VH replacement is a form of IgH chain receptor editing that is believed to be mediated by recombinase cleavage at cryptic recombination signal sequences (cRSS) embedded in VH genes. Whereas there are several reports of VH replacement in primary and transformed human B cells and murine models, it remains unclear whether VH replacement contributes to the normal human B cell repertoire. We identified VH→VH(D)JH compound rearrangements from fetal liver, fetal bone marrow, and naive peripheral blood, all of which involved invading and recipient VH4 genes that contain a cryptic heptamer, a 13-bp spacer, and nonamer in the 5′ portion of framework region 3. Surprisingly, all pseudohybrid joins lacked the molecular processing associated with typical VH(D)JH recombination or nonhomologous end joining. Although inefficient compared with a canonical recombination signal sequences, the VH4 cRSS was a significantly better substrate for in vitro RAG-mediated cleavage than the VH3 cRSS. It has been suggested that activation-induced cytidine deamination (AICDA) may contribute to VH replacement. However, we found similar secondary rearrangements using VH4 genes in AICDA-deficient human B cells. The data suggest that VH4 replacement in preimmune human B cells is mediated by an AICDA-independent mechanism resulting from inefficient but selective RAG activity.

Antigen receptor genes are assembled during lymphoid development by VH(D)JH recombination to generate a diversified Ig repertoire capable of recognizing any foreign Ag (1). During VH(D)JH recombination, BCRs specific for foreign and self Ags are generated and a number of mechanisms have evolved to cull the repertoire of autoreactivity. One mechanism involves secondary gene rearrangement. This mechanism for changing the specificity of self-reactive receptors involves the products of recombinase activating genes (RAG-1 and RAG-2, designated throughout as RAG1/2) that lead to the replacement of the autoreactive BCR by a secondary Ig gene rearrangement (2, 3). Receptor editing was initially thought to be a characteristic property of the L chain (3, 4), because the organization of the H chain locus would prohibit secondary rearrangements. In this regard, as a result of the initial H chain rearrangement, extra D segments are removed, thereby deleting elements with appropriately spaced heptamer/nonamer recombination signal sequences (RSS)3 and making it unlikely that secondary rearrangements would occur. However, evidence now indicates that VH replacement can occur at the H chain loci because of the presence of cryptic RSS (cRSS) embedded within VH gene segments that can be recognized by RAGs to initiate secondary gene rearrangements (5). Secondary rearrangements of VH genes have been reported in transformed murine (6, 7, 8, 9) and human (10, 11, 12, 13) B cells, murine pro-B cells (14), transgenic models with insertion of an autoreactive V(D)J rearrangement (5), murine strains (15, 16, 17, 18), human Abs (19), human tonsillar germinal center B cells (20), and B cells in rheumatoid arthritis synovium (21).

Although detection of VH replacement in experimental models and in vivo during inflammation suggested that H chain receptor editing occurred frequently, analysis of large VH databases from normal peripheral blood B cells has provided less evidence that this phenomenon occurs frequently in normal human B cells (22, 23).

In humans, nearly all VH germline genes contain a 3′ cRSS in which a heptamer but no nonamer with an appropriate spacer distance can be identified (24). Despite this, the apparent use of the IGHV1–69 gene and other VH genes with isolated heptamers for secondary rearrangements has been reported in rheumatoid arthritis synovial fluid (21). Other examples of secondary rearrangements using VH genes with minimal cRSS were identified in VH4 family transcripts of IgD+ germinal center cells from tonsil (20). Moreover, a human B cell line has been shown to undergo secondary VH replacement between similar or different VH gene families, each containing an isolated 3′ heptamer, and this process appears to be RAG-mediated (11). More recently, in vitro assays using a complete cRSS consisting of a heptamer, a 13-bp spacer, and a nonamer identified from a germline IGHV4–34 gene appeared to permit RAG-mediated cleavage (25). Although this cRSS contained more of the essential elements (heptamer/spacer/nonamer sequence) necessary for recombination than those previously reported to be involved in VH secondary rearrangements, there is no 23-bp cRSS and, as a result, RAG-mediated recombination would be expected to be inefficient. Moreover, the coding region of the RAG-mediated recombination that is maintained in the compound rearrangement would be a pseudohybrid join, because the cRSS of each VH gene is in the same heptamer/nonamer orientation and the recombined product retains one of the cRSS sequences.

Because of the irregular features of the compound rearrangements, their putative abundance in somatically mutated B cells, and the possibility of PCR errors contributing to their apparent identification in some cases, it has been have suggested that another mechanism for initiating double-strand breaks, such as activation-induced cytidine deaminase (AICDA), might be responsible for secondary VH gene rearrangements (26). AICDA, which is required for gene conversion and class switching (27), may therefore also contribute to VH replacement. The recent demonstration that AICDA is expressed during murine B cell ontogeny (28) supports a possible role for this enzyme in mediating VH replacement in developing B cells.

Because most receptor editing in the mouse occurs early during B cell development and the similarity of human VH genes can lead to ambiguity in identification of genes when mutations are present, we generated a database of human fetal and unmutated mature human B cells to explore the occurrence, frequency, and possible mechanism of VH replacement in normal B cells. The data provide clear evidence of VH replacement between VH4 genes in developing fetal B cells as well as in naive peripheral B cells in the adult. Even though examination of sequences suggested that secondary rearrangements might also be possible among members of other VH families because some contained a complete RSS with a 13-bp spacer, only VH4 hybrids were identified. In vitro assays using the VH4 and VH3 cRSS revealed less efficient RAG binding and cleavage when compared with a consensus RSS; yet, site-specific cleavage products were evident in the VH4 substrates, suggesting that VH4 compound rearrangements could be RAG-mediated. Moreover, AICDA did not appear to be required because compound VH4 rearrangements were recovered from AICDA-deficient B cells. In summary, secondary replacement of VH genes limited to VH4 family members was detected in fetal and naive human B cells. The evidence suggests that these secondary rearrangements are likely to arise by AICDA-independent, RAG-dependent pseudohybrid joining and may be an additional mechanism for generating repertoire diversity in normal B cells.

Single-cell preparations were made from peripheral blood of four normal donors, seven X-linked hyper-IgM (X-HIgM) patients, and three AICDA-deficient patients as described previously (22, 29, 30) and were sorted into CD19+, CD19, CD19+IgM+, CD19+IgD+CD27+, or CD19+IgDCD27+ populations. Fetal liver and fetal bone marrow were obtained at 18 wk of gestation. All tissue collections and processing were done in accordance with policies established by the Institutional Review Board for Human Experimentation at the University of Texas Southwestern Medical Center (Dallas, TX) and the National Institutes of Health (Bethesda, MD). Fetal liver cells were mechanically disrupted into tissue fragments followed by filtration through nylon mesh. Fetal bone marrow cells were flushed from long bone specimens. Mononuclear cells were enriched by Ficoll-Hypaque density gradient centrifugation as described (22). The cells were then stained with PE-labeled anti-CD19 mAb (BD Pharmingen), FITC labeled anti-IgM (Caltag), anti-CD27-PE, and isotype controls (BD Pharmingen) using a FACStarPlus flow cytometer (BD Pharmingen) outfitted with an automated single-cell deposition unit. One cell was deposited into each well of a 96-well PCR plate assembled on a microAmp base (PerkinElmer) as described previously (22). In some experiments, the CD19+ and CD19 B cells were diluted into aliquots of ∼1 cell into 96-well microtiter plates. Normal donor cells were sorted into CD19+IgM+, CD19+IgD+CD27+ preswitch, or CD19+IgDCD27+ postswitch populations. X-HIgM B cells were sorted into CD19+ or CD19 populations and AICDA-deficient B cells were CD19+ populations. The fetal B cells were sorted into CD19+IgM+ and CD19+IgM populations.

A single cell in 10 μl of PCR buffer (10 mM NaCl and 5 mM Tris-HCl (pH 8) at 25°C with 0.1% Triton X-100) containing 0.4 mg/ml proteinase K (Sigma-Aldrich) was incubated for 1 h at 55°C, and the enzyme was inactivated by heating at 95°C for 10 min. Primer extension linear preamplification using random 15-mers and 60 rounds of amplification with Taq polymerase (Promega) was performed to produce sufficient DNA for multiple subsequent DNA amplifications. Rearranged VH(D)JH genes were then amplified as described previously (22). Preferential amplification of IGHV4-59 was performed in CD19 cells with external forward (5′-ACATCTGTGGTTCTTCCTTCTC-3′) and reverse (5′-ACGGAGGTTTTTGTCTGGGC-3′) primers and nested forward (5′-TCACTGTGGGTCTCTCTGTTCA-3′) and reverse (5′-TCCCCTCACTGTGTCTCTC-3′) primers. The maximum PCR error rate for this method using linear genomic amplification followed by nested PCR is <0.008%. This rate is based upon finding two mutations per 25,986 bp in VH4 genes analyzed from non-B cells (30) and six mutations per 75,000 bp in a non-Ig gene analyzed from B cells (31). Thus, few if any of the nucleotide changes encountered in this analysis can be ascribed to PCR amplification errors.

