The differentiation of CD4+ T cells is regulated by cytokines locally within the compartments of secondary lymphoid organs during adaptive immune responses. Quantitative data about the expression of cytokine mRNAs within the T and B cell zones of lymphoid organs are lacking. In this study, we assessed the expression of multiple cytokine genes within the lymphoid compartments of the spleen of rats after two types of stimulation. First, the spleen was stimulated directly by a blood-derived Ag. Second, the spleen was stimulated indirectly by incoming lymphocytes that had been activated and released during a proceeding immune response at a distant tissue site. Using laser microdissection, we show that the expression of cytokine mRNAs was compartment specific, transient, and preceded cell proliferation after the direct antigenic stimulation. Surprisingly, the indirect stimulation by incoming activated lymphocytes induced similar cytokines in the T cell zone. However, the nonoverlapping expression was lost and IL10 appeared as the major cytokine in all compartments. Thus, tracking two types of immune activation without disturbing the integrity of structures reveals distinct and overlapping events in the compartments of the spleen. This information adds a new dimension to the understanding of immune responses in vivo.

The successful initiation of adaptive immune responses depends on cell-cell interactions and the presence of a supportive microenvironment. The organized structure of secondary lymphoid tissues in T and B cell zones is designed to regulate the activation of T and B cells. Accordingly, it has been shown that disturbances of the integrity of the T and B cell zones impair adaptive immune responses (1, 2). In particular, distinct CD4+ T cell subsets regulate the course of immune responses by secretion of cytokines. Besides the Th1–Th2 paradigm, new subsets of CD4+ T cells such as Th17, Th1 cells producing both IFNγ and IL10, and regulatory T cells have been identified (3, 4, 5). It has been shown that the presence of signature cytokines during T cell activation directs the resulting response (6). The analysis of cytokines in vivo is extremely difficult, because cytokines are rapidly secreted and dispersed. Commonly used methods yielded important information but cell isolation and restimulation in vitro was required (6, 7, 8). With these approaches, the original microenvironmental conditions are lost and this might lead to an altered gene expression profile. In vivo studies using genetically manipulated mice, especially bicistronic reporter mice, are very helpful for the analysis of cytokine expression at the single-cell level (9, 10, 11). However, they also have their limitations, because only one cytokine at a time can be visualized, the sensitivity might be too low and the isolation of cells is necessary for the analysis.

In this study, we used the combination of laser microdissection and real-time RT-PCR to determine the expression of multiple cytokine genes within their original environment, quantitatively and with high sensitivity. Both techniques combined with immunohistochemistry allow the analysis of cells and tissues without disturbing the organized structure of lymphoid organs (12). To obtain information about how immune activations take place in vivo, we examined the lymphoid compartments of the spleen in the steady-state and after two types of stimulation. First, a primary immune response was induced directly by i.v. injection of SRBC. SRBC are an excellent Ag, because they get trapped immediately in the marginal zone (MZ).3 As nonreplicating Ag, it is cleared readily from the organism and induces a Th1 response even without the addition of adjuvants (13, 14, 15). All these features help to avoid overlapping effects. Second, the spleen was stimulated indirectly by activated lymphocytes to mimic a proceeding infection at a distant tissue site. Thus, we activated lymphocytes polyclonally in vitro before i.v. injection.

We found a basic level of cytokine transcription even under steady-state conditions. For most of the cytokines, this basal transcriptional level was linked to a specific T or B cell zone. After a direct exposure to SRBC the changes in cytokine mRNA expression were rapid, transient, compartment specific, and preceded cell proliferation. In case the spleen was indirectly activated, identical sets of cytokines were expressed, but the organized and structured progression was lost. In conclusion, by analyzing the changes in cytokine gene expression at the compartmental level we are able to monitor each step during immune activation in vivo. This new information helps in understanding how immune responses take place, influence each other, and provide the basis to control them efficiently.

Healthy male Lewis rats (Charles River Laboratories) between the ages of 12 and 24 wk were used. Permission to perform these animal experiments was issued by the Ministry of Nature and Environment. SRBC (Labor Dr. Merk) were extensively washed and 2 ml containing 1010 SRBC were injected into the tail vein. The spleens were removed at 1, 4, 9, 24, 72, 144, 192, and 240 h after injection of SRBC, snap-frozen, and stored at −80°C. Cryosections, 10 μm in thickness, were mounted on membrane-covered slides (Palm Membrane Slides, PEN membrane, 1 mm; PALM Microlaser Technologies) for laser microdissection or on usual glass slides for histology and stored at −80°C. The staining with toluidine blue was performed as described (16). To visualize the T and B cell compartments in the spleens, the sections were stained immunohistologically with either mAbs R73 (αβ T cells) or mAbs G35-2238 (B cells, both BD Biosciences). To identify proliferating cells, the tissue sections were stained for the rat homolog of the Ki-67 Ag (MIB-5; DakoCytomation) as described (16). The TUNEL assay was used to detect apoptotic cells using an anti-mouse-digoxigenin-peroxidase Ab, digoxigenin-11-UTP and the TdT (Roche Diagnostics) as described (17).

A total of 109 SRBC were labeled with CFSE (25 μM in 2 ml) with the CFSE cell proliferation kit (Invitrogen) according to the manufacturer’s protocol. A total of 9 × 109 unlabeled SRBC were added and injected into the tail vein as described above. The spleens were removed at 1 min and 1 h after injection, respectively (n = 3 animals each time point), and immersion fixed in 4% paraformaldehyde in PBS. The organs were cryoprotected using 20% sucrose in PBS, shock-frozen in melting isopentane, and stored at −80°C until use. Cryosections (10-μm thick) were cut, mounted on slides, coverslipped with Mowiol, and examined using a Zeiss 510 Meta confocal laser scanning microscope.

A pulsed UV laser was used to dissect the lymphoid tissue compartments directly (Palm Microbeam; PALM Microlaser Technologies). To avoid contaminations, only well-defined T or B cell zones were dissected. To yield enough mRNA for the analysis of seven cytokine genes and the housekeeping gene (MLN51) in duplicated reactions including controls (minus reverse transcriptase), we captured an area of 2 × 106 μm2/compartment. The dissected tissue was immediately dissolved in 350 μl of guanidinium-isothiocyanate-containing lysis buffer for isolation of total RNA (RNeasy kit; Qiagen) and was stored at −20°C. Total RNA was isolated according to the manufacturer’s protocol. To increase the RNA concentration, the final volume of the extracted RNA was reduced to 8 μl (Speedvac concentrator; Eppendorf). After treatment with DNase I (Sigma-Aldrich) for 15 min, the RNA was heated 70°C for 10 min and immediately cooled on ice. cDNA synthesis was performed as described (16).

To analyze the expression of cytokine genes, the T and B cell zones were dissected and the RNA was extracted. After reverse transcription, the cDNA was added to the qPCR Master Mix Plus (Eurogentec) and amplified using the SDS ABI 7000 or SDS ABI 7900 system (Applied Biosystems). The TaqMan probes, forward (for) and reverse (rev) primers were designed by using the computer software CloneManager (version 7.01; Sci Ed Central). The optimal primer concentrations used were 900 nM each for the forward and reverse primers and 200 nM for the TaqMan probe (IBA). The primer sequences, the exon localizations, amplicon sizes, and gene accession numbers are shown in Table I or were published earlier (16). The same batch of cDNA (20 μl) was used to determine the cycles of threshold (ct), and the amounts of the cytokine cDNA copies were normalized to the housekeeping gene MLN51 as described (see Refs. 16 and 18). In case of a very low number of transcripts, we used a ct of 40 for our calculations, the maximum possible ct value using the TaqMan System (Manual, RQ software; Applied Biosystems). The cDNAs of Tbet, Gata3, Foxp3, and CCR7 were analyzed using the qPCR Master Mix Plus for SYBR Green I (Eurogentec). The optimal primer concentrations were found to be 500 nM each.

