In infection with the trematode helminth Schistosoma mansoni, the severity of CD4 T cell-mediated hepatic granulomatous and fibrosing inflammation against parasite eggs varies considerably in humans and among mouse strains. In mice, either the natural high pathology, or high pathology induced by concomitant immunization with schistosome egg Ags (SEA) in CFA (SEA/CFA), results from a failure to contain a net proinflammatory cytokine environment. We previously demonstrated that the induction of severe immunopathology was dependent on the IL-12/IL-23 common p40 subunit, and correlated with an increase in IL-17, thus implying IL-23 in the pathogenesis. We now show that mice lacking the IL-23-specific subunit p19 are impaired in developing severe immunopathology following immunization with SEA/CFA, which is associated with a marked drop of IL-17 in the granulomas, but not in the draining mesenteric lymph nodes, and with a markedly suppressed SEA-specific IFN-γ response regulated by a striking increase in IL-10. The granulomas are characterized by a significant reduction in Gr-1+ cell recruitment and by alternative macrophage activation. Taken together, these results demonstrate that IL-23 per se is not necessary for the generation of IL-17-producing T cells, but is essential for the development of severe schistosome egg-induced immunopathology, and its absence cannot be overcome with other possible compensatory mechanisms.

Granulomatous and fibrosing inflammation against parasite eggs is the main pathology in infection with schistosome helminths (1, 2). The lesions are mediated and orchestrated by CD4 T cells specific for egg Ags, and in the case of the species Schistosoma mansoni, localize to the liver and intestines. The extent of immunopathology varies widely both in humans as well as among mouse strains in an experimental model (3, 4, 5, 6). In genetically predisposed low pathology mouse strains, such as the C57BL/6 (BL/6), an early Th1-type response readily gives way to a Th2-type response, whereas in high pathology strains, such as the C3H or CBA, the Th1 response lingers along with the Th2 response into the chronic phase of the disease (7). Significantly, a high pathology phenotype with remarkable similarity to its natural counterpart can also be induced in BL/6 mice by concomitant immunization with soluble schistosome egg Ags (SEA)3 in CFA (SEA/CFA) (8, 9, 10).

IL-12, together with the transcription factor T-bet, is a most critical element in the induction of Th1 responses (11). IL-12 is a heterodimeric cytokine composed of two subunits, p40 and p35; however, the finding that the p40 subunit can also associate with a distinct p19 subunit to form IL-23 has added diversity and complexity to the initiation of inflammatory processes (12). Both IL-12 and IL-23 are produced by the same set of accessory cells—mainly activated dendritic cells and macrophages—but each of them drives different and independent subsets of proinflammatory CD4 T cells with distinct signature cytokines and functions: IL-12 induces Th1 cells that produce IFN-γ, thereby activating macrophages to kill intracellular pathogens, whereas IL-23 promotes the so-called Th17 cells, characterized by producing IL-17, IL-6, TNF-α (13, 14) and by mediating chronic inflammation in autoimmune diseases, including experimental allergic encephalomyelitis (15, 16), collagen-induced arthritis (17, 18), inflammatory bowel disease (19), and systemic sclerosis (20), as well as in transplant rejection (21).

Using schistosome-infected IL-12p35−/− and IL-12p40−/− BL/6 mice, we previously demonstrated that the exacerbation of egg-induced immunopathology afforded by immunization with SEA/CFA is not dependent on IL-12p35, but fails to materialize in the absence of IL-12p40 (10). The SEA/CFA-induced pathology correlated with increased levels of IL-17 and a decline in IL-5 and IL-10, but was independent of IFN-γ. Importantly, naturally high pathology CBA mice similarly exhibited elevated IL-17, and in both models the severe hepatic lesions could be reduced by in vivo treatment with mAb against IL-17 (10). These results, in agreement with the observations made in the autoimmune diseases, suggested that the IL-23/IL-17 pathway, and not the IL-12/IFN-γ pathway, was critical for the development of high pathology in schistosomiasis, indirectly implying a need for IL-23 in the Th17 cell-mediated immunopathology. More recent studies, however, cast a doubt on the importance of IL-23 by demonstrating that Th17 cells can be generated by a combination of IL-6 and TGF-β with IL-23 acting as a survival or expansion factor for the cells of this lineage (22, 23, 24). IL-21 has also been shown to facilitate Th17 cell development (25, 26).

To more precisely address the role of IL-23 in high pathology schistosomiasis, we now examined mice lacking the IL-23p19 subunit, which are unable to produce IL-23, while retaining the ability to make IL-12. Unlike the IL-12p40−/− mice, the schistosome-infected IL-23p19−/− mice displayed a more modest but still significant increase in pathology in response to immunization with SEA/CFA, which correlated with a rise in IL-17 production in the mesenteric lymph nodes (MLN), but not in the hepatic lesions themselves. Thus, our findings indicate that IL-23 critically contributes to the immunopathology, but by itself is not essential for the development of Th17 cells in schistosomiasis.

IL-23p19-deficient (IL-23p19−/−) mice were produced as previously described (15) and bred in-house. C57BL/6 (BL/6) mice, 5–6 wk old, were purchased from The Jackson Laboratory. All mice were maintained in the Animal Facility at Tufts University School of Medicine in accordance with the Association for Assessment and Accreditation of Laboratory Animal Care guidelines. Mice were infected by i.p. injection with 80 cercariae of S. mansoni (Puerto Rico strain), which were obtained from infected Biomphalaria glabrata snails, provided to us by Dr. F. Lewis (Biomedical Research Institute, Rockville, MD, through National Institutes of Health/National Institute of Allergy and Infectious Diseases Contract N01-AI-55270). Some mice were immunized by s.c. injection with 50 μg of SEA emulsified in CFA (SEA/CFA), as previously described (8). Treatment of BL/6 mice with SEA/CFA causes marked exacerbation of their egg-induced immunopathology; either SEA or CFA by themselves are ineffective (8). SEA was prepared as previously described (27).

Total RNA from individual livers and MLN of schistosome-infected mice were isolated using RNA STAT-60 (Tel-Test) according to manufacturer’s instructions. After isopropanol precipitation, total RNA was re-extracted with phenol:chloroform:isoamyl alcohol (25:24:1; Sigma-Aldrich) using phase-lock light tubes (Eppendorf). Total RNA (5 μg) was subjected to treatment with DNase (Roche Molecular Biochemicals) according to the manufacturer’s instructions to eliminate possible genomic DNA contamination. DNase-treated total RNA was reverse-transcribed using Superscript II (Invitrogen Life Technologies) according to manufacturer’s instructions. Primers shown in Table I were designed using Primer Express (Applied Biosystems). Other primers, for which sequences are unavailable, were obtained commercially from Applied Biosystems. Real-time RT-PCR on 10 ng of cDNA from each sample was performed using either of two methods. In the first method, two gene-specific unlabeled primers were used at 400 nM in a PerkinElmer SYBR Green real-time quantitative PCR assay using an ABI 5700 instrument (Applied Biosystems). In the second method, two unlabeled primers at 900 nM each were used with 250 nM FAM-labeled probe (Applied Biosystems) in a TaqMan real-time quantitative PCR on an ABI 7700 sequence detection system. The absence of genomic DNA contamination was confirmed using primers that recognize the genomic region of the CD4 promoter. Ubiquitin levels were measured in a separate reaction and used to normalize the data. Using the mean cycle threshold (Ct) value for ubiquitin and the gene of interest for each sample, the equation 1.8 e (Ct ubiquitin − Ct gene of interest) × 104 was used to obtain the normalized values (16).

Table I.

