Virus-immune CD8+ TCR repertoires specific for particular peptide-MHC class I complexes may be substantially shared between (public), or unique to, individuals (private). Because public TCRs can show reduced TdT-mediated N-region additions, we analyzed how TdT shapes the heavily public (to DbNP366) and essentially private (to DbPA224) CTL repertoires generated following influenza A virus infection of C57BL/6 (B6, H2b) mice. The DbNP366-specific CTL response was virtually clonal in TdT−/− B6 animals, with one of the three public clonotypes prominent in the wild-type (wt) response consistently dominating the TdT−/− set. Furthermore, this massive narrowing of TCR selection for DbNP366 reduced the magnitude of DbNP366-specific CTL response in the virus-infected lung. Conversely, the DbPA224-specific responses remained comparable in both magnitude and TCR diversity within individual TdT−/− and wt mice. However, the extent of TCR diversity across the total population was significantly reduced, with the consequence that the normally private wt DbPA224-specific repertoire was now substantially public across the TdT−/− mouse population. The key finding is thus that the role of TdT in ensuring enhanced diversity and the selection of private TCR repertoires promotes optimal CD8+ T cell immunity, both within individuals and across the species as a whole.

Host response profiles tend to be highly consistent for virus-specific CD8+ T cell-mediated immunity, with the same few epitopes being targeted in individuals sharing MHC class I haplotypes. This reproducibility can extend to epitope-specific T cell responses with, in some cases, the same TCRs (usually defined at the level of identical CDR3β amino acid sequence) being used repeatedly in different individuals to constitute an essentially public TCR repertoire (1). Alternatively, part (or all) of an epitope-specific TCR response may be substantially private to a given individual. Overall, a TCR repertoire is defined as broadly public or private by the extent to which the response is shared or unique (2, 3). This private vs public character looks to be determined by the particular peptide plus MHC (pMHC)4 epitope, the extent and character of the available naive TCRs, and the stochastic nature of T cell Ag encounter and activation (4).

Diversity within the TCR repertoire is generated via several mechanisms. Although different combinations of V, D, and J gene segments, along with the pairing of various TCR α- and β (or γ and δ)-chains, provide a measure of variability, much greater levels of diversity are generated at the junctions of the V, D, and J gene segments by template-dependent (P additions) and template-independent (N regions) nucleotide additions. The role of TdT as the DNA polymerase responsible for the template-independent addition of nucleotides during both TCR and Ab gene rearrangement has long been established (5, 6), with studies in mice genetically deficient in this enzyme showing that it is normally responsible for establishing at least 90% of the naive TCRαβ repertoire (7). Even so, despite the fact that the more limited TCR pool in TdT−/− animals results in a very substantial narrowing in epitope-specific TCR diversity, the responses to multiple epitopes in TdT−/− mice are generally comparable in magnitude to those elicited in the wild-type (wt) controls (8, 9).

The present analysis focuses on the role of TdT in determining the private or public nature of virus-specific CD8+ T cell TCRβ repertoires. Prior analysis with a number of epitope-specific T cell responses has shown that public TCR clonotypes have a substantially reduced number of N-region additions (8, 10), a finding that has in turn contributed to the idea that such TCRs tend to be both public and dominant within individuals because they are more readily generated by the recombination machinery (10). In this study, we analyze the simultaneous establishment of distinctive CD8+ T cell repertoires, directed at H2Db complexed with peptides from the influenza A virus nucleoprotein (DbNP366–374) and acid polymerase (DbPA224–233), in virus-infected wt and TdT−/− C57BL/6 mice. Although both nucleoprotein (NP)366 and acid polymerase (PA)224 bind to H2Db, they induce different TCRVβ biases, each with unique preferences for CDR3β length and Jβ usage (11, 12). Importantly, detailed CDR3β sequence analysis has established that whereas the wt DbNP366-specific repertoire tends to be restricted in clonotype diversity and is heavily public, the wt DbPA224-specific population is much more individualized, or private. This has allowed us to probe how TdT determines TCR repertoire diversity, the extent of sharing (public) or uniqueness (private), and response magnitude for parallel, in vivo viral epitope-specific CD8+ T cell responses.

Female C56Bl/6J (H-2b) mice were purchased from The Jackson Laboratory, and TdT−/− mice (5) were a gift from A. Feeney (Scripps Research Institute, La Jolla, CA). Naive mice were anesthetized by i.p. injection of 2,2,2-tribromoethanol (Avertin) (250 mg/kg) and primed intranasally (i.n.) with 106 EID50 of the HKx31 (H3N2), an influenza A virus (13), in 30 μl of PBS. Memory mice were primed by i.p. injection with 108 EID50 of the serologically distinct A/Puerto Rico/8/34 influenza A virus (PR8; H1N1) that shares NP and PA proteins of HK × 31 (14, 15), then challenged i.n. with HK × 31 virus at least 4 wk later to generate a secondary response. Virus stocks were grown in the allantoic cavity of 10-day embryonated hen’s eggs and quantified as EID50. All animal work was performed in compliance with the guidelines set forth by the St. Jude Research Children’s Hospital Animal Experimental Ethics Committee.