Table I.

Primer sequences, amplicon sizes, and gene accession numbers of the analyzed genesa

Primer Name5′ Nucleotide SequenceSize (bp)Gene Accession Number
MLN51-forb AGGACAGCCTTCATTCCTG 128 NM_147144 
MLN51-rev GCTTAGCTCGACCACTCTG   
Probe CACGGGAACTTCGAGGTATGCCTAACCAC   
Cd3ε-for ACCTGGTGCTAGAGGATTTCTC 143 XM_001063976 
Cd3ε–rev GGATACTGCTGTCAGGTCCAC   
Probe ATGCAGTTCTCGCACACTCTGGCTTTC   
CD19-for CGAGGAGGGCTCTGAATTCTATG 97 XM_001079863 
CD19-rev GGGGTCATCCTCAGGGTTC   
Probe CATAGCCACTGCCATCCTGGGAAAGTTG   
IL12p19-for ACCAGCTTCATACCTCCCTAC 87 NM_130410 
IL12p19-rev TCAGGCGAGGCATCTGTTG   
Probe CTCAGCCAGCTCCTCCAGCCAGAGGATC   
IL12p35-for AGGCCTGCTTACCACTGG 86 NM_053390 
IL12p35-rev CAGGCAGCTCCCTCTTATTATGG   
Probe CTCCACAAGAATGAGAGTTGCCTGGCTAC   
IL27p28-for TCCCCAATGTTTCCCTGACC 77 XM_001079922 
IL27p28-rev TGTGGTAGCGAGGAAGCAG   
Probe CAGGCATGGCGTCACCTCTCTGACTCTGAC   
EBI3-for CGAGGAGCCTCTCACTTC 75 XM_001057970 
EBI3-rev ATGGGGTTGTGTGTTCCTG   
Probe CCAGGTGGGACCTATTGAAGCCACGAC   
Gata3-for GGTACTGGGCACTACCTTTG 142 NM_133293 
Gata3-rev TGGTGGTGGTCTGACAGTTC   
Tbet-for ACTGGATGCGACAGGAAG 114 XM_001081363 
Tbet-rev GCGGCTGGTACTTATGGAG   
Foxp3-for GCACTGCCAAGCAGATCAC 123 XM_001064182 
Foxp3-rev TGCATAGCTCCCAGCTTCTC   
CCR7-for GGGAAGCCCACGAAAAACG 88 NM_199489 
CCR7-rev TGTAGTCGTCTGTGACCTCATC   
Primer Name5′ Nucleotide SequenceSize (bp)Gene Accession Number
MLN51-forb AGGACAGCCTTCATTCCTG 128 NM_147144 
MLN51-rev GCTTAGCTCGACCACTCTG   
Probe CACGGGAACTTCGAGGTATGCCTAACCAC   
Cd3ε-for ACCTGGTGCTAGAGGATTTCTC 143 XM_001063976 
Cd3ε–rev GGATACTGCTGTCAGGTCCAC   
Probe ATGCAGTTCTCGCACACTCTGGCTTTC   
CD19-for CGAGGAGGGCTCTGAATTCTATG 97 XM_001079863 
CD19-rev GGGGTCATCCTCAGGGTTC   
Probe CATAGCCACTGCCATCCTGGGAAAGTTG   
IL12p19-for ACCAGCTTCATACCTCCCTAC 87 NM_130410 
IL12p19-rev TCAGGCGAGGCATCTGTTG   
Probe CTCAGCCAGCTCCTCCAGCCAGAGGATC   
IL12p35-for AGGCCTGCTTACCACTGG 86 NM_053390 
IL12p35-rev CAGGCAGCTCCCTCTTATTATGG   
Probe CTCCACAAGAATGAGAGTTGCCTGGCTAC   
IL27p28-for TCCCCAATGTTTCCCTGACC 77 XM_001079922 
IL27p28-rev TGTGGTAGCGAGGAAGCAG   
Probe CAGGCATGGCGTCACCTCTCTGACTCTGAC   
EBI3-for CGAGGAGCCTCTCACTTC 75 XM_001057970 
EBI3-rev ATGGGGTTGTGTGTTCCTG   
Probe CCAGGTGGGACCTATTGAAGCCACGAC   
Gata3-for GGTACTGGGCACTACCTTTG 142 NM_133293 
Gata3-rev TGGTGGTGGTCTGACAGTTC   
Tbet-for ACTGGATGCGACAGGAAG 114 XM_001081363 
Tbet-rev GCGGCTGGTACTTATGGAG   
Foxp3-for GCACTGCCAAGCAGATCAC 123 XM_001064182 
Foxp3-rev TGCATAGCTCCCAGCTTCTC   
CCR7-for GGGAAGCCCACGAAAAACG 88 NM_199489 
CCR7-rev TGTAGTCGTCTGTGACCTCATC   
a

Information obtained from the National Resource for Molecular Biology Information (www.ncbi.nlm.nih.gov).

b

for, forward; rev, reverse.

To contain a high percentage of lymphocytes, the cell suspensions were prepared from peripheral and mesenteric lymph nodes by passage the organs through a stainless steel sieve. To preferentially enrich the activated T cell fraction, the cell suspension was stimulated via the αβ TCR (Ab R73) and CD28 (Ab JJ319) for 3 days (17, 19). The cell suspensions contained 91.8 ± 8% activated lymphocytes as judged by staining with BrdU; 81.1 ± 3.9% of the BrdU+ fraction were identified as T cells and 19.7 ± 4.0% as B cells (see also Bode et al., Ref. 17). At the time point of injection, the expression of IL2, IL12p40, IL10, and IFNγ was not increased (see Fig. 6C). The significantly decreased expression of IL12p40 mRNA indicates the poor survival rate of APCs under these culture conditions. The dead cells and cell debris were removed by centrifugation. A total of 7 × 107 lymphocytes were injected into the recipients (17). The residual of the cells was used for gene quantification and immediately dissolved in lysis buffer. For controls, lymphocytes were injected immediately after isolation into the recipients (Table II). The spleens were removed and snap-frozen at −80°C at 1, 9, 24, and 72 h after injection of stimulated or nonstimulated lymphocytes. For cytokine gene quantification the T and B cell zones of the spleen sections were dissected and analyzed as described above for the injection of SRBC.

Table II.