Primers used in this study

Primer NameForwardReverseAccession Number
p19 CCAGCAGCTCTCTCGGAATC GATTCATATGTCCCGCTGGTG  
p40 ACAGCACCAGCTTCTTCATCAG TCTTCAAAGGCTTCATCTGCAA  
p35 CACCCTTGCCCTCCTAAACC CACCTGGCAGGTCCAGAGA  
IL-17 ACCGCAATGAAGACCCTGAT CAGGATCTCTTGCTGGATGAGA  
IFN-γ GGATATCTGGAGGAACTGGCAA TGATGGCCTGATTGTCTTTCAA  
IL-6 ACACATGTTCTCTGGGAAATCGT AAGTGCATCATCGTTGTTCATACA  
IL-4 CTCATGGAGCTGCAGAGACTCTT CATTCATGGTGCAGCTTATCGA  
IL-13 TGACCAACATCTCCAATTGCA TTGTTATAAAGTGGGCTACTTCGATTT  
IL-10 TTTGAATTCCCTGGGTGAGAA GCTCCACTGCCTTGCTCTTATT  
IL-21   NM..021782.2 
CXCL1   NM..008176.1 
CXCL2   NM..009140.2 
CCL11   NM..011330.1 
YM1   NM..009892.1 
Arginase   NM..007482.2 
INOS   NM..00440483.m1 
Primer NameForwardReverseAccession Number
p19 CCAGCAGCTCTCTCGGAATC GATTCATATGTCCCGCTGGTG  
p40 ACAGCACCAGCTTCTTCATCAG TCTTCAAAGGCTTCATCTGCAA  
p35 CACCCTTGCCCTCCTAAACC CACCTGGCAGGTCCAGAGA  
IL-17 ACCGCAATGAAGACCCTGAT CAGGATCTCTTGCTGGATGAGA  
IFN-γ GGATATCTGGAGGAACTGGCAA TGATGGCCTGATTGTCTTTCAA  
IL-6 ACACATGTTCTCTGGGAAATCGT AAGTGCATCATCGTTGTTCATACA  
IL-4 CTCATGGAGCTGCAGAGACTCTT CATTCATGGTGCAGCTTATCGA  
IL-13 TGACCAACATCTCCAATTGCA TTGTTATAAAGTGGGCTACTTCGATTT  
IL-10 TTTGAATTCCCTGGGTGAGAA GCTCCACTGCCTTGCTCTTATT  
IL-21   NM..021782.2 
CXCL1   NM..008176.1 
CXCL2   NM..009140.2 
CCL11   NM..011330.1 
YM1   NM..009892.1 
Arginase   NM..007482.2 
INOS   NM..00440483.m1 

Livers and MLN were removed aseptically from 7-wk infected mice. Granuloma cells (GC) were obtained by homogenization of the livers in a Waring blender, isolation of granulomas by 1 g of sedimentation, extensive washing and enzymatic digestion with 1 mg/ml collagenase type H, from Clostridium histolyticum (Sigma-Aldrich). Single-cell suspensions from MLN were prepared by teasing the tissues in complete RPMI 1640 medium (cRPMI) supplemented with 10% FCS (Atlanta Biologicals), 4 mM l-glutamine, 80 U/ml penicillin, 80 μg/ml streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, 1× non-essential amino acids (all obtained from BioWhittaker), and 0.1% 2-ME. Erythrocytes were lysed with Tris ammonium chloride buffer (pH 7.2; Sigma-Aldrich) for 15 min on ice. Cells were washed and live cells that excluded trypan blue were counted and resuspended at the desired concentrations in cRPMI. For purification of CD4+ cells, MLN cells (MLNC) were negative selected on CD4 MACS columns (Miltenyi Biotec) following the manufacturer’s instructions. The resulting cell preparations were >94% CD4+ cells as determined by flow cytometry.

Bulk cell suspensions (5 × 106 cells/ml) from hepatic granulomas and MLN, or purified CD4+ cells from MLN (1 × 106 cells/ml) plus normal irradiated syngeneic splenic APC (4 × 106 cells/ml), were incubated in the presence or absence of 15 μg/ml SEA. Anti-IL-10 mAb (clone JS5-2A5; BD Biosciences) were added into some cultures of MLNC at a concentration of 1 or 5 μg/ml. After 48 h, the culture supernatants were removed, filtered, and stored at −36°C until analysis by ELISA. For the detection of IL-6, IL-17, IL-21, and IFN-γ, mAb, standard cytokines and protocols were obtained from R&D Systems, and for the detection of IL-5, IL-10, and TGF-β, from BD Biosciences.

GC were stained ex vivo for flow cytometry analysis using FITC-conjugated anti-Gr-1 (clone RB6-8C5; BD Biosciences) and allophycocyanin-conjugated anti-CCR3 mAb (R&D Systems) following a protocol described previously (28). Labeled cells were acquired on a FACSCalibur flow cytometer using the CellQuest software version 3.2.1 (BD Biosciences). Data were analyzed using the WinList 5.0 software (Verity Software House). Unstained cells and cells stained with irrelevant isotype-matched Abs were included as controls to assess the amount of nonspecific staining.

Liver samples were fixed in 10% buffered formalin and processed for routine histopathologic analysis. Five-micrometer sections were stained with H&E and the extent of granulomatous inflammation around schistosome eggs was measured by computer-assisted morphometric analysis using Image-Pro Plus software (Media Cybernetics). The lesions were assessed on coded slides by an observer unaware of the experimental setting. To reflect more accurately the true shape and dimension of the granulomas, only those with a visible central egg were counted. A minimum of 10 granulomas were scored per liver section. Granuloma sizes are expressed as means of areas measured in micrometers squared ± SEM.

ANOVA followed by the Tukey test for multiple comparisons or the χ2 test were used to determine the statistical significance of the differences among groups. Results differing with a p < 0.05 were considered significant. Each individual experiment was conducted with groups of three to eight mice.

The role of IL-23 in the schistosome infection was investigated in IL-23p19−/− mice concomitantly immunized with SEA/CFA, a regimen that causes marked exacerbation of egg-induced immunopathology with sharp increase in IL-17 and death typically ensuing at 7 wk postinfection (8, 10). This model, which bears substantial resemblance to the natural high pathology, was used because the IL-23p19−/− mice are on a low pathology BL/6 background. Unlike the BL/6 wild-type mice, all SEA/CFA-immunized IL-23p19−/− mice survived the 7 wk schistosome infection (Fig. 1,A), as was the case in IL-12p40−/− mice examined in another study (10). However, unlike the IL-12p40−/− mice, in which there was no pathology exacerbation following immunization with SEA/CFA, the IL-23p19−/− mice consistently responded to this challenge with a small but significant increase in the hepatic immunopathology (Fig. 1 B). No deaths or differences in the low pathology were observed in the schistosome-infected, unimmunized IL-23p19−/−, or BL/6 mice.

FIGURE 1.

Mortality and hepatic immunopathology in 7-wk schistosome-infected BL/6 and IL-23p19−/− mice. A, Mortality by 7 wk postinfection occurs only in the SEA/CFA-immunized BL/6 mice (p = 0.0003). Indicated are the numbers of dead mice over total in group. B, Hepatic granulomatous inflammation is significantly lower in the infected SEA/CFA-immunized IL-23p19−/− vs BL/6 mice but significantly higher in SEA/CFA-immunized IL-23p19−/− than in their unimmunized counterparts (both p < 0.05). Mortality data are pooled from seven separate experiments and the immunopathology from three separate experiments with three to six mice per group.

FIGURE 1.

Mortality and hepatic immunopathology in 7-wk schistosome-infected BL/6 and IL-23p19−/− mice. A, Mortality by 7 wk postinfection occurs only in the SEA/CFA-immunized BL/6 mice (p = 0.0003). Indicated are the numbers of dead mice over total in group. B, Hepatic granulomatous inflammation is significantly lower in the infected SEA/CFA-immunized IL-23p19−/− vs BL/6 mice but significantly higher in SEA/CFA-immunized IL-23p19−/− than in their unimmunized counterparts (both p < 0.05). Mortality data are pooled from seven separate experiments and the immunopathology from three separate experiments with three to six mice per group.