PCR products were separated by electrophoresis on a 1.5% Seakem agarose gel (FMC Bioproducts) and purified using GenElute agarose spin columns (Supelco or Edge Biosystems). Purified products were directly sequenced using the ABI Prism dye termination cycle sequencing kit (PerkinElmer) and analyzed with an automated sequencer (ABI Prism 377; Applied Biosystems). For identification of the germline IGHV gene segments, JoinSolver (32) or the V BASE sequence directory was used in conjunction with the software programs Sequencher (Gene Codes) and DNASTAR (DNASTAR). GenBank accession nos. for the normal donor sequences are X87006–X87089, Z80363Z80770 (excluding Z80606 and Z80679), EF542547EF542687, and EF542688-EF542796; for X-HIgM the GenBank accession nos. are AF077410AF077525, EF542103EF542275, EF541488EF542102, and EF542315EF542546; and for AICDA deficiency the GenBank accession nos. are EU237493EU238970). A total of 53 sequences were obtained from fetal liver (GenBank accession nos. AY582384AY582435) and 72 sequences were obtained from fetal bone marrow.

Initially, sequences were considered candidates for H chain secondary rearrangement if there was a 5′ region with extensive nucleotide matching to a germline gene and a 3′ region with mismatches. When the alignment analysis was repeated using only the 3′ region of the VH, the finding of an alignment to another gene in the database without mismatches suggested the presence of a compound rearrangement in which one VH gene had invaded another. The accession numbers for all of the VH compound rearrangements are listed in Table I.

Table I.

GenBank accession numbers for VH compound rearrangements

FetalX-HIgMAICDA−/−Normal Donors
AY013306 AF077496 EU237512 EF542609 
AY013307 AF077502 EU237526 EF542612 
AY013308 AF077509 EU237977 EF542614 
 AF077514 EU237990 EF542628 
 AF077518 EU238008 EF542636 
 EF541548 EU238013 EF542650 
 EF541594 EU238030 EF542652 
 EF541595 EU238206 EF542752 
 EF541597 EU238230 EF542753 
 EF541598 EU238238 EF542758 
 EF541613 EU238589 Z80390 
 EF541681 EU238597 Z80398 
 EF541693 EU238603 Z80558 
 EF541708 EU238634 Z80563 
 EF541774 EU238650 Z80735 
 EF541861 EU238660 Z80741 
 EF541884 EU238661 X87083 
 EF541983 EU238665 X87081 
 EF541985 EU238673 X87077 
 EF542024 EU238682  
 EF542038 EU238685  
 EF542104 EU238694  
 EF542108 EU238849  
 EF542122 EU238861  
 EF542172   
 EF542181   
 EF542195   
 EF542203   
 EF542325   
FetalX-HIgMAICDA−/−Normal Donors
AY013306 AF077496 EU237512 EF542609 
AY013307 AF077502 EU237526 EF542612 
AY013308 AF077509 EU237977 EF542614 
 AF077514 EU237990 EF542628 
 AF077518 EU238008 EF542636 
 EF541548 EU238013 EF542650 
 EF541594 EU238030 EF542652 
 EF541595 EU238206 EF542752 
 EF541597 EU238230 EF542753 
 EF541598 EU238238 EF542758 
 EF541613 EU238589 Z80390 
 EF541681 EU238597 Z80398 
 EF541693 EU238603 Z80558 
 EF541708 EU238634 Z80563 
 EF541774 EU238650 Z80735 
 EF541861 EU238660 Z80741 
 EF541884 EU238661 X87083 
 EF541983 EU238665 X87081 
 EF541985 EU238673 X87077 
 EF542024 EU238682  
 EF542038 EU238685  
 EF542104 EU238694  
 EF542108 EU238849  
 EF542122 EU238861  
 EF542172   
 EF542181   
 EF542195   
 EF542203   
 EF542325   

DNA substrates were made by annealing PAGE-purified DNA oligonucleotides. The top or bottom strand was labeled at the 3′ using cordycepin 5′ triphosphate (PerkinElmer) and TdT (New England Biolabs) before annealing. Unincorporated label was removed using Micro Bio-Spin P-6 columns (Bio-Rad). The sequences of cRSS within the human IGHV3-23 gene (CCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACTCGCTGT) and IGHV4-59 gene (CCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACC AGT TCT) and complementary strands were synthesized (predicted heptamer and nonamer sequences are underlined). The sequences of the consensus 12RSS substrate (DAR39 and DAR40), 23RSS substrate (DG61 and DG62) and a nonspecific (NS) 50-bp substrate with scrambled heptamer and nonamer sequences (DAR81 and DAR82) have been previously described (33).

Truncated high mobility group (HMG) box 1 (HMGB1) (34) and recombinant core RAG1 and core RAG2 proteins (coexpressed as fusions with maltose-binding protein) were expressed and purified as described elsewhere (33).

Ten-microliter binding reactions containing 10 ng/μl RAG1/2, 2 nM labeled DNA, 100 nM NS DNA, and 2 ng/ml HMGB1 were incubated for 10 min in a buffer comprising 25 mM MOPS-KOH (pH 7), 30 mM KCl, 1% glycerol, 0.1 mg/ml BSA, 2 mM CaCl2, and 4 mM DTT. Paired complexes were formed by adding 6.25 nM 23RSS to the reaction after 5 min. Complexes were loaded on a native 6% polyacrylamide gel in 20% glycerol (35).

Cleavage assays were catalyzed by the addition of 1 mM MnCl2 or 4 mM MgCl2 for 2 h at 37°C using 40 ng/μl RAG with the same buffer and DNA and HMGB1 concentrations as above, and also included 100 nM NS DNA (DAR81/82). In these reactions the RAG1/2 concentration was 40 ng/μl. Products were separated on 12.5% Tris-borate EDTA (TBE)-urea polyacrylamide gel that was visualized and analyzed using a Molecular Dynamics Typhoon Storm 860 PhosphorImager with ImageQuant 5.1 software (GE Healthcare). An oligonucleotide matching the expected IGHV4-59 (or IGHV4-b) product when it is cleaved 5′ of the putative heptamer was synthesized and used as a size marker. The percentage of binding and cleavage was calculated from the signal in the band of the expected size divided by the total signal in each lane.

The two-tailed Student t test was used to determine differences between the binding and cleavage of NS DNA, IGVH3-23 and IGHV4-59 cRSS substrates and p values ≤0.05 were considered significant.

Because of the reports of VH replacement in tonsillar (20) and synovial B cells (21), we generated a database of 105 nonproductive and 643 productive naive preswitch and postswitch B cells from normal donor peripheral blood to identify the frequency of VH replacement. Several normal donor sequences appeared to be candidates for intrachromosomal VH replacement, but the presence of mutation made it difficult to identify the VH genes that recombined accurately. Of the 748 sequences from adult naive and memory B cells examined, we were unable to identify VH replacements such as those described in mutated tonsillar B cell clones (20) or synovial fluid B cells (21). However, irregularities in the variable segments similar to those reported by others (36) were found. Insertions and deletions consisting of one or several nucleotides that have been associated with somatic hypermutation occurred in 16/741 (2%) of the normal donor rearrangements (data not shown). The current data extends the previous reports by noting one unmutated sequence (Z80532) with a single nucleotide deletion. In addition, insertions and deletions, which were found in framework regions (FRs) as well as CDRs, were not predominantly triplets or multiples of triplets as described in previous reports (36) and thus were more frequent in nonproductive (8/105, 7.6%) than in productive (8/643, 1.2%) rearrangements.

Several IGHV4-59 sequences with unique CDR3s in the normal donors had two identical mismatches in FR3 that were initially presumed to represent a new allelic variant of IGHV4-59. As discussed below, these appeared to be compound rearrangements in which a 5′ IGHV4-59 gene invaded a downstream IGHV4-b-DJH rearrangement.

It was apparent that sequences with evidence of VH gene replacement were uncommon in the normal adult B cell repertoire consisting of both naive and memory B cells. Because most of the murine examples of VH replacement occurred in early progenitor B cells (14) and the similarity between human VH genes made gene identification ambiguous when the sequence was mutated, we created a database from isolated CD19+IgM+ and CD19+IgM B cells from fetal liver and fetal bone marrow and CD19+ B cells from X-HIgM donors in which the B cells are intrinsically normal but unable to undergo somatic hypermutation (SHM).