No change in the expression of cytokine mRNA after injection of nonstimulated lymphocytesa

Cytokine Gene Copies/100 Copies MLN51Hours after Injection of Nonstimulated Lymphocytes
0124
IL2 TCZ 6.21 ± 4.30 10.12 ± 4.74 11.37 ± 1.02 
 BCF 1.47 ± 1.91 2.54 ± 1.75 2.28 ± 0.55 
 MZ 0.87 ± 1.02 2.60 ± 0.42 2.77 ± 1.16 
IFNγ TCZ 2.12 ± 1.45 2.33 ± 0.13 2.48 ± 2.97 
 BCF 5.39 ± 7.29 1.81 ± 0.21 2.30 ± 0.05 
 MZ 0.80 ± 0.66 0.48 ± 0.68 0.45 ± 0.64 
IL10 TCZ 6.39 ± 3.39 5.67 ± 1.27 5.93 ± 2.21 
 BCF 14.20 ± 6.61 9.48 ± 0.93 6.73 ± 1.15 
 MZ 3.81 ± 1.81 7.96 ± 1.36 3.07 ± 1.41 
IL12p40 TCZ 52.73 ± 44.37 79.23 ± 29.62 94.74 ± 45.27 
 BCF 7.99 ± 6.47 2.93 ± 1.02 5.06 ± 0.08 
 MZ 5.22 ± 4.29 7.59 ± 6.07 4.96 ± 0.35 
Cytokine Gene Copies/100 Copies MLN51Hours after Injection of Nonstimulated Lymphocytes
0124
IL2 TCZ 6.21 ± 4.30 10.12 ± 4.74 11.37 ± 1.02 
 BCF 1.47 ± 1.91 2.54 ± 1.75 2.28 ± 0.55 
 MZ 0.87 ± 1.02 2.60 ± 0.42 2.77 ± 1.16 
IFNγ TCZ 2.12 ± 1.45 2.33 ± 0.13 2.48 ± 2.97 
 BCF 5.39 ± 7.29 1.81 ± 0.21 2.30 ± 0.05 
 MZ 0.80 ± 0.66 0.48 ± 0.68 0.45 ± 0.64 
IL10 TCZ 6.39 ± 3.39 5.67 ± 1.27 5.93 ± 2.21 
 BCF 14.20 ± 6.61 9.48 ± 0.93 6.73 ± 1.15 
 MZ 3.81 ± 1.81 7.96 ± 1.36 3.07 ± 1.41 
IL12p40 TCZ 52.73 ± 44.37 79.23 ± 29.62 94.74 ± 45.27 
 BCF 7.99 ± 6.47 2.93 ± 1.02 5.06 ± 0.08 
 MZ 5.22 ± 4.29 7.59 ± 6.07 4.96 ± 0.35 
a

Nonstimulated lymphocytes prepared from peripheral and mesenteric lymph nodes were i.v. injected into recipient animals. The expression of IL2, IFNγ, IL10, and IL12p40 mRNA was analyzed in the compartments of the spleens at 1 and 24 h after injection. Data are normalized relative to MLN51 mRNA expression levels. Data are means ± SD, n = 2.

The statistical significance of differences between the related T and B cell zones after dissection was determined using the Wilcoxon signed-rank test. The statistical significance of differences between the compartments and cell suspensions before and after stimulation was determined using the Mann-Whitney U test as the nonparametric test for two independent samples.

The white pulp of the spleen that generates the Ag-specific immune responses consists of TCZ and BCF. The MZ is a B cell compartment that surrounds the white pulp and contains specific macrophages and dendritic cells (DC) (20). To analyze the pattern of gene expression at the compartmental level, it is important to precisely isolate the specific T and B cell zones of the spleen without mRNA loss. By using a short toluidine blue staining protocol, we show that the distinct tissue compartments can be identified correctly (Fig. 1, A–C). To confirm that the TCZ, BCF, and MZ are accurately identified and high-quality mRNAs are obtained, we analyzed the mRNA expression of CD3ε and CD19 after laser microdissection. CD3ε is part of the TCR complex whereas CD19 is expressed specifically by B cells. We found that CD3ε mRNA was preferentially expressed in the TCZ and CD19 mRNA in the BCF and MZ (Fig. 1,D). These results demonstrate the accuracy of our isolation technique. Besides the expression of these surface molecules, we asked whether the expression of transcription factors is compartment specific, too. We focused on the analysis of the typical T cell transcription factors like Gata3, Tbet, and Foxp3 (5, 21, 22, 23). Gata3 and Foxp3 mRNA were mainly expressed in the TCZ whereas the expression of Tbet was not linked to a preferential compartment (Fig. 1 E).

FIGURE 1.

Staining with toluidine blue allows the identification of functionally different lymphoid compartments of the spleen. A, Cryosections of a rat spleen were stained with toluidine blue. The TCZ, BCF, MZ, RP, and central artery (CA) are easily distinguishable. B, Adjacent cryosections were stained immunohistologically with Abs against T cells (αβ TCR) and (C) against B cells (IgD). Bar, 100 μm. D, The cDNA copies for CD3ε and CD19 were analyzed by real-time RT-PCR after microdissection of the TCZ, BCF, and MZ and normalized to the housekeeping gene metastatic lymph node gene 51 (MLN51) as described (16 ). E, The expression of the transcription factors Gata3, Foxp3, and Tbet in the T and B cell zones of the spleen is shown. Data are means ± SD. Brackets indicate significant differences among the level of expression between the TCZ and both B cell zones and between the BCF and MZ (p < 0.01; Wilcoxon signed-rank test; n = 14).

FIGURE 1.

Staining with toluidine blue allows the identification of functionally different lymphoid compartments of the spleen. A, Cryosections of a rat spleen were stained with toluidine blue. The TCZ, BCF, MZ, RP, and central artery (CA) are easily distinguishable. B, Adjacent cryosections were stained immunohistologically with Abs against T cells (αβ TCR) and (C) against B cells (IgD). Bar, 100 μm. D, The cDNA copies for CD3ε and CD19 were analyzed by real-time RT-PCR after microdissection of the TCZ, BCF, and MZ and normalized to the housekeeping gene metastatic lymph node gene 51 (MLN51) as described (16 ). E, The expression of the transcription factors Gata3, Foxp3, and Tbet in the T and B cell zones of the spleen is shown. Data are means ± SD. Brackets indicate significant differences among the level of expression between the TCZ and both B cell zones and between the BCF and MZ (p < 0.01; Wilcoxon signed-rank test; n = 14).

Close modal

After having established the surface markers CD3ε and the transcription factors Gata3 and Foxp3 as marker transcripts within the TCZ, we went on to ask whether cytokine genes display a compartment-specific expression in the steady-state, too. In our analysis, we focused on cytokines that are known to be produced by T cells like IL2, the Th1/Th2 effector cytokines IFNγ and IL4, and the homeostatic cytokines IL15, IL10, and TGFβ1 (15, 24, 25, 26, 27, 28). We found that only IL2 and IL15 were associated with the TCZ. IL10 mRNA was expressed mainly in the BCF. TGFβ1 had no preferential distribution and, most interestingly, the expression of the Th1/Th2 effector cytokines IFNγ and IL4 were not linked to any compartment either (Fig. 2 A).

FIGURE 2.

Expression of cytokine mRNAs in the steady-state differs between the TCZ, BCF, and MZ. A, The mRNA expression of the T cell-derived cytokines IL2, IL4, IFNγ, IL15, IL10, and TGFβ1 and (B) the subunits of the IL12 cytokine family: IL12p40 (p40), IL12p35 (p35), IL23p29 (p19), IL27p28 (p28), and EBI3 as marker cytokines for APC in the MZ, TCZ, and BCF of spleens from unchallenged rats is shown. Note that the level of each individual cytokine mRNA differed substantially (e.g., ∼100-fold between IL4 and EBI3). The means and SD of the amount of cDNA copies normalized to MLN51 are shown (n = 5–12). Brackets indicate significant differences among the level of expression between TCZ and BCF, TCZ and MZ, or BCF and MZ (p < 0.05; Wilcoxon signed-rank test; n = 5–12).