Close modal

The use of mice lacking specific and shared subunits of IL-12 and IL-23 made it possible to begin understanding the pathogenic roles of Th1 vs Th17 subsets in a number of disease models including schistosomiasis (10). Analysis of mRNA transcripts by real-time RT-PCR confirmed that IL-23p19 (Fig. 2,A), but not IL-12p40 (Fig. 2,B) and IL-12p35 (Fig. 2 C) were indeed absent in both the liver as well as MLN from the schistosome-infected, SEA/CFA-immunized, or unimmunized IL-23p19−/− mice.

FIGURE 2.

IL-23p19, IL-12p40, and IL-12p35 mRNA transcripts from livers and MLN of infected BL/6 and IL-23p19−/− mice. mRNA was measured by real-time RT-PCR as described in Materials and Methods. A, Liver and MLN IL-23p19 is significantly reduced in SEA/CFA-immunized and unimmunized IL-23p19−/− mice (both p < 0.05). Liver and MLN IL-12p40 (B) and IL-12p35 (C) are not significantly different in the SEA/CFA-immunized or unimmunized mouse groups. PCR data for all three transcripts were normalized to ubiquitin. Each bar represents the mean mRNA level of five to eight mice from two to three independent experiments.

FIGURE 2.

IL-23p19, IL-12p40, and IL-12p35 mRNA transcripts from livers and MLN of infected BL/6 and IL-23p19−/− mice. mRNA was measured by real-time RT-PCR as described in Materials and Methods. A, Liver and MLN IL-23p19 is significantly reduced in SEA/CFA-immunized and unimmunized IL-23p19−/− mice (both p < 0.05). Liver and MLN IL-12p40 (B) and IL-12p35 (C) are not significantly different in the SEA/CFA-immunized or unimmunized mouse groups. PCR data for all three transcripts were normalized to ubiquitin. Each bar represents the mean mRNA level of five to eight mice from two to three independent experiments.

Close modal

We previously demonstrated that pathology exacerbation following immunization with SEA/CFA correlates with increased levels of IL-17 in GC and MLNC irrespective of the presence or absence of IFN-γ (10). In agreement with these observations, there were no mRNA IL-17 transcripts in the livers with smaller granulomas of SEA/CFA-immunized IL-23p19−/− mice in comparison with similarly treated BL/6 mice, and there were no IL-17 transcripts in the livers of either unimmunized mouse groups (Fig. 3,A). In contrast, IFN-γ mRNA levels were not significantly different in these mouse groups (Fig. 3,B). IL-6 was increased (Fig. 3,C), and IL-21 was not different (Fig. 3,D) in the SEA/CFA-immunized mice. IL-4 and IL-13 were significantly reduced in BL/6 mice after immunization, but this difference was considerably less pronounced in the IL-23p19−/− mice (Fig. 3, E and F). IL-10 was also decreased in the SEA/CFA-immunized mouse groups (Fig. 3 G).

FIGURE 3.

Cytokine mRNA transcripts from livers of infected BL/6 and IL-23p19−/− mice. mRNA was measured by real-time RT-PCR as described in Materials and Methods. A, IL-17 is significantly lower in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). B, IFN-γ is higher in SEA/CFA-immunized IL-23p19−/− mice but the difference is not statistically significant. C, IL-6 is higher in SEA/CFA-immunized mice but not significantly different in BL/6 vs IL-23p19−/− groups. D, IL-21 is not significantly different in BL/6 and IL-23p19−/− mice. E, IL-4 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). F, IL-13 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.01). G, IL-10 is reduced in SEA/CFA-immunized mice but significantly higher in the IL-23p19−/− group (p < 0.001). PCR data for all seven transcripts were normalized to ubiquitin. Each bar represents the mean mRNA level ± SD of 5–12 mice from two to three independent experiments.

FIGURE 3.

Cytokine mRNA transcripts from livers of infected BL/6 and IL-23p19−/− mice. mRNA was measured by real-time RT-PCR as described in Materials and Methods. A, IL-17 is significantly lower in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). B, IFN-γ is higher in SEA/CFA-immunized IL-23p19−/− mice but the difference is not statistically significant. C, IL-6 is higher in SEA/CFA-immunized mice but not significantly different in BL/6 vs IL-23p19−/− groups. D, IL-21 is not significantly different in BL/6 and IL-23p19−/− mice. E, IL-4 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). F, IL-13 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.01). G, IL-10 is reduced in SEA/CFA-immunized mice but significantly higher in the IL-23p19−/− group (p < 0.001). PCR data for all seven transcripts were normalized to ubiquitin. Each bar represents the mean mRNA level ± SD of 5–12 mice from two to three independent experiments.

Close modal

Examination of mRNA levels from the MLN of the same mouse groups unexpectedly revealed that, in contrast to the livers, there was ample transcription of IL-17 in the SEA/CFA-immunized IL-23p19−/− mice comparable to that seen in the BL/6 mice (Fig. 4,A). IFN-γ (Fig. 4,B) and IL-6 (Fig. 4,C) were not significantly different in all four groups, but IL-21 (Fig. 4,D) was significantly higher in the SEA/CFA-immunized IL-23p19−/− mice. IL-4 (Fig. 4,E) and IL-13 (Fig. 4,F) values were similar to those seen in the livers, and IL-10 was significantly higher in the SEA/CFA-immunized IL-23p19−/− mice (Fig. 4 G).

FIGURE 4.

Cytokine mRNA transcripts from MLN of infected BL/6 and IL-23p19−/− mice. mRNA was measured by real-time RT-PCR as described in Materials and Methods. A, Elevated IL-17 levels in both SEA/CFA-immunized BL/6 and IL-23p19−/− mice are not significantly different from one another. B, IFN-γ is higher in SEA/CFA-immunized IL-23p19−/− mice, but the difference is not statistically significant. C, IL-6 is not significantly different in all four mouse groups. D, IL-21 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). E, IL-4 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). F, IL-13 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.01). G, IL-10 is significantly higher in the SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). PCR data for all seven transcripts were normalized to ubiquitin. Each bar represents the mean mRNA level ± SD of 5–12 mice from two to three independent experiments.

FIGURE 4.

Cytokine mRNA transcripts from MLN of infected BL/6 and IL-23p19−/− mice. mRNA was measured by real-time RT-PCR as described in Materials and Methods. A, Elevated IL-17 levels in both SEA/CFA-immunized BL/6 and IL-23p19−/− mice are not significantly different from one another. B, IFN-γ is higher in SEA/CFA-immunized IL-23p19−/− mice, but the difference is not statistically significant. C, IL-6 is not significantly different in all four mouse groups. D, IL-21 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). E, IL-4 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). F, IL-13 is significantly higher in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.01). G, IL-10 is significantly higher in the SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.001). PCR data for all seven transcripts were normalized to ubiquitin. Each bar represents the mean mRNA level ± SD of 5–12 mice from two to three independent experiments.

Close modal

To correlate the observed differential gene transcription with secreted proteins, we measured the cytokines produced in vitro by SEA-stimulated GC and MLNC from the same mouse groups by ELISA. In agreement with the mRNA levels, there was a sharp increase in IL-17 production by GC from SEA/CFA-immunized BL/6 mice which completely failed to materialize in the IL-23p19−/− group (Fig. 5,A). Interestingly, IFN-γ levels were also markedly inhibited in the IL-23p19−/− mice (Fig. 5,B). This was most surprising given that these mice are capable of making IL-12, and that IFN-γ transcripts were as high or higher than in the BL/6 mice (Fig. 3,B). Neither the unimmunized IL-23p19−/− nor BL/6 mice produced significant amounts of IL-17 or IFN-γ. In contrast to IL-17 and IFN-γ, as previously observed (10), IL-5 (Fig. 5,C) and IL-10 (Fig. 5,D) were down-regulated following immunization with SEA/CFA in both the IL-23p19−/− and BL/6 mice. However, interestingly, these cytokines were significantly higher in the IL-23p19−/− than in the BL/6 mice; this difference was striking in the case of IL-10. Lastly, IL-6 was lower in both SEA/CFA-immunized mice, but significantly higher in the IL-23p19−/− than the BL/6 mice (Fig. 5,E), whereas TGF-β was higher in the SEA/CFA-immunized mice, but there was no significant difference between both immunized groups (Fig. 5,F). No significant amounts of SEA-induced IL-21 were detected (data not shown). Given that both IL-6 and TGF-β have been implicated in the induction of Th17 cells (22, 23, 24, 29), our data fail to show an obvious correlation between their levels and the cells’ ability to produce IL-17 (Fig. 5 A).

