Autoreactive T cells are thought to be involved in the pathogenesis of autoimmune diseases, but evidence for their direct pathogenicity is almost lacking. Herein we established a unique system for evaluating the in vivo pathogenicity of desmoglein 3 (Dsg3)-reactive T cells at a clonal level in a mouse model for pemphigus vulgaris (PV), an autoimmune blistering disease induced by anti-Dsg3 autoantibodies. Dsg3-reactive CD4+ T cell lines generated in vitro were adoptively transferred into Rag-2−/− mice with primed B cells derived from Dsg3-immunized Dsg3−/− mice. Seven of 20 T cell lines induced IgG anti-Dsg3 Ab production and acantholytic blister, a typical disease phenotype, in recipient mice. Comparison of the characteristics between pathogenic and nonpathogenic Dsg3-reactive T cell lines led to the identification of IL-4 and IL-10 as potential factors associated with pathogenicity. Further in vitro analysis showed that IL-4, but not IL-10, promoted IgG anti-Dsg3 Ab production by primed B cells. Additionally, adenoviral expression of soluble IL-4Rα in vivo suppressed IgG anti-Dsg3 Ab production and the PV phenotype, indicating a pathogenic role of IL-4. This strategy is useful for evaluating the effector function of autoreactive T cells involved in the pathogenesis of various autoimmune diseases.

Autoreactive T cells are thought to play a central role in the pathogenesis of various autoimmune diseases (1). A number of studies using patient samples and animal models have identified and characterized the autoreactive T cells that potentially exert the pathogenic effector function. Recent reports using autoreactive T cell clones generated from patient samples indicate that a subset of autoreactive T cells has a pathogenic effector function in vitro (2). However, it has been difficult to evaluate whether the individual autoreactive T cells analyzed in vitro are actually involved in the autoimmune pathogenic process of patients in vivo. Autoreactive T cell clones have been shown to induce tissue damage in a mouse model for multiple sclerosis and insulin-dependent diabetes mellitus (3, 4), but the in vivo helper activity of autoreactive T cells has never been analyzed at a clonal level in mouse models for autoantibody-mediated autoimmune diseases.

Pemphigus vulgaris (PV)3 is a life-threatening blistering disease involving IgG autoantibodies directed against desmoglein 3 (Dsg3). Dsg3 is a cadherin-type glycoprotein expressed on stratified squamous epithelium, including the skin and oral mucosa, and plays a critical role in cell-cell adhesion (5). Anti-Dsg3 autoantibodies bind to keratinocyte cell surfaces and induce cell detachment, resulting in blisters and erosions in the skin and mucous membranes as well as characteristic histological findings, such as suprabasilar acantholysis (6, 7). Dsg3-reactive CD4+ T cells have been detected and characterized in PV patients and healthy individuals, but it remains unclear whether these autoreactive T cells can induce the PV phenotype in vivo. In this study, we developed a novel experimental system that evaluates the in vivo pathogenicity of individual Dsg3-reactive T cell clones. In this system, Dsg3-reactive T cell lines generated in vitro from Dsg3−/− mice were adoptively transferred into recipient immunodeficient Rag-2−/− mice (Dsg3+/+) to examine whether T cell lines have the ability to induce the PV phenotype after adoptive transfer. Using this system, we identified IL-4 as a critical T cell-derived factor involved in the pathogenesis of PV.

Dsg3−/− mice with a mixed genetic background of 129/SV (H-2b) and C57BL/6J (H-2b) were obtained by mating male and female Dsg3−/− mice (The Jackson Laboratory) (8). C57BL/6 mice and C57BL/6 Rag-2−/− mice were purchased from the Central Institute for Experimental Animals (Tokyo, Japan). OT-II (OVA-specific) TCR transgenic mice (H-2b) were originally generated by Barnden et al. (9), and Rag-2−/− OT-II transgenic mice (H-2b) were kindly provided by Prof. S. Koyasu (Keio University). The Keio University Ethics Committee for Animal Experiments approved all experiments in this study.

A baculoprotein rDsg3EHis, which includes the extracellular domain of mouse Dsg3 (amino acid residues 1–565), an E-tag, and a His-tag, was produced as described previously (10) with some modifications. In brief, the purification was improved by serial procedures using Talon affinity metal resin (Clontech Laboratories) followed by a HiTrap anti-E Tag column (GE Healthcare). Five mouse Dsg3 fragments (rDsg3-1–5) expressed in Escherichia coli were prepared as soluble maltose-binding protein (MalBP)-Dsg3 fusion proteins as described (11). The Dsg3 fragments encompassing together the entire 565-aa sequence of the extracellular domain of mouse Dsg3 included rDsg3-1 (aa 1–119), rDsg3-2 (aa 99–230), rDsg3-3 (aa 210–345), rDsg3-4 (aa 325–455), and rDsg3-5 (aa 428–565). These recombinant proteins were dialyzed against PBS containing 0.5 mM CaCl2, filter-sterilized, and stored at −80°C until use. The expression of recombinant Dsg3 fragments was evaluated by SDS-PAGE followed by Coomassie blue staining or immunoblotting probed with an anti-mouse Dsg3 mAb (AK7 or AK18) (7).

Adenoviral vectors harboring the entire extracellular domain and transmembrane region of mouse Dsg3 (rDsg3ΔIC; aa 1–590) or the extracellular domain of cytokine receptors (IL-4Rα, IL-10Rα, and IFN-γR1) were constructed using the AdEasy adenoviral vector system (Stratagene) according to the manufacturer’s instructions. rDsg3ΔIC was adenovirally expressed in COS cells, which were subjected to sonication in PBS containing 0.5 mM CaCl2 and 0.01% Triton X-100. The cellular lysates were filter-sterilized and used in T cell cultures as a source of Dsg3. The expression of Dsg3 was evaluated by SDS-PAGE followed by immunoblotting with anti-mouse Dsg3 mAb and rabbit anti-actin polyclonal Ab (Sigma-Aldrich). For soluble cytokine receptors, the cDNA for the entire extracellular domain of each cytokine receptor was cloned from a spleen cDNA library and used to construct recombinant adenoviruses. Each recombinant adenovirus harboring a soluble cytokine receptor was concentrated by CsCl2 density gradient centrifugation, dialyzed against PBS, and stocked at −80°C until use. The in vivo expression of soluble cytokine receptors was confirmed by immunoblotting plasma obtained from adenovirus-infected mice with goat anti-IL-4Rα, anti-IL-10Rα, or anti-IFN-γR1 polyclonal Abs (R&D Systems).

Footpads of Dsg3−/− mice were immunized with 5 μg of rDsg3EHis emulsified with CFA (Sigma-Aldrich). After 7 days, a single-cell suspension (3 × 106/well) was prepared from the popliteal lymph nodes and cultured in 24-well plates with a mixture of rDsg3-1–5 (5 μg/ml each) in complete medium (RPMI 1640, 2 mM l-glutamine, 1 mM pyruvate, 50 U/ml penicillin, and 50 μg/ml streptomycin) supplemented with 1% C57BL/6 mouse serum. The cells were stimulated twice with the mixture of rDsg3-1–5 in the presence of 106 autologous 40 Gy-irradiated splenocytes in complete medium containing 10% FBS (Cambrex). T-STIM without Con A (BD Biosciences) was added to a final concentration of 1% twice a week as a source of growth factors. T cell blasts were subsequently subjected to limiting dilution using round-bottom 96-well plates in the presence of irradiated autologous splenocytes (2 × 104/well), antigenic Dsg3 fragments, and 1% T-STIM without Con A.

