The transcription factor Pax5 is essential for B cell commitment in the mouse, where it represses lineage-inappropriate gene expression while simultaneously activating the B cell gene expression program. In this study we have performed a global gene expression screen of wild-type and Pax5-deficient pro-B cells in an attempt to identify the crucial Pax5 targets in early B lymphopoiesis. These studies have identified 109 Pax5 targets comprising 61% activated and 39% repressed genes. Interestingly, Pax5 directly regulates the genes encoding a number of transcription factors that are required at the pre-B cell stage of differentiation, including Irf8, Spib, and Ikzf3 (Aiolos), suggesting that a key function of Pax5 is to activate secondary transcription factors that further reinforce the B cell program. Pax5 is also required for the expression of many genes known to be involved in adhesion and signaling, indicating that Pax5 modulates the homing and or migration properties of B cell progenitors. Finally, Pax5 also represses a cohort of genes that are involved in multiple biological processes, many of which are not typically associated with B cells. These include the repression of the adhesion molecule Embigin, which is expressed in bone marrow progenitors, T cells, and myeloid cells but is specifically repressed by Pax5 in B cells.

The B lymphocytes are produced in a stepwise process from self-renewing hemopoietic stem cells (HSCs)5 in the fetal liver and postnatal bone marrow (BM). In recent years it has become apparent that this process is controlled by a complex transcription factor network that both activates lineage-specific gene expression (lineage specification) and restricts the differentiation options of HSCs and their progeny (lineage commitment) (1, 2, 3). Although there has been extensive analysis of the transcription factors that regulate the initial steps in B lymphopoiesis, relatively little is known about the molecular targets of these factors that ultimately mediate the commitment process.

The transcription factor Pax5 is essential for B lymphopoiesis, as development is arrested at an early pro-B cell stage in the BM of Pax5-deficient mice (4, 5). These Pax5−/− pro-B cells can be propagated in vitro in the presence of IL-7 and stromal cells and maintain an early B cell phenotype characterized by the expression of B cell-specific transcripts such as Cd79b (B29), Igll5 (λ5), and VpreB1 and D-J recombination events at the Igh locus (4, 6). Pax5-deficient pro-B cells, however, display a remarkable phenotype in that they are not committed to the B cell lineage and are able to differentiate into virtually all hemopoietic cell lineages in vitro and in vivo (7, 8, 9, 10).

Pax5 promotes B lymphopoiesis by activating B cell-specific genes such as those involved in pre-BCR signaling, including Cd19 (11), Cd79a (mb-1) (4, 12), and Blnk (13), as well as Igll5 and VpreB1 (14). Although the inability to express the pre-BCR was potentially the cause of the developmental block in the absence of Pax5, the introduction of functionally rearranged Igh and chimeric Igh-Igβ transgenes into the Pax5 mutant background was unable to progress B cell development beyond the early pro-B cell stage (15). Pax5 also functions to repress genes whose expression is not usually associated with the B cell program. The Pax5-dependent repression of the csf1r and Notch1 genes illustrates at the molecular level how developmental options are suppressed in committed B lymphocytes, as these cells are no longer responsive to the myeloid cytokine M-CSF or to the T cell-inducing Notch1 ligand Delta-like 1 (7, 16, 17). Pax5 also functions to repress genes associated with multipotency such as Flt3, which, although required for early hemopoiesis, must be silenced by Pax5 to allow B lymphopoiesis to proceed (18). A more global approach to identifying target genes using cDNA microarray technology has confirmed that many Pax5-repressed genes are normally expressed in non-B cell lineages and interestingly found that a number of those are reactivated during the physiological down-regulation of Pax5 during plasma cell differentiation, whereas many B cell-specific genes are positively regulated by Pax5 (19, 20).

As an alternative approach to identify potential Pax5 target genes, we performed a screen of a mature B cell cDNA microarray to compare gene expression between wild-type and Pax5−/− pro-B cells. This screen has resulted in the identification of >100 genes representing both Pax5-activated and -repressed targets, many of which were not detected in the previous studies. These genes are known or predicted to perform a diverse range of functions within the cell and highlight the dual function of Pax5 to repress inappropriate gene expression while further activating essential components of the B cell program.

Pax5−/− (5) mice were maintained on a C57BL/6 background and genotyped as described (4).

Pro-B cell lines were derived and propagated as described (4). The Pax5-estrogen receptor (ER) fusion protein (Pax5ER) and control ER retroviral vectors were introduced into Pax5−/− pro-B cells and activated by 1 μM β-estradiol as previously reported (6). Some experiments were performed in the presence of 50 μg/ml cycloheximide (Sigma-Aldrich).

A B lymphocyte cDNA library was a generous gift from C. Estes and M. Bento Soares of the University of Iowa (Iowa City, IA) (21). The microarray was prepared at the Australian Genome Research Facility (Melbourne, Australia), where the inserts from 10,000 randomly generated clones were PCR amplified, purified, and spotted onto glass slides in duplicate. A second screen with an identical strategy used microarrays printed with the 15,000 clone mouse cDNA library of the National Institute on Aging (NIA 15k) (22). Total RNA was isolated from four pro-B cell lines (108 cells) using TRIzol (Invitrogen Life Technologies) and mRNA isolated using the Oligotex mRNA isolation kit (Qiagen). mRNA (4 μg) was reverse transcribed using SuperScript II (Invitrogen Life Technologies) according to instructions from the manufacturer. The purified cDNA samples were labeled with the fluorescent dye esters N-hydroxysuccinimide (NHS)-Cy3 and NHS-Cy5 (Amersham Biosciences), and the microarrays were hybridized for 16 h at 42°C with each of the fluorescently labeled probes in 25% formamide, 5× SSC, 0.1% SDS, 5 μg/ml Cot-1 DNA (Invitrogen Life Technologies), 10 mg/ml poly(A) (Sigma-Aldrich), and 10 mg/ml salmon sperm DNA (Sigma-Aldrich). Slides were washed at room temperature with 1× SSC plus 0.2% SDS and then 0.1× SSC plus 0.2% SDS followed by two stringent washes (0.1× SSC) before scanning on a GenePix 4000B (Molecular Devices). For the B lymphocyte screen, nine arrays were used to compare one Pax5+/+ and three Pax5−/− pro-B cell lines. For the NIA15k screen, 12 arrays were used to compare Pax5+/+, Pax5−/−, and Rag1−/− pro-B cell lines in a saturated loop design. The scanned microarray images were quantified using SPOT image analysis software (www.hca-vision.com). Statistical analysis of the microarray data used the Bioconductor software package LIMMA (www.bioconductor.org). Quality assessment using MA plots resulted in three of the NIA 15k arrays being discarded due to apparent hybridization problems. Expression values were print-tip loess normalized, with spot quality weights used to down-weight spots with unusually small or large scanned sizes (23). The duplicate spots for each probe were combined using a common correlation algorithm that uses both within and between array variability to assess statistical significance (24). Clones were ranked for differential expression between Pax5−/− and Pax5+/+ using empirical Bayes modified t statistics (25). p values were adjusted for multiple testing using the Benjamini and Hochberg algorithm to control the false discovery rate. Raw data from the NIA 15k arrays is available from the Gene Expression Omnibus (GEO) database (www.ncbi.nlm.nih.gov/projects/geo) as series GSE9345.

Plasmid DNA from differentially expressed clones was prepared and the insert sequenced. Clones identities were determined using the basic local alignment search tool (BLAST).

Total RNA was isolated from sorted B cell populations using TRIzol (Invitrogen Life Technologies) and reverse-transcribed with Moloney murine leukemia virus reverse transcriptase (Promega) according to the manufacturer’s instructions. cDNA was amplified using the gene-specific primers listed in Table I. cDNA input was normalized to Hprt.

Table I.

Oligonucleotide primer sequences used in semiquantitative RT-PCR analysis of potential Pax5 target genesa