Spleens and bronchoalveolar lavage (BAL) samples were recovered from mice at the acute (day 10) and memory (day 33) phases of primary infection or acute (day 8) time point of the secondary response. BAL samples were incubated on plastic petri dishes for 1 h at 37°C to remove macrophages. Spleens were disrupted and enriched for CD8+ T cells by panning on goat anti-mouse IgG and IgM Ab-coated plates (Jackson ImmunoResearch Laboratories) for 1 h at 37°C. Cells were washed and resuspended either in FACS buffer (1% BSA/0.02% NaN3 in PBS) for phenotypic analysis or sort buffer (0.1% BSA in PBS) for single-cell sorting.

CD8+ T cell-enriched lymphocytes from spleen and BAL were stained with DbNP366 or DbPA224 tetramers conjugated to streptavidin-PE (Molecular Probes) for 60 min at room temperature. Cells were washed twice in FACS buffer (10% BSA/0.02% NaN3 in PBS) and stained with anti-CD8α FITC (BD Pharmingen) for 30 min on ice, washed twice, and analyzed by flow cytometry. For investigation of TCR avidity, the relative off-rates of TCR binding were determined by tetramer dissociation (16, 17, 18). Briefly, cells were stained with tetramer, then incubated in the presence of anti-H2Db Ab (28-14-8; BD Pharmingen) at 5 μg/ml at 37°C to prevent tetramer rebinding. At designated times, cells were removed into FACS buffer and placed on ice, stained with anti-CD8α FITC, and analyzed by flow cytometry. Loss of tetramer+ CD8+ T cells at particular time points was calculated relative to tetramer staining at t = 0 min.

Enriched T cell populations from spleen and BAL samples were stimulated with the NP366 (ASNENMETM) or PA224 (SSLENFRAYV) peptides (Hartwell Center, St. Jude Children’s Research Hospital) for 5 h in 200 μl of complete RPMI 1640 medium containing 1 μg/ml Golgi-Plug (BD Pharmingen) and 10 U/ml human rIL-2 (Roche). Cells were washed in FACS buffer and stained with anti-CD8α PerCP-Cy5.5 (BD Pharmingen) for 30 min on ice. After two washes, cells were fixed and permeabilized using BD Cytofix/Cytoperm kit (BD Pharmingen), according to manufacturer’s instructions. Subsequently, cells were stained with anti-IFN-γ FITC, anti-TNF-α allophycocyanin, and anti-IL-2 PE (BD Pharmingen) for 30 min on ice. After two washes, cells were analyzed by flow cytometry using a FACSCalibur flow cytometer (BD Immunocytometry Systems).

Lymphocytes from spleens of primary or secondary mice were stained with either the DbNP366-PE or DbPA224-PE tetramers for 1 h at room temperature. Cells were then washed twice, stained with anti-CD8α allophycocyanin, and a panel of anti-Vβ mAbs conjugated to FITC, for 30 min at 4°C (all from BD Pharmingen). After two washes, lymphocytes were analyzed by flow cytometry.

CD8+ T cell-enriched lymphocyte populations were stained either with DbNP366-PE or DbPA224-PE for 60 min at room temperature, followed by two washes in sort buffer. Cells were then stained with anti-CD8α allophycocyanin, and anti-Vβ8.3 FITC, or anti-Vβ7 FITC mAbs for DbNP366+CD8+ or DbPA224+CD8+ T cells, respectively. Individual DbNP336+Vβ8.3+CD8+ or DbPA224+Vβ7+CD8+ T cells were sorted, using a MoFlo sorter (DakoCytomation), into wells of a 96-well PCR plate (Brinkman Instruments). Negative controls were interspersed between the samples (1 in 10), and 80 cells were sorted per plate. cDNA synthesis was performed in 5 μl of cDNA reaction mix (11, 12) for 90 min at 37°C, followed by 5 min at 95°C. The Vβ8.3 and Vβ7 cDNA was then amplified by nested PCR, and the purified PCR products were sequenced (11, 12).

We focused on a set of statistics to describe clonotype diversity within and between individuals and clonotype sharing between individuals. The Simpson’s diversity index (D) (19, 20) is calculated as: D = Σ (n[Ni − 1])/N[N − 1] where ni is the number of individuals in the ith species, and N is the total number of individuals in the whole population. This is a measure of diversity, and it is expressed as 1-D so that a higher number corresponds to a higher level of diversity.

To measure clonotype sharing, we have determined the proportion of sequences that are found in a specific percentage of mice that have been examined. This is referred to as proportion of TCRs in common (PTICq), with the q referring to the percentage of mice in which the sequences must be found. For example, the PTIC0.4 would be calculated as: Σ nq/N for all sequences “n” where “n” is present in at least 40% (q) of the mice. Essentially, PTICq calculates the proportion of clones that are shared, based on a given percentage of sharing, q.