Dsg3-specific T cell proliferation was measured by [3H]thymidine uptake as described (11). In some experiments, bone marrow-derived dendritic cells, which were prepared by culturing C57BL/6 bone marrow cells with 10 ng/ml GM-CSF (PeproTech) for 7 days, were used as APCs. Before the coculture with T cells, the bone marrow-derived dendritic cells were pulsed with pAd-rDsg3ΔIC or mock vector-transduced COS cell lysates (100 μg/ml) and maturated with 10 μg/ml LPS (Sigma-Aldrich) for 24 h. MHC class II restriction was determined by evaluating the inhibitory effect on Ag-induced T cell proliferation of 4 μg/ml rat anti-I-Ab mAb (clone M5/114; BD Biosciences). An isotype-matched rat mAb to an irrelevant Ag (BD Biosciences) was used as a control.

To evaluate the pathogenicity of Dsg3-reactive T cell lines, Dsg3-reactive T cell lines (106) and splenic Dsg3−/− B cells (5 × 106) were transferred into Rag-2−/− mice via the tail vein. In vivo-primed Dsg3−/− B cells were prepared by depleting CD4+ and CD8+ cells from the splenocytes of rDsg3EHis-immunized Dsg3−/− mice (10), followed by the positive selection of B220+ cells using the MACS cell separation system (Miltenyi Biotec). A portion of the separated CD4+ and CD8+ cells was used as unfractionated Dsg3−/− T cells. In some experiments, recombinant adenovirus harboring sIL-4Rα, sIL-10Rα, or sIFN-γR1 (109 infections units) was directly injected into Rag-2−/− mice via tail vein 5 days before the passive transfer of pathogenic Dsg3-reactive T cell clones and Dsg3−/−-primed B cells. It has been demonstrated that recombinant adenovirus injected from tail vein mainly infects hepatocytes, resulting in expression of recombinant protein (12).

T cell lines were stimulated with 25 ng/ml PMA (Sigma-Aldrich) and 1 μg/ml ionomycin (Sigma-Aldrich) for 3 days, and isolated using anti-CD4 mAb-coupled magnetic beads (Dynal Biotech). Total RNA was isolated from individual T cell lines using the RNeasy mini kit with RNase-free DNase (Qiagen). For the analysis of TCR Vβ gene usage, aliquots of the synthesized cDNA (5 ng of total RNA equivalent) were amplified using a panel of TCR Vβ region-specific primers in combination with a Cβ region primer for 37 cycles. Primers for Vβ1–20 and Cβ were designed based on previous reports (13, 14, 15). The expression of cytokines and chemokine receptors was also examined by PCR using the specific primers listed in Table I for 38 and 40 cycles, respectively.

Table I.

Primer sequences, optical annealing temperatures, and amplified sizes of genes analyzed in PCR

GenesPrimers (5′ to 3′)Annealing Temp. (°C)Sizes (bp)
IL-2    
 Sense TGATGGACCTACAGGAGCTCCTGAG 60 168 
 Antisense GAGTCAAATCCAGAACATGCCGCAG   
IL-4    
 Sense CGAAGAACACCACAGAGAGTGAGCT 60 181 
 Antisense GACTCATTCATGGTGCAGCTTATCG   
IL-6    
 Sense CTGGTGACAACCACGGCCTCCCCT 60 601 
 Antisense ATGCTTAGGCATAACGCACTAGGT   
IL-10    
 Sense TGAAGCTTCTATTCTAAGGCTGGCC 60 178 
 Antisense CTGAGCTGCTGCAGGAATGATCATC   
IL-17    
 Sense GGTCAACCTCAAAGTCTTTAACTC 51 396 
 Antisense AAATACAAGTAAGTTTGCTGAGAAACG   
IFN-γ    
 Sense GCTACACACTGCATCTTGGCTTTGC 60 939 
 Antisense CCTGTTACTACCTGACACATTCGAG   
TGF-β    
 Sense GCTCACTGCTCTTGTGACAGCAAAG 60 362 
 Antisense CAAGGACCTTGCTGTACTGTGTGTC   
CCR4    
 Sense GACTGTCCTCAGGATCACTTTCAGA 60 255 
 Antisense CCCAACAAGAAGACCAAGGAGTAG   
CCR7    
 Sense AACCAAAAGCACAGCCTTCCTGT 60 299 
 Antisense TGTACGTCAGTATCACCAGCCC   
CXCR3    
 Sense AAAGGCAGAGAAGCAGGCA 60 1275 
 Antisense TTCAGGCTGAAATCCTGTGG   
CXCR5    
 Sense ATGGATGACCTGTACAAGGAACTG 60 282 
 Antisense TGCAAAAGGCAGGATGAAGAC   
CRTH2    
 Sense GACAACTGCTCTCTAGGAGGAACT 60 1263 
 Antisense ACCACAAACAGGATGAGTCCGT   
β-actin    
 Sense TGGAATCCTGTGGCATCCATGAAAC 60 227 
 Antisense TAAAACGCAGCTCAGTAACAGTCCG   
GenesPrimers (5′ to 3′)Annealing Temp. (°C)Sizes (bp)
IL-2    
 Sense TGATGGACCTACAGGAGCTCCTGAG 60 168 
 Antisense GAGTCAAATCCAGAACATGCCGCAG   
IL-4    
 Sense CGAAGAACACCACAGAGAGTGAGCT 60 181 
 Antisense GACTCATTCATGGTGCAGCTTATCG   
IL-6    
 Sense CTGGTGACAACCACGGCCTCCCCT 60 601 
 Antisense ATGCTTAGGCATAACGCACTAGGT   
IL-10    
 Sense TGAAGCTTCTATTCTAAGGCTGGCC 60 178 
 Antisense CTGAGCTGCTGCAGGAATGATCATC   
IL-17    
 Sense GGTCAACCTCAAAGTCTTTAACTC 51 396 
 Antisense AAATACAAGTAAGTTTGCTGAGAAACG   
IFN-γ    
 Sense GCTACACACTGCATCTTGGCTTTGC 60 939 
 Antisense CCTGTTACTACCTGACACATTCGAG   
TGF-β    
 Sense GCTCACTGCTCTTGTGACAGCAAAG 60 362 
 Antisense CAAGGACCTTGCTGTACTGTGTGTC   
CCR4    
 Sense GACTGTCCTCAGGATCACTTTCAGA 60 255 
 Antisense CCCAACAAGAAGACCAAGGAGTAG   
CCR7    
 Sense AACCAAAAGCACAGCCTTCCTGT 60 299 
 Antisense TGTACGTCAGTATCACCAGCCC   
CXCR3    
 Sense AAAGGCAGAGAAGCAGGCA 60 1275 
 Antisense TTCAGGCTGAAATCCTGTGG   
CXCR5    
 Sense ATGGATGACCTGTACAAGGAACTG 60 282 
 Antisense TGCAAAAGGCAGGATGAAGAC   
CRTH2    
 Sense GACAACTGCTCTCTAGGAGGAACT 60 1263 
 Antisense ACCACAAACAGGATGAGTCCGT   
β-actin    
 Sense TGGAATCCTGTGGCATCCATGAAAC 60 227 
 Antisense TAAAACGCAGCTCAGTAACAGTCCG   

Surface markers of the Dsg3-reactive T cell lines were analyzed using FITC-conjugated anti-mouse CD4 mAb (clone GK1.5), FITC-conjugated anti-mouse CD8 mAb (clone 53-6.7), PE-conjugated anti-mouse TCRβ mAb (clone H57-597), and Cy-Chrome-conjugated anti-mouse CD4 mAb (clone H129.19), all of which were purchased from BD Biosciences. In some experiments, T cell lines labeled with 1 μM CFSE (Molecular Probes) were analyzed by flow cytometry after gating on the CD4+TCRβ+ population of the lymphocyte fraction.