Gene5′ Primer Sequence (5′→3′)3′ Primer Sequence (5′→3′)
Ikzf3 ATGACAACAGCAGACCAACCAG TGTAGTTGGCATCGAAGCAGTG 
Arpc5l GAACGAGCCCAGGGTGTAGTCC TGGTCCATTGTCAGTCCCTTCTTC 
Blr1 GACATGGGCTCCATCACATA GTGCCTCTCCAGGATTACCA 
Cbfb GACCAGAGGAGCAAGTTCGAG GAGTTCTTCTTCGAGCCTCTTC 
Cd19 GAGAGGCACGTGAAGGTCATTG CATGGCTCTGAGCTCCAGTATC 
Tcfe2a TGGCACTTACAGTGGGACTTC ATGGAGACCTGCATCGTAGTTG 
Ebf1 ATGTTTGGGATCCAGGAAAGC CAGGGTTCTTGTCTTGGCCTT 
Emb TGTACACAGGGACCAACGGAGACG TGTTGCCCATTTTAGTTGTATTGA 
Ep400 GAGCTGGCTGACTTTATGGAAC GCTCCTTCCTCACATAAACAGG 
Flt3 GTGACTGGCCCCCTGGATAACGAG TCCAAGGGCGGGTGTAACTGAACT 
Frmd4b GGGCTCGAGGTGGCAAGTT CCAGTGGGGGTATGAGGTAGTTTA 
Gpx1 GGTTTCCCGTGCAATCAGTTCG GCCGCCTTAGGAGTTGCCAGAC 
Hprt GGGGGCTATAAGTTCTTTGC TCCAACACTTCGAGAGGTCC 
Lax1 GAACTCAGAGCCCAGCACTCGG GGAGGCAGAGTCAACGATGGAG 
Lcp1 TATCGGAGGTGGACAGAAGG ACCCTTGCTCCGATTTTTCT 
Lsp1 GAGAGTTCTCACCAAGCCAAAG TTCTGCTCCCACAGACTTTTCT 
Nfatc1 CCGATAGCACTCTGGACCTG GTAGCTGCACAATGGGGTGT 
Plcg2 GTGGAGACGAAGGCAGACAG CTGCAGGACGTAGCCTGTTC 
Pten GCTGAGAGACATTATGACACCG GCGCCTCTGACTGGGAATTGTG 
Spib GCTGGCTTCAAGCTCATGACAC TTGGCCTGTAGCACTTGAACGG 
Syvn1 GTGATGGGCAAGGTGTTCTT CACGGAGTGCAGCACATACT 
Tmsb10 GGCTCTTCCTCCACATCACGA AAGAAAACCGAGACGCAGGAGAAG 
Irf8 CAGGAGGTGGATGCTTCCATC GCACAGCGTAACCTCGTCTTC 
Blnk CTGCCGCACCATCCCCACTAC GTCACAGGCGCCAGCATACCAG 
Atp1b1 CGAGGCCTACGTGCTAAACAT GTATCCGCCCATCCCAAAGTA 
Ccnd3 CAGCGCTGCGAGGAGGATGTCTTC CACGGCAGCCAGGTCCCACTTGAG 
Sdc4 AGCCTCCCCGACGACGAAGAT ACGCCCGCCACCCACAACC 
Cd24a TTCCCCAAATCCAAGTAACG AACCTGTGCCCAATTTCAAGTG 
Snx2 TCGCAGAAGCCACAGAAGAGGT GAGCGGGTGGCACGATGTAAC 
Rbm3 AAACACATCAGACACAACAGAATA TGAGCTCCCAAGGTAGT 
Igf2 GCCCCTGAAAGCACCCATCC AGCCGTGAAAGCACCCATCC 
Gene5′ Primer Sequence (5′→3′)3′ Primer Sequence (5′→3′)
Ikzf3 ATGACAACAGCAGACCAACCAG TGTAGTTGGCATCGAAGCAGTG 
Arpc5l GAACGAGCCCAGGGTGTAGTCC TGGTCCATTGTCAGTCCCTTCTTC 
Blr1 GACATGGGCTCCATCACATA GTGCCTCTCCAGGATTACCA 
Cbfb GACCAGAGGAGCAAGTTCGAG GAGTTCTTCTTCGAGCCTCTTC 
Cd19 GAGAGGCACGTGAAGGTCATTG CATGGCTCTGAGCTCCAGTATC 
Tcfe2a TGGCACTTACAGTGGGACTTC ATGGAGACCTGCATCGTAGTTG 
Ebf1 ATGTTTGGGATCCAGGAAAGC CAGGGTTCTTGTCTTGGCCTT 
Emb TGTACACAGGGACCAACGGAGACG TGTTGCCCATTTTAGTTGTATTGA 
Ep400 GAGCTGGCTGACTTTATGGAAC GCTCCTTCCTCACATAAACAGG 
Flt3 GTGACTGGCCCCCTGGATAACGAG TCCAAGGGCGGGTGTAACTGAACT 
Frmd4b GGGCTCGAGGTGGCAAGTT CCAGTGGGGGTATGAGGTAGTTTA 
Gpx1 GGTTTCCCGTGCAATCAGTTCG GCCGCCTTAGGAGTTGCCAGAC 
Hprt GGGGGCTATAAGTTCTTTGC TCCAACACTTCGAGAGGTCC 
Lax1 GAACTCAGAGCCCAGCACTCGG GGAGGCAGAGTCAACGATGGAG 
Lcp1 TATCGGAGGTGGACAGAAGG ACCCTTGCTCCGATTTTTCT 
Lsp1 GAGAGTTCTCACCAAGCCAAAG TTCTGCTCCCACAGACTTTTCT 
Nfatc1 CCGATAGCACTCTGGACCTG GTAGCTGCACAATGGGGTGT 
Plcg2 GTGGAGACGAAGGCAGACAG CTGCAGGACGTAGCCTGTTC 
Pten GCTGAGAGACATTATGACACCG GCGCCTCTGACTGGGAATTGTG 
Spib GCTGGCTTCAAGCTCATGACAC TTGGCCTGTAGCACTTGAACGG 
Syvn1 GTGATGGGCAAGGTGTTCTT CACGGAGTGCAGCACATACT 
Tmsb10 GGCTCTTCCTCCACATCACGA AAGAAAACCGAGACGCAGGAGAAG 
Irf8 CAGGAGGTGGATGCTTCCATC GCACAGCGTAACCTCGTCTTC 
Blnk CTGCCGCACCATCCCCACTAC GTCACAGGCGCCAGCATACCAG 
Atp1b1 CGAGGCCTACGTGCTAAACAT GTATCCGCCCATCCCAAAGTA 
Ccnd3 CAGCGCTGCGAGGAGGATGTCTTC CACGGCAGCCAGGTCCCACTTGAG 
Sdc4 AGCCTCCCCGACGACGAAGAT ACGCCCGCCACCCACAACC 
Cd24a TTCCCCAAATCCAAGTAACG AACCTGTGCCCAATTTCAAGTG 
Snx2 TCGCAGAAGCCACAGAAGAGGT GAGCGGGTGGCACGATGTAAC 
Rbm3 AAACACATCAGACACAACAGAATA TGAGCTCCCAAGGTAGT 
Igf2 GCCCCTGAAAGCACCCATCC AGCCGTGAAAGCACCCATCC 

The labeled mAbs CD157, CXCR5 (Blr1), and Syndecan-4 (Sdc4) were purchased from BD Pharmingen. The mAbs against B220, CD19, Flt3 c-Kit, CD24a, and Embigin (Emb) were purified and conjugated in our laboratory. HSC, common lymphoid progenitor (CLP), and B cell populations were sorted as previously described (26, 27). For flow cytometry, single-cell suspensions were prepared from the BM of 12-day old mice and stained with the appropriate mAb in PBS containing 2% FCS. Biotinylated mAb were revealed by PE-streptavidin (SouthernBiotech). Cells were analyzed on a FACScan flow cytometer (BD Biosciences) and cell sorting was conducted on high-speed flow cytometers (Vantage SE DiVa; BD Biosciences). Dead cells were excluded by propidium iodide staining.

G7.43.1, the anti-Emb mAb, was generated by immunizing a rat with human 293T cells infected with a retrovirus-expressing mouse Emb. Supernatants from hybridoma clones were screened against Pax5−/− pro-B cells. The specificity of G7.43.1 was determined by Western blot analysis.

Tissues were embedded, stored, sectioned, and stained as described (28). Abs used were unlabeled anti-Emb and biotinylated anti-CD19. Anti-GL117 was an isotype control. Emb and GL117 were detected with mouse anti-rat Abs conjugated to HRP (BD Pharmingen) and anti-CD19 with streptavidin-alkaline phosphatase (SouthernBiotech). Alkaline phosphatase was visualized with the Fast Blue kit (Vector Laboratories), with endogenous phosphatases blocked by the addition of 2 mM levamisole (Sigma-Aldrich). HRP was visualized with the 3-amino-9-ethylcarbazole substrate kit (Vector Laboratories).

To further our understanding of gene regulation by Pax5 in early B cell development, we performed cDNA microarray analysis on wild-type and Pax5−/− pro-B cells. As starting material we took advantage of the ability to grow pure populations of pro-B cells in long-term cultures in the presence of IL-7 and a ST-2 stromal layer. Previous analysis has confirmed that these pro-B cells retain many of the features of the equivalent populations in vivo (4). The experimental setup involved a pairwise comparison of three Pax5−/− pro-B cells lines and a single wild-type control, SB+/+ (7). Hybridizations were performed on microarrays printed with two mouse cDNA libraries, a custom cDNA microarray consisting of 10,000 randomly selected cDNAs from an IgM+ mature B cell library and the NIA 15k library (22) derived from diverse sources including embryonic, neural, and malignant samples. The combination of these two libraries allowed us to maximize the identification of both B cell and non-B cell-specific Pax5 target genes. All hybridizations were performed in duplicate with the Cy3 and Cy5 fluorochromes swapped between each experiment and with three independent Pax5−/− pro-B cell lines.

The custom B cell microarray screens yielded a large number of clones with statistically significant differential expression in Pax5−/− (4919 probes at a false discovery rate of <5%). Approximately 200 of the most highly differentially expressed clones were sequenced and identified by database searches. As expected from a library comprised of random clones, the differentially expressed genes were represented by multiple cDNA clones (16 genes were present in two or three copies in the initial 200 clones). The NIA 15k microarray screens yielded another 1491 differentially expressed clones at a false discovery rate of <5%. Fifty-two of the most significant clones were sequence confirmed. Overall, ∼60% of the clones had reduced expression in Pax5−/− pro-B cells, representing potential Pax5-activated genes, and 40% were more strongly expressed in the absence of Pax5, representing Pax5-repressed genes. The sequence-validated candidates are shown in Tables II and III. Approximately 50% (54 of 109) has been confirmed by independent methodologies as outlined in the Tables II and III and Figs. 1 and 2. This list includes a number of previously identified Pax5 regulated genes, most notably the canonical Pax5 target gene Cd19 (4, 11) which was the most differentially expressed transcript on the B cell array (Table II). As expected Pax5 itself was also differentially expressed. Several other known Pax5 targets, including Blnk (13), Lef1, Cd79a (6), Notch1 (16), Ikzf3 (29), and Ebf1 (29, 30), were also identified, confirming the validity of the screen. Importantly, analysis of the expression of a selection of the potential Pax5 target genes confirmed the differential expression in three independent Pax5−/− pro-B cell lines (Fig. 1 B and data not shown).

Table II.