FIGURE 2.

Expression of cytokine mRNAs in the steady-state differs between the TCZ, BCF, and MZ. A, The mRNA expression of the T cell-derived cytokines IL2, IL4, IFNγ, IL15, IL10, and TGFβ1 and (B) the subunits of the IL12 cytokine family: IL12p40 (p40), IL12p35 (p35), IL23p29 (p19), IL27p28 (p28), and EBI3 as marker cytokines for APC in the MZ, TCZ, and BCF of spleens from unchallenged rats is shown. Note that the level of each individual cytokine mRNA differed substantially (e.g., ∼100-fold between IL4 and EBI3). The means and SD of the amount of cDNA copies normalized to MLN51 are shown (n = 5–12). Brackets indicate significant differences among the level of expression between TCZ and BCF, TCZ and MZ, or BCF and MZ (p < 0.05; Wilcoxon signed-rank test; n = 5–12).

Close modal

It has been shown that APCs like macrophages and DC produce cytokines of the IL12 family (IL12, IL23, and IL27) upon activation (29). Because both cell types reside in the lymphoid compartments of the spleen, we asked whether a compartment-specific basic level of IL12 transcription exists (20). Because the members of the IL12 cytokine family IL12p70 (IL12p35/IL12p40), IL23 (IL23p29/IL12p40), and IL27 (IL27p28/EBI3) are bioactive as heterodimers only, we analyzed each gene individually. We found that all cytokines of the IL12 family were transcribed in the steady-state (Fig. 2,B). Most interestingly, our results reveal that the monomers of the IL12 cytokine family were produced in distinct lymphoid compartments. IL12p40 and IL27p28 were found to be transcribed preferentially in the TCZ whereas IL23p19 and EBI3 prevailed in the B cell zones. Moreover, the MZ also displayed its own specific pattern of mRNA expression. Compared with the BCF, IL15 especially prevailed in the MZ, whereas IL10 and EBI3 were higher in the BCF (Fig. 2).

To expose the spleen directly to a blood-derived Ag, we injected SRBC i.v. To follow the arrival in the spleen, the SRBC were labeled with CFSE. We found SRBC within 1 min after injection in the MZ (Fig. 3,A). At 1 h after injection, most CFSE-labeled SRBC were internalized by cells either at the outer border of the MZ or in the red pulp (RP) (data not shown). At 3 days after injection, we observed a 5-fold increase in proliferating cells in the TCZ (Fig. 3,B). Finally, the immune response against SRBC proceeded with the formation of germinal centers (GC) (Fig. 3, C and D).

FIGURE 3.

SRBC induce an immune response in the spleen. A, At 1 min after injection, SRBC (green dots, arrows) were mainly found in the MZ. Because many phagocytotic cells possess autofluorescence (red and yellow cells), the specific T and B cell zones were easily distinguishable: TCZ, BCF, MZ, RP, and central artery (CA). B–D, To identify the individual compartments, the B cells were stained with IgD (blue) and the proliferating cells were labeled with Ki-67 (red). B, Ki-67+ cells within the TCZ were counted. C, The formation of GC was monitored by measuring the increase in size of the Ki-67+ area. The surrounding corona (Co) was excluded from cell proliferation. D, Thirty percent of the BCF was occupied by proliferating cells at 10 days after immunization. Bar, 100 μm. The mean values and SD are shown (n = 3).

FIGURE 3.

SRBC induce an immune response in the spleen. A, At 1 min after injection, SRBC (green dots, arrows) were mainly found in the MZ. Because many phagocytotic cells possess autofluorescence (red and yellow cells), the specific T and B cell zones were easily distinguishable: TCZ, BCF, MZ, RP, and central artery (CA). B–D, To identify the individual compartments, the B cells were stained with IgD (blue) and the proliferating cells were labeled with Ki-67 (red). B, Ki-67+ cells within the TCZ were counted. C, The formation of GC was monitored by measuring the increase in size of the Ki-67+ area. The surrounding corona (Co) was excluded from cell proliferation. D, Thirty percent of the BCF was occupied by proliferating cells at 10 days after immunization. Bar, 100 μm. The mean values and SD are shown (n = 3).

Close modal

After having established that T cells start to proliferate at 3 days after injection of SRBC, we aimed to identify cytokines that are present during T cell activation. We expected to find increased levels of cytokine transcription during the time of T cell proliferation in the TCZ (from days 3 to 6) and during the formation of GC in the BCF (from days 6 to 10). Surprisingly, we found that all changes in cytokine gene expression took place within 72 h after injection, but not later, even if a productive immune response was induced as shown by the formation of GC. The expression of IL2 increased transiently between 9 and 24 h after immunization. The expression of the Th1 cytokine IFNγ peaked at 24 h. The transcription of both cytokines was restricted to the TCZ and was down-regulated at 72 h, the time point of highest T cell proliferation (Fig. 4,A). All other cytokines studied (IL4, IL10, IL15, TGFβ1) did not change their transcriptional activity, at least not in the TCZ. However, in the MZ, we found a 25-fold—and in the BCF a 3-fold—increase in IL10 mRNA within the first hour of immunization (Fig. 4 A).

FIGURE 4.

Cytokine mRNAs are expressed transiently and sequentially in the TCZ, BCF, and MZ of the spleen after injection of SRBC. A, The expression of the T cell-derived cytokines IL2, IFNγ, and IL10 in the MZ, TCZ, and BCF is shown after i.v. injection of SRBC. No increase in expression of IL4, IL15, and TGFβ1 was found. B, Among the members of the IL12 cytokine family only the expression of IL12p40 and IL27p28 was altered after immunization. Data are normalized relative to MLN51 mRNA expression levels and further normalized to the mean value of the controls for the TCZ, BCF, and MZ which are set as 1. Data are means ± SEM. ∗, Significant differences between the level of expression between control and challenged animals (p < 0.01; Mann-Whitney U test, n = 3–12).

FIGURE 4.

Cytokine mRNAs are expressed transiently and sequentially in the TCZ, BCF, and MZ of the spleen after injection of SRBC. A, The expression of the T cell-derived cytokines IL2, IFNγ, and IL10 in the MZ, TCZ, and BCF is shown after i.v. injection of SRBC. No increase in expression of IL4, IL15, and TGFβ1 was found. B, Among the members of the IL12 cytokine family only the expression of IL12p40 and IL27p28 was altered after immunization. Data are normalized relative to MLN51 mRNA expression levels and further normalized to the mean value of the controls for the TCZ, BCF, and MZ which are set as 1. Data are means ± SEM. ∗, Significant differences between the level of expression between control and challenged animals (p < 0.01; Mann-Whitney U test, n = 3–12).

Close modal

The activation of T cells requires the presentation of the Ag by APC-like DC or macrophages (30, 31). Because the expression of IL12 has been described as indicator for the activation of APC, we analyzed the expression of the cytokine genes of the IL12 family during the immune response (32, 33). Our data reveal that the subunits IL12p40 and IL27p28 changed their level of transcription in the TCZ. The expression of IL12p40 increased significantly ∼3-fold at 9 h and decreased at 24 h after stimulation in the TCZ. The transcription of IL27p28 peaked at 24 h after injection of SRBC also in the TCZ. Interestingly, the increase in expression of IL12p40 mRNA was also observed in the MZ at 9 h after injection of SRBC (Fig. 4 B).

