus-induced fish IFNs appear as orthologs of mammalian IFN-λ, specifying type III IFN as the ancestral antiviral system of vertebrates.

Interferons have been historically described as molecules capable of inducing an antiviral state in treated cells. They are classified as type I, II, or III based on their structural features, receptor usage, and biological activities (1). Type I (α/β/ω/ε/κ in humans) and type III (λ) IFNs are induced by viral infections. They use different receptor complexes, but signal through the same Jak/STAT pathway involving Jak1 and Tyk2 as Jak kinases and the STAT family members STAT-1, -2, -3, and -4 (2, 3, 4, 5). Their biological activities are also similar and include antiviral activities and up-regulation of MHC class I Ag expression. Inactivation of the IFN type I system in knockout mice revealed that it is mainly involved in innate antiviral defense (6). In contrast, type II IFN-γ is not primarily induced by viruses, although it also has antiviral activity. IFN-γ is an immunomodulatory cytokine that signals through a distinct receptor complex leading mainly to the mobilization of STAT1 (7). The clearest criteria to distinguish the different types of IFNs are their gene structure and the composition of their receptor. Type I IFNs are encoded by genes with no introns, type II IFNs by genes with three introns, and type III IFNs by genes with four introns (as IL-10, -19, -20, -22, -24, -26, which make up the class II helical cytokine family along with IFNs (8)). In mice and humans, all cells express IFN α, β, and omega receptor (IFNAR4)1 and IFNAR2, the two transmembrane components of the type I IFNR. IFN-γ binds a receptor made up of two specific chains, IFN-γ receptor (IFNGR)1 and IFNGR2. The IFN-λ receptor (IFNLR) is made up of IL-10R2 expressed by all cells, and IFNLR1 expressed only by some cell types. IFN-λ therefore signals only on a limited number of cell types. IL-10R2 is also part of the IL-10R, IL-22R, and IL-26R complexes (8).

IFNs are restricted to vertebrates and have been studied mainly in birds and mammals (9). In teleost fish, the induction of an acid-resistant IFN-like activity by viruses was first described in the early 1970s (10). Recent advances in fish genomics allowed the description and preliminary molecular characterization of fish IFNs. Type II IFNs are the most conserved, and they have now been described in many fish species (11, 12). Although human and mice have a single gene coding for IFN-γ, some teleosts (including zebrafish) have more than one gene, but in all instances these genes have three introns. In contrast, the designation of fish virus-induced IFNs has been more problematic and most authors merely called them “IFN” (13, 14). Based on their similarity with mammalian IFNs some authors call them type I IFNs (15, 16, 17, 18, 19). In contrast, we previously showed that these IFNs are encoded by genes with four introns, suggesting that they are type III IFNs (20), but definitive conclusion should await the identification of their receptor complex. Depending on the species, fish have one or two virus-induced IFN genes; zebrafish only has one, to which we refer as “zIFN” (zebrafish virus-induced IFN) in this study.

To date, the receptor complexes of virus-induced fish IFNs remain unknown, and the mechanisms of their in vivo activity are still poorly characterized. To get insight into the fish antiviral IFN origin and functions, we set up an experimental virus infection system in zebrafish embryos before the appearance of any B or T cells (21). Zebrafish genes orthologous to trout VHSV (viral hemorrhagic septicemia virus)-induced genes were characterized and used as a readout for zIFN activity during the course of the infection. With this system, we knocked down candidate genes for the zIFN receptor subunits using specific morpholinos. Our results identify the zIFN receptor and clearly designate fish virus-induced IFN as a type III IFN.

For zebrafish viral infections, SVCV (22) was chosen as a rhabdovirus pathogenic for cyprinids including zebrafish (23). The SVCV strain corresponds to the type I serogroup of spring viremia viruses (24). SVCV was propagated in monolayer cultures of Epithelioma papulosum cyprini cells at 30°C. The virus was microinjected in dechorionated zebrafish embryos anesthetized with tricaine and set in a lateral position inside V-shaped agarose channels (25). Intravenous injections were performed in the caudal vein just posterior to the urogenital opening. Before injection, a SVCV stock was thawed, diluted to the appropriate concentration (usually 107 PFU/ml) in PBS containing 0.1% phenol red. Typical injected volume was 3 nl.

While performing injections, we noticed that virus infectivity tended to diminish when left for too long in the microinjection capillary at room temperature; in additional experiments the capillary was put on ice whenever possible, which restored consistency.

Following injection, embryos were rinsed once with fish water (Volvic source water with 0.3 μg/ml methylene blue). For survival experiments, embryos were transferred to individual wells in 24-well plates (1 ml of fish water/embryo) and incubated at 24°C. For gene induction measurements, embryos were kept in small groups of ∼10 embryos in 10 ml of fish water in 6-well plates and incubated at either 24 or 28°C.

The same strategy as that used for Tetraodon (20) was used for the analysis of Version 5 of the assembly of the zebrafish genome (www.ensembl.org/Danio_rerio). It was extended to the analysis of available expressed sequence tags (EST). Consistency of the gene models was checked using Version 6. Total RNAs from 3 to 30 pooled zebrafish embryos were prepared using the Macherey-Nagel NucleoSpin RNA kit. Oligo(dT)-primed reverse transcriptions were done using Moloney murine leukemia virus reverse transcriptase. Quantitative RT-PCRs were performed using homemade SYBR Green mix in a LightCycler instrument (Roche), as described in Lutfalla and Uzé (26). Results are displayed as mean measure values with error bars showing 95% confidence intervals in a Student t test. The primers used are listed in supporting information Table I.

Table I.