List of potential Pax5-activated genesa

GenBank or RefSeq Accession No.GeneDescriptionFold Change (Log2)t StatisticAdjusted p ValueValidation (Ref.)
NM_009844 Cd19 CD19 antigen −4.19 −46.4 5E-18 Known (11) 
NM_172656 Als2cr2 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 −2.39 −33.3 8E-16 In vitro 
NM_026386 Snx2 Sorting nexin 2 −1.87 −31.9 2E-15 In vitro 
AK037030 Prkd2 Protein kinase D2 −1.43 −31.2 2E-15  
AK014486 Mlstd2 Male sterility domain containing 2 −1.24 −27.8 1E-14  
NM_011417 Smarca4 SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily a, member 4 (Brg1) −1.01 −27.3 2E-14 Ex vivo 
XM_283022 Ikzf3 IKAROS family zinc finger 3 (Aiolos) −2.13 −25.1 7E-14 Ex vivo 
NM_008131 Glul Glutamate-ammonia ligase (glutamine synthetase) −1.27 −23.9 2E-13 In vitro 
AK028838 Stk4 Serine/threonine kinase 4 −1.07 −23.3 2E-13  
NM_207246 Rasgrp3 RAS, guanyl releasing protein 3 −1.83 −23.1 3E-13  
NM_026444 Cs Citrate synthase −1.04 −22.8 3E-13  
NM_178087 Pml Promyelocytic leukemia −1.76 −22.3 4E-13  
BC037730 H3f3b H3 histone, family 3B −0.87 −21.3 1E-12 In vitro 
NM_016791 Nfatc1 Nuclear factor of activated T cells, cytoplasmic, calcineurin-dependent 1 −1.09 −21.0 1E-12 Ex vivo 
MMU87620 Spib Spi-B transcription factor (Spi-1/PU.1 related) −1.45 −21.0 1E-12 Ex vivo 
NM_011925 Cd97 CD97 antigen −1.20 −21.0 1E-12  
NM_009846 Cd24a CD24a antigen (HSA) −1.77 −21.0 1E-12 Ex vivo 
NM_009763 Bst1 Bone marrow stromal cell antigen 1 (CD157 antigen) −1.39 −20.5 1E-12 Ex vivo 
NM_022309 Cbfb Core binding factor b −0.83 −20.4 1E-12 Ex vivo 
NM_009201 Slc1a5 Solute carrier family 1 (neutral amino acid transporter), member 5 −1.57 −20.3 1E-12 In vitro 
NM_028809 Arpc5l Actin related protein 2/3 complex, subunit 5-like −0.94 −20.1 2E-12 Ex vivo 
XM_204234 Cecr2 Cat eye syndrome chromosome region, candidate 2 −1.36 −20.1 2E-12 Ex vivo 
NM_198703 Wnk1 WNK lysine deficient protein kinase 1 −1.02 −19.8 2E-12 In vitro 
NM_001025572 Ankrd12 Ankyrin repeat domain 12 −1.02 −19.8 2E-12  
NM_017464 Nedd9 Neural precursor cell expressed, developmentally down-regulated gene 9 −1.24 −19.6 3E-12  
NM_011548 Tcfe2a Transcription factor E2a −0.87 −19.4 3E-12 In vitro 
NM_008511 Lrmp Lymphoid-restricted membrane protein (Jaw1) −1.46 −19.2 4E-12 Ex vivo 
NM_001039519 Gtf2a2 General transcription factor II A, 2 −1.18 −19.2 4E-12  
NM_144833 Zfp410 Zinc finger protein 410 −7.48 −17.7 1E-11  
NM_133910 Tbc1d14 TBC1 domain family, member 14 −1.03 −17.6 2E-11  
NM_016895 Ak2 Adenylate kinase 2 −0.84 −17.5 2E-11  
AK157720 Bcl7a B-cell CLL/lymphoma 7A −1.23 −17.5 2E-11  
NM_008142 Gnb1 Guanine nucleotide binding protein, b1 −0.66 −17.4 2E-11  
AL772319 Pax5 Paired box gene 5 −1.76 −17.4 2E-11  
NM_008031 Fmr1 Fragile X mental retardation syndrome 1 homolog −0.79 −17.0 2E-11  
BC055044 Epb4.1l2 Erythrocyte protein band 4.1-like 2 −0.67 −16.5 4E-11  
NM_001033293 Uap1l1 UDP-N-acetylglucosamine pyrophosphorylase 1-like 1 −1.62 −16.5 4E-11  
NM_170588 Cpne1 Copine 1 −0.87 −16.4 4E-11  
AK137389 Ebf1 Early B Cell Factor 1 −1.17 −16.2 5E-11 Ex vivo 
NM_031185 Akap12 A kinase (PRKA) anchor protein (gravin) 12 −1.70 −16.1 5E-11  
NM_172514 Tmem71 Transmembrane protein 71 −0.99 −15.8 7E-11  
NM_008321 Id3 Inhibitor of DNA binding 3 −1.07 −15.5 1E-12 Ex vivo 
NM_028780 Tm9sf1 Transmembrane 9 superfamily member 1 −0.90 −14.8 2E-10  
AK150817 Pyhin1 Pyrin and HIN domain family member 1 −1.67 −14.7 2E-10 Ex vivo 
NM_019635 Stk3 Serine/threonine kinase 3 −1.08 −14.7 2E-10  
NM_009727 Atp8a1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 −1.16 −14.6 3E-10  
NM_010731 Zbtb7a Zinc finger and BTB domain containing 7a (LRF) −1.77 −14.6 3E-10  
NM_016856 Cpsf2 Cleavage and polyadenylation specific factor 2 −0.72 −14.5 3E-10 Ex vivo 
NM_027184 Ipmk Inositol polyphosphate multikinase −0.68 −14.5 3E-10  
NM_172456 Endogl1 Endonuclease G-like 1 −1.10 −14.4 3E-10  
NM_028769 Syvn1 Synovial apoptosis inhibitor 1, synoviolin −0.68 −14.4 3E-10 Ex vivo  
NM_175048 Gimap4 GTPase, IMAP family member 4 −1.03 −14.3 4E-10  
NM_001002846 Fbxl12 F-box and leucine-rich repeat protein 12 −1.04 −14.1 5E-10  
NM_009009 Rad21 RAD21 −0.70 −13.8 7E-10  
NM_010703 Lef1 Lymphoid enhancer binding factor 1 −1.88 −13.5 9E-10 Known (6) 
NM_133739 Tmem123 Transmembrane protein 123 −.077 −13.3 1E-09  
NM_007655 Cd79a CD79A antigen (Iga, mb-1) −2.58 −13.3 1E-09 Known (12) 
NM_011671 Ucp2 Uncoupling protein 2 (mitochondrial, proton carrier) −1.23 −13.2 1E-09  
AK153056 D3Ucla1 Unknown −0.63 −12.4 4E-09  
AK032345 Tcf4 Transcription factor 4 (E2-2) −0.52 −7.56 4E-06  
AK017215 5033414 D02Rik Unknown −0.71 −7.35 6E-06  
AK050833 Clcn4−2 Chloride channel 4−2 −0.40 −1.98 1E-01  
       
NIA 15k       
NM_009721 H3019E05 Atp1b1 ATPase, Na+/K+ transporting, b1 polypeptide −2.29 −16.0 9E-09 In vitro 
NM_008528 H3057F11 Blnk B-cell linker (BASH, SLP-65) −2.27 −10.2 3E-06 Known (13) 
NM_001081636 H3041D11 Ccnd3 Cyclin D3 −1.13 −10.5 2E-06 In vitro 
NM_016809 H3010F04 Rbm3 RNA binding motif protein 3 −0.91 −9.19 1E-05 In vitro 
NM_011521 H3138F12 Sdc4 Syndecan 4 (ryudocan) −1.02 −9.34 9E-06 Ex vivo 
NM_009261 H3141C09 Strbp Spermatid perinuclear RNA binding protein −1.03 −9.42 8E-06 In vitro 
GenBank or RefSeq Accession No.GeneDescriptionFold Change (Log2)t StatisticAdjusted p ValueValidation (Ref.)
NM_009844 Cd19 CD19 antigen −4.19 −46.4 5E-18 Known (11) 
NM_172656 Als2cr2 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 −2.39 −33.3 8E-16 In vitro 
NM_026386 Snx2 Sorting nexin 2 −1.87 −31.9 2E-15 In vitro 
AK037030 Prkd2 Protein kinase D2 −1.43 −31.2 2E-15  
AK014486 Mlstd2 Male sterility domain containing 2 −1.24 −27.8 1E-14  
NM_011417 Smarca4 SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily a, member 4 (Brg1) −1.01 −27.3 2E-14 Ex vivo 
XM_283022 Ikzf3 IKAROS family zinc finger 3 (Aiolos) −2.13 −25.1 7E-14 Ex vivo 
NM_008131 Glul Glutamate-ammonia ligase (glutamine synthetase) −1.27 −23.9 2E-13 In vitro 
AK028838 Stk4 Serine/threonine kinase 4 −1.07 −23.3 2E-13  
NM_207246 Rasgrp3 RAS, guanyl releasing protein 3 −1.83 −23.1 3E-13  
NM_026444 Cs Citrate synthase −1.04 −22.8 3E-13  
NM_178087 Pml Promyelocytic leukemia −1.76 −22.3 4E-13  
BC037730 H3f3b H3 histone, family 3B −0.87 −21.3 1E-12 In vitro 
NM_016791 Nfatc1 Nuclear factor of activated T cells, cytoplasmic, calcineurin-dependent 1 −1.09 −21.0 1E-12 Ex vivo 
MMU87620 Spib Spi-B transcription factor (Spi-1/PU.1 related) −1.45 −21.0 1E-12 Ex vivo 
NM_011925 Cd97 CD97 antigen −1.20 −21.0 1E-12  
NM_009846 Cd24a CD24a antigen (HSA) −1.77 −21.0 1E-12 Ex vivo 
NM_009763 Bst1 Bone marrow stromal cell antigen 1 (CD157 antigen) −1.39 −20.5 1E-12 Ex vivo 
NM_022309 Cbfb Core binding factor b −0.83 −20.4 1E-12 Ex vivo 
NM_009201 Slc1a5 Solute carrier family 1 (neutral amino acid transporter), member 5 −1.57 −20.3 1E-12 In vitro 
NM_028809 Arpc5l Actin related protein 2/3 complex, subunit 5-like −0.94 −20.1 2E-12 Ex vivo 
XM_204234 Cecr2 Cat eye syndrome chromosome region, candidate 2 −1.36 −20.1 2E-12 Ex vivo 
NM_198703 Wnk1 WNK lysine deficient protein kinase 1 −1.02 −19.8 2E-12 In vitro 
NM_001025572 Ankrd12 Ankyrin repeat domain 12 −1.02 −19.8 2E-12  
NM_017464 Nedd9 Neural precursor cell expressed, developmentally down-regulated gene 9 −1.24 −19.6 3E-12  
NM_011548 Tcfe2a Transcription factor E2a −0.87 −19.4 3E-12 In vitro 
NM_008511 Lrmp Lymphoid-restricted membrane protein (Jaw1) −1.46 −19.2 4E-12 Ex vivo 
NM_001039519 Gtf2a2 General transcription factor II A, 2 −1.18 −19.2 4E-12  
NM_144833 Zfp410 Zinc finger protein 410 −7.48 −17.7 1E-11  
NM_133910 Tbc1d14 TBC1 domain family, member 14 −1.03 −17.6 2E-11  
NM_016895 Ak2 Adenylate kinase 2 −0.84 −17.5 2E-11  
AK157720 Bcl7a B-cell CLL/lymphoma 7A −1.23 −17.5 2E-11  
NM_008142 Gnb1 Guanine nucleotide binding protein, b1 −0.66 −17.4 2E-11  
AL772319 Pax5 Paired box gene 5 −1.76 −17.4 2E-11  
NM_008031 Fmr1 Fragile X mental retardation syndrome 1 homolog −0.79 −17.0 2E-11  
BC055044 Epb4.1l2 Erythrocyte protein band 4.1-like 2 −0.67 −16.5 4E-11  
NM_001033293 Uap1l1 UDP-N-acetylglucosamine pyrophosphorylase 1-like 1 −1.62 −16.5 4E-11  
NM_170588 Cpne1 Copine 1 −0.87 −16.4 4E-11  
AK137389 Ebf1 Early B Cell Factor 1 −1.17 −16.2 5E-11 Ex vivo 
NM_031185 Akap12 A kinase (PRKA) anchor protein (gravin) 12 −1.70 −16.1 5E-11  
NM_172514 Tmem71 Transmembrane protein 71 −0.99 −15.8 7E-11  
NM_008321 Id3 Inhibitor of DNA binding 3 −1.07 −15.5 1E-12 Ex vivo 
NM_028780 Tm9sf1 Transmembrane 9 superfamily member 1 −0.90 −14.8 2E-10  
AK150817 Pyhin1 Pyrin and HIN domain family member 1 −1.67 −14.7 2E-10 Ex vivo 
NM_019635 Stk3 Serine/threonine kinase 3 −1.08 −14.7 2E-10  
NM_009727 Atp8a1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 −1.16 −14.6 3E-10  
NM_010731 Zbtb7a Zinc finger and BTB domain containing 7a (LRF) −1.77 −14.6 3E-10  
NM_016856 Cpsf2 Cleavage and polyadenylation specific factor 2 −0.72 −14.5 3E-10 Ex vivo 
NM_027184 Ipmk Inositol polyphosphate multikinase −0.68 −14.5 3E-10  
NM_172456 Endogl1 Endonuclease G-like 1 −1.10 −14.4 3E-10  
NM_028769 Syvn1 Synovial apoptosis inhibitor 1, synoviolin −0.68 −14.4 3E-10 Ex vivo  
NM_175048 Gimap4 GTPase, IMAP family member 4 −1.03 −14.3 4E-10  
NM_001002846 Fbxl12 F-box and leucine-rich repeat protein 12 −1.04 −14.1 5E-10  
NM_009009 Rad21 RAD21 −0.70 −13.8 7E-10  
NM_010703 Lef1 Lymphoid enhancer binding factor 1 −1.88 −13.5 9E-10 Known (6) 
NM_133739 Tmem123 Transmembrane protein 123 −.077 −13.3 1E-09  
NM_007655 Cd79a CD79A antigen (Iga, mb-1) −2.58 −13.3 1E-09 Known (12) 
NM_011671 Ucp2 Uncoupling protein 2 (mitochondrial, proton carrier) −1.23 −13.2 1E-09  
AK153056 D3Ucla1 Unknown −0.63 −12.4 4E-09  
AK032345 Tcf4 Transcription factor 4 (E2-2) −0.52 −7.56 4E-06  
AK017215 5033414 D02Rik Unknown −0.71 −7.35 6E-06  
AK050833 Clcn4−2 Chloride channel 4−2 −0.40 −1.98 1E-01  
       