Our results revealed an increased transcription of IL12p40 and IL2 at 9 h and of IL2, IFNγ, and IL27p28 at 24 h after immunization in the TCZ (Fig. 4). To further characterize the local activities in the TCZ during the immune response, we compared the level of expression of these genes between the outer and inner TCZ (Fig. 5,A). We found that the increased transcription of IL2, IL12p40, and IFNγ was restricted to the inner part of the TCZ. Only the expression of IL27p28 took place in the inner and outer part of the TCZ (Fig. 5,B). The comparable expression of CD3ε in the inner and outer zone indicated that both zones are located in the TCZ (Fig. 5 C). The decreased expression of CD19 in the inner TCZ indicates a very low percentage of B cells in this area. However, the number of CD3ε-expressing T cells did not differ.

FIGURE 5.

IL2-, IL12p40-, and IFNγ-expressing cells are enriched in the inner TCZ. The outer and inner TCZ (A) was isolated by laser microdissection and the expression of IL12p40, IL2, IFNγ, and IL27p28 was analyzed at 9 and 24 h after injection of SRBC (B). Increasing numbers of IL12p40, IL2, and IFNγ transcripts were found in the inner TCZ around the central artery. In contrast, IL27p28 mRNA had no preferential distribution. Data are normalized relative to MLN51 mRNA expression levels. Each white circle represents one individual animal. The values obtained from the same animal are connected. C, The inner and the outer TCZ are clearly located within the TCZ as judged by comparing the expression of CD3ε and CD19. ∗, Significant differences between the level of expression among the designated zones (p < 0.01; Mann-Whitney U test, n = 6–12).

FIGURE 5.

IL2-, IL12p40-, and IFNγ-expressing cells are enriched in the inner TCZ. The outer and inner TCZ (A) was isolated by laser microdissection and the expression of IL12p40, IL2, IFNγ, and IL27p28 was analyzed at 9 and 24 h after injection of SRBC (B). Increasing numbers of IL12p40, IL2, and IFNγ transcripts were found in the inner TCZ around the central artery. In contrast, IL27p28 mRNA had no preferential distribution. Data are normalized relative to MLN51 mRNA expression levels. Each white circle represents one individual animal. The values obtained from the same animal are connected. C, The inner and the outer TCZ are clearly located within the TCZ as judged by comparing the expression of CD3ε and CD19. ∗, Significant differences between the level of expression among the designated zones (p < 0.01; Mann-Whitney U test, n = 6–12).

Close modal

After having shown that the expression of cytokine genes changed after directly stimulating the spleen with SRBC, we asked whether circulating lymphocytes that could have been activated during a proceeding infection at a peripheral tissue site would affect the spleen as well. Surprisingly, even though no Ag was present, and the expression of IL2, IL12p40, IL10, and IFNγ mRNA at the time of injection was not higher than their expression before activation in culture (Fig. 6,C), we found an increase in expression of IL2, IL12p40, IL10, and IFNγ. Apart from an altered sequence and duration, these findings are similar to the results obtained after the direct antigenic stimulation. The expression of IL2 increased ∼8-fold in the TCZ at 9 h similar to its expression after injection of SRBC, but this increased transcription continued until 72 h after injection (Figs. 4,A and 6,A). Also, an increase in transcription of IFNγ was induced by circulating lymphocytes. However, compared with the direct antigenic stimulation this increase was much lower (only 4-fold), earlier (after 9 h), and could also be observed in the BCF (Fig. 6,A). Strikingly, the spatial and temporal expression of IL10 mRNA changed dramatically. In contrast to its rapid, high, and limited expression in the MZ at 1 h after the direct antigenic stimulation, we found a much lower expression of IL10 that continued until 24 h in the MZ. Most importantly, we detected a significantly increased transcription of IL10 in the BCF and even in the TCZ at 9 h after injection of in vitro-activated lymphocytes (Fig. 6 A). No change in the expression of IL4, IL15, or TGFβ1 was detected.

FIGURE 6.

Cytokine mRNA expression change after injection of in vitro-activated lymphocytes. A, The expression of the T cell-derived cytokines IL2, IFNγ, and IL10 and (B) of IL12p40 mRNA as activation marker for APC is shown in the MZ, TCZ, and BCF of the spleen after i.v. injection of in vitro-activated lymphocytes. Data are normalized relative to MLN51 mRNA expression levels and further normalized to the mean value of the controls for the TCZ, BCF, and MZ which are set as 1. Data are means ± SEM. ∗, Significant differences between the level of expression between control and challenged animals (p < 0.01; Mann-Whitney U test, n = 5–12). C, The expression of IL2, IFNγ, IL10, and IL112p40 mRNA in lymphocytes before and after stimulation in culture is shown. The expression of IL12p40 was significantly decreased (p < 0.001; Mann-Whitney U test, n = 7). Data are normalized relative to MLN51 mRNA expression levels (means ± SEM). D, The number of apoptotic cells in the TCZ, BCF, and MZ was counted at 1 h after injection of activated lymphocytes. Data are means ± SEM, n = 6.

FIGURE 6.

Cytokine mRNA expression change after injection of in vitro-activated lymphocytes. A, The expression of the T cell-derived cytokines IL2, IFNγ, and IL10 and (B) of IL12p40 mRNA as activation marker for APC is shown in the MZ, TCZ, and BCF of the spleen after i.v. injection of in vitro-activated lymphocytes. Data are normalized relative to MLN51 mRNA expression levels and further normalized to the mean value of the controls for the TCZ, BCF, and MZ which are set as 1. Data are means ± SEM. ∗, Significant differences between the level of expression between control and challenged animals (p < 0.01; Mann-Whitney U test, n = 5–12). C, The expression of IL2, IFNγ, IL10, and IL112p40 mRNA in lymphocytes before and after stimulation in culture is shown. The expression of IL12p40 was significantly decreased (p < 0.001; Mann-Whitney U test, n = 7). Data are normalized relative to MLN51 mRNA expression levels (means ± SEM). D, The number of apoptotic cells in the TCZ, BCF, and MZ was counted at 1 h after injection of activated lymphocytes. Data are means ± SEM, n = 6.

Close modal

Interestingly, the only cytokine that displayed almost an identical pattern of mRNA transcription after a direct or indirect stimulation was IL12p40 (Fig. 6,B). Because it has been shown that APC in the spleen are induced to express IL12 after internalization of circulating apoptotic cells, we counted the number of apoptotic cells and found a strong increase at 1 h after injection in all compartments of the spleen (Fig. 6 D) (34).

In conclusion, a direct stimulation of the spleen by injecting SRBC started with the transient expression of IL12p40 mRNA after 9 h and ended with the expression of the effector cytokine IFNγ after 24 h in the TCZ. Neither of these events overlapped and preceded T cell proliferation. An indirect stimulation of the spleen by incoming activated lymphocytes induced not only the expression of IL12p40 and IFNγ but also that of IL10 after 9 h in the TCZ.