Primer sequences and annealing temperaturesa

NameSequenceT°CAccession No.
zIFN5 ACGACAGAATCTCTGAACCT   
zIFN.53 TCTTAATACACGCAAAGATGAGAACT   
zIFN.54 GCCTGAAATACGTTGGAATCA  BI708494 
zIFN3 GTCAGGACTAAAAACTTCAC 65 AJ544821 
zGAPDH5 ACTTTGTCATCGTTGAAGGT   
zGAPDH3 TGTCAGATCCACAACAGAGA 65 BC115131 
zvig1.5 CGCCATCAGAGCATCCAGT   
zvig1.3 TTCCACACCAACATCCAGAA 65 EF014961 
VPCN5 GATTGGGATTCAGGGAGAGA   
VPCN3 AGCAAAGTCCGGTATGTAGT 65 U18101 
zCRFB1.31 CACAGTACTGAACACCAGGCT   
zCRFB1.50 GAATATCAGCATCTCTCTACCCAA 65 EF014952 
zCRFB5.5 AGTATGTGCTGCACTGGGA   
zCRFB5.3 TAGATGCCCAAGTAGAAGA 65 EF014955 
zCRFB6.5 GCAGAGGATAAATGGTACAACGT   
zCRFB6.31 GATGTTCTCCATGTTCTTTCTCCAA 65 EF014956 
zActp6 TCGACTGGGTTAGTTGGCAT   
zActp2 GAGTGAAGATCTTCTCAGCGT 65 EF014962 
zMXA5 GGAGAATCAGTTACAAAACCT   
zMXA3 GATTGTCTCTTGCCTTGTAACA 65 NM_182942 
zMXB51 TAAGGAGTAAAGAGGATGAG   
zMXB3 CCAGATTGATTGTTTCCTGCT 65 AJ544824 
zMXC5.52 GGAAAGAGTTCAGTGCTGGA   
zMXC3 TTTGATGAACTTTTCAATAAGATC 60 NM_001007284 
zMXE5 TGAAGATGGCATCCACAGTT   
zMXE3 TCTTTCTGCAAGCAGGGGT 65 AJ544827 
zTNFalp.5 GCAGCATGGTGAGATACGAA   
zTNFalp.3 GTTGGAATGCCTGATCCACA 65 BC116495 
zvig6.5 CCTGGTTATCTGGTCATCGA   
zvig6.3 CATGAATCCAAACACACAGCT 65 NM_001006049 
zvig7.5 GCTTCTTGTCAGTTTAGCTGT   
zvig7.3 CCAGCTCCATTCTTCAGCGT 65 EB953258 
zRPB11.5 GATCACACACTGGGAAACATCA   
zRPB11.3 CTATCCCCTCCTGCTTGTCT 65 XM_678410 
zThymosinβ1.5 CCATTCACTGCTTTACGCTCAA   
zThymosinβ1.3 CTGCTGTGTTACAGACGTCAT 60 NM_205581 
zTymosinβ2.5 CACTTCTGTGCCCTACGCAA   
zThymosinβ2.3 TCCTAGGTTACGGAGTAGCA 65 XM_701286 
zIkBa5 GGAGACAATATGCGAGCCTT   
zIkBa3 TTCTGTGACAACGGCCAGAT 70 AY163840 
zIC06.51 CTCTAACGTTGCTCACAGCTT   
zIC06.31 CTCCATCAATGACATGCTGCTT 65 XM_680694 
zIC07.51 TGAGAGACCCACCGAACTA   
zIC07.30 TGGTTCTTCAGCTCCTCGAT 65 NM_200964 
zIC08.5 CTATGATGCCACGTATGAGACTA   
zIC08.3 GATATCGTCCATACCATTCACTT 65 AY398324 
zV01.51 TCCACCAGCACAGAAGGAT   
zV01.3 ATAGTCGAGCCTGTCGAAGTA 65 BC095651 
zV04.5 CTTTGGCACTAGTGTTCTTGACA   
zV04.3 ATTGGTTCAGGTCAGCAGGTT 65 BC122173 
zV05.5 GGTGACGCAGAGCCGTAAT   
zV05.3 CTGCCGATCTCCATACCCAT 65 CO917623 
zV08.5 TCATAGGACCACAGACGCAA   
zV08.3 ACATACTCTCCATAATCGAGCTT 65 BC092875 
NameSequenceT°CAccession No.
zIFN5 ACGACAGAATCTCTGAACCT   
zIFN.53 TCTTAATACACGCAAAGATGAGAACT   
zIFN.54 GCCTGAAATACGTTGGAATCA  BI708494 
zIFN3 GTCAGGACTAAAAACTTCAC 65 AJ544821 
zGAPDH5 ACTTTGTCATCGTTGAAGGT   
zGAPDH3 TGTCAGATCCACAACAGAGA 65 BC115131 
zvig1.5 CGCCATCAGAGCATCCAGT   
zvig1.3 TTCCACACCAACATCCAGAA 65 EF014961 
VPCN5 GATTGGGATTCAGGGAGAGA   
VPCN3 AGCAAAGTCCGGTATGTAGT 65 U18101 
zCRFB1.31 CACAGTACTGAACACCAGGCT   
zCRFB1.50 GAATATCAGCATCTCTCTACCCAA 65 EF014952 
zCRFB5.5 AGTATGTGCTGCACTGGGA   
zCRFB5.3 TAGATGCCCAAGTAGAAGA 65 EF014955 
zCRFB6.5 GCAGAGGATAAATGGTACAACGT   
zCRFB6.31 GATGTTCTCCATGTTCTTTCTCCAA 65 EF014956 
zActp6 TCGACTGGGTTAGTTGGCAT   
zActp2 GAGTGAAGATCTTCTCAGCGT 65 EF014962 
zMXA5 GGAGAATCAGTTACAAAACCT   
zMXA3 GATTGTCTCTTGCCTTGTAACA 65 NM_182942 
zMXB51 TAAGGAGTAAAGAGGATGAG   
zMXB3 CCAGATTGATTGTTTCCTGCT 65 AJ544824 
zMXC5.52 GGAAAGAGTTCAGTGCTGGA   
zMXC3 TTTGATGAACTTTTCAATAAGATC 60 NM_001007284 
zMXE5 TGAAGATGGCATCCACAGTT   
zMXE3 TCTTTCTGCAAGCAGGGGT 65 AJ544827 
zTNFalp.5 GCAGCATGGTGAGATACGAA   
zTNFalp.3 GTTGGAATGCCTGATCCACA 65 BC116495 
zvig6.5 CCTGGTTATCTGGTCATCGA   
zvig6.3 CATGAATCCAAACACACAGCT 65 NM_001006049 
zvig7.5 GCTTCTTGTCAGTTTAGCTGT   
zvig7.3 CCAGCTCCATTCTTCAGCGT 65 EB953258 
zRPB11.5 GATCACACACTGGGAAACATCA   
zRPB11.3 CTATCCCCTCCTGCTTGTCT 65 XM_678410 
zThymosinβ1.5 CCATTCACTGCTTTACGCTCAA   
zThymosinβ1.3 CTGCTGTGTTACAGACGTCAT 60 NM_205581 
zTymosinβ2.5 CACTTCTGTGCCCTACGCAA   
zThymosinβ2.3 TCCTAGGTTACGGAGTAGCA 65 XM_701286 
zIkBa5 GGAGACAATATGCGAGCCTT   
zIkBa3 TTCTGTGACAACGGCCAGAT 70 AY163840 
zIC06.51 CTCTAACGTTGCTCACAGCTT   
zIC06.31 CTCCATCAATGACATGCTGCTT 65 XM_680694 
zIC07.51 TGAGAGACCCACCGAACTA   
zIC07.30 TGGTTCTTCAGCTCCTCGAT 65 NM_200964 
zIC08.5 CTATGATGCCACGTATGAGACTA   
zIC08.3 GATATCGTCCATACCATTCACTT 65 AY398324 
zV01.51 TCCACCAGCACAGAAGGAT   
zV01.3 ATAGTCGAGCCTGTCGAAGTA 65 BC095651 
zV04.5 CTTTGGCACTAGTGTTCTTGACA   
zV04.3 ATTGGTTCAGGTCAGCAGGTT 65 BC122173 
zV05.5 GGTGACGCAGAGCCGTAAT   
zV05.3 CTGCCGATCTCCATACCCAT 65 CO917623 
zV08.5 TCATAGGACCACAGACGCAA   
zV08.3 ACATACTCTCCATAATCGAGCTT 65 BC092875 
a

zActp6 and p2 were used to amplify the zebrafish β-actin promoter (elongation time 5 min). All other primers were used for quantitative RT-PCR: denaturation time 0 s, annealing 10 s at the indicated temperature (5 s in case of 70°C), and 15 s elongation at 72°C. T, Temperature.

Wild-type AB zebrafish were purchased from the Zebrafish International Resource Center (ZIRC) as embryos and raised to adulthood in our facilities. Only fish directly from ZIRC or their F1 offspring were used as egg producers to avoid inbreeding effects.