NIA 15k       
NM_009721 H3019E05 Atp1b1 ATPase, Na+/K+ transporting, b1 polypeptide −2.29 −16.0 9E-09 In vitro 
NM_008528 H3057F11 Blnk B-cell linker (BASH, SLP-65) −2.27 −10.2 3E-06 Known (13) 
NM_001081636 H3041D11 Ccnd3 Cyclin D3 −1.13 −10.5 2E-06 In vitro 
NM_016809 H3010F04 Rbm3 RNA binding motif protein 3 −0.91 −9.19 1E-05 In vitro 
NM_011521 H3138F12 Sdc4 Syndecan 4 (ryudocan) −1.02 −9.34 9E-06 Ex vivo 
NM_009261 H3141C09 Strbp Spermatid perinuclear RNA binding protein −1.03 −9.42 8E-06 In vitro 
a

Potential Pax5 activated genes as identified by cDNA microarray analysis of gene expression between Pax5-deficient and wild-type pro-B cells. Genes are listed in order of statistical significance (moderated t-statistic). Adjusted p values represent false discovery rate bounds. Validation was performed on either pro-B cell lines (in vitro) or on sorted B220+c-Kit+ cell (ex vivo) from wild-type and Pax5−/− BM. Known target genes are indicated with the appropriate reference (Ref). The Pax5 transcript is truncated after exon 2 in Pax5−/− cells. Only those cDNAs identified from the NIA 15k array that were confirmed by RT-PCR are shown.

Table III.

List of potential Pax5 repressed genesa

GenBank or RefSeq Accession #GeneDescriptionLog2-Fold Changet StatisticAdjusted p ValueValidation (Ref.)
NM_019391 Lsp1 Lymphocyte specific 1 2.71 33.9 7E-16 Ex vivo 
NM_008505 Lmo2 LIM domain only 2 3.30 23.5 2E-13 In vitro 
NM_007415 Parp1 Poly (ADP-ribose) polymerase family, member 1 1.94 22.4 4E-13 In vitro 
AK009211.1 Lcp1 Lymphocyte cytosolic protein 1 1.13 21.9 6E-13 Ex vivo 
NM_008160 Gpx1 Glutathione peroxidase 1 1.88 21.2 1E-12 Ex vivo 
NM_008533 Cd180 CD180 antigen (RP105) 1.45 19.6 3E-12  
XM_127380.2 H2afy H2A histone family, member Y 1.66 19.4 3E-12  
NM_008761 Fxyd5 FXYD domain-containing ion transport regulator 5 1.70 18.7 5E-12 In vitro 
NM_008960 Pten Phosphatase and tensin homolog 1.19 18.5 6E-12 Ex vivo 
NM_007551 Blr1 Burkitt lymphoma receptor 1 (CXCR5) 0.91 17.9 1E-11 Ex vivo 
NM_010581 Cd47 CD47 Ag 1.43 17.4 2E-11  
NM_009741 Bcl2 B-cell leukemia/lymphoma 2 1.16 17.3 2E-11  
NM_013472 Anxa6 Annexin A6 0.87 17.3 2E-11  
NM_194052 Rtn4 Reticulon 4 1.03 17.3 2E-11 Ex vivo 
AK161168 Ttc3 Tetratricopeptide repeat domain 3 0.95 17.2 2E-11  
AK076070.1 Csnk1a1 Casein kinase 1, α1 0.83 17.1 2E-11  
NM_172842 Lax1 Lymphocyte transmembrane adaptor 1 1.55 16.5 4E-11 Ex vivo 
BC010489 Sept6 Septin 6 1.24 16.4 4E-11  
AK088605 Ggta1 Glycoprotein galactosyltransferase α1,3 1.38 16.3 4E-11  
XM_203393 Prr6 Proline-rich polypeptide 6 0.86 16.2 5E-11  
NM_011972 Pol Polymerase (DNA directed), ι 0.78 16.2 5E-11 In vitro 
NM_172285 Plcg2 Phospholipase C, γ2 1.28 15.9 7E-11 Ex vivo 
NM_008714 Notch1 Notch gene homolog 1 1.18 15.6 9E-11 Known (16) 
NM_016776 Mybbp1a MYB binding protein (P160) 1a 1.11 14.9 2E-10 Ex vivo 
NM_134086 Slc38a1 Solute carrier family 38, member 1 0.66 14.4 3E-10  
NM_019993 Aldh9a1 Aldehyde dehydrogenase 9, subfamily A1 0.71 14.4 3E-10  
NM_008774 Pabpc1 Poly A binding protein, cytoplasmic 1 0.74 14.2 4E-10 Ex vivo 
NM_009983 Ctsd Cathepsin D 0.65 14.0 5E-10  
AK030569 Dynlt1 Dynein light chain Tctex-type 1 0.95 14.0 5E-10  
NM_023326 Bmyc Brain expressed myelocytomatosis oncogene 0.99 13.8 6E-10  
NM_026446 Rgs19 Regulator of G-protein signaling 19 0.95 13.7 7E-10  
NM_022964 Lat2 Linker for activation of T cells family, member 2 0.88 13.7 7E-10  
NM_025282 Mef2c Myocyte enhancer factor 2C 0.99 13.4 1E-09  
AK146784 Mark4 MAP/microtubule affinity-regulating kinase 4 0.84 13.4 1E-09  
BC104333 Serpinb1a Serine (or cysteine) peptidase inhibitor, clade B, member 1a 1.18 10.7 3E-08 In vitro 
NM_029337 Ep400 E1A binding protein p400 (mDomino) 0.25 5.27 3E-04 Ex vivo 
       
NIA 15K       
NM_001039392 H3001H10 Tmsb10 Thymosin β 10 1.65 14.0 4E-08 Ex vivo 
NM_010514 H3024B07 Igf2 Insulin-like growth factor 2 2.44 8.47 2E-05 In vitro 
NM_054040 H3132F10 Tulp4 Tubby like protein 4 1.42 9.19 1E-05 In vitro 
NM_010330 H3024E05 Emb Embigin 0.93 9.12 1E-05 Ex vivo 
NM_025378 H3107D05 Ifitm3 Interferon induced transmembrane protein 3 1.59 8.51 2E-05 In vitro 
NM_145148 H3057G09 Frmd4b FERM domain containing 4B 1.10 5.35 3E-03 Ex vivo 
NM_207652 H3066H08 Tsc22d1 TSC22 domain family, member 1 1.17 5.89 8E-04 Ex vivo 
GenBank or RefSeq Accession #GeneDescriptionLog2-Fold Changet StatisticAdjusted p ValueValidation (Ref.)
NM_019391 Lsp1 Lymphocyte specific 1 2.71 33.9 7E-16 Ex vivo 
NM_008505 Lmo2 LIM domain only 2 3.30 23.5 2E-13 In vitro 
NM_007415 Parp1 Poly (ADP-ribose) polymerase family, member 1 1.94 22.4 4E-13 In vitro 
AK009211.1 Lcp1 Lymphocyte cytosolic protein 1 1.13 21.9 6E-13 Ex vivo 
NM_008160 Gpx1 Glutathione peroxidase 1 1.88 21.2 1E-12 Ex vivo 
NM_008533 Cd180 CD180 antigen (RP105) 1.45 19.6 3E-12  
XM_127380.2 H2afy H2A histone family, member Y 1.66 19.4 3E-12  
NM_008761 Fxyd5 FXYD domain-containing ion transport regulator 5 1.70 18.7 5E-12 In vitro 
NM_008960 Pten Phosphatase and tensin homolog 1.19 18.5 6E-12 Ex vivo 
NM_007551 Blr1 Burkitt lymphoma receptor 1 (CXCR5) 0.91 17.9 1E-11 Ex vivo 
NM_010581 Cd47 CD47 Ag 1.43 17.4 2E-11  
NM_009741 Bcl2 B-cell leukemia/lymphoma 2 1.16 17.3 2E-11  
NM_013472 Anxa6 Annexin A6 0.87 17.3 2E-11  
NM_194052 Rtn4 Reticulon 4 1.03 17.3 2E-11 Ex vivo 
AK161168 Ttc3 Tetratricopeptide repeat domain 3 0.95 17.2 2E-11  
AK076070.1 Csnk1a1 Casein kinase 1, α1 0.83 17.1 2E-11  
NM_172842 Lax1 Lymphocyte transmembrane adaptor 1 1.55 16.5 4E-11 Ex vivo 
BC010489 Sept6 Septin 6 1.24 16.4 4E-11  
AK088605 Ggta1 Glycoprotein galactosyltransferase α1,3 1.38 16.3 4E-11  
XM_203393 Prr6 Proline-rich polypeptide 6 0.86 16.2 5E-11  
NM_011972 Pol Polymerase (DNA directed), ι 0.78 16.2 5E-11 In vitro 
NM_172285 Plcg2 Phospholipase C, γ2 1.28 15.9 7E-11 Ex vivo 
NM_008714 Notch1 Notch gene homolog 1 1.18 15.6 9E-11 Known (16) 
NM_016776 Mybbp1a MYB binding protein (P160) 1a 1.11 14.9 2E-10 Ex vivo 
NM_134086 Slc38a1 Solute carrier family 38, member 1 0.66 14.4 3E-10  
NM_019993 Aldh9a1 Aldehyde dehydrogenase 9, subfamily A1 0.71 14.4 3E-10  
NM_008774 Pabpc1 Poly A binding protein, cytoplasmic 1 0.74 14.2 4E-10 Ex vivo 
NM_009983 Ctsd Cathepsin D 0.65 14.0 5E-10  
AK030569 Dynlt1 Dynein light chain Tctex-type 1 0.95 14.0 5E-10  
NM_023326 Bmyc Brain expressed myelocytomatosis oncogene 0.99 13.8 6E-10  
NM_026446 Rgs19 Regulator of G-protein signaling 19 0.95 13.7 7E-10  
NM_022964 Lat2 Linker for activation of T cells family, member 2 0.88 13.7 7E-10  
NM_025282 Mef2c Myocyte enhancer factor 2C 0.99 13.4 1E-09  
AK146784 Mark4 MAP/microtubule affinity-regulating kinase 4 0.84 13.4 1E-09  
BC104333 Serpinb1a Serine (or cysteine) peptidase inhibitor, clade B, member 1a 1.18 10.7 3E-08 In vitro 
NM_029337 Ep400 E1A binding protein p400 (mDomino) 0.25 5.27 3E-04 Ex vivo 
       