During the analysis of VH(D)JH arrangements from fetal B cells, we encountered several potential examples of VH replacement. One sequence from a total of 53 CD19+IgM pro/pre-B cells from fetal liver and two different sequences from a total of 72 CD19+IgM+ immature B cells from fetal bone marrow consisted of a 5′ region from one VH gene and the 3′ region from a second VH gene (Fig. 1). Using these criteria, the frequency of VH gene replacement was ∼3/26 (12%) of the VH4 repertoire. It is notable that all of these sequences consisted of secondary rearrangements of VH4 gene segments into VH4 rearrangements. One sequence from fetal liver CD19+/IgM pre/pro-B cells consisted of a compound rearrangement containing IGHV4-04 and an upstream IGHV4-39 (Fig. 1,A). Two compound rearrangements from fetal bone marrow CD19+/IgM+ immature B cells contained potential pseudohybrid joins between IGHV4-b and IGHV4-59 and consisted of an initial IGHV4-b-DJH rearrangement in which the portion of the sequence upstream of the cRSS was replaced by IGHV4-59 (Fig. 1 B). Each of these rearrangements was unique, as the CDR3s were distinct.

FIGURE 1.

VH compound rearrangements from immature fetal and mature B cells. Three examples of compound rearrangements with pseudohybrid joins found in fetal VH rearrangements are shown. The open arrowheads mark the proposed junction between the two VH genes. At the junction of the two VH genes, cRSS (heptamer/13-bp spacer/nonamer), which matches the canonical RSS, is underlined. The canonical RSS is shown (#) for comparison. Asterisks mark deletional differences between the two germline genes (IGHV4-04/IGHV4-39 and IGHV4-b/IGHV4-59). A, Compound rearrangement (VH FL3-3.4.4G) isolated from 18-wk fetal liver CD19+IgM B cells. The hybrid molecule consists of IGHV4-39 upstream of the cRSS and IGHV4-04 downstream. B, Two VH compound rearrangements (FM1-2.4.2G and FM1-2.4.12A) isolated from 18-wk fetal bone marrow CD19+IgM+ B cells. Both consist of IGHV4-59 upstream of the cRSS and IGHV4-b downstream.

FIGURE 1.

VH compound rearrangements from immature fetal and mature B cells. Three examples of compound rearrangements with pseudohybrid joins found in fetal VH rearrangements are shown. The open arrowheads mark the proposed junction between the two VH genes. At the junction of the two VH genes, cRSS (heptamer/13-bp spacer/nonamer), which matches the canonical RSS, is underlined. The canonical RSS is shown (#) for comparison. Asterisks mark deletional differences between the two germline genes (IGHV4-04/IGHV4-39 and IGHV4-b/IGHV4-59). A, Compound rearrangement (VH FL3-3.4.4G) isolated from 18-wk fetal liver CD19+IgM B cells. The hybrid molecule consists of IGHV4-39 upstream of the cRSS and IGHV4-04 downstream. B, Two VH compound rearrangements (FM1-2.4.2G and FM1-2.4.12A) isolated from 18-wk fetal bone marrow CD19+IgM+ B cells. Both consist of IGHV4-59 upstream of the cRSS and IGHV4-b downstream.

Close modal

When the gene locus relationship was analyzed between the VH genes forming the compound rearrangements, the VH gene introduced into the initial VH(D)JH rearrangement was found to be 5′ of the VH gene involved in initial VH(D)JH recombination in each. IGHV4-39 is located ∼400 kb upstream of IGHV4-b. In each of these VH4 compound rearrangements we were able to identify cRSS sequences in the region where the pseudohybrid junction may have potentially occurred. The cRSS sequences consisted of a heptamer (5′-CACCATA-3′), a 13-bp spacer, and a nonamer (5′-CCAAGAACC-3′) that was embedded in the conserved FR3 region of the VH4 gene family between ImMunoGeneTics (IMGT) codon 76 and 86. We were unable to identify RSS sequences containing a spacer of between 20 and 25 bp.

Having found compound rearrangements in fetal VH4 sequences, we expanded the search for these rearrangements to B cells from other sources. B cells from X-HIgM patients provide another source of unmutated B cells. When all X-HIgM VH4 rearrangements were examined, 28/327 sequences consisted of IGHV4-59/IGHV4-b and one X-HIgM sequence was an IGHV4-59/IGHV4–34 compound rearrangement (Table II). These compound rearrangements represented 29/327 (8.9%) of the X-HIgM VH4 repertoire.

Table II.

Human B cell VH(D)JH compound rearrangements with pseudohybrid joinsa

No. of RearrangementsB Cell SourceInvading GeneRecipient Gene
Fetal liver pre/pro-CD19+IgM VH4-39 VH4-4 
Fetal marrow immature CD19+IgM+ VH4-59 VH4-b 
28 X-HIgM mature CD19+ VH4-59 VH4-b 
X-HIgM mature CD19+ VH4-59 VH4-34 
24 AICDA deficient CD19+ VH4-59 VH4-b 
No. of RearrangementsB Cell SourceInvading GeneRecipient Gene
Fetal liver pre/pro-CD19+IgM VH4-39 VH4-4 
Fetal marrow immature CD19+IgM+ VH4-59 VH4-b 
28 X-HIgM mature CD19+ VH4-59 VH4-b 
X-HIgM mature CD19+ VH4-59 VH4-34 
24 AICDA deficient CD19+ VH4-59 VH4-b 
a

A total of 53 fetal liver, 72 fetal bone marrow, and 327 X-HIgM rearrangements were analyzed for pseudohybrid joins. An additional 284 AICDA-deficient VH4 B cell rearrangements were analyzed specifically for VH4-59/4b pseudohybrid joins.

The IGHV4-59/IGHV4-b compound rearrangements differ from the IGHV4-59*01 germline sequence by only two nucleotide mismatches in FR3. To exclude the possibility that this was not an allelic variant of IGHV4-59, the VH4 locus was amplified from CD19 non-B cells isolated from the same X-HIgM donor in which the IGHV4-59/IGHV4-b compound rearrangements had been identified in CD19+ B cells. A nested PCR approach was chosen to amplify genomic IGHV4-59 from individual cells preferentially. Of 96 PCR products, 71 matched the IGHV4-59 germline sequence and none of these sequences contained a T→C and G→A substitution in IMGT codons 96 and 97, respectively (Table III). The remaining amplifications yielded PCR products of other germline VH4 genes. The IGHV4-59 PCR products from CD19 cells demonstrate that the IGHV4-59 sequence with the two single bp substitutions is not an allelic form of IGHV4-59 and indicate that the source of these two FR3 substitutions in IGHV4-59 sequences is from a secondary rearrangement in which IGHV4-59 invaded a primary VH(D)JH rearrangement using the IGHV4-b gene.

Table III.

Frequency of IGHV4-59 products from CD19 cells

GeneCD19CD19+
IGHV4-b 
IGHV4-04 1/96 (1%) 7/55 (13%) 
IGHV4-34 24/96 (25%) 12/55 (22%) 
IGHV4-39 12/55 (22%) 
IGHV4-59 71/96 (74%) 12/55 (33%) 
VH4 hybrids 7/69 (10%) 
GeneCD19CD19+
IGHV4-b 
IGHV4-04 1/96 (1%) 7/55 (13%) 
IGHV4-34 24/96 (25%) 12/55 (22%) 
IGHV4-39 12/55 (22%) 
IGHV4-59 71/96 (74%) 12/55 (33%) 
VH4 hybrids 7/69 (10%) 

CD19 and CD19+ cells were isolated from PBMCs from a single donor. Nested PCR reactions were performed on both populations. The nested primers used on the CD19+ cells were designed to amplify all rearranged VH4 genes and the nested primers used on the CD19 cells preferentially amplified unrearranged IGHV4-59 gene segments in the H chain locus.

Because we were able to confirm that IGHV4-59 sequences with a T→C and G→A substitution in IMGT codons 96 and 97, respectively, were compound rearrangements, we searched for this specific compound rearrangement in the normal donor database. In total, 16/199 (8.0%) VH4 rearrangements with unique CDR3s had 5′ VH alignments to IGHV4-59*01 and 3′ VH segment alignments to the IGHV4-b germline sequence. Of these 16 sequences, six had no mismatches other than the two substitutions that are characteristic of the IGHV4-59/4-b compound rearrangement from the unmutated repertoire (X-HIgM), six sequences had ≤5 mutations, and four had eight or 17 mutations. Therefore, these VH4 replacements can be found in the normal naive repertoire and B cells expressing these compound rearrangements can undergo SHM.

Because of the absence of any molecular processing at the pseudohybrid join, most compound rearrangements were productive. However, 7/56 compound rearrangements (12.5%) were nonproductive (Table IV). Two compound rearrangements from normal donors and one from the X-HIgM database had productive rearrangements that were nonfunctional because they used a D segment reading frame containing a stop codon. Three other X-HIgM compound rearrangements were nonproductive as a consequence of exonuclease and TdT activities that generated an out-of-frame JH segment and/or a stop codon in the DJH junction. The nonproductive compound rearrangements were unmutated. Moreover, because the pseudohybrid join in the compound rearrangement lacked any molecular processing, they appeared to be nonproductive as a result of VH(D)JH recombination.