In this study, we assessed the location of cytokine-transcribing cells in vivo within the lymphoid compartments of the spleen. Because cytokines are produced in small amounts only, the analysis of cytokines in vivo is extremely difficult. Thus, most of the available data are established after cell isolation. This leads to a loss of important information, because immune responses are regulated by the interplay of all cell types present within the lymphoid compartments including stromal, lymphoid, and other hematopoietic cells. In the present study, we used the combination of laser microdissection and real-time RT-PCR to analyze the expression of multiple cytokine genes during immune stimulations of the spleen. Because an increase in cytokine mRNA copies at a specific area reflects either the initiation of mRNA transcription in a specific cell population at this site or the accumulation of migrating cells that contain higher copy numbers of specific mRNAs constitutively, this approach allows for tracing of the course of immune responses in vivo. Moreover, apart from IL4, it is shown for most cytokines that mRNA expression correlates significantly with protein expression. Thus, our approach also allows for prediction of changes of cytokines at the protein level (10, 11, 35).

First, we demonstrated that the compartments of the rat spleen (TCZ, BCF, and MZ) were isolated correctly by analyzing the expression of CD3ε and CD19 (Fig. 1). Also the mRNA species for the transcription factors and cytokines were found to be expressed specifically in the steady-state (Figs. 1 and 2).

Next, we stimulated the spleens directly by SRBC. The i.v. application of SRBC induced a complete primary immune response as shown by T cell proliferation and newly formed GC (Fig. 3). Because cytokines which are present during T cell activation influence the resulting response, we focused on the expression of cytokines in the TCZ (6, 7, 24). We found that the increased transcription of the cytokines IL12p40, IL20, and IFNγ clearly preceded the T cell proliferation (Figs. 3 and 4). In case of IL12p40 and IL2, this finding aligns with previous reports (32, 36). It has been shown in mice that APC produce IL12 in the MZ and TCZ at 5 h after infection (32). Also, the early and transient transcription of IL2 has been described (36). However, the rapid up and down-regulation of IFNγ mRNA at 24 h after stimulation was unexpected, because it is assumed that IFNγ-expressing CD4+ Th1 cell clones appear only after activation and division of Ag-specific Th0 cells (6, 7, 24). However, our finding is supported by previous reports. These reports have demonstrated that CD4+ and CD8+ T cells express IFNγ before cell division in ex vivo experiments, although they also have illustrated that the transcription of IFNγ continues during and after cell division (8, 10). One explanation for this discrepancy might be that during isolation of cells from their original environment the binding of cytokines to their receptors is lost and the cells are induced to transcribe new cytokine mRNAs immediately after isolation. Another possibility could be that SRBC might be cleared readily from the organism, because they are nonreplicating Ags. Thus, a single dose of SRBC might not be sufficient to induce fully mature IFNγ-producing T cell clones. Consistent with this hypothesis, it has been shown that a second encounter with Ag is required for a complete commitment of naive Th cells into IL4-secreting Th2 cells (11). Alternatively, the increase in IFNγ mRNA might be caused by innate IFNγ producers like migrating NK or NKT cells that accumulate in the inner TCZ. It has recently been shown for lymph nodes that NK cells migrate into the TCZ after infection (37). Hence, a directed migration of NK cells into the TCZ might be an additional regulatory step in the cascade of events before an ultimate commitment to IFNγ-producing CD4+ Th1 cells during adaptive immune responses. It will be interesting to find out how the duration and the quantity of IFNγ mRNA transcription could be influenced in vivo.

Our approach to analyze cells within their original environment allows detecting the exact localization of cell activation. By taking a closer look at the TCZ, we found an increased transcription of IL12p40, IL2, and IFNγ in the inner TCZ after immunization with SRBC (Fig. 5). These data imply that T cell activation takes place at the inner TCZ and introduce the possibility that migrating T cells enter the white pulp directly at the center around the central artery as suggested by earlier studies (38, 39). It has been shown that the interaction between DC, Ag-specific T and B cells takes place at the border between TCZ and BCF (40, 41). Accordingly, proliferating T cells move toward the outer TCZ (42). Our results reveal that the activation of T cells started in the inner TCZ as judged by an increase in IL2 transcription. Because the transcription of IL2 was at no time increased at the outer TCZ, we assume that the transcription stopped before T cells migrated to the outer TCZ. The only cytokine that was not preferentially expressed in the inner TCZ was IL27p28 mRNA. Because it has been shown that IL27 suppresses the expansion of T cells by inhibiting the production of IL2, it is reasonable to assume that IL27 expressing cells are located between the outer and inner TCZ. This would be the ideal place to inhibit the transcription of IL2 in activated T cells that move to the outer TCZ (43).

In addition to the TCZ, which revealed increased transcripts of IL12p40, IL2, and IFNγ after challenge with SRBC, we identified the expression of IL10 mRNA as the earliest and strongest increase in cytokine genes after directly stimulating the spleen in the MZ (Fig. 4). It is not surprising to find the first change in cytokine expression in the MZ, because the MZ is the compartment that traps blood-borne Ags (44). However, because IL10 is mainly recognized for its ability to inhibit the function of monocytes, macrophages, and activated T cells and B cells, we did not expect to find such a strong increase in IL10 mRNA that early during the adaptive immune response against SRBC (26, 45). The indirect stimulation of the spleen by exposure to in vitro-activated lymphocytes also induced the transcription of IL10 mRNA in the MZ at 1 h after injection but to a lower extend (only 5-fold) and with a longer duration (until 72 h) (Fig. 6 A). Because MZ B cells are shown to be in a preactivated state enabling them to respond rapidly to blood-borne Ags, we assume that the early IL10 mRNA originates from MZ B cells. Our data, which revealed a 3-fold increase in IL10 mRNA in the BCF at 1 h after the direct stimulation, are supported by the fact that MZ B cells may enter the BCF. Moreover, it has been reported that MZ B cells are able both to express IL10 and to recognize Ags directly via BCRs, TLRs, or indirectly by immature blood-derived DC (46, 47). In case of the indirect stimulation, arriving apoptotic cells might activate MZ B cells to express IL10 as shown recently (48). The assumption that IL10 originates from cells that reside specifically in the MZ is further supported by the fact that its early expression is restricted to the MZ, even if apoptotic cells also appear in the TCZ and BCF. Thus, in our opinion, MZ B cells are suitable candidate cells for the expression of IL10 during the initial phase of immune activations in the spleen. One role for this early IL10 could be the induction of chemokine receptors as described previously (49). Accordingly, initial data from this laboratory indicate that the expression of CCR7 mRNA increased ∼16-fold in the MZ at 1 h after stimulation (data not shown). However, many questions remain to be answered regarding the source and role of the early transcription of IL10.