IgG anti-Dsg3 Abs in plasma samples or culture supernatants were quantitatively measured using an ELISA as described previously (10). To examine the capacity of B cells to produce anti-Dsg3 Abs in vitro, MACS-sorted Dsg3−/− B cells were cultured with 500 ng/ml soluble CD40L (R&D Systems) in the presence of various concentrations of IL-4, IL-10, or IFN-γ (R&D Systems) for 7 days.

Formalin-fixed palate tissue was stained with H&E and observed with an inverted microscope TE2000-U (Nikon).

For direct immunofluorescent staining, 10-μm cryosections of the palate were directly stained with AlexaFluor 488-conjugated anti-mouse IgG Abs (Molecular Probes) and observed using a fluorescence microscope (Nikon) to detect IgG deposits. For indirect staining, 6-μm cryosections of the spleen were fixed with acetone and subsequently stained with the appropriate combination of the following Abs: FITC-conjugated anti-mouse CD19 (clone 1D3), PE-conjugated anti-mouse TCRβ (clone H57-597), AlexaFluor 488-conjugated anti-mouse B220 (clone RA3-6B2), biotinylated anti-mouse CD4 (clone RM4-5, BD Biosciences), and anti-Ki-67 mAb (clone TEC-3; DakoCytomation). Secondary Abs included AlexaFluor 488-conjugated anti-mouse IgG, AlexaFluor 660-conjugated anti-rat IgG, and AlexaFluor 488-conjugated anti-FITC Abs, and AlexaFluor 568-conjugated streptavidin (Molecular Probes). BrdU staining was performed using AlexaFluor 660-conjugated anti-BrdU mAb (clone PRB-1, Molecular Probes), as previously described (16). Sections were observed under a confocal laser fluorescence microscope FV1000 (Olympus).

All continuous data are shown as the means ± SD. Two-tailed repeated-measures ANOVA, Fisher’s exact probability test, or the Mann-Whitney U test was used as appropriate.

We prepared recombinant mouse Dsg3 fragments using three different expression systems (Fig. 1,A). rDsg3EHis (10), a baculoprotein containing the entire extracellular domain of Dsg3, was used to immunize Dsg3−/− mice. rDsg3-1–5, a series of recombinant MalBP-Dsg3 fusion proteins produced in E. coli, were used to expand Dsg3-reactive T cells and to evaluate antigenic regions in vitro. The purity of each recombinant protein was >95% (Fig. 1,B). Lysates from COS cells infected with pAd-rDsg3ΔIC, an adenovirus vector harboring Dsg3 cDNA lacking the sequence for the intracellular domain, were used to evaluate T cell reactivity to native Dsg3 produced in mammalian cells (Fig. 1 C). Serial use of more than one Dsg3 preparation for T cell stimulation is useful to eliminate expansion of T cells responsive to contaminant proteins unique to individual Ag preparations.

FIGURE 1.

Recombinant mouse Dsg3 proteins. A, Schematic illustration of the mouse Dsg3 and recombinant Dsg3 proteins used in this study. rDsg3-1–5 are bacterial recombinant Dsg3 fragments fused to MalBP. rDsg3EHis is a baculovirally produced Dsg3 extracellular domain with an E-tag and His-tag at the carboxyl terminus. rDsg3ΔIC is adenovirally produced Dsg3 lacking the intracellular domain. The numbers indicate the positions of amino acid residues in Dsg3. TM, transmembrane domain. B, rDsg3-1–5 and MalBP visualized by Coomassie blue staining. Lane 1, molecular mass markers; lanes 2–6, rDsg3-1–5; lane 7, MalBP (lane 7 is a different part of the same gel). C, Immunoblots of lysates from cells infected with the rDsg3ΔIC-harboring adenovirus vector or mock virus. Fractionated proteins were probed with anti-mouse Dsg3 or anti-actin Ab.

FIGURE 1.

Recombinant mouse Dsg3 proteins. A, Schematic illustration of the mouse Dsg3 and recombinant Dsg3 proteins used in this study. rDsg3-1–5 are bacterial recombinant Dsg3 fragments fused to MalBP. rDsg3EHis is a baculovirally produced Dsg3 extracellular domain with an E-tag and His-tag at the carboxyl terminus. rDsg3ΔIC is adenovirally produced Dsg3 lacking the intracellular domain. The numbers indicate the positions of amino acid residues in Dsg3. TM, transmembrane domain. B, rDsg3-1–5 and MalBP visualized by Coomassie blue staining. Lane 1, molecular mass markers; lanes 2–6, rDsg3-1–5; lane 7, MalBP (lane 7 is a different part of the same gel). C, Immunoblots of lysates from cells infected with the rDsg3ΔIC-harboring adenovirus vector or mock virus. Fractionated proteins were probed with anti-mouse Dsg3 or anti-actin Ab.

Close modal

To establish Dsg3-reactive T cell lines, the footpads of Dsg3−/− mice were immunized with rDsg3EHis emulsified with CFA. Single-cell suspensions of lymphocytes were prepared from the popliteal lymph nodes and were subsequently stimulated twice with a mixture of rDsg3-1–5 in vitro. The expanded cells that showed a specific proliferative response to at least one of the Dsg3 fragments were subjected to limiting dilution. From this selection, we obtained 59 T cell lines that were specifically reactive with one of rDsg3-1–4. All of these T cell lines were restricted by MHC class II (Fig. 2,A) and expressed the CD4 surface marker (Fig. 2,B). To evaluate whether these T cell lines responded to peptides generated from native Dsg3 through Ag processing, randomly selected T cell lines were cultured with bone marrow-derived dendritic cells pulsed with pAd-rDsg3ΔIC-infected and control adenovirus-infected cell lysates. All the T cell lines examined showed a specific response to Dsg3-expressing cell lysates in a MHC class II-dependent manner (Fig. 2,C). The in vitro-generated T cell lines were reactive to two different Dsg3 preparations, indicating that they were specific for Dsg3. Eighteen Dsg3-reactive T cell lines were confirmed to be clones based on their expression of a single functional TCR Vβ-chain, determined by family PCR combined with a direct nucleotide sequencing (Fig. 2 D).

FIGURE 2.

Characterization of representative Dsg3-reactive T cell lines. A, Dsg3-specific proliferative response of T cell line 145#27, which responded to rDsg3–2 in an I-Ab-specific manner. B, Surface expression of CD4 and CD8 by T cell clone 129#30 examined by flow cytometry. C, Proliferative responses of T cell line 161#100 to DC pulsed with cellular lysates infected with either rDsg3ΔIC or control adenovirus. D, Expression of a single functional TCR Vβ gene Vβ5.1 in Dsg3-reactive T cell clone 151#10, analyzed by family PCR using a series of TCR Vβ gene-specific primers.

FIGURE 2.

Characterization of representative Dsg3-reactive T cell lines. A, Dsg3-specific proliferative response of T cell line 145#27, which responded to rDsg3–2 in an I-Ab-specific manner. B, Surface expression of CD4 and CD8 by T cell clone 129#30 examined by flow cytometry. C, Proliferative responses of T cell line 161#100 to DC pulsed with cellular lysates infected with either rDsg3ΔIC or control adenovirus. D, Expression of a single functional TCR Vβ gene Vβ5.1 in Dsg3-reactive T cell clone 151#10, analyzed by family PCR using a series of TCR Vβ gene-specific primers.