NIA 15K       
NM_001039392 H3001H10 Tmsb10 Thymosin β 10 1.65 14.0 4E-08 Ex vivo 
NM_010514 H3024B07 Igf2 Insulin-like growth factor 2 2.44 8.47 2E-05 In vitro 
NM_054040 H3132F10 Tulp4 Tubby like protein 4 1.42 9.19 1E-05 In vitro 
NM_010330 H3024E05 Emb Embigin 0.93 9.12 1E-05 Ex vivo 
NM_025378 H3107D05 Ifitm3 Interferon induced transmembrane protein 3 1.59 8.51 2E-05 In vitro 
NM_145148 H3057G09 Frmd4b FERM domain containing 4B 1.10 5.35 3E-03 Ex vivo 
NM_207652 H3066H08 Tsc22d1 TSC22 domain family, member 1 1.17 5.89 8E-04 Ex vivo 
a

Potential Pax5 repressed genes as identified by cDNA microarray analysis of gene expression between Pax5-deficient and wild-type pro-B cells. Genes are listed in order of statistical significance (moderated t statistic). Adjusted p values represent false discovery rate bounds. Validation was performed on either pro-B cell lines (in vitro) or sorted B220+c-Kit+ cells (ex vivo) from wild-type and Pax5−/− BM. Known target genes are indicated with the appropriate reference (Ref). Additional cDNAs identified from the NIA 15k array are indicated.

FIGURE 1.

Expression of potential Pax5 target genes in pro-B cells in vitro. A, cDNA was prepared from established Pax5-deficient (−/−) and wild-type (+/+) pro-B cell lines, and transcripts of the indicated genes were analyzed by semiquantitative RT-PCR using 5-fold serial dilutions of the cDNA. B, Comparison of target gene expression in three independent Pax5−/− pro-B cell lines. Genes were amplified using semiquantitative RT-PCR. The cDNA input in A and B was normalized according to the expression of the Hprt gene. C, Flow cytometric analysis of CD24a, CXCR5 (Blr1), and Emb expression in Pax5-deficient (−/−) and wild-type (+/+) pro-B cell lines. Genotypes are as indicated on the panels.

FIGURE 1.

Expression of potential Pax5 target genes in pro-B cells in vitro. A, cDNA was prepared from established Pax5-deficient (−/−) and wild-type (+/+) pro-B cell lines, and transcripts of the indicated genes were analyzed by semiquantitative RT-PCR using 5-fold serial dilutions of the cDNA. B, Comparison of target gene expression in three independent Pax5−/− pro-B cell lines. Genes were amplified using semiquantitative RT-PCR. The cDNA input in A and B was normalized according to the expression of the Hprt gene. C, Flow cytometric analysis of CD24a, CXCR5 (Blr1), and Emb expression in Pax5-deficient (−/−) and wild-type (+/+) pro-B cell lines. Genotypes are as indicated on the panels.

Close modal
FIGURE 2.

Expression of potential Pax5 target genes in pro-B cells ex vivo. cDNA was prepared from sorted BM pro-B cells (B220+c-Kit+) of the indicated genotype, and transcripts of the indicated genes were analyzed by semiquantitative RT-PCR using 5-fold serial dilutions of the cDNA. The cDNA input was normalized according to the expression of the Hprt gene. A, Potential Pax5-activated genes whose expression is higher in wild-type pro-B cells. B, Potential Pax5-repressed genes whose expression is higher in Pax5-deficient pro-B cells. C, Comparison of Tcfe2a expression between in vitro propagated and ex vivo sorted pro-B cells.

FIGURE 2.

Expression of potential Pax5 target genes in pro-B cells ex vivo. cDNA was prepared from sorted BM pro-B cells (B220+c-Kit+) of the indicated genotype, and transcripts of the indicated genes were analyzed by semiquantitative RT-PCR using 5-fold serial dilutions of the cDNA. The cDNA input was normalized according to the expression of the Hprt gene. A, Potential Pax5-activated genes whose expression is higher in wild-type pro-B cells. B, Potential Pax5-repressed genes whose expression is higher in Pax5-deficient pro-B cells. C, Comparison of Tcfe2a expression between in vitro propagated and ex vivo sorted pro-B cells.

Close modal

Of the potential Pax5-activated genes, a striking 28% were nuclear proteins involved in various aspects of transcription, 15% were cell surface receptors, 15% were involved in intracellular signaling pathways, and a further 15% were of unknown function. The remaining genes have been implicated in a variety of cellular functions such as metabolism, transport, and cytoskeletal integrity. The Pax5-repressed genes contained a relatively large proportion of cell surface (26%) and intracellular signal-transducing (17%) proteins, with nuclear proteins (21%) and metabolic enzymes (12%) making up a significant fraction of the clones.

Although the pro-B cell culture system provided an abundant and pure source of mRNA with which to conduct the array screening, analysis of differentially expressed genes in pro-B cells in vivo provided an important additional validation to exclude any differences between the genotypes that resulted from differences in the ability of the cells of the two genotypes to be propagated in culture. Indeed Lmo2, which was identified as a Pax5-repressed gene from the B cell array and confirmed as being differentially expressed in pro-B cell cultures, was not differentially regulated on ex vivo isolated pro-B cells (data not shown). Interestingly, the expression of Tcfe2a, which encodes the essential regulator of early B cell development, E2A, was also reduced in Pax5-deficient pro-B cell cultures, yet the expression of Tcfe2a was actually increased in mutant pro-B cells ex vivo (Table II and Fig. 2 C).

Semiquantitative RT-PCR on cDNA isolated from FACS-sorted B220+c-Kit+ pro-B cells from either genotype confirmed the differential expression of the many of the candidates (Fig. 2). In a number of cases, the putative target genes were cell surface molecules against which mAbs were available and expression could be assessed by flow cytometry. In this manner, CD157, CD24a, and Sdc4 were shown to rely to varying degrees on Pax5 (Fig. 3), whereas CXCR5 (Blr1) was confirmed as being expressed in Pax5-deficient pro-B cell cultures (Fig. 1 C).

FIGURE 3.

Cell surface expression of potential Pax5 target genes ex vivo. A, BM cells from 2-wk-old mice of the indicated genotype were stained with B220 and c-Kit to identify the pro-B cell population (boxed). Number indicates the percentage of total BM cells. B, Cells gated as in A were analyzed for expression of CD157, Emb, Sdc4, and CD24a. CD19 and Flt3 were included as known targets, being activated and repressed by Pax5, respectively. Wild-type cells are indicated by a solid line and Pax5-deficient cells by a dotted line.

FIGURE 3.

Cell surface expression of potential Pax5 target genes ex vivo. A, BM cells from 2-wk-old mice of the indicated genotype were stained with B220 and c-Kit to identify the pro-B cell population (boxed). Number indicates the percentage of total BM cells. B, Cells gated as in A were analyzed for expression of CD157, Emb, Sdc4, and CD24a. CD19 and Flt3 were included as known targets, being activated and repressed by Pax5, respectively. Wild-type cells are indicated by a solid line and Pax5-deficient cells by a dotted line.

Close modal

We have previously shown that Pax5 directly regulates the expression of a variety of genes in pro-B cells including Cd19 and Flt3 (6, 18). In those cases, direct regulation was initially inferred by the complementation of Pax5−/− pro-B cells with a retrovirus expressing an inducible Pax5-ER fusion protein and subsequently proven using direct promoter analysis. To assess to what extent the differentially expressed genes identified here were direct Pax5 targets, we used the Pax5-ER system to induce Pax5 activity in the presence and absence of the protein translation inhibitor cycloheximide and assessed the expression of the relevant genes by RT-PCR. In this manner the transcription factors Ikzf3 (encoding for Aiolos) and Spib, which play important roles at the pre-B and mature B cell stages of differentiation, as well as the E3 ubiquitin ligase Syvn1 appear to be direct Pax5 targets (Fig. 4). Interestingly, Irf8 (Icsbp), which was identified using a candidate approach by us and others (20), also appeared to be directly regulated by Pax5 (Fig. 4). Despite its reduced expression in the absence of Pax5, we were unable to induce Ebf1 using this system.

FIGURE 4.