Next, we asked whether the expression of cytokine genes in the compartments of the spleen would be influenced by incoming lymphocytes as well, because the spleen is not only exposed to blood-borne Ags but also to activated lymphocytes that reach their target via the bloodstream. Because T and B cells would migrate into the spleen after being activated at a distant tissue site, we injected T and B cells after stimulation in culture. Unexpectedly, even without adding any Ag or APC, we found an increase in expression of IL10, IL12p40, IL2, and IFNγ similarly to the observations after the direct challenge with SRBC (Fig. 6). However, compared with the antigenic stimulation, the structured spatial and temporal sequence was disturbed. The expression of these cytokines was overlapping and had their highest peaks simultaneously at 9 h after injection. Why did the expression of cytokine mRNA increase even in the absence of any Ag? We assume that the changes in cytokine gene expression were caused by two events. First, the increased expression of IL12p40 mRNA in the MZ and TCZ implies an activation of APC in the spleen (Fig. 6,B). Because no Ag was present and the cells did not express IL12p40 mRNA at the time of injection (Fig. 6,C), we suggest that some of the injected cells became apoptotic immediately after injection and were trapped in the MZ. In addition, a higher number of cells underwent apoptosis after migration into the TCZ or BCF (Fig. 6,D). It is shown that apoptotic cells are internalized by APCs and induce the expression of IL12p40 along with the presentation of self-peptides to T cells in the TCZ to establish a peripheral T cell tolerance (34). Second, the injected lymphocytes that had been polyclonally activated in vitro and had not become apoptotic could be triggered to produce cytokines by those APC that present self-peptides in the TCZ. Thus, the injected lymphocytes themselves would be the source for IL2, IFNγ, and IL10 mRNA after APC encounter in the TCZ. The result that IL2 and IFNγ, as T cell-derived cytokines, were also transcribed in the BCF was unexpected because both cytokines have not been found in B cells so far. We suppose that activated T cells enter BCF in a CD40-dependent manner as previously described (50). However, it is reported that apoptotic cells usually suppress immune responses (51). Our results reveal that even though IL12p40 expression was entirely similar after both types of stimulation, the transcription of IFNγ mRNA was much lower in total (only 4-fold), earlier (at 9 h) and disappeared completely at 24 h in the TCZ after injection of activated lymphocytes. Instead, we found a profound increase in IL10 mRNA in the BCF and in the TCZ at 9 h after injection. Because IL10 is known as immunosuppressive cytokine, we suppose that particularly the presence of IL10 in the TCZ at 9 h after injection contributed to the suppression of IFNγ. Thus, the ability of IL10 to induce multiple effects during immune responses may be explained by its expression at several time points and in distinct compartments (26). Depending on the time and localization, IL10 could act as an activator or inhibitor of innate components, e.g., early in the MZ (Fig. 4,A), and/or as regulator for T cells and B cells in the TCZ and BCF (Fig. 6 A).

Taken together, we demonstrate that not only blood-borne Ags but also Ags that invade the organism at a peripheral tissue site and induce the circulation of activated or apoptotic lymphocytes modify the microenvironmental conditions within the T and B cell zones of the spleen. Because an identical set of cytokines is induced, it is obvious that events outside the spleen influence and affect immune responses within the organ. This situation might be unique for the spleen because activated lymphocytes are mainly excluded from the entry into lymph nodes. Thus, the determination of each step during initiation, expansion, and memory phases of immune responses in vivo after applying different types of Ags once, repetitively, and/or in combination with activated lymphocytes, and/or apoptotic cells will provide new insights into the distinct and overlapping effects of cytokines during both protective immune responses and immune disorders such as autoimmunity.

We thank E. Behrens, L. Gutjahr, P. Lau, K. von Lingelsheim, and M.-L. Leppin for their excellent technical assistance. We address special thanks to M. Blessenohl for taking care of the animals and to Katrin Schmidt for proofreading the manuscript.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by German Research Foundation Grant SFB 654-C4.

3

Abbreviations used in this paper: MZ, marginal zone; ct, cycle of threshold; TCZ, T cell zone; BCF, B cell follicle; DC, dendritic cells; RP, red pulp; GC, germinal center.