Morpholino oligonucleotides were purchased from Gene Tools. Their sequences are given in Table II. They were dissolved and kept in morpholino buffer (KCl 120 mM, HEPES 20 mM (pH7.2)) at −20°C. After thawing, the morpholino was heated at 65°C for 10 min to ensure complete dissolution. Morpholinos were diluted to the desired concentration in morpholino buffer + 0.1% phenol red and coinjected with a reporter, either dextran-10000 rhodamine (Molecular Probes) or the Act26:mCherryF plasmid. Developing embryos were observed at 24 h postfertilization (hpf) under a fluorescence stereomicroscope, and poorly fluorescent embryos were discarded. Except for experiments with zebrafish CRBF (zCRFB)4 and zCRFB5-specific morpholinos, misshapen embryos (usually no more than 20%) were also systematically discarded. The typical morpholino concentration for injection was 500 μM (200 μM for moCRFB4&5-AUG), and typical injected volume was 1 nl (hence yielding 4 ng).

Table II.

Sequences of morpholino oligonucleotides used in this study

NameSequence of Morpholinos
moIFN-AUG AAATATAGGTCCACATCTTTGCGTG 
moIFNS-splice CTGGTCCTCCACCTGTAATGCAATG 
moCRFB1-AUG CAGTGTATGATGATGATGTCTTCAT 
moCRFB1-splice CGCCAAGATCATACCTGTAAATAA 
moCRFB2-splice CTATGAATCCTCACCTAGGGTAAAC 
moCRFB4-AUG GAAAAACTGATAAAAGCGGACATTC 
moCRFB5-AUG CAGGGCACACTCCTCCATGATCCGC 
moCRFB5-splice AGAGCGTATCCTCACCGTGTTTATC 
moCRFB6-AUG GTCATTTCGACAAATATAAATCCAC 
moCRFB7-AUG AACAAATCCACAAGGTCCAATCCAT 
moCRFB8-AUG ACAGGTCGATAAAACTACATCCATC 
NameSequence of Morpholinos
moIFN-AUG AAATATAGGTCCACATCTTTGCGTG 
moIFNS-splice CTGGTCCTCCACCTGTAATGCAATG 
moCRFB1-AUG CAGTGTATGATGATGATGTCTTCAT 
moCRFB1-splice CGCCAAGATCATACCTGTAAATAA 
moCRFB2-splice CTATGAATCCTCACCTAGGGTAAAC 
moCRFB4-AUG GAAAAACTGATAAAAGCGGACATTC 
moCRFB5-AUG CAGGGCACACTCCTCCATGATCCGC 
moCRFB5-splice AGAGCGTATCCTCACCGTGTTTATC 
moCRFB6-AUG GTCATTTCGACAAATATAAATCCAC 
moCRFB7-AUG AACAAATCCACAAGGTCCAATCCAT 
moCRFB8-AUG ACAGGTCGATAAAACTACATCCATC 

The zebrafish β-actin promoter (4.8 kb including 60 bp of the first noncoding exon) was amplified from wild-type DNA using Phusion high-fidelity polymerase from Finnzymes using primers zActp6 and p2 (see Table I) and cloned in the Bluescript vector with two meganuclease sites (27). The open reading frame (ORF) encoding a farnesylated membrane-anchored version of monomeric-RFP1 or mCherry (28) together with SV40 poly(A) signal was inserted downstream of the β-actin promoter to yield pAct26mCherry-F or pAct26mRFP-F. Plasmids for the in vivo expression of zIFN-λ and the different candidate receptors were obtained by inserting the corresponding ORFs between the promoter and the mCherry (IFN) or mRFP-F (CRFBs) ORF to yield pAct26zIFN and pAct26zCRFB1-6. The accession numbers of the complete sequences of the expression vectors are EF014962-7.

Sanders et al. (23) have shown that adult zebrafish are susceptible to experimental waterborne infection by SVCV. To exploit the genetic tractability of zebrafish embryos and their lack of adaptive immunity, we conducted infections of zebrafish embryos and early larvae aged 1–6 days postfertilization (dpf). With dechorionated embryos aged up to 3 dpf, no symptoms were observed after a bath exposition to SVCV (up to 107 PFU/ml overnight). In contrast, early swimming larvae were clearly susceptible to waterborne infection; in a typical experiment, 17 of 24 larvae aged 5.3 dpf died following an overnight exposure at 24°C to 107 PFU/ml SVCV in water; the bulk of death occurred between 48 and 65 h postinfection (hpi). The stage at which zebrafish become susceptible to SVCV in water correlates with onset of respiratory movements following opening of the mouth and gill slits, suggesting that SVCV may infect zebrafish larvae via the gills.

In zebrafish, gene knockdown is easily accomplished by microinjection of modified antisense oligonucleotides (morpholinos) at the zygote stage (29). However, this approach is efficient for no more than 1 wk postfertilization, making waterborne infection of larvae inadequate in this case. Therefore, we attempted to infect embryos by an i.v. route. Most experiments were conducted with 30- or 54-hpf embryos. Microinjecting the virus in the caudal vein was found to be extremely efficient, even at very low doses: the 50% lethal dose was ∼2 PFU for 30-hpf embryos and 8 PFU for 54-hpf embryos (Table III).

Table III.

Mortality of zebrafish embryos following i.v. inoculation of various amounts of SVCVa

Embryo age at the time of infection30 HPF54 HPF
Injection dose (per embryo)1 PFU3 PFU3 PFU10 PFU30 PFU
n 24 26 14 14 12 
Dead embryos 72 hpi 10 18 12 11 
Embryo age at the time of infection30 HPF54 HPF
Injection dose (per embryo)1 PFU3 PFU3 PFU10 PFU30 PFU
n 24 26 14 14 12 
Dead embryos 72 hpi 10 18 12 11 
a

Nearly all deaths occurred between 24 and 48 hpi. All embryos still alive at 72 hpi survived for >1 wk.

For the following experiments, we typically injected 30 PFU into 54-hpf embryos. With these settings, when embryos were incubated at 24°C following infection, the first overt sign of infection was the slowing down of blood flow, starting at ∼18 hpi. Complete arrest of blood flow (with the heart still beating) was observed at ∼22 hpi. Death generally occurred between 25 and 32 hpi.

In addition to these clinical signs, expression of the SVCV viral nucleoprotein was measured by quantitative RT-PCR. Embryos were infected i.v. at 54 hpf, and mRNA was extracted 2 or 24 hpi. A massive induction of viral N gene expression was typically observed, illustrating efficient viral replication (Fig. 1 A).

FIGURE 1.

zIFN-induced gene expression in SVCV-infected zebrafish embryos. A, Quantification of SVCV mRNA encoding the nucleoprotein 2 or 24 h after SVCV i.v. injection (30 PFU at 54 hpf) (measured ratio of SVCV-N cDNA:GAPDH cDNA). B and E, Quantification by RT-PCR of total zIFN mRNA measured at either 2 or 24 h after either no injection (control), mock injection (PBS), or SVCV injection (30 PFU at 54 hpf). C, Structure of the zIFN gene and structure of the corresponding cDNAs in infected and uninfected fish. Boxes indicate exons, with ▪ for coding exons. Broken lines indicate introns. D, Quantitative RT-PCR of zIFN mRNA using primers (53 and 3) matching only the functional mRNA (measured 24 h after iv injection of either PBS or 30 PFU SVCV at 54 h hpf). F, Effect of zIFN-specific morpholino injection on SVCV-induced vig1/viperin expression. Embryos were injected at the one-cell stage with either 4 ng of morpholino or nothing and i.v. infected with SVCV (30 pfu at 54 hpf) or not (control). Quantification by RT-PCR was done at 24 hpi.