Direct regulation of Irf8, Ikzf3, Syvn1, and Spib by Pax5. RT-PCR analysis of gene expression in Pax5−/− pro-B cell lines complemented with a retrovirus expressing the Pax5-ER fusion protein or the ER alone. Cell lines were induced by 1 μM β-estradiol (E2) for 8 h in the presence of absence of 50 μg/ml cycloheximide (CHX). cDNAs were normalized using Hprt. Induction of Cd19 was a positive control.

FIGURE 4.

Direct regulation of Irf8, Ikzf3, Syvn1, and Spib by Pax5. RT-PCR analysis of gene expression in Pax5−/− pro-B cell lines complemented with a retrovirus expressing the Pax5-ER fusion protein or the ER alone. Cell lines were induced by 1 μM β-estradiol (E2) for 8 h in the presence of absence of 50 μg/ml cycloheximide (CHX). cDNAs were normalized using Hprt. Induction of Cd19 was a positive control.

Close modal

One gene that was strongly and specifically expressed in Pax5-deficient pro-B cells in vitro and in vivo was Emb (Fig. 1). Emb is a transmembrane glycoprotein belonging to the Ig superfamily that is expressed in the early stages of mouse embryogenesis and is postulated to mediate integrin-cell-substratum adhesion (31). Analysis of Emb during normal hemopoiesis revealed expression in T cell and myeloid cells but not B cells (Fig. 5,A and data not shown). Specific analysis of progenitors showed that Emb was strongly expressed in HSC- and CLP-enriched populations and later repressed in pro- and pre-B cells (Fig. 5 A). This was a virtually identical expression pattern to that of Flt3, which we have shown is directly repressed by Pax5 upon B cell lineage commitment (18).

FIGURE 5.

Analysis of Emb expression within the hemopoietic system. A, cDNA was prepared from sorted HSC, CLP, pro-B (B220+c-Kit+) and pre-B (B220+CD25+) cells as well as cultivated Pax5-deficient (−/−) and wild-type (+/+) pro-B cell lines. Expression of Emb and Flt3 was analyzed by semiquantitative RT-PCR. The cDNA input was previously normalized according to the expression of the control Hprt gene. B, Flow cytometric analysis of Emb expression within the hemopoietic system of wild-type mice. In the histograms, Emb staining is indicated by a dotted line and the solid line indicates the isotype control. C, Histological examination of Emb expression in the spleen and thymus of wild-type mice. Anti-CD19 (αCD19) was used to identify the B cell areas and anti-GL117 (αGL117) is an isotype control.

FIGURE 5.

Analysis of Emb expression within the hemopoietic system. A, cDNA was prepared from sorted HSC, CLP, pro-B (B220+c-Kit+) and pre-B (B220+CD25+) cells as well as cultivated Pax5-deficient (−/−) and wild-type (+/+) pro-B cell lines. Expression of Emb and Flt3 was analyzed by semiquantitative RT-PCR. The cDNA input was previously normalized according to the expression of the control Hprt gene. B, Flow cytometric analysis of Emb expression within the hemopoietic system of wild-type mice. In the histograms, Emb staining is indicated by a dotted line and the solid line indicates the isotype control. C, Histological examination of Emb expression in the spleen and thymus of wild-type mice. Anti-CD19 (αCD19) was used to identify the B cell areas and anti-GL117 (αGL117) is an isotype control.

Close modal

To further analyze the Emb expression domain, we generated a specific mAb by immunizing rats with the 293T cell line expressing full-length mouse Emb. Supernatants from hybridoma clones were initially screened by flow cytometry on wild-type and Pax5−/− pro-B cells lines. A single clone, G7.43.1, with specific reactivity against Pax5-deficient pro-B cells was identified and further characterized. The specificity of G7.43.1 was confirmed by Western blotting of parental and Emb-transfected 293T cells (data not shown).

Analysis of Pax5−/− BM confirmed the differential expression of Emb protein on pro-B cells in vivo (Fig. 3). A detailed flow cytometric analysis of the hemopoietic compartment using biotinylated anti-Emb Ab revealed very strong expression in thymocytes, a finding that was confirmed by immunohistochemistry (Fig. 5,B). Emb was also expressed at a moderate level in mature peripheral CD4+ and CD8+ T cells and NK cells, and at a very high level in myeloid cells (Fig. 5,B and data not shown). In keeping with the RT-PCR data, the majority of BM, spleen, and lymph node B cells did not express Emb (Fig. 5, B and C). Initial attempts to use the anti-Emb Ab to assess the function of this poorly characterized molecule in non-B cells has not been successful, as the addition of the Ab did not affect thymopoiesis using fetal thymic organ culture, mature T cell proliferation, or NK cell cytolytic function (S. L. Nutt and M. Polli, unpublished observations). Anti-Emb did however partially deplete CD8+ T cells when injected in vivo (S. L. Nutt and M. Polli, unpublished observations). Interestingly, we and others have recently shown that Emb is re-expressed in activated B cells and plasma cells and that this expression correlated with the posttranslational inhibition of Pax5 function (32). Thus Emb expression in B cells represents a convenient marker for impaired Pax5 function.

Pax5 is essential for many aspects of B cell biology, including the initiation of B cell lineage commitment in the BM, V-DJ recombination of the Igh locus, and the maintenance of the B cell fate in more mature cells (33). In an attempt to understand the molecular events mediated by Pax5 in lineage commitment and early B cell differentiation, we used a cDNA microarray approach to identify genes regulated by Pax5. The putative Pax5 target genes identified here, as well as those isolated in the recent studies (19, 20), provide a wealth of material to further define existing roles and identify new functions of Pax5 in B cells.

Analysis of the microarray data revealed that Pax5 potentially activated the majority of targets identified thus far, as expression was relatively higher in wild-type pro-B cells. Numerous genes involved in signaling have been previously identified as Pax5 targets, including Cd19, Cd79a, Lef1 (6), and Blnk (13), were confirmed in the current screen. Other signaling molecules include Cd97, a transmembrane receptor involved in intracellular signaling in association with G proteins in immune cells (34), and Cd24a (heat-stable Ag or HSA), a surface glycoprotein expressed on immature hemopoietic cells involved in cell adhesion and activation that has a minor role in B lymphopoiesis in the BM (35). Pax5 also activates Bst1 (encoding CD157) and Sdc4, two receptors that play roles in mature B cells. Bst1−/− mice have delayed B1 B cell development and impaired T-independent Ab responses (36), whereas Sdc4 is expressed broadly in the B cell lineage and is involved in adhesion to the extracellular matrix (37). Pax5 also activates a variety of intracellular signaling molecules including Rasgrp3, which is required for BCR-induced signaling and proliferation (38), along with a number of other molecules with less characterized roles in lymphocyte signaling including protein kinase D2 (Prkd2), Lrmp, Stk3, Stk4, and Wnk1.

The potential outcome of the altered expression of a group of adhesion receptors and intracellular signaling molecules may be manifested in a defect in homing or adhesion. Indeed, lymphoid progenitors undergo a dramatic change in cell migration and adhesion at B cell commitment, where committed early B cells adhere to a specialized BM niche consisting of IL-7-expressing stromal cells. In contrast, uncommitted progenitors adhere to IL-7-negative BM stroma (39). Interestingly, Nedd9 (also called HEF1), which is an important component of the cytoskeleton-linked signaling pathway initiated by ligation of the BCR (40), was dependent on Pax5 for its expression. In agreement with these results, Pax5−/− pro-B cells have recently been shown in a Transwell assay to have increased CXCL12-induced migration and, most significantly, have greatly impaired integrin-mediated substrate adhesion compared with wild-type pro-B cells (20). Pax5 is also regulates the cellular proliferation that is required for the expansion phase of BM lymphopoiesis, first by IL-7 and then as a result of signals received from the pre-BCR, as Pax5 regulates Ccnd3 (cyclin D3), which is crucial for the proliferation of early B cells (41).

It is striking that many of the Pax5-activated genes identified here were nuclear proteins. A number of the genes identified were well-known regulators of B cell differentiation and function, including Ikzf3 (Aiolos), Spib, and Irf8 (Icsbp), as well as the previously identified regulators Lef1 (6) and Ebf1 (30). In most cases this regulation appeared to be direct, suggesting that Pax5 functions in part to reinforce the B cell program by further activating the downstream transcriptional cascade. Interestingly, Ikzf3 and Ebf1 expression was also dependent on Pax5 in the chicken DT40 B cell line, although that study did not determine whether the regulation was direct (29). Although these factors have many functions within the B cell lineage, it is interesting to note that they all have roles in early B cell development, particularly at the pre-B cell stage (2, 3, 42). The genes encoding two E proteins, Tcfe2a (encoding E2A) and Tcf4 (encoding E2-2), were also differentially expressed, as was the inhibitor of E proteins, Id3. E2-2 is required for optimal pro-B cell expansion (43), whereas Id3 functions to inhibit growth and induce apoptosis in pro-B cells as well as late stage B cells (44, 45). The differential expression of Tcfe2a and Id3 was surprising, as previous studies have not found these genes to be Pax5 dependent (4, 46). Although the available genetic evidence suggests that Tcfe2a acts upstream of Pax5 during B cell commitment (47), the recent finding that Ebf1 also acts both upstream and downstream of Pax5 raised the possibility that a similar situation occurred with Tcfe2a (30). Comparison of cultured and ex vivo isolated pro-B cells revealed that the differential expression of Tcfe2a was an artifact of adaptation of the cells to in vitro propagation, as the expression of Tcfe2a in pro-B cell analyzed ex vivo did not depend on Pax5 and was actually slightly increased in Pax5−/− pro-B cells. The factors that regulate Tcfe2a expression are unknown, but IL-7 has been predicted to promote expression in early B cells (1). Because both the pro-B cell cultures and a number of Pax5 target genes, including Nmyc, are exquisitely sensitive to IL-7 (6), small changes in the culture conditions may result in this apparent differential expression. Similarly, while our previous studies did not find Id3 to be directly regulated by Pax5 (6), it was subsequently reported that Id3 is induced by pre-BCR signaling, a process that is also Pax5-dependent (13). These findings highlight the fact that the regulation of specific targets may be context specific and confirm the importance of assessing differential gene expression using equivalent primary cell populations directly isolated from the BM.

A number of other transcription factors whose function in B cells is less well known were also identified. Of these, the calcium-inducible factor Nfatc1 is important for T cell function. Nfatc1−/− lack B1a B cells (48), and their follicular B cells are hyporesponsive to BCR and CD40L-mediated signals (49). It is possible that NFATc1 fulfills a function in pre-BCR signaling, although this has not been investigated.