FIGURE 5.

Cytokine production by SEA-stimulated GC from infected BL/6 and IL-23p19−/− mice. A–F, Cytokine levels in 48 h supernatants from SEA-stimulated GC were measured by ELISA. IL-17 (A) and IFN-γ (B) are significantly lower in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (both p < 0.001). IL-5 (C) and IL-10 (D) are reduced in both SEA/CFA-immunized groups but are significantly higher in the IL-23p19−/− mice (p < 0.05 and p < 0.01, respectively). IL-6 (E) is significantly higher in the SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.05). TGF-β (F) is not significantly different in both SEA/CFA-immunized mice. Cytokine levels are expressed as means of triplicate determinations ± SD; background cytokine levels from unstimulated GC were subtracted (except for TGF-β). Results shown are from one experiment representative of five.

FIGURE 5.

Cytokine production by SEA-stimulated GC from infected BL/6 and IL-23p19−/− mice. A–F, Cytokine levels in 48 h supernatants from SEA-stimulated GC were measured by ELISA. IL-17 (A) and IFN-γ (B) are significantly lower in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (both p < 0.001). IL-5 (C) and IL-10 (D) are reduced in both SEA/CFA-immunized groups but are significantly higher in the IL-23p19−/− mice (p < 0.05 and p < 0.01, respectively). IL-6 (E) is significantly higher in the SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (p < 0.05). TGF-β (F) is not significantly different in both SEA/CFA-immunized mice. Cytokine levels are expressed as means of triplicate determinations ± SD; background cytokine levels from unstimulated GC were subtracted (except for TGF-β). Results shown are from one experiment representative of five.

Close modal

The cytokine secretion profile of MLNC generally mimicked that of the GC although in the case of the T cell-derived cytokines, the absolute levels were usually higher. One notable exception was that SEA-stimulated, MLNC from schistosome-infected SEA/CFA-immunized IL-23p19−/− mice consistently produced low but significant amounts of IL-17, despite the absence of IL-23 (Fig. 6,A). By comparison, IFN-γ production by the same cells was again exceedingly low (Fig. 6,B). IL-5 levels (Fig. 6,C) were similar to those seen in the GC and IL-10 was again markedly higher in the SEA/CFA-immunized IL-23p19−/− mice than in the corresponding BL/6 mice (Fig. 6,D). Lastly, in contrast to the GC, IL-6 was higher in both SEA/CFA-immunized mouse groups (Fig. 6,E) while TGF-β was not significantly different (Fig. 6,F) and IL-21 was higher in the IL-23p19−/− mice (Fig. 6,G). Importantly, IL-17 (Fig. 6,H) and IFN-γ (Fig. 6,I) production by purified CD4 T cells in the presence of normal splenic APC was similar to that from bulk MLNC (Fig. 6, A and B), confirming that this is largely a function of the T cells.

FIGURE 6.

Cytokine production by SEA-stimulated MLN and CD4 T cells from infected BL/6 and IL-23p19−/− mice. A–G, Cytokine levels in 48 h supernatants from SEA-stimulated bulk MLNC or, H and I, purified CD4 T cells plus APC (as described in Materials and Methods) measured by ELISA. IL-17 (A) and IFN-γ (B) are significantly lower in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (both p < 0.001). IL-5 (C) and IL-10 (D) are reduced in both SEA/CFA-immunized mice but are significantly higher in the SEA/CFA-immunized IL-23p19−/− mice (p < 0.05 and p < 0.001, respectively). IL-6 (E) is increased in the SEA/CFA-immunized mice but is not significantly different in the IL-23p19−/− vs BL/6 groups. TGF-β (F) is not significantly different in all groups. IL-21 (G) is increased in the SEA/CFA-immunized mice and is significantly higher in the IL-23p19−/− vs BL/6 groups (p < 0.01). IL-17 (H) and IFN-γ (I) secreted by CD4 T cells are significantly lower in the SEA/CFA-immunized IL-23p19−/− mice (both p < 0.001). Cytokine levels are expressed as means of triplicate determinations ± SD; background cytokine levels from unstimulated MLNC were subtracted (except for TGF-β). Results shown are from one experiment representative of five.

FIGURE 6.

Cytokine production by SEA-stimulated MLN and CD4 T cells from infected BL/6 and IL-23p19−/− mice. A–G, Cytokine levels in 48 h supernatants from SEA-stimulated bulk MLNC or, H and I, purified CD4 T cells plus APC (as described in Materials and Methods) measured by ELISA. IL-17 (A) and IFN-γ (B) are significantly lower in SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (both p < 0.001). IL-5 (C) and IL-10 (D) are reduced in both SEA/CFA-immunized mice but are significantly higher in the SEA/CFA-immunized IL-23p19−/− mice (p < 0.05 and p < 0.001, respectively). IL-6 (E) is increased in the SEA/CFA-immunized mice but is not significantly different in the IL-23p19−/− vs BL/6 groups. TGF-β (F) is not significantly different in all groups. IL-21 (G) is increased in the SEA/CFA-immunized mice and is significantly higher in the IL-23p19−/− vs BL/6 groups (p < 0.01). IL-17 (H) and IFN-γ (I) secreted by CD4 T cells are significantly lower in the SEA/CFA-immunized IL-23p19−/− mice (both p < 0.001). Cytokine levels are expressed as means of triplicate determinations ± SD; background cytokine levels from unstimulated MLNC were subtracted (except for TGF-β). Results shown are from one experiment representative of five.

Close modal

The exceedingly low to absent IFN-γ production by GC and MLNC from schistosome-infected SEA/CFA-immunized IL-23p19−/− mice was most intriguing in view of the detected messages for IL-12p40, IL-12p35 and IFN-γ in these cells (Figs. 2–4), and suggested a posttranslational regulation. An obvious candidate for this activity was IL-10, which is known to inhibit proinflammatory responses and immunopathology in schistosomiasis (30, 31). Importantly, IL-10 was significantly higher in infected, SEA/CFA-immunized IL-23p19−/− mice than in the corresponding BL/6 mice (Figs. 5,D and 6,D). To further explore the impact of IL-10 on the production of IFN-γ and IL-17, neutralizing anti-IL-10 mAb were included in cultures from SEA-stimulated MLNC from infected, SEA/CFA-immunized, and unimmunized IL-23p19−/− and BL/6 mice. As shown in Fig. 7,A, the treatment with anti-IL-10 mAb reconstituted strong IFN-γ production, which was significantly higher in SEA/CFA-immunized than unimmunized mice, but no different in IL-23p19−/− vs BL/6 mice. In contrast, blocking IL-10 had a very weak if any effect on the vigorous IL-17 production by MLNC from SEA/CFA-immunized mice, which was consistently lower in the IL-23p19−/− group; only a minor increase in IL-17 was observed in cells from unimmunized BL/6 mice (Fig. 7,B). Lastly, as expected, IL-10 production was neutralized in the presence of the corresponding mAb (Fig. 7 C). These findings indicate that IL-10 effectively suppresses potential IFN-γ production by T cells, but does not significantly affect IL-17.

FIGURE 7.