FIGURE 1.

zIFN-induced gene expression in SVCV-infected zebrafish embryos. A, Quantification of SVCV mRNA encoding the nucleoprotein 2 or 24 h after SVCV i.v. injection (30 PFU at 54 hpf) (measured ratio of SVCV-N cDNA:GAPDH cDNA). B and E, Quantification by RT-PCR of total zIFN mRNA measured at either 2 or 24 h after either no injection (control), mock injection (PBS), or SVCV injection (30 PFU at 54 hpf). C, Structure of the zIFN gene and structure of the corresponding cDNAs in infected and uninfected fish. Boxes indicate exons, with ▪ for coding exons. Broken lines indicate introns. D, Quantitative RT-PCR of zIFN mRNA using primers (53 and 3) matching only the functional mRNA (measured 24 h after iv injection of either PBS or 30 PFU SVCV at 54 h hpf). F, Effect of zIFN-specific morpholino injection on SVCV-induced vig1/viperin expression. Embryos were injected at the one-cell stage with either 4 ng of morpholino or nothing and i.v. infected with SVCV (30 pfu at 54 hpf) or not (control). Quantification by RT-PCR was done at 24 hpi.

Close modal

We first assessed whether SVCV infection induces zIFN expression in zebrafish embryos. Following infection at 54 hpf, RNAs were prepared 24 hpi and zIFN mRNA levels were monitored by reverse transcription-quantitative PCR (Fig. 1,B). The zIFN gene is composed of 5 exons separated by four phase-0 introns (20). We first measured the amount of zIFN cDNA using a pair of primers mapping to the end of exon 1 and to exon 3, respectively (primers 5 and 3 are shown in Fig. 1,C). As can be seen in Fig. 1,B, zIFN was induced by SVCV infection. However, constitutive expression of the zIFN gene seemed fairly high and the level of induction after SVCV infection fairly low (<1 log). To check the nature of the mRNA produced, 5′ and 3′RACE were performed on the zIFN mRNA from either uninfected or SVCV-infected embryos. This analysis revealed that, in uninfected embryos, the zIFN mRNA includes an additional 5′ exon (exon 1′) that is spliced to an internal acceptor site downstream of the first AUG codon of exon 1, the downstream exons being correctly spliced (Fig. 1 C). The first in-frame AUG codon on this constitutive zIFN mRNA being downstream of the leader peptide, it cannot code for a secreted IFN (GenBank accession no. EF014960).

Upon viral infection, another promoter is used downstream, and 5 exons are spliced together to yield a mRNA encoding a functional IFN (Fig. 1 C).

Interestingly, the only EST available in GenBank for zIFN (EST no. BI708494), which was sequenced from a library built from a noninfected fish, corresponds to the nonfunctional mRNA. Two similar nonfunctional mRNAs have been described in channel catfish (IFN-1 and 3) (18). Bergan et al. (30) recently identified two IFN genes in Atlantic salmon, each with two potential promoters, an upstream one that is “hardly induced” and a downstream one that can be strongly induced by polyinosinic-polycytidylic acid. Alternative promoter usage and splicing of virus-induced IFNs after viral infection thus appears as a general mechanism in teleosts. It is reminiscent of the situation recently described for the Adar1, Irgd, and Irga6 genes in mouse where two different promoters, one constitutive and one IFN inducible, lie ahead of alternative first exons (31, 32).

To quantify the induction of the functional zIFN mRNA, another 5′ primer (primer 53) was designed just upstream of the ATG start codon. Quantitative RT-PCR analyses were performed using primers 53 and 3. As shown in Fig. 1 D, the functional zIFN mRNA that represents <10% of total zIFN mRNA in uninfected embryos was induced >100 times after viral infection. In contrast, the amount of nonfunctional mRNA remained unchanged after viral infection (data not shown).

Our results probably explain why, in a model of snakehead rhabdovirus infection, Phelan et al. (14) only found a very modest zIFN mRNA increase despite strong MX induction.

In mammals and birds, IFNs induce the up-regulation of many downstream genes (33), some of which, such as 2–5 A synthetase, RNA-dependent PKR, RNase L, and MXA, have a well-established antiviral activity. Several of these genes (such as 2–5 A synthetase and PKR) have no clear homolog in zebrafish. To broaden the list of genes usable as IFN response markers, we performed a systematic search for orthologs of genes previously shown to be induced by VHSV in rainbow trout (34, 35). By genome and EST database mining followed by RACE amplifications, we identified a vig-1 ortholog in zebrafish, which we call vig1/viperin (GenBank accession no. EF014961). Interestingly, stable expression of the vig-1/viperin human homolog in fibroblasts (36) inhibits productive human cytomegalovirus infection, down-regulating several human CMV structural proteins essential for viral assembly (37). Orthologs of several other vig genes were similarly identified (see Table I and Fig. 2).

FIGURE 2.

Quantitative RT-PCR analysis of the effect of a zIFN-specific morpholino on gene induction during SVCV infection of zebrafish embryos. Embryos were injected at the one-cell stage with 0, 4, 8, or 12 ng of moIFN-AUG and infected i.v. with SVCV (30 PFU) or not at 54 hpf. For each condition, six embryos were lysed at 24 hpi to prepare total RNAs that were reverse transcribed. At that time point, all injected embryos were still alive. The eight reverse transcriptions were used to measure the amount of cDNA for the 19 genes (18 genes of interest plus GAPDH).

FIGURE 2.

Quantitative RT-PCR analysis of the effect of a zIFN-specific morpholino on gene induction during SVCV infection of zebrafish embryos. Embryos were injected at the one-cell stage with 0, 4, 8, or 12 ng of moIFN-AUG and infected i.v. with SVCV (30 PFU) or not at 54 hpf. For each condition, six embryos were lysed at 24 hpi to prepare total RNAs that were reverse transcribed. At that time point, all injected embryos were still alive. The eight reverse transcriptions were used to measure the amount of cDNA for the 19 genes (18 genes of interest plus GAPDH).

Close modal

The mRNA levels for several of these genes were measured by quantitative by RT-PCR in cDNA samples obtained from infected zebrafish embryos 24 hpi. The studied genes fall in two groups: those that are induced after infection (zIFN, vig1/viperin, IκBα, MXA, MXB, MXC, MXE, and the homologs of TNF-α) and those that are not (cofilin2, RPB11, Thymosineβ, et al.) (Fig. 2). Vig1/viperin was selected for further analysis because it was highly expressed and the quantification of its mRNA by RT-PCR was robust (Fig 2).

To test for the involvement of zIFN in the induction of the virus-induced genes, zebrafish embryos were injected at the one-cell stage with an antisense morpholino (moIFN-AUG) directed against the start AUG of the zIFN mRNA. Embryos were then i.v. infected by SVCV at 54 hpf. The effect of moIFN on virus-induced gene expression was assessed by quantitative RT-PCR. moIFN-AUG had no detectable effect on development (data not shown). However, the induction of vig1/viperin, MXA, and MXB by SVCV was totally abrogated in the presence of moIFN-AUG (Fig. 2), indicating that virus-induced expression of these transcripts requires zIFN induction in zebrafish embryos. These results contrast with data reported in human, trout, and carp, where vig1/viperin expression was not fully IFN-dependent (34, 36, 37, 38); however, vig1/viperin induction in a mouse dendritic cell line by the pseudorabies virus was strictly dependent on IFN synthesis (39). Therefore, depending on the infection system, vig1/viperin induction may depend fully or only partially on IFN. In zebrafish embryos, a second zIFN-specific morpholino (moIFN-splice) targeted to a splice site led to the same result as moIFN-AUG (data not shown), confirming that the vig1/viperin and MXA/B transcripts were not directly induced by the virus in this system. Induction of these genes thus is a good indicator of zIFN activity.