Several cofactors and chromatin regulators were also differentially expressed, including Cbfb (core-binding factor-β). Cbfβ is a transcriptional coactivator that interacts with Runx family members, such as Runx1, a factor that is essential for many aspects of hemopoiesis including B cell development (50). The gene coding for the catalytic subunit of the SWI/SNF-related complex, Smarca4 (also known as Brg1), which is essential for T cell development (51), was moderately differentially expressed in both arrays. Taken together, the number of nuclear proteins that are activated by Pax5 suggests that a key function of this factor is to activate the expression of a panel of genes that further reinforce the B cell transcriptional program.

The expression of lineage inappropriate genes such as Csf1r, Flt3, and Notch1 in Pax5−/− pro-B cells (reviewed in Ref. 52) has provided support for the concept of lineage priming and led to a model whereby Pax5 functions to repress this promiscuous gene expression and thus restrict progenitors to the B cell fate. The Pax5-repressed genes identified here include a number of genes associated with broad hemopoietic expression such as Tmsb10 (thymosin β10), Cd47, and Lat2. Two genes involved in neutrophil migration were also identified as potential Pax5-repressed genes: l-plastin (murine Lcp1) (53) and Lsp1 (54). In addition, glutathione peroxidase-1 (Gpx1) expression was up-regulated in Pax5 deficient pro-B cells. This enzyme is primarily responsible for the intracellular degradation of hydrogen peroxide and is the predominant antioxidant enzyme expressed by osteoclasts and BM macrophages (55).

The gene encoding the Ig superfamily receptor Emb appears to be a particularly interesting Pax5-repressed gene, as it was expressed both in progenitor populations as well as in non-B cells. To further our study of Emb, we produced a mAb that detects Emb in flow cytometry, immunohistochemistry and Western blotting. These studies demonstrate that while virtually all B cells are Emb-low or negative, myeloid cells express an extremely high level of Emb whereas T cells are Emb-intermediate. Finally, Emb is induced during the terminal differentiation of conventional B cells and its expression is maintained in plasma cells, whereas peritoneal B1 B cells and splenic marginal zone B cells constitutively express Emb (32). Emb is thought to be involved in mediating adhesion to the extracellular matrix and is a member of a small gene family that also contains Basigin (CD147) a protein expressed on a variety of cell lineages including erythrocytes and T cells (56). Future loss-of-function studies are required to test the importance of the Pax5-mediated down-regulation of Emb for B cell differentiation.

Several Pax5-repressed genes have important functions in B cells. This includes Cd180 (also known as RP105), which encodes a receptor for LPS that triggers Ig class switching and secretion (57). The Pten-encoded phosphatase functions as a negative regulator of the PI3K signaling pathway upon engagement of the TCR or BCR (reviewed in Ref. 58). Although BM B lymphopoiesis occurred normally after the conditional deletion of Pten in B cells, the resultant lower signaling threshold through the BCR promoted marginal zone and B1 B cell development and rescued germinal center formation in signaling deficient, Cd19−/− mice (59). As well as being essential for many aspects of peripheral B cell biology, the inhibition of Pax5 function and the down-regulation of its expression is a crucial event in initiating plasma cell differentiation (29, 32, 60). In line with this, it has been shown that many Pax5-repressed genes, including, Flt3, Mef2c, Igj, and Emb are re-expressed during late B cell differentiation (19, 32).

The microarray data set presented in this study complements two recent screens for Pax5 target genes performed by the Busslinger laboratory (19, 20). These studies also used cDNA microarrays to compare the transcriptomes of in vitro cultivated Pax5−/− and wild-type pro-B cells. The initial study used subtractive hybridization to enrich for differentially expressed genes and found 110 putative Pax5-repressed genes (19), whereas that of Schebesta et al. used the mouse “lymphochip” (61) to identify 170 Pax5-activated transcripts (20). A variety of models of Pax5 deficiency were then used to extensively validate the target genes. In comparison, our study has used two different cDNA microarrays for the screening, a cDNA clone set from the National Institute of Aging that does not contain specifically selected hemopoietic cDNAs and a custom array produced from a mature IgM+ normalized cDNA library. In addition, other small variables would be expected to slightly alter the gene lists; for example the prior studies have used a 3-fold cutoff for differential expression whereas our studies have used statistical significance only.

Comparison of the data presented here on Pax5-activated genes revealed that 18 of the 66 genes listed in Table II (or 27%) were found in the previous report (20). Similarly, 12 of the 43 repressed genes (28%) were found in the prior study (19). The overlap between the lists can, however, be further enhanced by only comparing those genes in our study that were validated by an independent methodology (RT-PCR and/or flow cytometry), as only 50% of the genes in our study were further examined. Using this approach, the overlap between these studies was now 39%. Thus, it appears that the use of distinct screen techniques have, while identifying many common genes such as Notch1, Igf2, Emb, Spib, Ikzf3, Sdc4, and Ccnd3, proven complementary by detecting additional unique target genes, for example Syvn1, Frm4, and Tmsb10.

In summary, we have identified numerous novel Pax5 target genes whose expression is potentially activated or repressed by Pax5. These genes mediate diverse biological functions in B cells such as migration, signaling, and the regulation of gene expression and demonstrate the plethora of processes that are regulated by Pax5 to promote B cell lineage commitment and subsequent differentiation.

We thank Jason Brady, Kate Elder, Jaclyn Gilbert, and Matthew Ritchie for technical assistance.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by a Pfizer Australia Research Fellowship (to S.L.N.), and the National Health and Medical Research Council of Australia.

5

Abbreviations used in this paper: HSC, hemopoietic stem cell; BM, bone marrow; CLP, common lymphoid progenitor; EMB, Embigin; ER, estrogen receptor; NIA 15k, 15,000 clone mouse cDNA library of National Institute of Aging; Sdc4, syndecan-4.