1
Matter, M., B. Odermatt, H. Yagita, J. M. Nuoffer, A. F. Ochsenbein.
2006
. Elimination of chronic viral infection by blocking CD27 signaling.
J. Exp. Med.
203
:
2145
-2155.
2
Mueller, S. N., K. A. Hosiawa-Meagher, B. T. Konieczny, B. M. Sullivan, M. F. Bachmann, R. M. Locksley, R. Ahmed, M. Matloubian.
2007
. Regulation of homeostatic chemokine expression and cell trafficking during immune responses.
Science
317
:
670
-674.
3
Anderson, C. F., M. Oukka, V. J. Kuchroo, D. Sacks.
2007
. CD4+CD25Foxp3 Th1 cells are the source of IL-10-mediated immune suppression in chronic cutaneous leishmaniasis.
J. Exp. Med.
204
:
285
-297.
4
Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, C. T. Weaver.
2005
. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages.
Nat. Immunol.
6
:
1123
-1132.
5
Mills, K. H..
2004
. Regulatory T cells: friend or foe in immunity to infection?.
Nat. Rev. Immunol.
4
:
841
-855.
6
Openshaw, P., E. E. Murphy, N. A. Hosken, V. Maino, K. Davis, K. Murphy, A. O’Garra.
1995
. Heterogeneity of intracellular cytokine synthesis at the single-cell level in polarized T helper 1 and T helper 2 populations.
J. Exp. Med.
182
:
1357
-1367.
7
Assenmacher, M., M. Lohning, A. Scheffold, R. A. Manz, J. Schmitz, A. Radbruch.
1998
. Sequential production of IL-2, IFN-γ and IL-10 by individual staphylococcal enterotoxin B-activated T helper lymphocytes.
Eur. J. Immunol.
28
:
1534
-1543.
8
Veiga-Fernandes, H., U. Walter, C. Bourgeois, A. McLean, B. Rocha.
2000
. Response of naive and memory CD8+ T cells to antigen stimulation in vivo.
Nat. Immunol.
1
:
47
-53.
9
Kamanaka, M., S. T. Kim, Y. Y. Wan, F. S. Sutterwala, M. Lara-Tejero, J. E. Galan, E. Harhaj, R. A. Flavell.
2006
. Expression of interleukin-10 in intestinal lymphocytes detected by an interleukin-10 reporter knockin tiger mouse.
Immunity
25
:
941
-952.
10
Mayer, K. D., K. Mohrs, S. R. Crowe, L. L. Johnson, P. Rhyne, D. L. Woodland, M. Mohrs.
2005
. The functional heterogeneity of type 1 effector T cells in response to infection is related to the potential for IFN-γ production.
J. Immunol.
174
:
7732
-7739.
11
Mohrs, K., A. E. Wakil, N. Killeen, R. M. Locksley, M. Mohrs.
2005
. A two-step process for cytokine production revealed by IL-4 dual-reporter mice.
Immunity
23
:
419
-429.
12
Fink, L., W. Seeger, L. Ermert, J. Hanze, U. Stahl, F. Grimminger, W. Kummer, R. M. Bohle.
1998
. Real-time quantitative RT-PCR after laser-assisted cell picking.
Nat. Med.
4
:
1329
-1333.
13
Van den Eertwegh, A. J., W. J. Boersma, E. Claassen.
1992
. Immunological functions and in vivo cell-cell interactions of T cells in the spleen.
Crit. Rev. Immunol.
11
:
337
-380.
14
Mackaness, G. B., P. H. Lagrange, T. E. Miller, T. Ishibashi.
1974
. Feedback inhibition of specifically sensitized lymphocytes.
J. Exp. Med.
139
:
543
-559.
15
Mosmann, T. R., H. Cherwinski, M. W. Bond, M. A. Giedlin, R. L. Coffman.
1986
. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins.
J. Immunol.
136
:
2348
-2357.
16
Kalies, K., M. Blessenohl, J. Nietsch, J. Westermann.
2006
. T cell zones of lymphoid organs constitutively express Th1 cytokine mRNA: specific changes during the early phase of an immune response.
J. Immunol.
176
:
741
-749.
17
Bode, U., K. Wonigeit, R. Pabst, J. Westermann.
1997
. The fate of activated T cells migrating through the body: rescue from apoptosis in the tissue of origin.
Eur. J. Immunol.
27
:
2087
-2093.
18
Livak, K. J., T. D. Schmittgen.
2001
. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔC(T) method.
Methods
25
:
402
-408.
19
Bode, U., A. Sahle, G. Sparmann, F. Weidner, J. Westermann.
2002
. The fate of effector T cells in vivo is determined during activation and differs for CD4+ and CD8+ cells.
J. Immunol.
169
:
6085
-6091.
20
Mebius, R. E., G. Kraal.
2005
. Structure and function of the spleen.
Nat. Rev. Immunol.
5
:
606
-616.
21
Li-Weber, M., P. H. Krammer.
2003
. Regulation of IL4 gene expression by T cells and therapeutic perspectives.
Nat. Rev. Immunol.
3
:
534
-543.
22
Marine, J., A. Winoto.
1991
. The human enhancer-binding protein Gata3 binds to several T-cell receptor regulatory elements.
Proc. Natl. Acad. Sci. USA
88
:
7284
-7288.
23
Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, L. H. Glimcher.
2000
. A novel transcription factor, T-bet, directs Th1 lineage commitment.
Cell
100
:
655
-669.
24
Abbas, A. K., K. M. Murphy, A. Sher.
1996
. Functional diversity of helper T lymphocytes.
Nature
383
:
787
-793.
25
Gorelik, L., R. A. Flavell.
2002
. Transforming growth factor-β in T-cell biology.
Nat. Rev. Immunol.
2
:
46
-53.
26
Moore, K. W., R. de Waal Malefyt, R. L. Coffman, A. O’Garra.
2001
. Interleukin-10 and the interleukin-10 receptor.
Annu. Rev. Immunol.
19
:
683
-765.
27
Schluns, K. S., L. Lefrancois.
2003
. Cytokine control of memory T-cell development and survival.
Nat. Rev. Immunol.
3
:
269
-279.
28
Smith, K. A..
1988
. Interleukin-2: inception, impact, and implications.
Science
240
:
1169
-1176.
29
Hunter, C. A..
2005
. New IL-12-family members: IL-23 and IL-27, cytokines with divergent functions.
Nat. Rev. Immunol.
5
:
521
-531.
30
Banchereau, J., R. M. Steinman.
1998
. Dendritic cells and the control of immunity.
Nature
392
:
245
-252.
31
Underhill, D. M., M. Bassetti, A. Rudensky, A. Aderem.
1999
. Dynamic interactions of macrophages with T cells during antigen presentation.
J. Exp. Med.
190
:
1909
-1914.
32
Gorak, P. M., C. R. Engwerda, P. M. Kaye.
1998
. Dendritic cells, but not macrophages, produce IL-12 immediately following Leishmania donovani infection.
Eur. J. Immunol.
28
:
687
-695.
33
Trinchieri, G..
2003
. Interleukin-12 and the regulation of innate resistance and adaptive immunity.
Nat. Rev. Immunol.
3
:
133
-146.
34
Morelli, A. E., A. T. Larregina, W. J. Shufesky, A. F. Zahorchak, A. J. Logar, G. D. Papworth, Z. Wang, S. C. Watkins, L. D. Falo, Jr, A. W. Thomson.
2003
. Internalization of circulating apoptotic cells by splenic marginal zone dendritic cells: dependence on complement receptors and effect on cytokine production.
Blood
101
:
611
-620.
35
Kruse, N., N. F. Moriabadi, K. V. Toyka, P. Rieckmann.
2001
. Characterization of early immunological responses in primary cultures of differentially activated human peripheral mononuclear cells.
J. Immunol. Methods
247
:
131
-139.
36
Sojka, D. K., D. Bruniquel, R. H. Schwartz, N. J. Singh.
2004
. IL-2 secretion by CD4+ T cells in vivo is rapid, transient, and influenced by TCR-specific competition.
J. Immunol.
172
:
6136
-6143.
37
Bajenoff, M., B. Breart, A. Y. Huang, H. Qi, J. Cazareth, V. M. Braud, R. N. Germain, N. Glaichenhaus.
2006
. Natural killer cell behavior in lymph nodes revealed by static and real-time imaging.
J. Exp. Med.
203
:
619
-631.
38
Grayson, M. H., R. S. Hotchkiss, I. E. Karl, M. J. Holtzman, D. D. Chaplin.
2003
. Intravital microscopy comparing T lymphocyte trafficking to the spleen and the mesenteric lymph node.
Am. J. Physiol.
284
:
H2213
-H2226.
39
Pellas, T. C., L. Weiss.
1990
. Deep splenic lymphatic vessels in the mouse: a route of splenic exit for recirculating lymphocytes.
Am. J. Anat.
187
:
347
-354.
40
Khanna, K. M., J. T. McNamara, L. Lefrancois.
2007
. In situ imaging of the endogenous CD8 T cell response to infection.
Science
318
:
116
-120.
41
Smith, K. M., J. M. Brewer, A. M. Mowat, Y. Ron, P. Garside.
2004
. The influence of follicular migration on T-cell differentiation.
Immunology
111
:
248
-251.
42
Matsuno, K..
1991
. Outer PALS as an immunoproliferative microenvironment.
Res. Immunol.
142
:
342
-345.
43
Villarino, A. V., J. S. Stumhofer, C. J. Saris, R. A. Kastelein, F. J. de Sauvage, C. A. Hunter.
2006
. IL-27 limits IL-2 production during Th1 differentiation.
J. Immunol.
176
:
237
-247.
44
Aichele, P., J. Zinke, L. Grode, R. A. Schwendener, S. H. Kaufmann, P. Seiler.
2003
. Macrophages of the splenic marginal zone are essential for trapping of blood-borne particulate antigen but dispensable for induction of specific T cell responses.
J. Immunol.
171
:
1148
-1155.
45
Mizoguchi, A., A. K. Bhan.
2006
. A case for regulatory B cells.
J. Immunol.
176
:
705
-710.
46
Brummel, R., P. Lenert.
2005
. Activation of marginal zone B cells from lupus mice with type A(D) CpG-oligodeoxynucleotides.
J. Immunol.
174
:
2429
-2434.
47
Pillai, S., A. Cariappa, S. T. Moran.
2005
. Marginal zone B cells.
Annu. Rev. Immunol.
23
:
161
-196.
48
Gray, M., K. Miles, D. Salter, D. Gray, J. Savill.
2007
. Apoptotic cells protect mice from autoimmune inflammation by the induction of regulatory B cells.
Proc. Natl. Acad. Sci. USA
104
:
14080
-14085.
49
Ato, M., S. Stager, C. R. Engwerda, P. M. Kaye.
2002
. Defective CCR7 expression on dendritic cells contributes to the development of visceral leishmaniasis.
Nat. Immunol.
3
:
1185
-1191.
50
Fillatreau, S., D. Gray.
2003
. T cell accumulation in B cell follicles is regulated by dendritic cells and is independent of B cell activation.
J. Exp. Med.
197
:
195
-206.
51
Hoffmann, P. R., J. A. Kench, A. Vondracek, E. Kruk, D. L. Daleke, M. Jordan, P. Marrack, P. M. Henson, V. A. Fadok.
2005
. Interaction between phosphatidylserine and the phosphatidylserine receptor inhibits immune responses in vivo.
J. Immunol.
174
:
1393
-1404.