Close modal

Twenty Dsg3-reactive T cell lines, including 13 clones expressing single functional TCR Vβ-chain, were further evaluated for their in vivo pathogenicity. Since our previous study demonstrated that splenic T cells and B cells are required to induce experimental PV (17), the individual T cell lines were transferred into Rag-2−/− mice together with primed B cells isolated from the spleen of a rDsg3EHis-immunized Dsg3−/− mouse. In a representative experiment, clone 154#33 effectively promoted the production of IgG anti-Dsg3 Abs in vivo (Fig. 3,A) and subsequently induced a PV phenotype, consisting of skin erosions and hair loss (Fig. 3,B). Mice into which clone 154#33 was transferred showed acantholytic blisters and in vivo IgG deposition on keratinocyte cell surfaces (Fig. 3 C). These PV features were also observed in positive control mice, into which unfractionated Dsg3−/− T cells had been transferred instead of Dsg3-reactive T cell lines. In contrast, transplantation of another clone, 152#25, failed to induce the IgG anti-Dsg3 Ab production or the PV phenotype, indicating that only a subset of the Dsg3-reactive T cell lines possessed in vivo pathogenic activity. The PV phenotype was not observed in control mice that received primed Dsg3−/− B cells alone or in combination with irrelevant OVA-specific T cells derived from Rag-2−/− OT-II transgenic mice (data not shown).

FIGURE 3.

Evaluation of the in vivo pathogenicity of Dsg3-reactive T cell clones. A, Serial changes in the levels of IgG anti-Dsg3 Abs in mice that had been treated with the adoptive transfer of the Dsg3-reactive T cell clone 152#25 (□) or 154#33 (○). Mice were treated with Dsg3−/− unfractionated T cells as a positive control (PC, ▵). B, Skin phenotype of mice treated with 154#33 (left), Dsg3−/− T cells (center), or 152#25 (right) on day 22. Erosions and hair loss (arrows) were apparent in the periorbital area, nose, head, ears, and shoulders of mice treated with 154#33 or Dsg3−/− T cells. C, Histology (upper panels) and IgG deposition (lower panels) in the palate from recipient mice. Acantholytic blister (arrowheads) and IgG deposition on keratinocyte cell surfaces were observed in the 154#33-treated mouse, as observed in the Dsg3−/− T cell-treated mouse. Dotted lines indicate the basement membrane. Bars: 50 μm.

FIGURE 3.

Evaluation of the in vivo pathogenicity of Dsg3-reactive T cell clones. A, Serial changes in the levels of IgG anti-Dsg3 Abs in mice that had been treated with the adoptive transfer of the Dsg3-reactive T cell clone 152#25 (□) or 154#33 (○). Mice were treated with Dsg3−/− unfractionated T cells as a positive control (PC, ▵). B, Skin phenotype of mice treated with 154#33 (left), Dsg3−/− T cells (center), or 152#25 (right) on day 22. Erosions and hair loss (arrows) were apparent in the periorbital area, nose, head, ears, and shoulders of mice treated with 154#33 or Dsg3−/− T cells. C, Histology (upper panels) and IgG deposition (lower panels) in the palate from recipient mice. Acantholytic blister (arrowheads) and IgG deposition on keratinocyte cell surfaces were observed in the 154#33-treated mouse, as observed in the Dsg3−/− T cell-treated mouse. Dotted lines indicate the basement membrane. Bars: 50 μm.

Close modal

As summarized in Table II, 7 of the Dsg3-reactive T cell lines, including 5 clones, induced the PV phenotype in vivo, and thus were regarded as pathogenic lines; in contrast, 13 of the Dsg3-reactive T cell lines failed to induce the PV phenotype. A total of 86 mice were used for this analysis. Results regarding the PV phenotype induction were completely reproducible: none of the nonpathogenic T cell lines induced the PV phenotype despite several attempts. Detailed data on the anti-Dsg3 Ab production, histological findings, and skin phenotype in mice receiving transplants of six additional Dsg3-reactive T cell lines possessing in vivo pathogenicity are shown in Fig. 4. Interestingly, the in vivo production of IgG anti-Dsg3 Abs and the PV skin phenotype in mice receiving Dsg3-reactive T cell lines were completely concordant, suggesting a direct pathogenic role of the anti-Dsg3 Ab response in our PV model.

Table II.

Characteristics of Dsg3-reactive T cell lines according to their in vivo pathogenicity

Line NameAntigenic FragmentsFunctional TCR Vβ Gene Usage (Vβ)Cytokine ExpressionChemokine Receptor ExpressionIn Vivo Production of Anti-Dsg3 Antibody
IL-2IL-4IL-6IL-10IL-17IFN-γTGF-βCCR7CCR4CXCR5CRTH2CXCR3
T cell lines with in vivo pathogenicitya                
 140#27b rDsg3-3 − − − − 
 147#27b rDsg3-3 8.2 − − 
 147#48b rDsg3-3 8.2 − − − 
 153#5 rDsg3-1 5, 7, 8.1 − − − − 
 154#33b rDsg3-1 8.2 − 
 161#100 rDsg3-1 6, 11 − − − 
 164#2b rDsg3-3 − − − − 
T cell lines without in vivo pathogenicitya                
 129#30b rDsg3-3 8.3 − − − − − − − 
 141#70b rDsg3-1 − − − − − − − 
 145#27 rDsg3−2, 4 6, 14 − − − − − − − − − − − 
 145#28 rDsg3-1 8.2, 11 − − − − − − 
 146#13 rDsg3-2 1, 4 − − 
 146#25 rDsg3-4 8.1, 15 − − − − − − − − − 
 151#10b rDsg3-1 5.1 − − − − − − − − 
 152#25b rDsg3-1 − − − − − − − 
 159#11 rDsg3-1 3, 4 − − − − − − 
 161#28b rDsg3-2 − − − 
 161#29b rDsg3-2 − − − 
 162#24b rDsg3-1 8.1 − − − − 
 162#92b rDsg3-2 8.2 − − − 
Line NameAntigenic FragmentsFunctional TCR Vβ Gene Usage (Vβ)Cytokine ExpressionChemokine Receptor ExpressionIn Vivo Production of Anti-Dsg3 Antibody
IL-2IL-4IL-6IL-10IL-17IFN-γTGF-βCCR7CCR4CXCR5CRTH2CXCR3
T cell lines with in vivo pathogenicitya                
 140#27b rDsg3-3 − − − − 
 147#27b rDsg3-3 8.2 − − 
 147#48b rDsg3-3 8.2 − − − 
 153#5 rDsg3-1 5, 7, 8.1 − − − − 
 154#33b rDsg3-1 8.2 − 
 161#100 rDsg3-1 6, 11 − − − 
 164#2b rDsg3-3 − − − − 
T cell lines without in vivo pathogenicitya                
 129#30b rDsg3-3 8.3 − − − − − − − 
 141#70b rDsg3-1 − − − − − − − 
 145#27 rDsg3−2, 4 6, 14 − − − − − − − − − − − 
 145#28 rDsg3-1 8.2, 11 − − − − − − 
 146#13 rDsg3-2 1, 4 − − 
 146#25 rDsg3-4 8.1, 15 − − − − − − − − − 
 151#10b rDsg3-1 5.1 − − − − − − − − 
 152#25b rDsg3-1 − − − − − − − 
 159#11 rDsg3-1 3, 4 − − − − − − 
 161#28b rDsg3-2 − − − 
 161#29b rDsg3-2 − − − 
 162#24b rDsg3-1 8.1 − − − − 
 162#92b rDsg3-2 8.2 − − − 
a

Identification of in vivo pathogenicity requres anti-Dsg3 Ab production, IgG deposition on the epithelial cell surfaces of the palate, and acantholysis.

b

Clonality was confirmed by TCR β-chain analysis.

FIGURE 4.