IFN-γ and IL-17 production by MLNC in the presence of anti-IL-10 mAb. MLNC were cultured for 48 h in the presence or absence of anti-IL-10 mAb as described in Materials and Methods. A, IFN-γ levels produced by the MLNC are significantly increased in the presence of neutralizing anti-IL-10 mAb in all four groups (all p < 0.001) whereas IL-17 levels (B) are not significantly modified by the addition of anti-IL-10 mAb. C, IL-10 is not detected in cultures receiving anti-IL-10 mAb. Cytokine levels are expressed as means of triplicate determinations ± SD; background cytokine levels from unstimulated MLNC were subtracted. Results shown are from one experiment representative of two.

FIGURE 7.

IFN-γ and IL-17 production by MLNC in the presence of anti-IL-10 mAb. MLNC were cultured for 48 h in the presence or absence of anti-IL-10 mAb as described in Materials and Methods. A, IFN-γ levels produced by the MLNC are significantly increased in the presence of neutralizing anti-IL-10 mAb in all four groups (all p < 0.001) whereas IL-17 levels (B) are not significantly modified by the addition of anti-IL-10 mAb. C, IL-10 is not detected in cultures receiving anti-IL-10 mAb. Cytokine levels are expressed as means of triplicate determinations ± SD; background cytokine levels from unstimulated MLNC were subtracted. Results shown are from one experiment representative of two.

Close modal

A most likely mechanism by which the lack of IL-23 translates to reduced granulomatous inflammation is the overall down-regulation of Th17 cells capable of recruiting leukocytes to the lesions (32, 33, 34). Flow cytometric analysis demonstrated that SEA/CFA immunization in IL-23p19−/− mice fails to stimulate the recruitment of Gr-1+ cells to the granulomas to the same extent as is the case in BL/6 mice (Fig. 8,A). Given the relative expression of the CCL11 (eotaxin) receptor CCR3 on the Gr-1+ cells, this shortfall is mostly at the expense of Gr-1+CCR3 neutrophils rather than Gr-1+CCR3+ eosinophils (Fig. 8,B) (35, 36, 37). In support of this interpretation is the marked decrease in the neutrophil attracting and activating chemokines CXCL1 (Gro-α, KC) (Fig. 8,C) and CXCL2 (Gro-β, MIP-2) (Fig. 8,D) (33, 38) in the SEA/CFA-immunized IL-23p19−/− mice, which contrasted with an increased expression of the eosinophil chemoattractant CCL11 (eotaxin) (Fig. 8 E) (39).

FIGURE 8.

Characterization of GC from infected BL/6 and IL-23p19−/− mice. A and B, Liver GC were isolated and stained ex vivo with anti-Gr-1 and -CCR3 mAb as described in Materials and Methods. A, Gr-1+ cells are markedly reduced in the granulomas from SEA/CFA-immunized IL-23p19−/− vs BL/6 mice. B, There is a greater decrease in Gr-1+CCR3 cells than Gr-1+ CCR3+ cells in granulomas from the SEA/CFA-immunized IL-23p19−/− mice. C–E, Chemokine mRNA transcripts from livers were measured by real-time RT-PCR as described in Materials and Methods. (C) CXCL1 (Gro-α, KC) and (D) CXCL2 (Gro-β, MIP-2) are lower whereas (E) CCL11 (eotaxin) is higher in the SEA/CFA-immunized IL-23p19−/− compared with SEA/CFA-immunized BL/6 mice. PCR data for all three transcripts were normalized to ubiquitin. Results shown are from one experiment representative of three with similar results, using pooled GC or pooled liver mRNA from three to eight mice per group.

FIGURE 8.

Characterization of GC from infected BL/6 and IL-23p19−/− mice. A and B, Liver GC were isolated and stained ex vivo with anti-Gr-1 and -CCR3 mAb as described in Materials and Methods. A, Gr-1+ cells are markedly reduced in the granulomas from SEA/CFA-immunized IL-23p19−/− vs BL/6 mice. B, There is a greater decrease in Gr-1+CCR3 cells than Gr-1+ CCR3+ cells in granulomas from the SEA/CFA-immunized IL-23p19−/− mice. C–E, Chemokine mRNA transcripts from livers were measured by real-time RT-PCR as described in Materials and Methods. (C) CXCL1 (Gro-α, KC) and (D) CXCL2 (Gro-β, MIP-2) are lower whereas (E) CCL11 (eotaxin) is higher in the SEA/CFA-immunized IL-23p19−/− compared with SEA/CFA-immunized BL/6 mice. PCR data for all three transcripts were normalized to ubiquitin. Results shown are from one experiment representative of three with similar results, using pooled GC or pooled liver mRNA from three to eight mice per group.

Close modal

The severity of inflammation in a given lesional environment typically is reflected in, if not dictated by, the state of activation of its macrophage population. “Classically” activated macrophages are typically induced after phagocytosis of microorganisms or exposure to IFN-γ, whereas “alternatively” activated macrophages arise in context with a Th2-dominated immune response under the influence of the cytokines IL-4, IL-13, and IL-10 (40, 41, 42, 43). Importantly, in schistosomiasis, alternatively activated macrophages were shown to be critical in protecting the host from severe pathology and death (44). We examined whether the observed differences in immunopathology and cytokine configuration between IL-23p19−/− and BL/6 mice preferentially associate with a particular state of macrophage activation. Indeed, SEA/CFA-immunized IL-23p19−/− mice displayed a phenotype consistent with alternative macrophage activation, as measured by the increased expression of the markers YM1 and arginase (45, 46, 47), whereas classical activation, measured by higher expression of inducible NO synthase (INOS) (47), was dominant in the BL/6 mice (Fig. 9). In other words, in IL-23p19−/− mice, SEA/CFA-immunization solidified alternative macrophage activation similar to that seen in the unimmunized groups, whereas in BL/6 mice it induced classically activated macrophages, which correlates well with the magnitude of immunopathology and the prevailing cytokine milieu.

FIGURE 9.

Macrophage activation in infected BL/6 and IL-23p19−/− mice. mRNA transcripts for YM1, arginase, and INOS were measured by real-time RT-PCR as described in Materials and Methods. (A) YM1 and (B) arginase are significantly higher, whereas (C) INOS is significantly lower in the SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (all p < 0.01). mRNA for YM1 and INOS are from livers and arginase from MLN, given the high endogenous expression of arginase in hepatocytes. PCR data for all three transcripts were normalized to ubiquitin. Each bar represents the mean mRNA level ± SD of 5–12 mice per group from two independent experiments.

FIGURE 9.

Macrophage activation in infected BL/6 and IL-23p19−/− mice. mRNA transcripts for YM1, arginase, and INOS were measured by real-time RT-PCR as described in Materials and Methods. (A) YM1 and (B) arginase are significantly higher, whereas (C) INOS is significantly lower in the SEA/CFA-immunized IL-23p19−/− vs BL/6 mice (all p < 0.01). mRNA for YM1 and INOS are from livers and arginase from MLN, given the high endogenous expression of arginase in hepatocytes. PCR data for all three transcripts were normalized to ubiquitin. Each bar represents the mean mRNA level ± SD of 5–12 mice per group from two independent experiments.

Close modal

Lastly, although there were no significant differences in the percentage of CD4 T cells in the granulomas of SEA/CFA-immunized IL-23p19−/− mice, the T cells were less activated than in their BL/6 counterparts as judged by a drop in the expression of CD69 (data not shown). Overall, the above parameters are indicative of a diminished cellular inflammatory response in the IL-23p19−/− mice, which is consistent with the reduced size of the granulomatous lesions.

Our previous work has pointed out the critical role of IL-12p40 in the development of severe schistosomiasis associated with the secretion of IL-17 by SEA-stimulated CD4 T cells (10). Although IL-12 per se was ruled out for this activity, this observation did not strictly implicate IL-23 instead. To address this issue, the present study was conducted with schistosome-infected IL-23p19−/− mice specifically unable to make IL-23. Because they are on the naturally low pathology background H-2b, some IL-23p19−/− mice were concomitantly immunized with SEA/CFA as a means to enhance their hepatic lesions and levels of IL-17 (10).