Because SVCV-induced death is so fast in zebrafish embryos, direct loss-of-function analysis of resistance genes was difficult to perform. This result prompted us to attempt to increase the resistance of embryos by overexpressing the functional form of zIFN. The corresponding cDNA was cloned downstream of the zebrafish β-actin promoter in a vector with a SV40 polyadenylation site. The vector (called pAct26zIFN) was injected at the zygote stage. Coinjection of a similar plasmid (pAct26mCherry-F) encoding a membrane-anchored form of the monomeric fluorescent protein mCherry allowed the sorting of correctly injected embryos at 24 hpf. RNAs were prepared from injected embryos at either 24 or 72 hpf, and the levels of functional zIFN and vig1/viperin mRNAs were measured by quantitative RT-PCR. As shown in Fig. 3,A, zIFN mRNA was efficiently transcribed from the injected plasmid and stimulated the accumulation of the IFN inducible vig1/viperin mRNA (Fig. 3 B). The full vig1/viperin response at either 24 or 72 h suggests that the IFN signal is not limiting in these conditions.

FIGURE 3.

Overexpression of zIFN protects embryos against viral infection. Embryos at the one-cell stage were either not injected (no plasmid), injected with 12 pg of a mCherry-producing plasmid (cherry), or injected with 12 pg of a mixture of mCherry and zIFN-producing plasmids (IFN). A and B, Levels of functional IFN mRNA or vig1/viperin mRNA measured at 24 or 72 hpf. C, Survival curves following infection at 54 hpf with 30 PFU of SVCV.

FIGURE 3.

Overexpression of zIFN protects embryos against viral infection. Embryos at the one-cell stage were either not injected (no plasmid), injected with 12 pg of a mCherry-producing plasmid (cherry), or injected with 12 pg of a mixture of mCherry and zIFN-producing plasmids (IFN). A and B, Levels of functional IFN mRNA or vig1/viperin mRNA measured at 24 or 72 hpf. C, Survival curves following infection at 54 hpf with 30 PFU of SVCV.

Close modal

To test the effect of zIFN overexpression on the susceptibility of embryos to SVCV infection, zygotes were injected with both Act26zIFN and Act26mCherry plasmid. The embryos were sorted for mCherry expression at 24 hpf, then infected in a blind experiment with 30 PFU of SVCV at 54 hpf. A sizable fraction of IFN-injected embryos were found to be more resistant to the virus, as determined by the timing of blood flow arrest or death time course (Fig. 3 C). Most of them, however, finally succumbed to the infection.

Like all IFNs, the virally induced fish IFN that we study is a member of the class II helical cytokine family. Based on knowledge in mammals, we postulated that the receptor complex that accommodates this cytokine consists of two chains belonging to the CRFB family. Among fish, we previously described this family of receptors (CRFB 1–9) in Tetraodon nigroviridis (20). In zebrafish, we analyzed the latest assembly version of the genome and we identified eight members of the CRFB family. The corresponding cDNAs were cloned by 5′ and 3′ RACE and sequenced (GenBank accession nos. EF014952EF014959). The deduced structure of zCRFB family members is depicted in Fig. 4 A. According to our analysis, CRFB3 is lacking from the zebrafish genome. Because CRFB9 is in fact a soluble receptor similar to IL-22BP, and because, in addition, we cannot detect its expression during zebrafish development, we excluded it from the repertoire of potential components of the zIFN receptor. We therefore focused on the seven candidates left, and analyzed their contribution to zIFN responsiveness in the developing zebrafish embryo.

FIGURE 4.

Identification of the transmembrane components of the zIFN receptor. A, Schematic drawing of the eight members of the helical cytokine receptor family in zebrafish. All have a single D200 ligand binding domain and, except CRFB9, are transmembrane proteins with an intracellular domain of varying length. B, Effect of CRFB-specific morpholino injections on zIFN-induced vig1/viperin expression in zebrafish embryos. Embryos were injected at the one-cell stage with 4 ng of the indicated morpholino (or none) and 6 pg of Act26zIFN plasmid (IFN) (or none). All quantifications were done by RT-PCR at 72 hpf except those marked by an ∗, done at 24 hpf. C, Effect of receptor overexpression on zIFN-induced vig1/viperin expression in 24-hpf embryos. Embryos were injected at the one-cell stage with 6 pg of a mixture of plasmids driving expression of the indicated proteins. D, Survival curves of embryos infected at 54 hpf with 30 PFU of SVCV, following injection at the one-cell stage with a mixture of morpholino and plasmids as in B.

FIGURE 4.

Identification of the transmembrane components of the zIFN receptor. A, Schematic drawing of the eight members of the helical cytokine receptor family in zebrafish. All have a single D200 ligand binding domain and, except CRFB9, are transmembrane proteins with an intracellular domain of varying length. B, Effect of CRFB-specific morpholino injections on zIFN-induced vig1/viperin expression in zebrafish embryos. Embryos were injected at the one-cell stage with 4 ng of the indicated morpholino (or none) and 6 pg of Act26zIFN plasmid (IFN) (or none). All quantifications were done by RT-PCR at 72 hpf except those marked by an ∗, done at 24 hpf. C, Effect of receptor overexpression on zIFN-induced vig1/viperin expression in 24-hpf embryos. Embryos were injected at the one-cell stage with 6 pg of a mixture of plasmids driving expression of the indicated proteins. D, Survival curves of embryos infected at 54 hpf with 30 PFU of SVCV, following injection at the one-cell stage with a mixture of morpholino and plasmids as in B.

Close modal

For this purpose, we devised a strategy consisting of the injection of antisense morpholinos targeting the different receptor candidates in embryos overexpressing zIFN. Antisense morpholinos were designed against the ATG start codon of zCRFB1, -4, -5, -6, -7, and -8. Due to the difficulty in assigning the correct ATG start codon for zCRFB2, a splice morpholino was used for this gene. Morpholinos were injected at the zygote stage together with the pAct26zIFN and pAct26mCherry-F plasmids. Correctly injected embryos were then sorted according to red fluorescence. MoCRFB4 and moCRFB5 induced an important developmental delay, and injected embryos died within 72 h of development. RNAs from embryos injected with these morpholinos were therefore prepared at 24 hpf. The other morpholinos had no effect on development, and the corresponding RNAs were prepared at 72 hpf. As shown in Fig. 4 B, moCRFB1 and moCRFB5 have a dramatic effect on zIFN responsiveness, whereas the five other morpholinos have no effect. These results were reproduced with another set of morpholinos targeting splice sites of zCRFB1 and zCRFB5 (data not shown). The results were quite similar for both types of morpholinos, but the developmental problems induced by injection of moCRFB5 were milder with the splice-targeted morpholino. zCRFB1 and zCRFB5 can therefore be designated as the two subunits of the IFN receptor.

zCRFB1 and zCRFB5 are both expressed throughout development, but the steady-state level of zCRFB5 mRNA is much higher than that of zCRFB1 (data not shown). By in situ hybridization, zCRFB1 mRNA was undetectable from 1 to 72 hpf, whereas zCRFB5 expression was ubiquitous (Fig. 5). We tested the possibility that one or both of these transmembrane proteins may be limiting for IFN responsiveness. The corresponding ORFs were cloned in an expression vector downstream of the zebrafish β-actin (plasmids pAct26zCRFB1 and pAct26CRFB5). A control vector with the zCRFB6 ORF was also constructed (pAct26zCR FB6). These vectors were coinjected with pAct26zIFN and pAct26mCherry-F in zebrafish embryos at the zygote stage. Correct expression of the different transgenes was checked (data not shown), and induction of the vig1/viperin mRNA at 24 hpf was used as a measure of zIFN responsiveness. As shown in Fig. 4 C, vig1/viperin gene expression was significantly up-regulated in embryos injected with pAct26zCRFB1, but not in embryos injected with pAct26CRFB5 or with the control plasmid pAct26CRFB6. The level of expression of zCRFB1 is therefore limiting for the response to zIFN, unlike that of zCRFB5.