Anti-Dsg3 Ab production, IgG deposition in the palate, acantholytic blisters, and skin phenotype induced by individual Dsg3-reactive T cell lines with in vivo pathogenicity. 140#27, 147#27, 147#48, 154#33, and 164#2 were confirmed to be clones. A, E, I, M, P, T, and W, In the anti-Dsg3 Ab ELISA, the blue lines indicate mice with the transplanted T cell lines of interest, black lines indicate the positive control mice with transplanted Dsg3−/− T cells, and red lines indicate the negative control mice with transplanted B cells alone (A and E) or B cells in combination with a nonpathogenic clone 161#28 (I), 152#25 (M, P, and T), or 161#29 (W). Crosses indicate death. B, F, J, N, Q, U, and X, IgG deposition (green) in the palate was detected by immunostaining with an AlexaFluor 488-conjugated anti-mouse IgG Ab. Dotted lines indicate basement membrane. C, G, K, O, R, V, and Y, Acantholytic blisters (arrowheads) in the palate were evaluated by H & E staining. D, H, L, S, and Z, PC denotes the positive control mouse, and NC denotes the negative control mouse. Bars: 50 μm. Asterisks indicate that images are unavailable.

FIGURE 4.

Anti-Dsg3 Ab production, IgG deposition in the palate, acantholytic blisters, and skin phenotype induced by individual Dsg3-reactive T cell lines with in vivo pathogenicity. 140#27, 147#27, 147#48, 154#33, and 164#2 were confirmed to be clones. A, E, I, M, P, T, and W, In the anti-Dsg3 Ab ELISA, the blue lines indicate mice with the transplanted T cell lines of interest, black lines indicate the positive control mice with transplanted Dsg3−/− T cells, and red lines indicate the negative control mice with transplanted B cells alone (A and E) or B cells in combination with a nonpathogenic clone 161#28 (I), 152#25 (M, P, and T), or 161#29 (W). Crosses indicate death. B, F, J, N, Q, U, and X, IgG deposition (green) in the palate was detected by immunostaining with an AlexaFluor 488-conjugated anti-mouse IgG Ab. Dotted lines indicate basement membrane. C, G, K, O, R, V, and Y, Acantholytic blisters (arrowheads) in the palate were evaluated by H & E staining. D, H, L, S, and Z, PC denotes the positive control mouse, and NC denotes the negative control mouse. Bars: 50 μm. Asterisks indicate that images are unavailable.

Close modal

To analyze the fate of the transferred autoreactive T cells, we examined whether the transplanted Dsg3-reactive T cells proliferated in vivo in the recipient Rag-2−/− mice, using several different systems. First, Dsg3-reactive or OVA-specific T cells were labeled with CFSE and transferred into Rag-2−/− mice in combination with primed Dsg3−/− B cells. On the 10th day after adoptive transfer, diluted CFSE was detected in the spleen of mice treated with pathogenic and nonpathogenic Dsg3-reactive T cell lines as well as those receiving irrelevant OVA-specific T cells (Fig. 5,A), indicating that the transferred T cells were viable and expanded in vivo irrespective of their antigenic specificity or pathogenic activity. This early and nonspecific T cell proliferation was consistent with homeostatic proliferation (18, 19), which is a proliferative response of mature T cells in the lymphopenic environment to restore the lymphocyte pool size (20). Since it has been reported that the influence of homeostatic proliferation is negligible beyond 30 days of transfer (21), T cell proliferation was evaluated on day 37 by BrdU incorporation in the spleen of recipient mice. BrdU-bearing proliferating CD4+ T cells were frequently detected in mice treated with Dsg3-reactive T cell lines irrespective of their pathogenicity, but not in mice treated with irrelevant OVA-specific T cells (Fig. 5,B). The in vivo expansion of the Dsg3-reactive T cells was further evaluated by the expression of Ki-67, a marker for cell proliferation. In recipient mice, Dsg3-reactive and OVA-specific T cells expressed Ki-67 with similar frequencies on day 10, but Ki-67 expression was exclusively detected in the Dsg3-reactive T cells, irrespective of their pathogenicity, on day 37 (Fig. 5 C). These findings together indicate that the transferred Dsg3-reactive T cells persistently proliferate in vivo, independent of their pathogenicity. Thus, the in vivo proliferative capacity did not account for the presence or absence of the in vivo pathogenicity of individual T cell lines.

FIGURE 5.

In vivo proliferative capacity of Dsg3-reactive T cell clones. A, Flow cytometric analysis of CFSE dilution in splenic CD4+TCRβ+ T cells. After Dsg3-reactive T cell clone 164#2 (pathogenic), clone 162#92 (nonpathogenic), or OVA-specific T cells were labeled with CFSE in vitro, the T cells were transferred with Dsg3−/− B cells isolated from a Dsg3-immunized Dsg3−/− mouse into Rag2−/− mice. T cells were analyzed for CFSE dilution by flow cytometry after gating on the CD4+TCRβ+ population of the splenocytes 3 and 10 days after transfer. B, Immunostaining for B220 (green), CD4 (blue), and BrdU (red) in the spleen from recipient mice 37 days after the transfer of Dsg3-reactive T cell clone 164#2 (pathogenic), clone 162#92 (nonpathogenic), or OVA-specific T cells. BrdU-bearing CD4+ T cells (arrows) were detected in the region close to the B cell area in mice with transplanted Dsg3-reactive T cell lines. C, Immunostaining for B220 (green), TCRβ (blue), and Ki-67 (red) in the spleen from recipient mice on days 10 and 37 after the transfer of Dsg3-reactive T cell clone 162#92 or OVA-specific T cells. On day 37, Ki-67-positive T cells (arrows) were detected in mice with transplanted Dsg3-reactive T cell lines, but not in mice with transplanted OVA-specific T cells. Bars: 50 μm. Insets denote high-power views of T cells positive for BrdU or Ki-67.

FIGURE 5.

In vivo proliferative capacity of Dsg3-reactive T cell clones. A, Flow cytometric analysis of CFSE dilution in splenic CD4+TCRβ+ T cells. After Dsg3-reactive T cell clone 164#2 (pathogenic), clone 162#92 (nonpathogenic), or OVA-specific T cells were labeled with CFSE in vitro, the T cells were transferred with Dsg3−/− B cells isolated from a Dsg3-immunized Dsg3−/− mouse into Rag2−/− mice. T cells were analyzed for CFSE dilution by flow cytometry after gating on the CD4+TCRβ+ population of the splenocytes 3 and 10 days after transfer. B, Immunostaining for B220 (green), CD4 (blue), and BrdU (red) in the spleen from recipient mice 37 days after the transfer of Dsg3-reactive T cell clone 164#2 (pathogenic), clone 162#92 (nonpathogenic), or OVA-specific T cells. BrdU-bearing CD4+ T cells (arrows) were detected in the region close to the B cell area in mice with transplanted Dsg3-reactive T cell lines. C, Immunostaining for B220 (green), TCRβ (blue), and Ki-67 (red) in the spleen from recipient mice on days 10 and 37 after the transfer of Dsg3-reactive T cell clone 162#92 or OVA-specific T cells. On day 37, Ki-67-positive T cells (arrows) were detected in mice with transplanted Dsg3-reactive T cell lines, but not in mice with transplanted OVA-specific T cells. Bars: 50 μm. Insets denote high-power views of T cells positive for BrdU or Ki-67.

Close modal

Table II summarizes the antigenic Dsg3 fragments, functional TCR Vβ gene usage, and expression profiles of cytokines (IL-2, IL-4, IL-6, IL-10, IL-17, IFN-γ, and TGF-β) and chemokine receptors (CCR4, CCR7, CXCR3, CXCR5, and CRTH2) in the 20 Dsg3-reactive T cell lines evaluated for their pathogenicity, which included 13 clones. To identify T cell-derived factors associated with in vivo pathogenicity, the individual characteristics were compared between the 7 T cell lines with in vivo pathogenicity and the 13 lines without it. This analysis showed that all of the pathogenic T cell lines expressed IL-4 and IL-10, and the frequency of lines expressing IL-4 or IL-10 was significantly higher in the pathogenic than in the nonpathogenic group (p = 0.045 for both comparisons). There was no significant difference in the other characteristics between these two groups.