A most significant observation in our study was that in IL-23p19−/− mice, SEA/CFA immunization elicited a small but significant increase in pathology with respect to the unimmunized controls, which contrasted with IL-12p40−/− mice, that completely fail to respond to this treatment (10). Furthermore, in comparison with their BL/6 counterparts, the SEA/CFA-immunized IL-23p19−/− mice displayed a diminished IL-17 response, a profoundly inhibited IFN-γ response, and a rise in IL-4, IL-5, IL-13, IL-21, but mainly in IL-10. Taken together, our findings, in agreement with others (19, 48), demonstrate that the absence of IL-23 does not result in an absolute loss of IL-17, thus implying an IL-23-independent pathway for its production; they also show that IL-23 is critical to attain full development of high pathology in response to immunization with SEA/CFA.

In the infected SEA/CFA-immunized IL-23p19−/− mice, there was ample IL-17 expression and production in the MLN, which contrasted with a profound suppression of IL-17 in the lesional environment, despite the presence of IL-6, TGF-β, and IL-21. These findings confirm and emphasize the critical role of IL-23 in sustaining Th17 cells in diseased peripheral organs and tissues, as previously demonstrated in the nervous system, intestine and joints (15, 16, 17, 18, 19, 49). Remarkably, there was no obvious regional correlation between the levels of IL-17 with those of IL-6, TGF-β, or IL-21; however, this observation is not inconsistent with the currently held view that ultimate control over the generation and maintenance of Th17 cells is exerted by the combined effect of IL-6, TGF-β, and IL-21, in concert with IL-23 (22, 24, 25, 26, 29). Direct support for this contention comes from our observation that in IL-6−/− mice there is no exacerbation of egg-induced immunopathology or production of IL-17 in response to immunization with SEA/CFA (L. I. Rutitzky and M. J. Stadecker, unpublished results).

An unexpected observation in our study was the posttranslational down-regulation of IFN-γ produced by SEA-stimulated GC and MLNC from the schistosome-infected, SEA/CFA-immunized IL-23p19−/− mice, given the fact that these mice can make IL-12 and produce normal levels of mRNA for IFN-γ. Our findings also demonstrated sharply higher levels of IL-10 in the IL-23p19−/− mice, which, when neutralized, resulted in a full restoration of IFN-γ production. Although cross-regulation between IL-10 and IFN-γ has been well-documented (50), a direct control by IL-23 over IL-10, and thus indirect regulation of IFN-γ, is novel and as yet not described. The loss of IFN-γ has been reported to cause an increase of IL-17 in other systems (14, 51); however, this differs from our results with schistosome-infected, SEA/CFA-immunized IL-23p19−/− mice, in which the overall IL-17 levels were low. Aside from markedly inhibiting IFN-γ, IL-10 only had a marginal direct effect on IL-17 production.

Analogous to IL-10, the SEA/CFA immunization caused a marked decrease in IL-4, IL-5, and IL-13; however, this decrease was significantly more pronounced in BL/6 mice than in IL-23p19−/− mice, in which levels of these cytokines remained close or were equal to those seen in the unimmunized counterparts. IL-21 production was also higher in the IL-23p19−/− mice, but increased after SEA/CFA immunization, thus reflecting its dual role as a Th2 cytokine and a stimulator of Th17 cells (25, 26, 52). Taken together, these findings are indicative of a severely impaired IL-17-mediated inflammatory response in the IL-23p19−/− mice, in which there remained a Th2-dominated state akin to that seen in the absence of immunization.

Th17 cells have now been shown to play an important pathogenic role in an increasing number of inflammatory and infectious conditions including schistosomiasis (10, 13, 18, 53, 54). Th17 cells mediate pathology by secreting IL-17 and thereby stimulating the production of additional proinflammatory and chemotactic molecules such as IL-1, TNF-α, IL-6, CXCL1 (Gro-α, KC), CXCL2 (Gro-β, MIP-2), and CCL2 (MCP-1)—and in the human, CXCL8 (IL-8)—by local lymphoid, vascular, and mesenchymal cells (33, 34, 38, 55). Enhanced neutrophil recruitment and activation is an important element in Th17 cell-mediated inflammation (56, 57, 58). A closer analysis of the reduced, IL-17-depleted egg granulomas in the SEA/CFA-immunized IL-23p19−/− mice indeed disclosed a greater reduction in Gr-1+CCR3 neutrophils than CCR3+ eosinophils (36), which correlates well with the selective loss of the neutrophil chemoattractants CXCL1 and CXCL2 (59). Neutrophils thus contribute more significantly to pathology exacerbation in response to SEA/CFA immunization than eosinophils, which are normal constituents of the schistosome egg granulomas.

Another significant finding in the SEA/CFA-immunized IL-23p19−/− mice was in their macrophage population, which, by virtue of expressing high YM1 and arginase, and low INOS, displayed a phenotype characteristic of alternative activation. This contrasted sharply with macrophages from BL/6 mice, which expressed low YM1 and arginase, and high INOS, typical of classical activation. The alternative macrophage activation in the IL-23p19−/− mice correlates well with, and is a likely consequence of, the prevalent Th2-polarized environment that explains the reduced immunopathology and enhanced survival of the infected mice (44).

In sum, IL-23 emerges as a critical factor that contributes to pathology exacerbation in schistosomiasis both by boosting predominantly lesional Th17 cell development and by restraining regulatory networks involving IL-10, which results in proinflammatory cytokine and chemokine release, neutrophil recruitment and activation, and phagocyte-associated NO release. The production of IL-23 by innate immunocytes such as dendritic cells and macrophages may be in direct response to specific schistosome egg-associated molecules recognized by pattern recognition receptors such as the TLRs or C-type lectins (60, 61, 62), although positive feedback loops involving additional cells may amplify the initial pathogen stimulus. The absence of IL-23 therefore results in a significantly decreased immunopathology owed to the reduction of Th17 cells amid an anti-inflammatory cytokine environment marked by high levels of IL-10. How much of this IL-10 is associated with T regulatory cell function (63, 64) remains to be elucidated. In any case, severe schistosomiasis represents an ideal condition in which disruption of the IL-23/IL-17 axis could be further explored as a means to control excessive harmful inflammation.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by Public Health Service Grant RO1-18919.

3

Abbreviations used in this paper: SEA, schistosome egg Ag; MLN, mesenteric lymph node; Ct, cycle threshold; GC, granuloma cell; MLNC, MLN cell; INOS, inducible NO synthase.