FIGURE 5.

zCRFB5 expression during zebrafish embryogenesis and early larval stages. In situ hybridization was performed with antisense (top panels) or control sense (bottom panels) zCRFB5 probes at various developmental stages. A, Strong maternal expression is detected in all blastomeres at the eight-cell stage. B, Still ubiquitous expression of zCRFB5 at the shield stage. C, Weak ubiquitous expression at the 3-somite stage, with a somewhat stronger signal in the head region. D, Ubiquitous expression at the 17-somite stage. E, Ubiquitous expression at 24 hpf. F and G, Weak ubiquitous expression at 48 hpf, with prominent expression throughout the head. H, Weak ubiquitous expression at 72 hpf, somewhat stronger in the anterior region, and strong expression in the heart region.

FIGURE 5.

zCRFB5 expression during zebrafish embryogenesis and early larval stages. In situ hybridization was performed with antisense (top panels) or control sense (bottom panels) zCRFB5 probes at various developmental stages. A, Strong maternal expression is detected in all blastomeres at the eight-cell stage. B, Still ubiquitous expression of zCRFB5 at the shield stage. C, Weak ubiquitous expression at the 3-somite stage, with a somewhat stronger signal in the head region. D, Ubiquitous expression at the 17-somite stage. E, Ubiquitous expression at 24 hpf. F and G, Weak ubiquitous expression at 48 hpf, with prominent expression throughout the head. H, Weak ubiquitous expression at 72 hpf, somewhat stronger in the anterior region, and strong expression in the heart region.

Close modal

To assess the contribution of zCRFB1 in zIFN-mediated resistance to the virus in vivo, embryos were injected at the 1- to 2-cell stage with a mixture of plasmids (either pAct26zIFN plus pAct26mCherry or pAct26mCherry alone) and morpholinos knocking down the translation of either zCRFB1 or, as a control, zCRFB7 (due to the developmental arrest of moCRFB5-injected embryos, it was not possible to perform a similar experiment with CRFB5). Embryos were sorted at 24 hpf according to red fluorescence. Following i.v. injection of SVCV at 54 hpf, the increased resistance of IFN-overexpressing embryos was clear in the control moCRFB7-injected embryos. In contrast, zIFN-induced resistance was completely abolished in moCRFB1-injected embryos (Fig. 4 D). The experiment was replicated with splice-targeted morpholinos directed against zCRFB1 and zCRFB2 as a control (data not shown). These data demonstrate that zCRFB1 is required for the antiviral activity of zIFN, confirming its designation as a subunit of the zIFN receptor.

Mammals have three types of IFNs: type I (IFN-α/β/ω/ε/κ in humans) and type III (IFN-λ) are induced by viral infection, whereas type II (IFN-γ) is mainly a Th1 cytokine involved in both acquired and innate immunity (1). These different types of IFN can easily be distinguished based on their gene structure and receptor composition. Due to the high degree of sequence divergence among IFNs, their genes have remained unknown in fish species until the availability of entirely sequenced genomes. Genes encoding proteins similar to mammalian IFN-γ were recently described from several fish genomes, and nonequivocally assigned as type II IFN. In addition, different authors have recently cloned genes encoding virus-induced fish IFN (13, 20). Most teleost species studied so far have a single gene coding for such an IFN, but channel catfish and Atlantic salmon have several (15, 18). Some authors called these molecules “type I IFN” because they had some similarity with mammalian type I IFN and possessed antiviral activity in vitro. However, their receptors have remained unknown so the classification of these cytokines was still to determine.

The candidate genes for the zIFN receptor complex were the members of the CRFB family (8). We identified seven receptor candidates in the zebrafish genome and assessed all of them functionally by morpholino-mediated knockdown in zIFN-overexpressing embryos. This strategy allowed us to identify two transmembrane receptor chains (zCRFB1 and zCRFB5) involved in zIFN signaling. Both have a single extracellular ligand binding domain.

The zebrafish IFN receptor is thus very likely constituted by a heterodimer formed by zCRFB1 and zCRFB5. Structurally speaking, as shown in Fig. 6, a zCRFB1/zCRFB5 dimer is clearly similar to the mammalian IFNLR (IFNLR1/IL-10R2) and not to the type I IFN receptor (IFNAR1/IFNAR2). For the short chain receptors, the phylogenetic tree in Fig. 6,B suggests a smaller distance between zCRFB5 and IL-10R2 than between zCRFB5 and IFNAR1, and for the long chain receptors, a smaller distance between zCRFB1 and human IFNLR1 (hIFNLR1) than between zCRFB1 and IFNAR2. Fig. 6,D shows the alignment of zCRFB1 together with hIFNLR1 and IFNAR2. It is a sample of the alignments that have been used to draw the tree. Despite very low sequence conservation, blocks of conserved residues can be used to obtain the alignment that also illustrates the good conservation of the introns. The alignment of the intracellular domains stresses the difference between the mammalian receptors and their fish homolog, and the presence of an extra exon encoding the N terminus of the mature IFNAR2 proteins highlights the difference of IFNAR2 from zCRFB1 and mammalian IFNLR1s. This extra exon encoding the N terminus of IFNAR2 proteins is present in all known IFNAR2 genes even in birds (40). Similarly, Fig. 6 C highlights the good sequence conservation between zIFN and human λ IFNs and stresses the perfect matching of intron phases and positions. Thus, based on both the gene organization (5 exons) of the zIFN and the protein structure of its receptor subunits, we propose to call this cytokine IFN-λ. Analysis of the recent literature related to fish IFN reveals that all fish species so far analyzed have a homologous IFN-λ system, and no type I IFN system. Therefore, fish most probably do not possess type I IFNs. The easiest explanation for this is that type I IFNs appeared only later during the evolution of tetrapods. We therefore propose that the IFN-λ system is the ancestral virus-induced antiviral system in vertebrates.

FIGURE 6.

Virus-induced IFNs and their receptors in human and zebrafish. A, Schematic representation of the IFNs and their receptors. B, Phylogenetic tree schematically showing the main distances between the receptors. zCRFB1 may be renamed zIFNLR1. C, Sequence alignment of the human λ IFNs with zIFN showing the sequence conservation and the perfect conservation of introns positions and phases. D, Sequence alignment of zCRFB1 with hIFNLR1 and IFNAR2. The transmembrane domain is depicted in bold letters. The extra phase-0 intron in the intracellular domain of zCRFB1 is probably specific to the zebrafish because Tetraodon has no such intron in its CRFB1 gene.

FIGURE 6.

Virus-induced IFNs and their receptors in human and zebrafish. A, Schematic representation of the IFNs and their receptors. B, Phylogenetic tree schematically showing the main distances between the receptors. zCRFB1 may be renamed zIFNLR1. C, Sequence alignment of the human λ IFNs with zIFN showing the sequence conservation and the perfect conservation of introns positions and phases. D, Sequence alignment of zCRFB1 with hIFNLR1 and IFNAR2. The transmembrane domain is depicted in bold letters. The extra phase-0 intron in the intracellular domain of zCRFB1 is probably specific to the zebrafish because Tetraodon has no such intron in its CRFB1 gene.