Table IV.

The CDR3 sequence of nonproductive compound rearrangementsa

SourceAccession No.FunctionalityCodon 104CDR3 DNA Sequence
VHNDNJH
ND EF542652 Stop codon in D segment TGT GCGAGA- - CATGGA CGCCAC G - - - - - - -GGTGGTAA- - - - TTCTG - - - -CTTTGACTAC 
ND EF542614 Stop codon in D segment TGT GCGAGA- - CTTACTC - - - -TATTGTAGGAGT ACAGCTG- - - - - - - GTAAGTC - - -AC TGGTTCGAC CCC 
X-HIgM EF541613 Stop codon in D segment TGT GCGAGA- - CGGGGT ACT AGGATATTGTAGTAGTACCAG CTGC- GC - - -TATACGCT GC TTTTGATATC 
X-HIgM EF541884 Stop codon in DJH junction TGT GCGAGA- - CAAAGAGGGT GGAC -TACCAGCTGCT- - - - - - - - - TATGATGAGT GGGG - -TACTACTACTACTAC GGTATGGACGTC 
X-HIgM EF542038 Stop codon in DJH junction and JH is out of frame TGT GCGAGA- - CCC GTATTACGATTTTT GGAGTGG TTA- - - - - - - GTCTATTG - - -ACTACTACTACTACGG TATGGACGTC 
X-HIgM EF542108 JH is out of frame TGT GCGA- - - CCTG GGGTATAGCAGT GGCTGG- - - CC - - - - - - - - - - - - - - - -CTC 
AICDA−/− EU238603 Stop codon in VD junction and JH is out of frame TGT - - - - - - - - GACAC GTATTACTATGGT TCGGGGAGTCAT TAT- - - TCCATTCG ACTACTACTACTACATGG ACGTC 
SourceAccession No.FunctionalityCodon 104CDR3 DNA Sequence
VHNDNJH
ND EF542652 Stop codon in D segment TGT GCGAGA- - CATGGA CGCCAC G - - - - - - -GGTGGTAA- - - - TTCTG - - - -CTTTGACTAC 
ND EF542614 Stop codon in D segment TGT GCGAGA- - CTTACTC - - - -TATTGTAGGAGT ACAGCTG- - - - - - - GTAAGTC - - -AC TGGTTCGAC CCC 
X-HIgM EF541613 Stop codon in D segment TGT GCGAGA- - CGGGGT ACT AGGATATTGTAGTAGTACCAG CTGC- GC - - -TATACGCT GC TTTTGATATC 
X-HIgM EF541884 Stop codon in DJH junction TGT GCGAGA- - CAAAGAGGGT GGAC -TACCAGCTGCT- - - - - - - - - TATGATGAGT GGGG - -TACTACTACTACTAC GGTATGGACGTC 
X-HIgM EF542038 Stop codon in DJH junction and JH is out of frame TGT GCGAGA- - CCC GTATTACGATTTTT GGAGTGG TTA- - - - - - - GTCTATTG - - -ACTACTACTACTACGG TATGGACGTC 
X-HIgM EF542108 JH is out of frame TGT GCGA- - - CCTG GGGTATAGCAGT GGCTGG- - - CC - - - - - - - - - - - - - - - -CTC 
AICDA−/− EU238603 Stop codon in VD junction and JH is out of frame TGT - - - - - - - - GACAC GTATTACTATGGT TCGGGGAGTCAT TAT- - - TCCATTCG ACTACTACTACTACATGG ACGTC 
a

All of the nonproductive compound rearrangements from each database are displayed. The reading frame for each CDR3 is derived from the primary IGHV4-b-DJH rearrangements. Stop codons are in bold face type, dashes (- - -) represent nucleotides excised from germline genes during recombination and N represents nontemplated nucleotides inserted by TdT. ND, normal donor.

The cRSS from IGHV4-59 has 4/7 of the canonical heptamer bases, 6/9 of the canonical nonamer bases, and a 13-bp spacer instead of one of 12 bp. The IGHV3-23 cRSS that was used as a control has a heptamer and nonamer that is identical with that of IGHV4-59 except for the last nucleotide in each, but there is only 60% homology in the spacer and flanking sequences. To determine whether these RSSs could be cleaved by RAG1/2s, in vitro binding and cleavage assays were conducted. An electrophoretic mobility assay was used to determine the binding of recombinant RAG1/2 proteins to IGHV4-59 and IGHV3-23 cRSS DNA substrates, which also contained 16 bp of the IGHV4-59 or IGHV3-23 sequence 5′ of the putative heptamer. The amount of the RAG-cRSS complex observed in the native gel was compared with that obtained with an optimal 12-bp RSS substrate and a NS substrate of similar length (50 bp) with no heptamer or nonamer sequences. Fig. 2 demonstrates that the RAG1/2 protein recognized the IGHV4-59 sequence, albeit with a reduced affinity as compared with the control 12-bp RSS substrate. Quantification of the complexes indicated that the IGHV4-59 cRSS bound RAG significantly (p = 0.05) more effectively than the IGHV3-23 cRSS.

FIGURE 2.

EMSA of core RAG proteins binding to radiolabeled standard (12RSS), cRSS (from VH3-23 and VH4-59), and NS DNA substrates. Stable RAG-DNA single complexes (SC) migrated more slowly than DNA-HMGB1 (HMG) complexes and free DNA (RSS). The results shown are from one of three different binding assays from which the DNA in a single complex was quantified. The mean and SE of the percentage of DNA found in a RAG complex was 5.7 ± 1.4 for NS DNA, 6.6 ± 1.4 for VH3-23, 10.3 ± 1.1 for VH4-59, and 40.5 ± 7.6 for 12RSS. Significant differences were found when comparing the SC involving IGHV4-59 (p = 0.03) vs NS DNA and IGHV3-23 vs IGHV4-59 (p = 0.05). RSS* denotes the mobility of each radiolabeled unbound RSS.

FIGURE 2.

EMSA of core RAG proteins binding to radiolabeled standard (12RSS), cRSS (from VH3-23 and VH4-59), and NS DNA substrates. Stable RAG-DNA single complexes (SC) migrated more slowly than DNA-HMGB1 (HMG) complexes and free DNA (RSS). The results shown are from one of three different binding assays from which the DNA in a single complex was quantified. The mean and SE of the percentage of DNA found in a RAG complex was 5.7 ± 1.4 for NS DNA, 6.6 ± 1.4 for VH3-23, 10.3 ± 1.1 for VH4-59, and 40.5 ± 7.6 for 12RSS. Significant differences were found when comparing the SC involving IGHV4-59 (p = 0.03) vs NS DNA and IGHV3-23 vs IGHV4-59 (p = 0.05). RSS* denotes the mobility of each radiolabeled unbound RSS.

Close modal

The ability of RAG proteins to catalyze a double-strand break at the cRSS was also assessed. Physiologically, Mg2+ is likely to be the relevant cation, as this ion restricts RAG cleavage to obey the 12/23 rule by permitting double-strand breaks to occur only in the presence of 12-bp RSS and 23-bp RSS in the RAG-DNA complex (37, 38, 39). When one RSS is present, the RAG proteins are only able to catalyze a nick 5′ of the heptamer in the presence of Mg2+. When Mn2+is used instead of Mg2+, double-strand breaks can be detected in the absence of 23-bp RSS. To monitor nicking in the presence of Mg2+ in the current study, the top strand of the substrate was labeled at the 3′ end and the assay was conducted in the presence of an unlabeled 23-bp RSS. No significant levels of nicking of the cryptic sequences were detected (p = 0.06) for either IGHV3-23 or IGHV4-59 cRSS when compared with the control 12-bp RSS (Fig. 3,B). When the more permissive Mn2+ ion was used, more appreciable amounts of nick product of the IGHV4-59 substrate were detected (Fig. 3 A). Nicking of the IGHV4-59 substrate was found to be significantly greater than that of NS DNA (p = 0.02), whereas nicking of the IGHV3-23 substrate was not (p = 0.20). The efficiency of RAG cleavage of the IGHV4-59 substrate varied among replicate assays (17–50% of the control 12RSS). Importantly, however, nicking of the IGHV4-59 cRSS was consistently and significantly (p = 0.03) greater than that of the IGHV3-23 cRSS. We also found that the nicked cRSS was smaller than the expected size for cleavage at the heptamer border, agreeing with previous reports that nicking on certain cRSSs occurred 1–2 nt into the cryptic heptamer (25).

FIGURE 3.