1
Pearce, E. J., A. S. MacDonald.
2002
. The immunobiology of schistosomiasis.
Nat. Rev. Immunol.
2
:
499
-511.
2
Gause, W. C., J. F. Urban, M. J. Stadecker.
2003
. The immune response to parasitic helminths: insights from murine models.
Trends Immunol.
24
:
269
-277.
3
Marquet, S., L. Abel, D. Hillaire, H. Dessein, J. Kalil, J. Feingold, J. Weissenbach, A. J. Dessein.
1996
. Genetic localization of a locus controlling the intensity of infection by Schistosoma mansoni on chromosome 5q31–q33.
Nat. Genet.
14
:
181
-184.
4
Bica, I., D. H. Hamer, M. J. Stadecker.
2000
. Hepatic schistosomiasis.
Infect. Dis. Clin. North. Am.
14
:
583
-604, viii.
5
Cheever, A., R. Duvall, T. Hallack, Jr, R. Minker, J. Malley, K. Malley.
1987
. Variation of hepatic fibrosis and granuloma size among mouse strains infected with Schistosoma mansoni.
Am. J. Trop. Med. Hyg.
37
:
85
-97.
6
Rutitzky, L. I., H. J. Hernandez, Y. S. Yim, D. E. Ricklan, E. Finger, C. Mohan, I. Peter, E. K. Wakeland, M. J. Stadecker.
2005
. Enhanced egg-induced immunopathology correlates with high IFN-γ in murine schistosomiasis: identification of two epistatic genetic intervals.
J. Immunol.
174
:
435
-440.
7
Hernandez, H. J., C. M. Edson, D. A. Harn, C. J. Ianelli, M. J. Stadecker.
1998
. Schistosoma mansoni: genetic restriction and cytokine profile of the CD4+ T helper cell response to dominant epitope peptide of major egg antigen Sm-p40.
Exp. Parasitol.
90
:
122
-130.
8
Rutitzky, L. I., H. J. Hernandez, M. J. Stadecker.
2001
. Th1-polarizing immunization with egg antigens correlates with severe exacerbation of immunopathology and death in schistosome infection.
Proc. Natl. Acad. Sci. USA
98
:
13243
-13248.
9
Stadecker, M. J., H. Asahi, E. Finger, H. J. Hernandez, L. I. Rutitzky, J. Sun.
2004
. The immunobiology of Th1 polarization in high-pathology schistosomiasis.
Immunol. Rev.
201
:
168
-179.
10
Rutitzky, L. I., J. R. Lopes da Rosa, M. J. Stadecker.
2005
. Severe CD4 T cell-mediated immunopathology in murine schistosomiasis is dependent on IL-12p40 and correlates with high levels of IL-17.
J. Immunol.
175
:
3920
-3926.
11
Szabo, S. J., B. M. Sullivan, S. L. Peng, L. H. Glimcher.
2003
. Molecular mechanisms regulating Th1 immune responses.
Annu. Rev. Immunol.
21
:
713
-758.
12
Trinchieri, G., S. Pflanz, R. A. Kastelein.
2003
. The IL-12 family of heterodimeric cytokines: new players in the regulation of T cell responses.
Immunity
19
:
641
-644.
13
Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, D. J. Cua.
2005
. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation.
J. Exp. Med.
201
:
233
-240.
14
Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L. Hood, Z. Zhu, Q. Tian, C. Dong.
2005
. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17.
Nat. Immunol.
6
:
1133
-1141.
15
Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian, W. To, S. Kwan, T. Churakova, et al
2003
. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain.
Nature
421
:
744
-748.
16
Chen, Y., C. L. Langrish, B. McKenzie, B. Joyce-Shaikh, J. S. Stumhofer, T. McClanahan, W. Blumenschein, T. Churakovsa, J. Low, L. Presta, et al
2006
. Anti-IL-23 therapy inhibits multiple inflammatory pathways and ameliorates autoimmune encephalomyelitis.
J. Clin. Invest.
116
:
1317
-1326.
17
Murphy, C. A., C. L. Langrish, Y. Chen, W. Blumenschein, T. McClanahan, R. A. Kastelein, J. D. Sedgwick, D. J. Cua.
2003
. Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation.
J. Exp. Med.
198
:
1951
-1957.
18
Nakae, S., A. Nambu, K. Sudo, Y. Iwakura.
2003
. Suppression of immune induction of collagen-induced arthritis in IL-17-deficient mice.
J. Immunol.
171
:
6173
-6177.
19
Yen, D., J. Cheung, H. Scheerens, F. Poulet, T. McClanahan, B. McKenzie, M. A. Kleinschek, A. Owyang, J. Mattson, W. Blumenschein, et al
2006
. IL-23 is essential for T cell-mediated colitis and promotes inflammation via IL-17 and IL-6.
J. Clin. Invest.
116
:
1310
-1316.
20
Kurasawa, K., K. Hirose, H. Sano, H. Endo, H. Shinkai, Y. Nawata, K. Takabayashi, I. Iwamoto.
2000
. Increased interleukin-17 production in patients with systemic sclerosis.
Arthritis Rheum.
43
:
2455
-2463.
21
Afzali, B., G. Lombardi, R. I. Lechler, G. M. Lord.
2007
. The role of T helper 17 (Th17) and regulatory T cells (Treg) in human organ transplantation and autoimmune disease.
Clin. Exp. Immunol.
148
:
32
-46.
22
Veldhoen, M., R. J. Hocking, C. J. Atkins, R. M. Locksley, B. Stockinger.
2006
. TGFβ in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells.
Immunity
24
:
179
-189.
23
Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, V. K. Kuchroo.
2006
. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells.
Nature
441
:
235
-238.
24
Mangan, P. R., L. E. Harrington, D. B. O’Quinn, W. S. Helms, D. C. Bullard, C. O. Elson, R. D. Hatton, S. M. Wahl, T. R. Schoeb, C. T. Weaver.
2006
. Transforming growth factor-β induces development of the Th17 lineage.
Nature
441
:
231
-234.
25
Nurieva, R., X. O. Yang, G. Martinez, Y. Zhang, A. D. Panopoulos, L. Ma, K. Schluns, Q. Tian, S. S. Watowich, A. M. Jetten, C. Dong.
2007
. Essential autocrine regulation by IL-21 in the generation of inflammatory T cells.
Nature
448
:
480
-483.
26
Korn, T., E. Bettelli, W. Gao, A. Awasthi, A. Jager, T. B. Strom, M. Oukka, V. K. Kuchroo.
2007
. IL-21 initiates an alternative pathway to induce proinflammatory Th17 cells.
Nature
448
:
484
-487.
27
Boros, D., K. Warren.
1970
. Delayed hypersensitivity-type granuloma formation and dermal reaction induced and elicited by a soluble factor isolated from Schistosoma mansoni soluble eggs.
J. Exp. Med.
132
:
488
-507.
28
Rutitzky, L. I., G. A. Mirkin, M. J. Stadecker.
2003
. Apoptosis by neglect of CD4+ Th cells in granulomas: a novel effector mechanism involved in the control of egg-induced immunopathology in murine schistosomiasis.
J. Immunol.
171
:
1859
-1867.
29
Bettelli, E., M. Oukka, V. K. Kuchroo.
2007
. Th-17 cells in the circle of immunity and autoimmunity.
Nat. Immunol.
8
:
345
-350.
30
Flores-Villanueva, P. O., X. X. Zheng, T. B. Strom, M. J. Stadecker.
1996
. Recombinant IL-10 and IL-10/Fc treatment down-regulate egg antigen-specific delayed hypersensitivity reactions and egg granuloma formation in schistosomiasis.
J. Immunol.
156
:
3315
-3320.
31
Sadler, C. H., L. I. Rutitzky, M. J. Stadecker, R. A. Wilson.
2003
. IL-10 is crucial for the transition from acute to chronic disease state during infection of mice with Schistosoma mansoni.
Eur. J. Immunol.
33
:
880
-888.
32
Fossiez, F., O. Djossou, P. Chomarat, L. Flores-Romo, S. Ait-Yahia, C. Maat, J. J. Pin, P. Garrone, E. Garcia, S. Saeland, et al
1996
. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines.
J. Exp. Med.
183
:
2593
-2603.
33