To examine the in vivo homing profiles of the transferred Dsg3-reactive T cell lines, spleen sections were stained with TCRβ for Dsg3-reactive T cells and with CD19 for B cells. Both the Dsg3-reactive T cell lines and the B cells had accumulated in the spleen and formed a lymphoid follicle-like structure. The Dsg3-reactive T cells were mainly detected in the T cell area, but some had infiltrated into the B cell area (Fig. 6,A). There was no difference in the number of T cells within the B cell area between mice treated with pathogenic T cell lines and those treated with nonpathogenic T cell lines (Fig. 6 B), indicating that the presence or absence of pathogenicity in the Dsg3-reactive T cell lines was not due to a difference in the in vivo homing profiles.

FIGURE 6.

In vivo homing of transferred Dsg3-reactive T cell lines in the spleen. A, A representative image of CD19 (green) and TCRβ (red) in the spleen of mice with transplanted Dsg3-reactive T cell line 161#100. Based on the distribution of CD19 and TCRβ staining, the Dsg3-reactive T cells were classified into T cells within the B cell area (pink arrowheads) and those residing outside the B cell area (yellow arrowheads). The T cell area (T) and B cell area (B) are indicated with white outlines. B, The proportion of T cells within the B cell area of the total T cells in the spleen from mice with transplanted Dsg3-reactive T cell lines, according to the presence or absence of in vivo pathogenicity. A total of 165 lymphoid follicle-like structures were analyzed. Values were averaged in 23 individual mice and compared between the pathogenic (147#48, 153#5, 161#100, and 164#2) and nonpathogenic T cell lines (146#13, 152#25, 159#11, 161#28, and 162#24). Statistical analysis was performed by the Mann-Whitney U test. Horizontal bars indicate the mean.

FIGURE 6.

In vivo homing of transferred Dsg3-reactive T cell lines in the spleen. A, A representative image of CD19 (green) and TCRβ (red) in the spleen of mice with transplanted Dsg3-reactive T cell line 161#100. Based on the distribution of CD19 and TCRβ staining, the Dsg3-reactive T cells were classified into T cells within the B cell area (pink arrowheads) and those residing outside the B cell area (yellow arrowheads). The T cell area (T) and B cell area (B) are indicated with white outlines. B, The proportion of T cells within the B cell area of the total T cells in the spleen from mice with transplanted Dsg3-reactive T cell lines, according to the presence or absence of in vivo pathogenicity. A total of 165 lymphoid follicle-like structures were analyzed. Values were averaged in 23 individual mice and compared between the pathogenic (147#48, 153#5, 161#100, and 164#2) and nonpathogenic T cell lines (146#13, 152#25, 159#11, 161#28, and 162#24). Statistical analysis was performed by the Mann-Whitney U test. Horizontal bars indicate the mean.

Close modal

We next assessed the roles of IL-4 and IL-10 released by Dsg3-reactive T cells in the mouse PV model, in vitro and in vivo. First, the IgG anti-Dsg3 Abs produced in vitro were measured in the culture supernatants of splenic B cells from rDsg3EHis-immunized Dsg3−/− mice stimulated with soluble recombinant CD40L in the presence of exogenous IL-4, IL-10, or IFN-γ. As shown in Fig. 7,A, IL-4 significantly promoted the production of IgG anti-Dsg3 Abs from primed Dsg3−/− B cells, but neither IL-10 nor IFN-γ had such activity. Next, recombinant adenovirus harboring soluble cytokine receptors (IL-4Rα, IL-10Rα, or IFN-γR1) was administered to Rag-2−/− mice via the tail vein to neutralize IL-4, IL-10, or IFN-γ in vivo. Five days later, the pathogenic Dsg3-reactive T cell clone 147#48 and primed Dsg3−/− B cells were adoptively transferred into immunodeficient mice. The in vivo expression of soluble IL-4Rα significantly suppressed the IgG anti-Dsg3 Ab production (Fig. 7,B) and the PV skin phenotype (Fig. 7 C), but the expression of soluble IL-10Rα or soluble IFN-γR1 had no effect. Concordant results were obtained from six independent experiments using clone 147#48, and from four experiments using another pathogenic clone, 164#2.

FIGURE 7.

Role of T cell-derived cytokines in experimental PV. A, IgG anti-Dsg3 Ab titers in the culture supernatants of primed B cells. Splenic B cells from rDsg3EHis-immunized Dsg3−/− mice were cultured for 7 days with recombinant soluble CD40L in the presence of IL-4, IL-10, or IFN-γ at the concentrations indicated. Values shown are the means and SD of 16 individual experiments. Statistical analysis was performed by two-tail repeated measures ANOVA. ∗, p = 0.0002; ∗∗, p = 0.008; ∗∗∗, p = 0.01. B, Effects of cytokine blockade on anti-Dsg3 Ab production in mice with transplanted Dsg3-reactive T cell clones. Serial IgG anti-Dsg3 Ab titers in plasma from mice expressing adenovirus-borne sIL-4Rα, sIL-10Rα, or sIFN-γR1 and subsequently undergoing adoptive transfer of pathogenic Dsg3-reactive T cell clone 147#48. Values are the mean and SD of six independent experiments, shown as a ratio to the Ab titer on day 28 in mock-treated mice. Statistical analysis was performed by two-tail repeated-measures ANOVA. ∗, p = 0.03; ∗∗, p = 0.04; ∗∗∗, p = 0.02. C, Effects of cytokine blockade on the skin phenotype of mice 14 days after the adoptive transfer of pathogenic Dsg3-reactive T cell clone 147#48. Note the lack of erosion or hair loss in a mouse pretreated with adenovirus vector harboring sIL-4Rα.

FIGURE 7.

Role of T cell-derived cytokines in experimental PV. A, IgG anti-Dsg3 Ab titers in the culture supernatants of primed B cells. Splenic B cells from rDsg3EHis-immunized Dsg3−/− mice were cultured for 7 days with recombinant soluble CD40L in the presence of IL-4, IL-10, or IFN-γ at the concentrations indicated. Values shown are the means and SD of 16 individual experiments. Statistical analysis was performed by two-tail repeated measures ANOVA. ∗, p = 0.0002; ∗∗, p = 0.008; ∗∗∗, p = 0.01. B, Effects of cytokine blockade on anti-Dsg3 Ab production in mice with transplanted Dsg3-reactive T cell clones. Serial IgG anti-Dsg3 Ab titers in plasma from mice expressing adenovirus-borne sIL-4Rα, sIL-10Rα, or sIFN-γR1 and subsequently undergoing adoptive transfer of pathogenic Dsg3-reactive T cell clone 147#48. Values are the mean and SD of six independent experiments, shown as a ratio to the Ab titer on day 28 in mock-treated mice. Statistical analysis was performed by two-tail repeated-measures ANOVA. ∗, p = 0.03; ∗∗, p = 0.04; ∗∗∗, p = 0.02. C, Effects of cytokine blockade on the skin phenotype of mice 14 days after the adoptive transfer of pathogenic Dsg3-reactive T cell clone 147#48. Note the lack of erosion or hair loss in a mouse pretreated with adenovirus vector harboring sIL-4Rα.