Close modal

Because one of the receptor chains (zCRFB1) has a long intracellular domain of 288 aa and the other (zCRFB5) has a smaller one (111 aa), following mammalian nomenclature, we propose to rename zCRFB1 as zIFNLR1. The naming of zCRFB5 is more problematic: should it be renamed IL-10R2? Interestingly, morpholinos directed against zIFNLR1 do not affect zebrafish development, whereas those directed against zCRFB5 do. This developmental phenotype suggests that zCRFB5 could be involved in more signaling pathways than zIFNLR1. However, we have not shown that zCRFB5 is involved in IL-10 signaling. These considerations advocate the use of the name zCRFB5 until new data are available.

Based on these results, we propose that the last common ancestor of the clade-encompassing bony fish and mammals (osteichthyans) had a virus-induced IFN system consisting of a single ligand (IFN-λ) signaling on a heterodimeric receptor made of two transmembrane proteins, each with a single D200 ligand binding domain. All osteichthyans kept this ancestral system, some duplicating the ligand genes, but somewhere in the lineage leading to the amniotes, two sets of instrumental events occurred that allowed for the appearance of a new IFN system, type I, that further diversified. The first one was a retrotransposition event that led to IFN genes with no introns; the second one consisted in recombination events that led to the duplication of the receptor genes creating two new receptors, one (IFNAR1) with two D200 ligand binding domains and the other (IFNAR2) with an extended N terminus encoded by a newly acquired exon. In amniotes, this new type I IFN system has superseded the ancestral IFN-λ system as the major innate antiviral system. The present IFN-λ system of mammals can probably be viewed more as a tissue-specific antiviral system (4) and is also clearly involved in the regulation of the adaptative immune system (41). Further diversification of the type I IFN system has mainly consisted in ligand diversification in the context of a fixed receptor architecture (40, 42). This scheme would be compatible with the models of Krause and Pestka (9) for the assignment and evolution of the helical cytokines and their receptors.

The data presented in this study suggest that some class II cytokines (IFN/IL-10 class) may have a developmental function in the zebrafish, because inactivation of zCRFB4 or zCRFB5 blocks the development of zebrafish embryos. It is difficult to assign a mammalian ortholog to either of these receptors, but until now, all tested CRFBs appear to be dispensable for development in mice (6, 43). Interestingly, however, in some mammals, type I IFNs have a function in embryo-maternal communication (44).

Based on the genetic tractability of the zebrafish embryo, the experimental system we set up will ease the investigation of other genes acting downstream of IFN in the antiviral response. This work also paves the way for the in vivo analysis of the function of IL-10 and other related cytokines in the ontogeny of the immune system in fish.

We thank Erik Mogensen, Gilles Uzé, and Frédérique Michel for critical reading of the manuscript. G. Lutfalla is grateful to Alain Ghysen, Christine Dambly-Chaudiere, and Nicolas Cubedo for their help and access to their fish facilities. J.-P. Levraud thanks Emma Colucci-Guyon and Valérie Briolat for their assistance in blind experiments, and Valérie Briolat again for expert fish care. P. Boudinot thanks Pierre de Kinkelin for helpful discussions and Corinne Torhy for excellent technical assistance.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported in part by GENANIMAL/ANR Project 426.

2

The sequences presented in this article have been submitted to GenBank under accession numbers EF014952 to EF014967.

4

Abbreviations used in this paper: IFNAR, IFN α, β, and omega receptor; IFNGR, IFN-γ receptor; IFNLR, IFN-λ receptor; zIFN, zebrafish virus-induced IFN; VHSV, viral hemorrhagic septicemia virus; SVCV, spring viremia of carp virus; CRFB, class II helical cytokine receptor; EST, expressed sequence tag; hpf, hour postfertilization; zCRFB, zebrafish CRFB; ORF, open reading frame; dpf, day postfertilization; hpi, hour postinfection; hIFNLR1, human IFNLR1.