Cleavage of cRSS by RAG proteins. Standard, cryptic, and NS DNA substrates were 3′-labeled (∗) on top or bottom strands. Expected nick (35 nt) and nick-nick (16 nt) products were run in the molecular weight (MW) lane to compare the actual nick sizes. Hairpin products were of various sizes. Reactions included an excess of unlabeled NS DNA and Mn2+ (A) and 23RSS and Mg2+ (B). The filled arrowhead indicates the nick product. The results are representative of seven nicking assays in the presence of Mn2+and four experiments using Mg2+. In the presence of Mg2+, the mean and SE of the cleavage product expressed as the percentage of total DNA in the lane appearing in the band of the expected size (34 bp) was 4.6 ± 1.8 for NS DNA, 6.2 ± 2.2 for VH3-23, 9.1 ± 3.2 for VH4-59, and 62.8 ± 15.7 for 12RSS. In the presence of Mn2+, the mean ± SE of the cleavage product was 7.6 ± 1.9 for NS DNA, 9.4 ± 2.1 for VH3-23, 17.3 ± 4.6 for VH4-59, and 57.0 ± 7.3 for 12RSS. Significant differences were found in RAG-mediated cleavage of IGHV4-59 vs NS DNA (p = 0.02) and IGHV3-23 vs IGHV4-59 (p = 0.03) in the presence of Mn2+.

FIGURE 3.

Cleavage of cRSS by RAG proteins. Standard, cryptic, and NS DNA substrates were 3′-labeled (∗) on top or bottom strands. Expected nick (35 nt) and nick-nick (16 nt) products were run in the molecular weight (MW) lane to compare the actual nick sizes. Hairpin products were of various sizes. Reactions included an excess of unlabeled NS DNA and Mn2+ (A) and 23RSS and Mg2+ (B). The filled arrowhead indicates the nick product. The results are representative of seven nicking assays in the presence of Mn2+and four experiments using Mg2+. In the presence of Mg2+, the mean and SE of the cleavage product expressed as the percentage of total DNA in the lane appearing in the band of the expected size (34 bp) was 4.6 ± 1.8 for NS DNA, 6.2 ± 2.2 for VH3-23, 9.1 ± 3.2 for VH4-59, and 62.8 ± 15.7 for 12RSS. In the presence of Mn2+, the mean ± SE of the cleavage product was 7.6 ± 1.9 for NS DNA, 9.4 ± 2.1 for VH3-23, 17.3 ± 4.6 for VH4-59, and 57.0 ± 7.3 for 12RSS. Significant differences were found in RAG-mediated cleavage of IGHV4-59 vs NS DNA (p = 0.02) and IGHV3-23 vs IGHV4-59 (p = 0.03) in the presence of Mn2+.

Close modal

Mn2+ also allows the formation of hairpins to occur in the absence of the 23-bp RSS (37, 38, 39). Therefore, we examined the formation of breaks in the bottom strand as well. The control 12-bp RSS substrate formed the hairpin product efficiently, whereas the IGHV3-23 and IGHV4-49 substrates yielded several minor products. Of note, the IGHV4-59 substrate resulted in a product of the expected size of a longer hairpin made at the abnormal nick position. No major product resembling a nicked bottom strand (16–18 nt) was formed under these conditions, as reported in a previous in vitro study of cRSS cleavage (25). Poor hairpinning activity of these cRSSs in Mn2+ may have been influenced by inappropriate flanking nucleotides, as it is known that certain bases bordering the heptamer hinder the subsequent hairpin formation catalyzed by Mn2+ (40). Indeed, when the coding flank of the optimal 12RSS was replaced with the coding flank of cRSS, IGHV3-23 or IGHV4-59 (ending TT or GT, both known to be nonoptimal flanks), a reduction of hairpinning was observed, particularly with IGHV4-59 (Fig. 4). Thus, the influence of flanking dinucleotides decreased the capacity of RAG to form the IGHV4-59 hairpin product.

FIGURE 4.

The coding flank reduces hairpin formation. A substrate was prepared in which the 12RSS flanking sequence was replaced with either the IGHV4-59 flank (4F) or the IGHV3-23 flank (3F) to determine the effect of flank residues on RAG cleavage in the presence of Mn+2. A consensus 12RSS and the IGHV3-23 and IGHV4-59 substrates were 5′-labeled (∗) on the top strand with T4 polynucleotide kinase. A supportive flank sequence ends in YR. The IGHV4-59 flank ending in GT is considered an unsupportive flank (RY) and results in reduced hairpinning. Hairpinning on the IGHV3-23 flank, which ends in TT (YY), was less severely inhibited but yielded an unusually short hairpin. The hairpin and nick products are indicated.

FIGURE 4.

The coding flank reduces hairpin formation. A substrate was prepared in which the 12RSS flanking sequence was replaced with either the IGHV4-59 flank (4F) or the IGHV3-23 flank (3F) to determine the effect of flank residues on RAG cleavage in the presence of Mn+2. A consensus 12RSS and the IGHV3-23 and IGHV4-59 substrates were 5′-labeled (∗) on the top strand with T4 polynucleotide kinase. A supportive flank sequence ends in YR. The IGHV4-59 flank ending in GT is considered an unsupportive flank (RY) and results in reduced hairpinning. Hairpinning on the IGHV3-23 flank, which ends in TT (YY), was less severely inhibited but yielded an unusually short hairpin. The hairpin and nick products are indicated.

Close modal

To investigate the action of RAG on cRSS where nonoptimal flank effects were operative, we included a 23RSS partner in the presence of Mg+2. However, only small amounts of nick product on the top strand were detected and no hairpin product was detected (Fig. 3 B). Similarly, no alternative cleavage site on the bottom strand was detected.

Studies identifying AICDA-targeted motifs (RGYW/WRCY; R = A/G, Y = C/T, W = A/T) near hybrid junctions (26) have led to the suggestion that secondary VH rearrangements may be dependent on AICDA activity. To examine this possibility, we initially determined the frequency of AICDA-targeted motifs in the putative region of pseudohybrid joins that corresponds to the region between FR3 IMGT codons 69 and 96. After normalizing the data for the total number of nucleotides in the region in all VH3 vs VH4 genes, we found 23 and 61 RGYW and WRCY motifs, respectively, in the VH3 family compared with 51 and 83 RGYW and WRCY motifs in the VH4 family (data not shown). Thus, the likelihood of AICDA-mediated VH replacement overall may be as much as 1.6-fold greater in VH4 genes than in VH3 genes. To determine the role of AICDA in the formation of compound rearrangements in human B cells, we analyzed 284 VH4 rearrangements that were directly amplified from genomic DNA isolated from individual CD19+ AICDA-deficient B cells. Twenty-four of these sequences with unique CDR3s had a compound IGHV4-59/IGIGHV4-b rearrangement, providing evidence that these VH replacements were not dependent on AICDA (Table II).

We identified VH replacement involving VH4 genes from human fetal liver, fetal bone marrow, and the peripheral blood of normal donors, X-HIgM and AICDA-deficient patients. Using CD19 non-B cells, we confirmed that the IGHV4-59/4-b pseudohybrid join, which was found in all populations analyzed except fetal liver and differs from germline IGHV4-59*01 by only two single nucleotide mismatches in FR3, was not an allelic variant of IGHV4-59. When these IGHV4-59 rearrangements were originally sequenced, X87091 was in fact submitted to GenBank as a new polymorphism of VH4-59/DP71 that was later designated as IGHV4-59*08 by IMGT, the international ImMunoGeneTics information system (41). However, the current study clearly indicates that these rearrangements represent VH replacement. Therefore, the frequency of the VH replacements in the normal repertoire was originally underestimated.

IGHV4-59 and other VH4 genes contain a complete cRSS that provides the potential for a RAG-mediated pseudohybrid join. In this regard, we found the VH4 cRSS was a substrate for in vitro RAG cleavage, albeit a less effective one than the canonical RSS. At least part of this inefficiency could be accounted for by the VH4 flanking sequence. It is notable that even though the VH4 cRSS was an inefficient substrate, it was cleaved significantly more effectively than a control VH3 cRSS. Sequence-specific breaks were detected at the cRSS heptamer, suggesting that RAG could catalyze double -strand breaks via the normal nick-hairpin mechanism. Because similar VH replacements were present in AICDA-deficient B cells, we concluded that VH4 replacement was independent of AICDA activity and was likely to result from RAG-dependent pseudohybrid joining or possibly an atypical cleavage and joining mechanism that did not depend on AICDA.