Close modal

We successfully established a novel evaluation system for the in vivo pathogenicity of Ag-specific T cells at a clonal level, by performing the adoptive transfer of in vitro-generated Ag-specific T cell clones into immunodeficient Rag-2−/− mice in combination with in vivo-primed B cells. We confirmed that the transferred Dsg3-reactive T cells proliferated persistently and homed to the secondary lymphoid tissue in vivo, but only a subset of the T cell lines were able to induce the disease phenotype. Additionally, the capacity of Dsg3-reactive T cell lines to induce anti-Dsg3 Ab production was completely concordant with the PV phenotype expression, confirming previous reports showing that the anti-Dsg3 autoantibody has a direct role in inducing PV in human patients (6) and in a mouse model (7). More importantly, this study directly demonstrates that a single Ag-specific CD4+ T cell is capable of inducing autoimmune disease phenotype through pathogenic autoantibody production. Finally, the classification of Dsg3-reactive T cell lines into pathogenic and nonpathogenic lines enabled us to identify T cell-derived IL-4 as a critical molecule driving PV in the mouse model. Our experimental system is applicable to other autoimmune diseases in which the autoimmune targets are identified, and it is useful not only for screening the in vivo pathogenicity of autoantigen-specific T cells, but also for identifying molecules and pathways critically involved in the pathogenic autoimmune process. The in vitro establishment of autoantigen-reactive T cell lines is the most time-consuming step in our procedure, but once specific T cell lines are available, their in vivo pathogenic activity and behavior can be readily evaluated.

Our in vivo finding that T cell-derived IL-4 plays a critical role in this mouse model of PV may also be relevant to human PV, because a previous report demonstrated the presence of Dsg3-reactive T cells capable of producing IL-4 in PV patients, but not in healthy controls (22). Since we showed that exogenous IL-4 directly stimulated B cells to produce anti-Dsg3 Abs in vitro, IL-4 produced by Dsg3-reactive T cells is likely to play an essential role in pathogenic anti-Dsg3 autoantibody production. Our results further indicate that IL-4 is essential but not enough to induce PV phenotype, because some of the nonpathogenic Dsg3-reactive T cell lines express IL-4. The pathogenic role of T cell-derived IL-4 has been previously investigated in mouse models for several autoantibody-mediated autoimmune diseases. For example, in experimental autoimmune myasthenia gravis, the disease phenotype is more severe and lasts longer in IL-4−/− mice, indicating a role for IL-4 in preventing the disease (23, 24). In this regard, it has been shown that acetylcholine receptor-reactive T cell clones generated from myasthenia gravis patients fail to secrete IL-4 (25), and that acetylcholine receptor-stimulated IL-4 secretion from PBMC is rarely detected in myasthenia gravis patients (26). Additionally, experimental Graves’ disease can be induced in IFN-γ−/− mice, but not in IL-4−/− mice, indicating a requirement for IL-4 in disease induction (27), while IL-4 was shown to exert an inhibitory effect in another mouse model for Graves’ disease (28). These inconsistent results suggest that the roles of IL-4 in the pathogenic processes of autoantibody-mediated autoimmune diseases are complex, but they may also reflect the limitation of studies using gene-deficient mice to evaluate the roles of cytokines in autoimmune pathogenesis. Congenital defects in systemic cytokine production are known to affect the physiologic development of the immune system. Moreover, IL-4 secreted by non-T cells could potentially regulate the autoimmune pathogenesis. Our system enables the in vivo effector function of autoreactive T cell clones to be evaluated without the influence of these factors.

It is unclear what determines the nature of Dsg3-reactive T cells in terms of pathogenicity. Our results clearly show that there were a wide variety of gene expression profiles among Dsg3-reacive T cell clones. This heterogeneity is probably generated in a hierarchy during T cell development, and Dsg3-reactive T cells with all of the quantitative and qualitative features required for the PV phenotype induction in our experimental system were regarded as pathogenic clones. Therefore, it is probable that nonpathogenic Dsg3-reactive T cell clones may be able to induce the PV phenotype when missing factors would be supplemented with an appropriate microenvironment. In this regard, it would be interesting to examine if transfer of a large number of the nonpathogenic T cell clone or transfer of the nonpathogenic T cell clone in the presence of exogenous IL-4 would induce the PV phenotype.

Although systemic corticosteroids and other immunosuppressants have been shown to reduce the mortality rate in PV patients, some cases are still refractory to these conventional therapies (29). Recent reports showing remarkable effects of biologics targeting molecules critically involved in the pathogenic process, such as TNF-α and IL-6, have resulted in dramatic changes in the treatment algorithms of several inflammatory diseases, including rheumatoid arthritis and Crohn’s disease (30, 31, 32). Therefore, anti-IL-4 biologics are a potential therapeutic strategy for refractory PV. In this regard, humanized anti-IL-4 mAb and soluble IL-4Rα have already been manufactured for the treatment of allergic diseases, such as asthma, and shown to be well tolerated in clinical trials (33, 34). Further studies are necessary to evaluate the efficacy of anti-IL-4 biologics in patients with severe PV.

We are grateful to S. Koyasu (Keio University) for providing the Rag-2−/− OT-II transgenic mice, T. Randall and K. Kusser (Trudeau Institute) for advice on BrdU staining, S. Ito for mouse management, and M. Suzuki for the preparation of cryosections.

The authors have no financial conflicts of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan, the Health and Labour Sciences Research Grants for Research on Measures for Intractable Diseases from Ministry of Health, Labor and Welfare of Japan, and Keio Gakuji Academic Development Funds.

3

Abbreviations used in this paper: Dsg3, desmoglein 3; PV, pemphigus vulgaris; MalBP, maltose-binding protein.