1
Meager, A..
2006
.
The Interferons: Characterization and Application
Wiley-VCH Verlag GmbH and Company, KGaA, Weinheim.
2
van Boxel-Dezaire, A. H., M. R. Rani, G. R. Stark.
2006
. Complex modulation of cell type-specific signaling in response to type I interferons.
Immunity
25
:
361
-372.
3
Lasfar, A., A. Lewis-Antes, S. V. Smirnov, S. Anantha, W. Abushahba, B. Tian, K. Reuhl, H. Dickensheets, F. Sheikh, R. P. Donnelly, et al
2006
. Characterization of the mouse IFN-λ ligand-receptor system: IFN-λs exhibit antitumor activity against B16 melanoma.
Cancer Res.
66
:
4468
-4477.
4
Kotenko, S., R. P. Donnelly.
2006
. Type III interferons: the interferon-λ family. A. Meager, ed.
The Interferons: Characterization and Application
141
-163. Wiley-VCH Verlag GmbH and Company, KGaA, Weinheim.
5
Ank, N., H. West, S. R. Paludan.
2006
. IFN-λ: novel antiviral cytokines.
J. Interferon Cytokine Res.
26
:
373
-379.
6
Müller, U., U. Steinhoff, L. F. L. Reis, S. Hemmi, J. Pavlovic, R. M. Zinkernagel, M. Aguet.
1994
. Functional role of type I and type II interferons in antiviral defense.
Science
264
:
1918
-1921.
7
Boehm, U., T. Klamp, M. Groot, J. C. Howard.
1997
. Cellular responses to interferon-γ.
Annu. Rev. Immunol.
15
:
749
-795.
8
Langer, J. A., E. C. Cutrone, S. Kotenko.
2004
. The class II cytokine receptor (CRF2) family: overview and patterns of receptor-ligand interactions.
Cytokine Growth Factor Rev.
15
:
33
-48.
9
Krause, C. D., S. Pestka.
2005
. Evolution of the class 2 cytokines and receptors, and discovery of new friends and relatives.
Pharmacol. Ther.
106
:
299
-346.
10
de Kinkelin, P., M. Dorson.
1973
. Interferon production in rainbow trout (Salmo gairdneri) experimentally infected with Egtved virus.
J. Gen. Virol.
19
:
125
-127.
11
Igawa, D., M. Sakai, R. Savan.
2006
. An unexpected discovery of two interferon γ-like genes along with interleukin (IL)-22 and -26 from teleost: IL-22 and -26 genes have been described for the first time outside mammals.
Mol. Immunol.
43
:
999
-1009.
12
Milev-Milovanovic, I., S. Long, M. Wilson, E. Bengten, N. W. Miller, V. G. Chinchar.
2006
. Identification and expression analysis of interferon γ genes in channel catfish.
Immunogenetics
58
:
70
-80.
13
Altmann, S. M., M. T. Mellon, D. L. Distel, C. H. Kim.
2003
. Molecular and functional analysis of an interferon gene from the zebrafish, Danio rerio.
J. Virol.
77
:
1992
-2002.
14
Phelan, P. E., M. E. Pressley, P. E. Witten, M. T. Mellon, S. Blake, C. H. Kim.
2005
. Characterization of snakehead rhabdovirus infection in zebrafish (Danio rerio).
J. Virol.
79
:
1842
-1852.
15
Robertsen, B..
2006
. The interferon system of teleost fish.
Fish Shellfish Immunol.
20
:
172
-191.
16
Robertsen, B., V. Bergan, T. Rokenes, R. Larsen, A. Albuquerque.
2003
. Atlantic salmon interferon genes: cloning, sequence analysis, expression, and biological activity.
J. Interferon Cytokine Res.
23
:
601
-612.
17
Wang, L., L. Wang, H. X. Zhang, J. H. Zhang, W. H. Chen, X. F. Ruan, C. Xia.
2006
. In vitro effects of recombinant zebrafish IFN on spring viremia of carp virus and infectious hematopoietic necrosis virus.
J. Interferon Cytokine Res.
26
:
256
-259.
18
Long, S., I. Milev-Milovanovic, M. Wilson, E. Bengten, L. W. Clem, N. W. Miller, V. G. Chinchar.
2006
. Identification and expression analysis of cDNAs encoding channel catfish type I interferons.
Fish Shellfish Immunol.
21
:
42
-59.
19
Novoa, B., A. Romero, V. Mulero, I. Rodriguez, I. Fernandez, A. Figueras.
2006
. Zebrafish (Danio rerio) as a model for the study of vaccination against viral haemorrhagic septicemia virus (VHSV).
Vaccine
24
:
5806
-5816.
20
Lutfalla, G., H. R. Crollius, N. Stange-Thomann, O. Jaillon, K. Mogensen, D. Monneron.
2003
. Comparative genomic analysis reveals independent expansion of a lineage-specific gene family in vertebrates: the class II cytokine receptors and their ligands in mammals and fish.
BMC Genomics
4
:
29
21
Traver, D., P. Herbomel, E. E. Patton, R. D. Murphey, J. A. Yoder, G. W. Litman, A. Catic, C. T. Amemiya, L. I. Zon, N. S. Trede.
2003
. The zebrafish as a model organism to study development of the immune system.
Adv. Immunol.
81
:
253
-330.
22
Fijan, N..
1972
. Infection dropsy in carp: a disease complex. T. Mawdesley, ed.
Diseases of Fish
39
-51. Academic Press, London.
23
Sanders, G. E., W. N. Batts, J. R. Winton.
2003
. Susceptibility of zebrafish (Danio rerio) to a model pathogen, spring viremia of carp virus.
Comp. Med.
53
:
514
-521.
24
Stone, D. M., W. Ahne, K. L. Denham, P. F. Dixon, C. T. Liu, A. M. Sheppard, G. R. Taylor, K. Way.
2003
. Nucleotide sequence analysis of the glycoprotein gene of putative spring viraemia of carp virus and pike fry rhabdovirus isolates reveals four genogroups.
Dis. Aquat. Org.
53
:
203
-210.
25
Westerfield, M..
1993
.
The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Brachydanio rerio)
University of Oregon Press, Eugene.
26
Lutfalla, G., G. Uzé.
2006
. Performing quantitative reverse-transcribed polymerase chain reaction experiments.
Methods Enzymol.
410
:
386
-400.
27
Thermes, V., C. Grabher, F. Ristoratore, F. Bourrat, A. Choulika, J. Wittbrodt, J. S. Joly.
2002
. I-SceI meganuclease mediates highly efficient transgenesis in fish.
Mech. Dev.
118
:
91
-98.
28
Shaner, N. C., R. E. Campbell, P. A. Steinbach, B. N. Giepmans, A. E. Palmer, R. Y. Tsien.
2004
. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein.
Nat. Biotechnol.
22
:
1567
-1572.
29
Nasevicius, A., S. C. Ekker.
2000
. Effective targeted gene ‘knockdown’ in zebrafish.
Nat. Genet.
26
:
216
-220.
30
Bergan, V., S. Steinsvik, H. Xu, O. Kileng, B. Robertsen.
2006
. Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions.
FEBS J.
273
:
3893
-3906.
31
Bekpen, C., J. P. Hunn, C. Rohde, I. Parvanova, L. Guethlein, D. M. Dunn, E. Glowalla, M. Leptin, J. C. Howard.
2005
. The interferon-inducible p47 (IRG) GTPases in vertebrates: loss of the cell autonomous resistance mechanism in the human lineage.
Genome Biol.
6
:
R92
32
George, C. X., M. V. Wagner, C. E. Samuel.
2005
. Expression of interferon-inducible RNA adenosine deaminase ADAR1 during pathogen infection and mouse embryo development involves tissue-selective promoter utilization and alternative splicing.
J. Biol. Chem.
280
:
15020
-15028.
33
Welsh, R. M., G. Sen.
1997
. Nonspecific host responses to viral infections. N. Nathanson, ed.
Viral Pathogenesis
109
-141. Lippincott-Raven, Philadelphia.
34
Boudinot, P., P. Massin, M. Blanco, S. Riffault, A. Benmansour.
1999
. vig-1, a new fish gene induced by the rhabdovirus glycoprotein, has a virus-induced homologue in humans and shares conserved motifs with the MoaA family.
J. Virol.
73
:
1846
-1852.
35
O’Farrell, C., N. Vaghefi, M. Cantonnet, B. Buteau, P. Boudinot, A. Benmansour.
2002
. Survey of transcript expression in rainbow trout leukocytes reveals a major contribution of interferon-responsive genes in the early response to a rhabdovirus infection.
J. Virol.
76
:
8040
-8049.
36
Zhu, H., J. P. Cong, T. Shenk.
1997
. Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsive RNAs.
Proc. Natl. Acad. Sci. USA
94
:
13985
-13990.
37
Chin, K. C., P. Cresswell.
2001
. Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus.
Proc. Natl. Acad. Sci. USA
98
:
15125
-15130.
38
Zhang, Y. B., J. Jiang, Y. D. Chen, R. Zhu, Y. Shi, Q. Y. Zhang, J. F. Gui.
2006
. The innate immune response to grass carp hemorrhagic virus (GCHV) in cultured Carassius auratus blastulae (CAB) cells.
Dev. Comp. Immunol.
31
:
232
-243.
39
Boudinot, P., S. Riffault, S. Salhi, C. Carrat, C. Sedlik, N. Mahmoudi, B. Charley, A. Benmansour.
2000
. Vesicular stomatitis virus and pseudorabies virus induce a vig1/cig5 homologue in mouse dendritic cells via different pathways.
J. Gen. Virol.
81
:
2675
-2682.
40
Reboul, J., K. Gardiner, D. Monneron, G. Uzé, G. Lutfalla.
1999
. Comparative genomic analysis of the interferon/interleukin-10 receptor gene cluster.
Genome Res.
9
:
242
-250.
41
Mennechet, F. J., G. Uzé.
2006
. Interferon-λ-treated dendritic cells specifically induce proliferation of FOXP3-expressing suppressor T cells.
Blood
107
:
4417
-4423.
42
Roberts, R. M., L. Liu, Q. Guo, D. Leaman, J. Bixby.
1998
. The evolution of the type I interferons.
J. Interferon Cytokine Res.
18
:
805
-816.
43
Spencer, S. D., F. Di Marco, J. Hooley, S. Pitts-Meek, M. Bauer, A. M. Ryan, B. Sordat, V. C. Gibbs, M. Aguet.
1998
. The orphan receptor CRF2–4 is an essential subunit of the interleukin 10 receptor.
J. Exp. Med.
187
:
571
-578.
44
Roberts, R. M., A. D. Ealy, A. P. Alexenko, C. S. Han, T. Ezashi.
1999
. Trophoblast interferons.
Placenta
20
:
259
-264.