Previous reports suggested that RAG enzymes recognizing cRSS present in VH genes are capable of mediating secondary rearrangements in human B cells that had undergone SHM (20, 21). In addition, ligation mediated-PCR products of VH cRSS sites have been detected in human immature bone marrow cells, indicating that DNA double-strand breaks occur at these sites (11, 14). We extended these studies by confirming that VH secondary rearrangements in immature and unmutated mature human B cells can be detected by amplifying genomic DNA from single cells. This approach allowed us to eliminate the possible bias introduced in analyzing the rearranged Ig repertoire acquired by cloning from cDNA (22, 42, 43). Amplifying Ig genes from genomic DNA of single B cells has been shown to minimize unusual PCR-induced artifacts such as the creation of chimeric molecules or nucleotide exchanges between the mutational variants, which are known to occur during amplification of cDNA from bulk populations of B cells (44). Importantly, the sequence error rate using this technique is very low (<0.8 × 10−4/base pair), largely because the PCR products are directly sequenced (30, 31). This makes it possible to distinguish minor differences in sequences and permits a more comprehensive interpretation of the data. Fewer than 10% of the sequences analyzed from X-HIgM and AICDA-deficient patients contained mutations, most of which contained a single nucleotide substitution, thereby making it possible to interpret the sequence differences in mature B cells accurately. Compared with the analysis of mature mutated B cells, this was a particular advantage for identifying VH replacement, because VH genes within the same family share >80% homology (45).

An important feature of the VH hybrids identified in the current study was that the replacement gene always resided in the H chain locus upstream of the VH gene used in the initial rearrangement. This finding supports the conclusion that these compound rearrangements resulted from secondary VH replacement. During the initial rearrangement, VH genes downstream of the primary rearrangement are deleted, leaving only upstream VH genes available for the secondary rearrangement (Fig. 5). Notably, this is different from the VH1 compound rearrangements reported in the rheumatoid arthritis synovium in which only one-half of the rearrangements involved the replacement of a downstream gene by an upstream counterpart (21), suggesting that these sequences were either an artifact (26) or that the replacement gene came from the opposite chromosome.

FIGURE 5.

Schematic representation of a primary 12/23 VH(D)JH recombination and a secondary 12/12 rearrangement between two VH4 genes. A, The H chain locus on chromosome 14 is partially represented to demonstrate normal VH(D)JH recombination. Row 1, The 23RSS (filled triangles) flank VH and JH genes, and the 12RSS (open triangle) flank D segments. Each RSS, which is targeted and cleaved by RAG1/2, is oriented with the heptamer adjacent to either the 5′ (D and JH) or 3′ (D and VH) end of the gene. Row 2, The D1 gene is joined to JH1 and the intervening D2 segment is deleted. Row 3, The VH1 gene is joined to the DJH segment and the intervening VH2 gene is deleted. B, A region of the H chain locus containing a primary IGHV4-bDJH rearrangement is represented. Row 1, RAG enzymes bind to the cRSS embedded in a nonrearranged IGHV4-59 donor gene and the cRSS of the recipient IGHV4-b gene that has undergone prior rearrangement with a D and JH segment. Row 2, RAG cleaves at the heptamer of the cRSS in IGHV4-59 and IGHV4-b (noted with arrows). Row 3, After RAG-mediated double-strand cleavage at the cRSS heptamers, the intervening gene segment is removed and the 5′ portion of the donor gene (coding end) and the recipient VH4 gene containing the cRSS (signal end) are joined together forming a VH pseudohybrid join. Filled triangles represent 23-bp RSS; open triangles represent 12-bp RSS.

FIGURE 5.

Schematic representation of a primary 12/23 VH(D)JH recombination and a secondary 12/12 rearrangement between two VH4 genes. A, The H chain locus on chromosome 14 is partially represented to demonstrate normal VH(D)JH recombination. Row 1, The 23RSS (filled triangles) flank VH and JH genes, and the 12RSS (open triangle) flank D segments. Each RSS, which is targeted and cleaved by RAG1/2, is oriented with the heptamer adjacent to either the 5′ (D and JH) or 3′ (D and VH) end of the gene. Row 2, The D1 gene is joined to JH1 and the intervening D2 segment is deleted. Row 3, The VH1 gene is joined to the DJH segment and the intervening VH2 gene is deleted. B, A region of the H chain locus containing a primary IGHV4-bDJH rearrangement is represented. Row 1, RAG enzymes bind to the cRSS embedded in a nonrearranged IGHV4-59 donor gene and the cRSS of the recipient IGHV4-b gene that has undergone prior rearrangement with a D and JH segment. Row 2, RAG cleaves at the heptamer of the cRSS in IGHV4-59 and IGHV4-b (noted with arrows). Row 3, After RAG-mediated double-strand cleavage at the cRSS heptamers, the intervening gene segment is removed and the 5′ portion of the donor gene (coding end) and the recipient VH4 gene containing the cRSS (signal end) are joined together forming a VH pseudohybrid join. Filled triangles represent 23-bp RSS; open triangles represent 12-bp RSS.

Close modal

We found VH replacement only among VH4 genes, which contrasts with previous reports of RAG-mediated VH replacement involving VH3, VH4, and VH1 genes (20). This finding was of interest, because VH3 genes contain a cRSS in FR3 that is very similar to the cRSS in VH4 genes. Importantly, the cRSS in both the VH3 gene and the VH4 gene is composed not only of a heptamer 5′-CACCAT(A/C)-3′ but also a 13-bp spacer and a nonamer 5′-CCAAGAAC(C/T). In a canonical RSS, the three nucleotides of the heptamer closest to the recombination site (5′CAC-) are invariant, and sequence positions 5 and 6 of the nonamer (5′-AA) are critical for RAG-mediated recombination (46, 47). The VH FR3 cRSS meets most of the minimal sequence requirements for a complete RSS and therefore presents the possibility for RAG binding and cleavage and formation of a pseudohybrid join involving an upstream VH4 gene and a downstream VH4(D)JH in a secondary rearrangement (4). Each gene in the VH4 family conforms closely to the consensus heptamer and nonamer. The cRSS of VH3 gene family members differ from the VH4 family primarily in the spacer sequence and the first and last position of the nonamer. By comparison, the VH1 cRSS nonamer is even more divergent and lacks the conserved AA dinucleotide. Although the differences in VH4 and VH3 cRSSs are apparently minor, they result in a major loss of efficiency of RAG cleavage. The differential efficiency of VH4 and VH3 cRSS to permit RAG-mediated cleavage may contribute to the differential use of these gene families for secondary VH rearrangement. Other considerations such as chromosomal organization (45) and the frequency of sterile transcription (48, 49) could contribute to the increased prevalence of the IGHV4-59 and IGHV4b genes in secondary rearrangements. Finally, it is known that IGHV4-59 is the only VH4 gene that is rearranged more frequently than expected from random chance (22), and this may contribute to the prevalence of compound rearrangements using IGHV4-59. Other features of VH3 and VH4 genes may contribute to inefficient RAG-mediated cleavage. In this regard, we found that the flanking sequences affect the outcome of RAG-mediated cleavage in that the hairpinning step was decreased and abnormal when the IGHV3-23 flank was present. It has been observed that coding sequences ending in TT, such as IGHV3-23, results in lower in vitro recombination frequencies (50). Thus, the presence of the VH3 coding sequence may contribute to the decreased appearance of VH3 containing compound rearrangements. More recently, it has been shown that the spacer sequence also contributes to RAG-mediated recombination (51). Such sequence variation in the flank and spacer regions can account for similar RAG binding and cleavage at distinct cRSSs, but different levels of joining (13, 51), and thereby contribute to different levels of VH3 and VH4 containing compound rearrangements. Importantly, neither VH3 nor VH4 family genes contain a cRSS containing a 23-bp spacer. Because the presence of a 23-bp RSS increases the specificity of double-stranded breaks (52), the absence of a 23-bp RSS in the FR3 of VH4 and VH3 genes would be anticipated to alter the efficiency of RAG-mediated cleavage.

A discrepancy between our findings and those of others who demonstrated more robust in vitro RAG cleavage of the IGHV4-34 cRSS (25) may in part be related to the inclusion of excess nonspecific DNA in our reactions, which was added to avoid nonspecific cleavage during long incubations. In addition, we avoided alterations in buffer pH or ionic strength and the addition of organic solvents such as DMSO, which can lead to altered or relaxed specificity of endonucleases in general (53), as well as RAG (54). Others have identified RAG-mediated breaks at CAC sequences under certain conditions (11). In the current study, a low level of semispecific cleavage was also noted in the NS DNA controls. We concluded that RAG may have contributed to VH replacement but because of the low efficiency even with permissive conditions, it is possible that another mechanism may be responsible for VH replacement.

Because many of the secondary VH replacements previously reported in human B cells were found in mutated populations, it was suggested that the process was dependent on AICDA or SHM (26). Although there are several reports of AICDA expression during early murine B cell development (28, 55, 56, 57, 58), it is not known whether AICDA may have contributed to the compound rearrangements in human fetal liver and bone marrow. Importantly, the presence of compound rearrangements in AICDA-deficient B cells argues against a mechanism that is dependent on AICDA, even though AICDA-targeted RGYW/WRCY motifs are more frequent in VH4 than VH3 sequences in the region in which the pseudohybrid join could have occurred. The presence of compound VH4 rearrangements in human fetal liver and bone marrow cells also argues against a requirement for SHM. However, we cannot exclude the possibility that there may be more than one mechanism for VH replacement and the compound rearrangements from the mutated populations may have arisen after SHM was initiated.