1
Janeway, C. A., Jr, P. Travers, M. Walport, M. J. Shlomchik.
2005
. Autoimmunity and transplantation. E. Lawrence, Jr, ed.
Immunobiology, the Immune System in Health and Disease
6th Ed.
557
-612. Garland Science Publishing, New York.
2
Kuwana, M., T. A. Medsger, Jr, T. M. Wright.
2000
. Analysis of soluble and cell surface factors regulating anti-DNA topoisomerase I autoantibody production demonstrates synergy between Th1 and Th2 autoreactive T cells.
J. Immunol.
164
:
6138
-6146.
3
Zamvil, S., P. Nelson, J. Trotter, D. Mitchell, R. Knobler, R. Fritz, L. Steinman.
1985
. T-cell clones specific for myelin basic protein induce chronic relapsing paralysis and demyelination.
Nature
317
:
355
-358.
4
Utsugi, T., J. W. Yoon, B. J. Park, M. Imamura, N. Averill, S. Kawazu, P. Santamaria.
1996
. Major histocompatibility complex class I-restricted infiltration and destruction of pancreatic islets by NOD mouse-derived β-cell cytotoxic CD8+ T-cell clones in vivo.
Diabetes
45
:
1121
-1131.
5
Amagai, M., V. Klaus-Kovtun, J. R. Stanley.
1991
. Autoantibodies against a novel epithelial cadherin in pemphigus vulgaris, a disease of cell adhesion.
Cell
67
:
869
-877.
6
Amagai, M., T. Hashimoto, N. Shimizu, T. Nishikawa.
1994
. Absorption of pathogenic autoantibodies by the extracellular domain of pemphigus vulgaris antigen (Dsg3) produced by baculovirus.
J. Clin. Invest.
94
:
59
-67.
7
Tsunoda, K., T. Ota, M. Aoki, T. Yamada, T. Nagai, T. Nakagawa, S. Koyasu, T. Nishikawa, M. Amagai.
2003
. Induction of pemphigus phenotype by a mouse monoclonal antibody against the amino-terminal adhesive interface of desmoglein 3.
J. Immunol.
170
:
2170
-2178.
8
Koch, P. J., M. G. Mahoney, H. Ishikawa, L. Pulkkinen, J. Uitto, L. Shultz, G. F. Murphy, D. Whitaker-Menezes, J. R. Stanley.
1997
. Targeted disruption of the pemphigus vulgaris antigen (desmoglein 3) gene in mice causes loss of keratinocyte cell adhesion with a phenotype similar to pemphigus vulgaris.
J. Cell Biol.
137
:
1091
-1102.
9
Barnden, M. J., J. Allison, W. R. Heath, F. R. Carbone.
1998
. Defective TCR expression in transgenic mice constructed using cDNA-based α- and β-chain genes under the control of heterologous regulatory elements.
Immunol. Cell Biol.
76
:
34
-40.
10
Amagai, M., K. Tsunoda, H. Suzuki, K. Nishifuji, S. Koyasu, T. Nishikawa.
2000
. Use of autoantigen-knockout mice in developing an active autoimmune disease model for pemphigus.
J. Clin. Invest.
105
:
625
-631.
11
Kuwana, M., T. A. Medsger, Jr, T. M. Wright.
1995
. T cell proliferative response induced by DNA topoisomerase I in patients with systemic sclerosis and healthy donors.
J. Clin. Invest.
96
:
586
-596.
12
Wood, M., P. Perrotte, E. Onishi, M. E. Harper, C. Dinney, L. Pagliaro, D. R. Wilson.
1999
. Biodistribution of an adenoviral vector carrying the luciferase reporter gene following intravesical or intravenous administration to a mouse.
Cancer Gene Ther.
6
:
367
-372.
13
Casanova, J. L., P. Romero, C. Widmann, P. Kourilsky, J. L. Maryanski.
1991
. T cell receptor genes in a series of class I major histocompatibility complex-restricted cytotoxic T lymphocyte clones specific for a Plasmodium berghei nonapeptide: implications for T cell allelic exclusion and antigen-specific repertoire.
J. Exp. Med.
174
:
1371
-1383.
14
Baker, F. J., M. Lee, Y. H. Chien, M. M. Davis.
2002
. Restricted islet-cell reactive T cell repertoire of early pancreatic islet infiltrates in NOD mice.
Proc. Natl. Acad. Sci. USA
99
:
9374
-9379.
15
Friedman, T. M., M. Gilbert, C. Briggs, R. Korngold.
1998
. Repertoire analysis of CD8+ T cell responses to minor histocompatibility antigens involved in graft-versus-host disease.
J. Immunol.
161
:
41
-48.
16
Moyron-Quiroz, J. E., J. Rangel-Moreno, K. Kusser, L. Hartson, F. Sprague, S. Goodrich, D. L. Woodland, F. E. Lund, T. D. Randall.
2004
. Role of inducible bronchus associated lymphoid tissue (iBALT) in respiratory immunity.
Nat. Med.
10
:
927
-934.
17
Tsunoda, K., T. Ota, H. Suzuki, M. Ohyama, T. Nagai, T. Nishikawa, M. Amagai, S. Koyasu.
2002
. Pathogenic autoantibody production requires loss of tolerance against desmoglein 3 in both T and B cells in experimental pemphigus vulgaris.
Eur. J. Immunol.
32
:
627
-633.
18
Freitas, A. A., B. B. Rocha.
1993
. Lymphocyte lifespans: homeostasis, selection and competition.
Immunol. Today
14
:
25
-29.
19
Bell, E. B., S. M. Sparshott.
1997
. The peripheral T-cell pool: regulation by non-antigen induced proliferation?.
Semin. Immunol.
9
:
347
-353.
20
Jameson, S. C..
2002
. Maintaining the norm: T-cell homeostasis.
Nat. Rev. Immunol.
2
:
547
-556.
21
Cannons, J. L., L. J. Yu, D. Jankovic, S. Crotty, R. Horai, M. Kirby, S. Anderson, A. W. Cheever, A. Sher, P. L. Schwartzberg.
2006
. SAP regulates T cell-mediated help for humoral immunity by a mechanism distinct from cytokine regulation.
J. Exp. Med.
203
:
1551
-1565.
22
Veldman, C. M., K. L. Gebhard, W. Uter, R. Wassmuth, J. Grotzinger, E. Schultz, M. Hertl.
2004
. T cell recognition of desmoglein 3 peptides in patients with pemphigus vulgaris and healthy individuals.
J. Immunol.
172
:
3883
-3892.
23
Balasa, B., C. Deng, J. Lee, P. Christadoss, N. Sarvetnick.
1998
. The Th2 cytokine IL-4 is not required for the progression of antibody-dependent autoimmune myasthenia gravis.
J. Immunol.
161
:
2856
-2862.
24
Ostlie, N., M. Milani, W. Wang, D. Okita, B. M. Conti-Fine.
2003
. Absence of IL-4 facilitates the development of chronic autoimmune myasthenia gravis in C57BL/6 mice.
J. Immunol.
170
:
604
-612.
25
Moiola, L., P. Karachunski, M. P. Protti, J. F. Howard, Jr, B. M. Conti-Tronconi.
1994
. Epitopes on the β subunit of human muscle acetylcholine receptor recognized by CD4+ cells of myasthenia gravis patients and healthy subjects.
J. Clin. Invest.
93
:
1020
-1028.
26
Yi, Q., R. Ahlberg, R. Pirskanen, A. K. Lefvert.
1994
. Acetylcholine receptor-reactive T cells in myasthenia gravis: evidence for the involvement of different subpopulations of T helper cells.
J. Neuroimmunol.
50
:
177
-186.
27
Dogan, R. N., C. Vasu, M. J. Holterman, B. S. Prabhakar.
2003
. Absence of IL-4, and not suppression of the Th2 response, prevents development of experimental autoimmune Graves’ disease.
J. Immunol.
170
:
2195
-2204.
28
Nagayama, Y., H. Mizuguchi, T. Hayakawa, M. Niwa, S. M. McLachlan, B. Rapoport.
2003
. Prevention of autoantibody-mediated Graves’-like hyperthyroidism in mice with IL-4, a Th2 cytokine.
J. Immunol.
170
:
3522
-3527.
29
Harman, K. E., S. Albert, M. M. Black.
2003
. Guidelines for the management of pemphigus vulgaris.
Br. J. Dermatol.
149
:
926
-937.
30
Elliott, M. J., R. N. Maini, M. Feldmann, J. R. Kalden, C. Antoni, J. S. Smolen, B. Leeb, F. C. Breedveld, J. D. Macfarlane, H. Bijl, et al
1994
. Randomised double-blind comparison of chimeric monoclonal antibody to tumour necrosis factor alpha (cA2) versus placebo in rheumatoid arthritis.
Lancet
344
:
1105
-1110.
31
Stack, W. A., S. D. Mann, A. J. Roy, P. Heath, M. Sopwith, J. Freeman, G. Holmes, R. Long, A. Forbes, M. A. Kamm.
1997
. Randomised controlled trial of CDP571 antibody to tumour necrosis factor-alpha in Crohn’s disease.
Lancet
349
:
521
-524.
32
Choy, E. H., D. A. Isenberg, T. Garrood, S. Farrow, Y. Ioannou, H. Bird, N. Cheung, B. Williams, B. Hazleman, R. Price, et al
2002
. Therapeutic benefit of blocking interleukin-6 activity with an anti-interleukin-6 receptor monoclonal antibody in rheumatoid arthritis: a randomized, double-blind, placebo-controlled, dose-escalation trial.
Arthritis Rheum.
46
:
3143
-3150.
33
Hart, T. K., M. N. Blackburn, M. Brigham-Burke, K. Dede, N. Al-Mahdi, P. Zia-Amirhosseini, R. M. Cook.
2002
. Preclinical efficacy and safety of pascolizumab (SB 240683): a humanized anti-interleukin-4 antibody with therapeutic potential in asthma.
Clin. Exp. Immunol.
130
:
93
-100.
34
Borish, L. C., H. S. Nelson, M. J. Lanz, L. Claussen, J. B. Whitmore, J. M. Agosti, L. Garrison.
1999
. Interleukin-4 receptor in moderate atopic asthma: a phase I/II randomized, placebo-controlled trial.
Am. J. Respir. Crit. Care Med.
160
:
1816
-1823.