Ye, P., F. H. Rodriguez, S. Kanaly, K. L. Stocking, J. Schurr, P. Schwarzenberger, P. Oliver, W. Huang, P. Zhang, J. Zhang, et al
2001
. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense.
J. Exp. Med.
194
:
519
-527.
34
Kolls, J. K., A. Linden.
2004
. Interleukin-17 family members and inflammation.
Immunity
21
:
467
-476.
35
Hestdal, K., F. W. Ruscetti, J. N. Ihle, S. E. Jacobsen, C. M. Dubois, W. C. Kopp, D. L. Longo, J. R. Keller.
1991
. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells.
J. Immunol.
147
:
22
-28.
36
Nagase, H., M. Miyamasu, M. Yamaguchi, T. Fujisawa, H. Kawasaki, K. Ohta, K. Yamamoto, Y. Morita, K. Hirai.
2001
. Regulation of chemokine receptor expression in eosinophils.
Int. Arch. Allergy Immunol.
125
: (Suppl. 1):
29
-32.
37
Gurish, M. F., A. Humbles, H. Tao, S. Finkelstein, J. A. Boyce, C. Gerard, D. S. Friend, K. F. Austen.
2002
. CCR3 is required for tissue eosinophilia and larval cytotoxicity after infection with Trichinella spiralis.
J. Immunol.
168
:
5730
-5736.
38
Witowski, J., K. Ksiazek, A. Jorres.
2004
. Interleukin-17: a mediator of inflammatory responses.
Cell. Mol. Life Sci.
61
:
567
-579.
39
Dixon, H., C. Blanchard, M. L. Deschoolmeester, N. C. Yuill, J. W. Christie, M. E. Rothenberg, K. J. Else.
2006
. The role of Th2 cytokines, chemokines and parasite products in eosinophil recruitment to the gastrointestinal mucosa during helminth infection.
Eur. J. Immunol.
36
:
1753
-1763.
40
Goerdt, S., C. E. Orfanos.
1999
. Other functions, other genes: alternative activation of antigen-presenting cells.
Immunity
10
:
137
-142.
41
Maizels, R. M., A. Balic, N. Gomez-Escobar, M. Nair, M. D. Taylor, J. E. Allen.
2004
. Helminth parasites–masters of regulation.
Immunol. Rev.
201
:
89
-116.
42
Park-Min, K. H., T. T. Antoniv, L. B. Ivashkiv.
2005
. Regulation of macrophage phenotype by long-term exposure to IL-10.
Immunobiology
210
:
77
-86.
43
Kreider, T., R. M. Anthony, J. F. Urban, Jr, W. C. Gause.
2007
. Alternatively activated macrophages in helminth infections.
Curr. Opin. Immunol.
19
:
448
-453.
44
Herbert, D. R., C. Holscher, M. Mohrs, B. Arendse, A. Schwegmann, M. Radwanska, M. Leeto, R. Kirsch, P. Hall, H. Mossmann, et al
2004
. Alternative macrophage activation is essential for survival during schistosomiasis and downmodulates T helper 1 responses and immunopathology.
Immunity
20
:
623
-635.
45
Munder, M., K. Eichmann, M. Modolell.
1998
. Alternative metabolic states in murine macrophages reflected by the nitric oxide synthase/arginase balance: competitive regulation by CD4+ T cells correlates with Th1/Th2 phenotype.
J. Immunol.
160
:
5347
-5354.
46
Loke, P., M. G. Nair, J. Parkinson, D. Guiliano, M. Blaxter, J. E. Allen.
2002
. IL-4 dependent alternatively-activated macrophages have a distinctive in vivo gene expression phenotype.
BMC Immunol.
3
:
7
47
Gordon, S..
2003
. Alternative activation of macrophages.
Nat. Rev. Immunol.
3
:
23
-35.
48
Aggarwal, S., N. Ghilardi, M. H. Xie, F. J. de Sauvage, A. L. Gurney.
2003
. Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17.
J. Biol. Chem.
278
:
1910
-1914.
49
Hue, S., P. Ahern, S. Buonocore, M. C. Kullberg, D. J. Cua, B. S. McKenzie, F. Powrie, K. J. Maloy.
2006
. Interleukin-23 drives innate and T cell-mediated intestinal inflammation.
J. Exp. Med.
203
:
2473
-2483.
50
Fiorentino, D. F., A. Zlotnik, P. Vieira, T. R. Mosmann, M. Howard, K. W. Moore, A. O’Garra.
1991
. IL-10 acts on the antigen-presenting cell to inhibit cytokine production by Th1 cells.
J. Immunol.
146
:
3444
-3451.
51
Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, C. T. Weaver.
2005
. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages.
Nat. Immunol.
6
:
1123
-1132.
52
Wurster, A. L., V. L. Rodgers, A. R. Satoskar, M. J. Whitters, D. A. Young, M. Collins, M. J. Grusby.
2002
. Interleukin 21 is a T helper (Th) cell 2 cytokine that specifically inhibits the differentiation of naive Th cells into interferon γ-producing Th1 cells.
J. Exp. Med.
196
:
969
-977.
53
Kullberg, M. C., D. Jankovic, C. G. Feng, S. Hue, P. L. Gorelick, B. S. McKenzie, D. J. Cua, F. Powrie, A. W. Cheever, K. J. Maloy, A. Sher.
2006
. IL-23 plays a key role in Helicobacter hepaticus-induced T cell-dependent colitis.
J. Exp. Med.
203
:
2485
-2494.
54
Elson, C. O., Y. Cong, C. T. Weaver, T. R. Schoeb, T. K. McClanahan, R. B. Fick, R. A. Kastelein.
2007
. Monoclonal anti-interleukin 23 reverses active colitis in a T cell-mediated model in mice.
Gastroenterology
132
:
2359
-2370.
55
Fossiez, F., J. Banchereau, R. Murray, C. Van Kooten, P. Garrone, S. Lebecque.
1998
. Interleukin-17.
Int. Rev. Immunol.
16
:
541
-551.
56
Laan, M., Z. H. Cui, H. Hoshino, J. Lotvall, M. Sjostrand, D. C. Gruenert, B. E. Skoogh, A. Linden.
1999
. Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways.
J. Immunol.
162
:
2347
-2352.
57
Witowski, J., K. Pawlaczyk, A. Breborowicz, A. Scheuren, M. Kuzlan-Pawlaczyk, J. Wisniewska, A. Polubinska, H. Friess, G. M. Gahl, U. Frei, A. Jorres.
2000
. IL-17 stimulates intraperitoneal neutrophil infiltration through the release of GRO α chemokine from mesothelial cells.
J. Immunol.
165
:
5814
-5821.
58
Wu, Q., R. J. Martin, J. G. Rino, R. Breed, R. M. Torres, H. W. Chu.
2007
. IL-23-dependent IL-17 production is essential in neutrophil recruitment and activity in mouse lung defense against respiratory Mycoplasma pneumoniae infection.
Microbes Infect.
9
:
78
-86.
59
Rossi, D., A. Zlotnik.
2000
. The biology of chemokines and their receptors.
Annu. Rev. Immunol.
18
:
217
-242.
60
Thomas, P. G., M. R. Carter, O. Atochina, A. A. Da’Dara, D. Piskorska, E. McGuire, D. A. Harn.
2003
. Maturation of dendritic cell 2 phenotype by a helminth glycan uses a Toll-like receptor 4-dependent mechanism.
J. Immunol.
171
:
5837
-5841.
61
Hokke, C. H., M. Yazdanbakhsh.
2005
. Schistosome glycans and innate immunity.
Parasite Immunol.
27
:
257
-264.
62
van Liempt, E., S. J. van Vliet, A. Engering, J. J. Garcia Vallejo, C. M. Bank, M. Sanchez-Hernandez, Y. van Kooyk, I. van Die.
2007
. Schistosoma mansoni soluble egg antigens are internalized by human dendritic cells through multiple C-type lectins and suppress TLR-induced dendritic cell activation.
Mol. Immunol.
44
:
2605
-2615.
63
Taylor, J. J., M. Mohrs, E. J. Pearce.
2006
. Regulatory T cell responses develop in parallel to Th responses and control the magnitude and phenotype of the Th effector population.
J. Immunol.
176
:
5839
-5847.
64
Hesse, M., C. A. Piccirillo, Y. Belkaid, J. Prufer, M. Mentink-Kane, M. Leusink, A. W. Cheever, E. M. Shevach, T. A. Wynn.
2004
. The pathogenesis of schistosomiasis is controlled by cooperating IL-10-producing innate effector and regulatory T cells.
J. Immunol.
172
:
3157
-3166.