1
Singh, H., K. L. Medina, J. M. Pongubala.
2005
. Contingent gene regulatory networks and B cell fate specification.
Proc. Natl. Acad. Sci. USA
102
:
4949
-4953.
2
Nutt, S. L., B. L. Kee.
2007
. The transcriptional regulation of B cell lineage commitment.
Immunity
26
:
715
-725.
3
Busslinger, M..
2004
. Transcriptional control of early B cell development.
Annu. Rev. Immunol.
22
:
55
-79.
4
Nutt, S. L., P. Urbanek, A. Rolink, M. Busslinger.
1997
. Essential functions of Pax5 (BSAP) in pro-B cell development: difference between fetal and adult B lymphopoiesis and reduced V-to-DJ recombination at the IgH locus.
Genes Dev.
11
:
476
-491.
5
Urbanek, P., Z. Q. Wang, I. Fetka, E. F. Wagner, M. Busslinger.
1994
. Complete block of early B cell differentiation and altered patterning of the posterior midbrain in mice lacking Pax5/BSAP.
Cell
79
:
901
-912.
6
Nutt, S. L., A. M. Morrison, P. Dorfler, A. Rolink, M. Busslinger.
1998
. Identification of BSAP (Pax-5) target genes in early B-cell development by loss- and gain-of-function experiments.
EMBO J.
17
:
2319
-2333.
7
Nutt, S. L., B. Heavey, A. G. Rolink, M. Busslinger.
1999
. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5.
Nature
401
:
556
-562.
8
Rolink, A. G., S. L. Nutt, F. Melchers, M. Busslinger.
1999
. Long-term in vivo reconstitution of T-cell development by Pax5-deficient B-cell progenitors.
Nature
401
:
603
-606.
9
Schaniel, C., L. Bruno, F. Melchers, A. G. Rolink.
2002
. Multiple hematopoietic cell lineages develop in vivo from transplanted Pax5-deficient pre-B I-cell clones.
Blood
99
:
472
-478.
10
Carotta, S., J. Brady, L. Wu, S. L. Nutt.
2006
. Transient Notch signaling induces NK cell potential in Pax5-deficient pro-B cells.
Eur. J. Immunol.
36
:
3294
-3304.
11
Kozmik, Z., S. Wang, P. Dorfler, B. Adams, M. Busslinger.
1992
. The promoter of the CD19 gene is a target for the B-cell-specific transcription factor BSAP.
Mol. Cell. Biol.
12
:
2662
-2672.
12
Fitzsimmons, D., W. Hodsdon, W. Wheat, S. M. Maira, B. Wasylyk, J. Hagman.
1996
. Pax-5 (BSAP) recruits Ets proto-oncogene family proteins to form functional ternary complexes on a B-cell-specific promoter.
Genes Dev.
10
:
2198
-2211.
13
Schebesta, M., P. L. Pfeffer, M. Busslinger.
2002
. Control of pre-BCR signaling by Pax5-dependent activation of the BLNK gene.
Immunity
17
:
473
-485.
14
Tian, J., T. Okabe, T. Miyazaki, S. Takeshita, A. Kudo.
1997
. Pax-5 is identical to EBB-1/KLP and binds to the VpreB and λ5 promoters as well as the KI and KII sites upstream of the Jκ genes.
Eur. J. Immunol.
27
:
750
-755.
15
Thevenin, C., S. L. Nutt, M. Busslinger.
1998
. Early function of Pax5 (BSAP) before the pre-B cell receptor stage of B lymphopoiesis.
J. Exp. Med.
188
:
735
-744.
16
Souabni, A., C. Cobaleda, M. Schebesta, M. Busslinger.
2002
. Pax5 promotes B lymphopoiesis and blocks T cell development by repressing Notch1.
Immunity
17
:
781
-793.
17
Tagoh, H., R. Ingram, N. Wilson, G. Salvagiotto, A. J. Warren, D. Clarke, M. Busslinger, C. Bonifer.
2006
. The mechanism of repression of the myeloid-specific c-fms gene by Pax5 during B lineage restriction.
EMBO J.
25
:
1070
-1080.
18
Holmes, M. L., S. Carotta, L. M. Corcoran, S. L. Nutt.
2006
. Repression of Flt3 by Pax5 is crucial for B-cell lineage commitment.
Genes Dev.
20
:
933
-938.
19
Delogu, A., A. Schebesta, Q. Sun, K. Aschenbrenner, T. Perlot, M. Busslinger.
2006
. Gene repression by Pax5 in B cells is essential for blood cell homeostasis and is reversed in plasma cells.
Immunity
24
:
269
-281.
20
Schebesta, A., S. McManus, G. Salvagiotto, A. Delogu, G. A. Busslinger, M. Busslinger.
2007
. Transcription factor pax5 activates the chromatin of key genes involved in B cell signaling, adhesion, migration, and immune function.
Immunity
27
:
49
-63.
21
Soares, M. B., M. F. Bonaldo, P. Jelene, L. Su, L. Lawton, A. Efstratiadis.
1994
. Construction and characterization of a normalized cDNA library.
Proc. Natl. Acad. Sci. USA
91
:
9228
-9232.
22
Kargul, G. J., D. B. Dudekula, Y. Qian, M. K. Lim, S. A. Jaradat, T. S. Tanaka, M. G. Carter, M. S. Ko.
2001
. Verification and initial annotation of the NIA mouse 15K cDNA clone set.
Nat. Genet.
28
:
17
-18.
23
Smyth, G. K., T. Speed.
2003
. Normalization of cDNA microarray data.
Methods
31
:
265
-273.
24
Smyth, G. K., J. Michaud, H. S. Scott.
2005
. Use of within-array replicate spots for assessing differential expression in microarray experiments.
Bioinformatics
21
:
2067
-2075.
25
Smyth, G. K..
2004
. Linear models and empirical bayes methods for assessing differential expression in microarray experiments.
Stat. Appl. Genet. Mol. Biol.
3
:
Article3
26
Nutt, S. L., D. Metcalf, A. D’Amico, M. Polli, L. Wu.
2005
. Dynamic regulation of PU.1 expression in multipotent hematopoietic progenitors.
J. Exp. Med.
201
:
221
-231.
27
Polli, M., A. Dakic, A. Light, L. Wu, D. M. Tarlinton, S. L. Nutt.
2005
. The development of functional B lymphocytes in conditional PU.1 knock-out mice.
Blood
106
:
2083
-2090.
28
Pulendran, B., M. Karvelas, G. J. Nossal.
1994
. A form of immunologic tolerance through impairment of germinal center development.
Proc. Natl. Acad. Sci. USA
91
:
2639
-2643.
29
Nera, K. P., P. Kohonen, E. Narvi, A. Peippo, L. Mustonen, P. Terho, K. Koskela, J. M. Buerstedde, O. Lassila.
2006
. Loss of Pax5 promotes plasma cell differentiation.
Immunity
24
:
283
-293.
30
Roessler, S., I. Gyory, S. Imhof, M. Spivakov, R. R. Williams, M. Busslinger, A. G. Fisher, R. Grosschedl.
2007
. Distinct promoters mediate the regulation of Ebf1 gene expression by interleukin-7 and Pax5.
Mol. Cell. Biol.
27
:
579
-594.
31
Huang, R. P., M. Ozawa, K. Kadomatsu, T. Muramatsu.
1993
. Embigin, a member of the immunoglobulin superfamily expressed in embryonic cells, enhances cell-substratum adhesion.
Dev. Biol.
155
:
307
-314.
32
Kallies, A., J. Hasbold, K. Fairfax, C. Pridans, D. Emslie, B. S. McKenzie, A. M. Lew, L. M. Corcoran, P. D. Hodgkin, D. M. Tarlinton, S. L. Nutt.
2007
. Initiation of plasma cell differentiation is independent of the transcription factor Blimp-1.
Immunity
26
:
555
-566.
33
Cobaleda, C., A. Schebesta, A. Delogu, M. Busslinger.
2007
. Pax5: the guardian of B cell identity and function.
Nat. Immunol.
8
:
463
-470.
34
Hamann, J., C. van Zeventer, A. Bijl, C. Molenaar, K. Tesselaar, R. A. van Lier.
2000
. Molecular cloning and characterization of mouse CD97.
Int. Immunol.
12
:
439
-448.
35
Nielsen, P. J., B. Lorenz, A. M. Muller, R. H. Wenger, F. Brombacher, M. Simon, T. von der Weid, W. J. Langhorne, H. Mossmann, G. Kohler.
1997
. Altered erythrocytes and a leaky block in B-cell development in CD24/HSA-deficient mice.
Blood
89
:
1058
-1067.
36
Itoh, M., K. Ishihara, T. Hiroi, B. O. Lee, H. Maeda, H. Iijima, M. Yanagita, H. Kiyono, T. Hirano.
1998
. Deletion of bone marrow stromal cell antigen-1 (CD157) gene impaired systemic thymus independent-2 antigen-induced IgG3 and mucosal TD antigen-elicited IgA responses.
J. Immunol.
161
:
3974
-3983.
37
Yamashita, Y., K. Oritani, E. K. Miyoshi, R. Wall, M. Bernfield, P. W. Kincade.
1999
. Syndecan-4 is expressed by B lineage lymphocytes and can transmit a signal for formation of dendritic processes.
J. Immunol.
162
:
5940
-5948.
38
Coughlin, J. J., S. L. Stang, N. A. Dower, J. C. Stone.
2005
. RasGRP1 and RasGRP3 regulate B cell proliferation by facilitating B cell receptor-Ras signaling.
J. Immunol.
175
:
7179
-7184.
39
Tokoyoda, K., T. Egawa, T. Sugiyama, B. I. Choi, T. Nagasawa.
2004
. Cellular niches controlling B lymphocyte behavior within bone marrow during development.
Immunity
20
:
707
-718.
40
Manie, S. N., A. R. Beck, A. Astier, S. F. Law, T. Canty, H. Hirai, B. J. Druker, H. Avraham, N. Haghayeghi, M. Sattler, et al
1997
. Involvement of p130(Cas) and p105(HEF1), a novel Cas-like docking protein, in a cytoskeleton-dependent signaling pathway initiated by ligation of integrin or antigen receptor on human B cells.
J. Biol. Chem.
272
:
4230
-4236.
41
Cooper, A. B., C. M. Sawai, E. Sicinska, S. E. Powers, P. Sicinski, M. R. Clark, I. Aifantis.
2006
. A unique function for cyclin D3 in early B cell development.
Nat. Immunol.
7
:
489
-497.
42
Lu, R., K. L. Medina, D. W. Lancki, H. Singh.
2003
. IRF-4,8 orchestrate the pre-B-to-B transition in lymphocyte development.
Genes Dev.
17
:
1703
-1708.
43
Wikstrom, I., J. Forssell, M. Goncalves, F. Colucci, D. Holmberg.
2006
. E2-2 regulates the expansion of pro-B cells and follicular versus marginal zone decisions.
J. Immunol.
177
:
6723
-6729.
44
Kee, B. L..
2005
. Id3 induces growth arrest and caspase-2-dependent apoptosis in B lymphocyte progenitors.
J. Immunol.
175
:
4518
-4527.
45
Kee, B. L., R. R. Rivera, C. Murre.
2001
. Id3 inhibits B lymphocyte progenitor growth and survival in response to TGF-β.
Nat. Immunol.
2
:
242
-247.
46
Fuxa, M., J. Skok, A. Souabni, G. Salvagiotto, E. Roldan, M. Busslinger.
2004
. Pax5 induces V-to-DJ rearrangements and locus contraction of the immunoglobulin heavy-chain gene.
Genes Dev.
18
:
411
-422.
47
Ikawa, T., H. Kawamoto, L. Y. Wright, C. Murre.
2004
. Long-term cultured E2A-deficient hematopoietic progenitor cells are pluripotent.
Immunity
20
:
349
-360.
48
Berland, R., H. H. Wortis.
2003
. Normal B-1a cell development requires B cell-intrinsic NFATc1 activity.
Proc. Natl. Acad. Sci. USA
100
:
13459
-13464.
49
Peng, S. L., A. J. Gerth, A. M. Ranger, L. H. Glimcher.
2001
. NFATc1 and NFATc2 together control both T and B cell activation and differentiation.
Immunity
14
:
13
-20.
50
Ichikawa, M., T. Asai, S. Chiba, M. Kurokawa, S. Ogawa.
2004
. Runx1/AML-1 ranks as a master regulator of adult hematopoiesis.
Cell Cycle
3
:
722
-724.
51
Gebuhr, T. C., G. I. Kovalev, S. Bultman, V. Godfrey, L. Su, T. Magnuson.
2003
. The role of Brg1, a catalytic subunit of mammalian chromatin-remodeling complexes, in T cell development.
J. Exp. Med.
198
:
1937
-1949.
52
Carotta, S., M. L. Holmes, C. Pridans, S. L. Nutt.
2006
. Pax5 maintains cellular identity by repressing gene expression throughout B cell differentiation.
Cell Cycle
5
:
2452
-2456.
53
Jones, S. L., E. J. Brown.
1996
. FcγRII-mediated adhesion and phagocytosis induce L-plastin phosphorylation in human neutrophils.
J. Biol. Chem.
271
:
14623
-14630.
54
Liu, L., D. C. Cara, J. Kaur, E. Raharjo, S. C. Mullaly, J. Jongstra-Bilen, J. Jongstra, P. Kubes.
2005
. LSP1 is an endothelial gatekeeper of leukocyte transendothelial migration.
J. Exp. Med.
201
:
409
-418.
55
Lean, J. M., C. J. Jagger, B. Kirstein, K. Fuller, T. J. Chambers.
2005
. Hydrogen peroxide is essential for estrogen-deficiency bone loss and osteoclast formation.
Endocrinology
146
:
728
-735.
56
Muramatsu, T., T. Miyauchi.
2003
. Basigin (CD147): a multifunctional transmembrane protein involved in reproduction, neural function, inflammation, and tumor invasion.
Histol. Histopathol.
18
:
981
-987.
57
Ogata, H., I. Su, K. Miyake, Y. Nagai, S. Akashi, I. Mecklenbrauker, K. Rajewsky, M. Kimoto, A. Tarakhovsky.
2000
. The toll-like receptor protein RP105 regulates lipopolysaccharide signaling in B cells.
J. Exp. Med.
192
:
23
-29.
58
Kishimoto, H., K. Hamada, M. Saunders, S. Backman, T. Sasaki, T. Nakano, T. W. Mak, A. Suzuki.
2003
. Physiological functions of Pten in mouse tissues.
Cell Struct. Funct.
28
:
11
-21.
59
Anzelon, A. N., H. Wu, R. C. Rickert.
2003
. Pten inactivation alters peripheral B lymphocyte fate and reconstitutes CD19 function.
Nat. Immunol.
4
:
287
-294.
60
Kallies, A., S. L. Nutt.
2007
. Terminal differentiation of lymphocytes depends on Blimp-1.
Curr. Opin. Immunol.
19
:
156
-162.
61
Shaffer, A. L., M. Shapiro-Shelef, N. N. Iwakoshi, A. H. Lee, S. B. Qian, H. Zhao, X. Yu, L. Yang, B. K. Tan, A. Rosenwald, et al
2004
. XBP1, downstream of Blimp-1, expands the secretory apparatus and other organelles, and increases protein synthesis in plasma cell differentiation.
Immunity
21
:
81
-93.