The data clearly demonstrate that VH4 replacement can occur during early B cell development and in the absence of SHM. However, it remains unclear whether the secondary rearrangement occurs before (VH→VH) or after a primary rearrangement (VH→VHDJH), or if both are possible. The finding that compound rearrangements can be found in the nonproductive repertoire implies that VH→VH fusions may occur between two VH4 genes before or during VH(D)JH rearrangement and, moreover, is unlikely to relate to B cell reactivity to self or exogenous Ags. The possibility that VH→VH fusion may occur before VH(D)JH rearrangement suggests that the event may be influenced by gene accessibility related to differential sterile transcription of VH genes (48, 49) or chromatin remodeling (59, 60, 61). This explanation may provide a clue as to why the compound rearrangements preferentially involve VH4 genes.

Interestingly, all of the VH compound rearrangements in the current study exhibited no modification of the pseudohybrid join. In contrast, classic hybrid joins derived from artificial substrates have a considerable degree of end processing (62). The signal end is usually kept intact, whereas the coding end exhibits modifications with loss or gain of nucleotides. The data suggest that modification enzymes do not have access to the VH4 locus when the compound rearrangement occurs or are less active when the compound rearrangement is initially generated. In this regard, both TdT and exonuclease activities are known to be developmentally regulated (63).

The frequency of compound rearrangements ranged from to 8.6% in X-HIgM to 12% of the VH4 rearrangements in fetal samples. Similarly, 8.3% of the AICDA-deficient B cells and 9.4% of the normal donor B VH4 cells contained IGHV4-59/IGHV4-b compound rearrangements. These results indicate that this is not an uncommon event and may be involved in providing additional diversity.

In summary, the current data clearly demonstrate evidence of secondary rearrangement at the H chain locus involving VH4 genes in fetal, X-HIgM, AICDA-deficient, and normal mature human B cells. Our findings suggest that VH replacement in human B cells is likely to involve RAG activity but does not depend on AICDA (Table II).

We are grateful for the cooperation of the patients and their families who made this study possible.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This research was supported by the National Institute of Arthritis and Musculoskeletal and Skin Diseases and the National Institute of Diabetes and Digestive and Kidney Diseases intramural research programs of the National Institutes of Health, Bethesda, MD.

3

Abbreviations used in this paper: RSS, recombination signal sequence; AICDA, activation-induced cytidine deaminase; cRSS, cryptic RSS; FR, framework region; HMG, high mobility group; HMGB1, HMG box 1; IGMT, ImMunoGeneTics; NS, nonspecific; SHM, somatic hypermutation; X-HIgM, X-linked hyper-IgM.

1
Tonegawa, S..
1983
. Somatic generation of antibody diversity.
Nature
302
:
575
-581.
2
Gay, D., T. Saunders, S. Camper, M. Weigert.
1993
. Receptor editing: an approach by autoreactive B cells to escape tolerance.
J. Exp. Med.
177
:
999
-1008.
3
Tiegs, S. L., D. M. Russell, D. Nemazee.
1993
. Receptor editing in self-reactive bone marrow B cells.
J. Exp. Med.
177
:
1009
-1020.
4
Gellert, M..
1994
. DNA double-strand breaks and hairpins in V(D)J recombination.
Sem. Immunol.
6
:
125
-130.
5
Chen, C., Z. Nagy, E. L. Prak, M. Weigert.
1995
. Immunoglobulin heavy chain gene replacement: a mechanism of receptor editing.
Immunity
3
:
747
-755.
6
Reth, M., P. Gehrmann, E. Petrac, P. Wiese.
1986
. A novel VH to VHDJH joining mechanism in heavy-chain-negative (null) pre-B cells results in heavy-chain production.
Nature
322
:
840
-842.
7
Kleinfield, R. W., M. G. Weigert.
1989
. Analysis of VH gene replacement events in a B cell lymphoma.
J. Immunol.
142
:
4475
-4482.
8
Covey, L. R., P. Ferrier, F. W. Alt.
1990
. VH to VHDJH rearrangement is mediated by the internal VH heptamer.
Int. Immunol.
2
:
579
-583.
9
Usuda, S., T. Takemori, M. Matsuoka, T. Shirasawa, K. Yoshida, A. Mori, K. Ishizaka, H. Sakano.
1992
. Immunoglobulin V gene replacement is caused by the intramolecular DNA deletion mechanism.
EMBO J.
11
:
611
-618.
10
Bende, R. J., W. M. Aarts, S. T. Pals, C. J. van Noesel.
2002
. Immunoglobulin diversification in B cell malignancies: internal splicing of heavy chain variable region as a by-product of somatic hypermutation.
Leukemia
16
:
636
-644.
11
Zhang, Z., M. Zemlin, Y. H. Wang, D. Munfus, L. E. Huye, H. W. Findley, S. L. Bridges, D. B. Roth, P. D. Burrows, M. D. Cooper.
2003
. Contribution of VH gene replacement to the primary B cell repertoire.
Immunity
19
:
21
-31.
12
Lenze, D., A. Greiner, C. Knorr, I. Anagnostopoulos, H. Stein, M. Hummel.
2003
. Receptor revision of immunoglobulin heavy chain genes in human MALT lymphomas.
Mol. Pathol.
56
:
249
-255.
13
Zhang, M., P. C. Swanson.
2008
. V(D)J recombinase binding and cleavage of cryptic recombination signal sequences identified from lymphoid malignancies.
J. Biol. Chem.
283
:
6717
-6727.
14
Davila, M., F. Liu, L. G. Cowell, A. E. Lieberman, E. Heikamp, A. Patel, G. Kelsoe.
2007
. Multiple, conserved cryptic recombination signals in VH gene segments: detection of cleavage products only in pro B cells.
J. Exp. Med.
204
:
3195
-3208.
15
Cascalho, M., A. Ma, S. Lee, L. Masat, M. Wabl.
1996
. A quasi-monoclonal mouse.
Science
272
:
1649
-1652.
16
Koralov, S. B., T. I. Novobrantseva, K. Hochedlinger, R. Jaenisch, K. Rajewsky.
2005
. Direct in vivo VH to JH rearrangement violating the 12/23 rule.
J. Exp. Med.
201
:
341
-348.
17
Kolar, G. R., J. D. Capra.
2004
. Immunoglobulin heavy-chain receptor editing is observed in the NOD/SCID model of human B-cell development.
Scand. J. Immunol.
60
:
108
-111.
18
Lutz, J., W. Muller, H. M. Jack.
2006
. VH replacement rescues progenitor B cells with two nonproductive VDJ alleles.
J. Immunol.
177
:
7007
-7014.
19
Xu, C., J. Sui, H. Tao, Q. Zhu, W. A. Marasco.
2007
. Human anti-CXCR4 antibodies undergo VH replacement, exhibit functional V-region sulfation, and define CXCR4 antigenic heterogeneity.
J. Immunol.
179
:
2408
-2418.
20
Wilson, P. C., K. Wilson, Y. J. Liu, J. Banchereau, V. Pascual, J. D. Capra.
2000
. Receptor revision of immunoglobulin heavy chain variable region genes in normal human B lymphocytes.
J. Exp. Med.
191
:
1881
-1894.
21
Itoh, K., E. Meffre, E. Albesiano, A. Farber, D. Dines, P. Stein, S. E. Asnis, R. A. Furie, R. I. Jain, N. Chiorazzi.
2000
. Immunoglobulin heavy chain variable region gene replacement as a mechanism for receptor revision in rheumatoid arthritis synovial tissue B lymphocytes.
J. Exp. Med.
192
:
1151
-1164.
22
Brezinschek, H. P., R. I. Brezinschek, P. E. Lipsky.
1995
. Analysis of the heavy chain repertoire of human peripheral B cells using single-cell polymerase chain reaction.
J. Immunol.
155
:
190
-202.
23
Brezinschek, H. P., S. J. Foster, R. I. Brezinschek, T. Dörner, R. Domiati-Saad, P. E. Lipsky.
1997
. Analysis of the human VH gene repertoire: differential effects of selection and somatic hypermutation on human peripheral CD5+/IgM+ and CD5/IgM+ B cells.
J. Clin. Invest.
99
:
2488
-2501.
24
Radic, M. Z., J. Erikson, S. Litwin, M. Weigert.
1993
. B lymphocytes may escape tolerance by revising their antigen receptors.
J. Exp. Med.
177
:
1165
-1173.
25
Rahman, N. S., L. J. Godderz, S. J. Stray, J. D. Capra, K. K. Rodgers.
2006
. DNA cleavage of a cryptic recombination signal sequence by RAG1 and RAG2. Implications for partial VH gene replacement.
J. Biol. Chem.
281
:
12370
-12380.
26
Darlow, J. M., D. I. Stott.
2006
. Gene conversion in human rearranged immunoglobulin genes.
Immunogenetics
58
:
511
-522.
27
Neuberger, M. S., R. S. Harris, J. Di Noia, S. K. Petersen-Mahrt.
2003
. Immunity through DNA deamination.
Trends Biochem. Sci.
28
:
305
-312.
28
Han, J. H., S. Akira, K. Calame, B. Beutler, E. Selsing, T. Imanishi-Kari.
2007
. Class switch recombination and somatic hypermutation in early mouse B cells are mediated by B cell and Toll-like receptors.
Immunity
27
:
64
-75.
29
Dörner, T., H. P. Brezinschek, S. J. Foster, R. I. Brezinschek, N. L. Farner, P. E. Lipsky.
1998
. Comparable impact of mutational and selective influences in shaping the expressed repertoire of peripheral IgM+/CD5 and IgM+/CD5+ B cells.
Eur. J. Immunol.
28
:
657
-668.
30
Longo, N. S., C. L. Satorius, A. Plebani, A. Durandy, P. E. Lipsky.
2008
. Characterization of immunoglobulin gene somatic hypermutation in the absence of activation-induced cytidine deaminase.
J. Immunol.
181
:
1299
-1306.
31
Yavuz, A. S., P. E. Lipsky, S. Yavuz, D. D. Metcalfe, C. Akin.
2002
. Evidence for the involvement of a hematopoietic progenitor cell in systemic mastocytosis from single-cell analysis of mutations in the c-kit gene.
Blood
100
:
661
-665.
32
Souto-Carneiro, M. M., N. S. Longo, D. E. Russ, H. W. Sun, P. E. Lipsky.
2004
. Characterization of the human Ig heavy chain antigen binding complementarity determining region 3 using a newly developed software algorithm, JOINSOLVER.
J. Immunol.
172
:
6790
-6802.
33
McBlane, J. F., D. C. van Gent, D. A. Ramsden, C. Romeo, C. A. Cuomo, M. Gellert, M. A. Oettinger.
1995
. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps.
Cell
83
:
387
-395.
34
Mo, X., T. Bailin, S. Noggle, M. J. Sadofsky.
2000
. A highly ordered structure in V(D)J recombination cleavage complexes is facilitated by HMG1.
Nucleic Acids Res.
28
:
1228
-1236.
35
Jones, J. M., M. Gellert.
2002
. Ordered assembly of the V(D)J synaptic complex ensures accurate recombination.
EMBO J.
21
:
4162
-4171.
36
Wilson, P. C., O. de Bouteiller, Y. J. Liu, K. Potter, J. Banchereau, J. D. Capra, V. Pascual.
1998
. Somatic hypermutation introduces insertions and deletions into immunoglobulin V genes.
J. Exp. Med.
187
:
59
-70.
37
Eastman, Q. M., T. M. Leu, D. G. Schatz.
1996
. Initiation of V(D)J recombination in vitro obeying the 12/23 rule.
Nature
380
:
85
-88.
38
van Gent, D. C., D. A. Ramsden, M. Gellert.
1996
. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination.
Cell
85
:
107
-113.
39
West, R. B., M. R. Lieber.
1998
. The RAG-HMG1 complex enforces the 12/23 rule of V(D)J recombination specifically at the double-hairpin formation step.
Mol. Cell. Biol.
18
:
6408
-6415.
40
Grundy, G. J., J. E. Hesse, M. Gellert.
2007
. Requirements for DNA hairpin formation by RAG1/2.
Proc. Natl. Acad. Sci. USA
104
:
3078
-3083.
41
Giudicelli, V., P. Duroux, C. Ginestoux, G. Folch, J. Jabado-Michaloud, D. Chaume, M. P. Lefranc.
2006
. IMGT/LIGM-DB, the IMGT comprehensive database of immunoglobulin and T cell receptor nucleotide sequences.
Nucleic Acids Res.
34
:
D781
-D784.
42
Farner, N. L., T. Dörner, P. E. Lipsky.
1999
. Molecular mechanisms and selection influence the generation of the human V λ J λ repertoire.
J. Immunol.
162
:
2137
-2145.
43
Lee, J., N. L. Monson, P. E. Lipsky.
2000
. The V λ J λ repertoire in human fetal spleen: evidence for positive selection and extensive receptor editing.
J. Immunol.
165
:
6322
-6333.
44
Ford, J. E., M. G. McHeyzer-Williams, M. R. Lieber.
1994
. Chimeric molecules created by gene amplification interfere with the analysis of somatic hypermutation of murine immunoglobulin genes.
Gene
142
:
279
-283.
45
Berman, J. E., S. J. Mellis, R. Pollock, C. L. Smith, H. Suh, B. Heinke, C. Kowal, U. Surti, L. Chess, C. R. Cantor, et al
1988
. Content and organization of the human Ig VH locus: definition of three new VH families and linkage to the Ig CH locus.
EMBO J.
7
:
727
-738.
46
Hesse, J. E., M. R. Lieber, K. Mizuuchi, M. Gellert.
1989
. V(D)J recombination: a functional definition of the joining signals.
Genes Dev.
3
:
1053
-1061.
47
Ramsden, D. A., K. Baetz, G. E. Wu.
1994
. Conservation of sequence in recombination signal sequence spacers.
Nucleic Acids Res.
22
:
1785
-1796.
48
Oltz, E. M., O. Osipovich.
2007
. Targeting V(D)J recombinase: putting a PHD to work.
Immunity
27
:
539
-541.
49
Cobb, R. M., K. J. Oestreich, O. A. Osipovich, E. M. Oltz.
2006
. Accessibility control of V(D)J recombination.
Adv. Immunol.
91
:
45
-109.
50
Gerstein, R. M., M. R. Lieber.
1993
. Coding end sequence can markedly affect the initiation of V(D)J recombination.
Genes Dev.
7
:
1459
-1469.
51
Lee, A. I., S. D. Fugmann, L. G. Cowell, L. M. Ptaszek, G. Kelsoe, D. G. Schatz.
2003
. A functional analysis of the spacer of V(D)J recombination signal sequences.
PLoS Biol.
1
:
E1
52
Steen, S. B., L. Gomelsky, D. B. Roth.
1996
. The 12/23 rule is enforced at the cleavage step of V(D)J recombination in vivo.
Genes Cells
1
:
543
-553.
53
Nasri, M., D. Thomas.
1986
. Relaxation of recognition sequence of specific endonuclease HindIII.
Nucleic Acids Res.
14
:
811
-821.
54
Bergeron, S., D. K. Anderson, P. C. Swanson.
2006
. RAG and HMGB1 proteins: purification and biochemical analysis of recombination signal complexes.
Methods Enzymol.
408
:
511
-528.
55
Seagal, J., E. Edry, H. Naftali, D. Melamed.
2004
. Generation and selection of an IgG-driven autoimmune repertoire during B-lymphopoiesis in Igμ-deficient/lpr mice.
Int. Immunol.
16
:
905
-913.
56
Macpherson, A. J., A. Lamarre, K. McCoy, G. R. Harriman, B. Odermatt, G. Dougan, H. Hengartner, R. M. Zinkernagel.
2001
. IgA production without μ or δ chain expression in developing B cells.
Nat. Immunol.
2
:
625
-631.
57
Ueda, Y., D. Liao, K. Yang, A. Patel, G. Kelsoe.
2007
. T-independent activation-induced cytidine deaminase expression, class-switch recombination, and antibody production by immature/transitional 1 B cells.
J. Immunol.
178
:
3593
-3601.
58
Seagal, J., E. Edry, Z. Keren, N. Leider, O. Benny, M. Machluf, D. Melamed.
2003
. A fail-safe mechanism for negative selection of isotype-switched B cell precursors is regulated by the Fas/FasL pathway.
J. Exp. Med.
198
:
1609
-1619.
59
Bates, J. G., D. Cado, H. Nolla, M. S. Schlissel.
2007
. Chromosomal position of a VH gene segment determines its activation and inactivation as a substrate for V(D)J recombination.
J. Exp. Med.
204
:
3247
-3256.
60
Maes, J., L. P. O'Neill, P. Cavelier, B. M. Turner, F. Rougeon, M. Goodhardt.
2001
. Chromatin remodeling at the Ig loci prior to V(D)J recombination.
J. Immunol.
167
:
866
-874.
61
Cherry, S. R., D. Baltimore.
1999
. Chromatin remodeling directly activates V(D)J recombination.
Proc. Natl. Acad. Sci. USA
96
:
10788
-10793.
62
Lewis, S. M..
1994
. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses.
Adv. Immunol.
56
:
27
-150.
63
Souto-Carneiro, M. M., G. P. Sims, H. Girschik, J. Lee, P. E. Lipsky.
2005
. Developmental changes in the human heavy chain CDR3.
J. Immunol.
175
:
7425
-7436.