Student’s t tests were used to determine significance for all individual statistical comparisons. For population-level comparisons of Simpson’s diversity, we used EstimateS v 7.51 (21). The statistics presented are generated by random sampling with replacement from our database of wt primary and secondary DbNP366- and DbPA224-specific sequences, or the TdT sequences determined in this study. The statistics represent the average Simpson’s diversity index of sequences pooled from four mice generated by 10,000 randomizations, to compare our wt data directly with the four mice in each TdT−/− group.

A broad investigation of DbNP366- and DbPA224-specific CD8+ T cell repertoires in TdT−/− mice was initiated to analyze profiles of TCRVβ usage in wt and TdT−/− mice infected i.n. with the HKx31 influenza virus. Previous studies identified substantial, yet distinct Vβ biases in the DbNP366- and DbPA224-specific T cell responses, with Vβ8.3+ T cells constituting ∼30–50% of the DbNP366-specific response (22, 23), and Vβ7+ cells comprising 50–65% of the DbPA224-specific population (12, 24). Interestingly, for both the DbNP366- and DbPA224-specific sets, there was a significant increase (to 77 and 81%, respectively) in the proportion of CD8+ T cells expressing the preferred Vβ8.3+ or Vβ7+ TCRs in TdT−/− mice (Fig. 1). Thus, a clear narrowing in TCRβ diversity was already evident at this superficial level of analysis.

FIGURE 1.

Vβ bias within DbNP366+CD8+ and DbPA224+CD8+ T cells in TdT−/− mice. TCRVβ usage within DbNP366+CD8+ and DbPA224+CD8+ T cell populations was compared for B6 and TdT−/− mice at day 10 following primary influenza virus infection. Splenocytes were stained with DbNP366 or DbPA224 tetramers, and anti-CD8α and anti-Vβ mAbs. Tetramer+ CD8+ cells were analyzed for the spectrum of Vβ usage. Data from four to five mice per group are expressed as a pie chart with the mean ± SD of the dominant Vβ shown. ∗, Statistical comparisons (using Student’s t test) are made for the dominant Vβ usage between wt and TdT−/− groups.

FIGURE 1.

Vβ bias within DbNP366+CD8+ and DbPA224+CD8+ T cells in TdT−/− mice. TCRVβ usage within DbNP366+CD8+ and DbPA224+CD8+ T cell populations was compared for B6 and TdT−/− mice at day 10 following primary influenza virus infection. Splenocytes were stained with DbNP366 or DbPA224 tetramers, and anti-CD8α and anti-Vβ mAbs. Tetramer+ CD8+ cells were analyzed for the spectrum of Vβ usage. Data from four to five mice per group are expressed as a pie chart with the mean ± SD of the dominant Vβ shown. ∗, Statistical comparisons (using Student’s t test) are made for the dominant Vβ usage between wt and TdT−/− groups.

Close modal

Single-cell CDR3β sequencing was then used to analyze sorted CD8+Vβ8.3+DbNP366- and CD8+Vβ7+DbPA224-specific cells from TdT−/− mice, for comparison with the extensive database of wt DbNP366 and DbPA224 sequences that have been generated using the same methodology (11, 12, 25). The results obtained following both primary (Tables I and II) and secondary (data not shown) challenge were broadly comparable. Initial analysis of the DbNP366- and DbPA224-specific CDR3β profiles from TdT−/− animals showed that the characteristic modal CDR3β lengths (9 and 6 aa, respectively) were maintained, as were the respective preferences for Jβ2S2 and Jβ2S6 (however, the contribution of Jβ1S4 was increased in the DbPA224-specific population) (Tables I and II) (3, 11, 12). Beyond that, though, there were major differences between wt and TdT−/− mice for both the DbNP366- and DbPA224-specific repertoires.

Table I.

TCRβ repertoire of DbNP366+Vβ8.3+CD8+ T cells in TdT−/− mice following primary influenza A virus infection

CDR3β RegionaaaFrequency
M1M2M3M4
SGGANTGQL 2S2 44 43 59 53 
SGGGNTGQL 2S2   
Number of sequences   45 43 62 53 
CDR3β RegionaaaFrequency
M1M2M3M4
SGGANTGQL 2S2 44 43 59 53 
SGGGNTGQL 2S2   
Number of sequences   45 43 62 53 
a

mRNA from individual sorted cells isolated from TdT−/− mice at the acute phase following primary infection was reverse transcribed followed by two rounds of nested Vβ8.3-specific PCR amplification. The PCR products were purified and sequenced using the internal Vβ8.3 oligonucleotide primer.

Table II.

TCRβ repertoire of DbPA224+Vβ7+CD8+ T cells in TdT−/− mice following primary influenza A virus infection

CDR3β RegionaaaFrequency
M1M2M3M4
SLGGEQb 2S6 10 15 4 1 
SLGAEQ 2S1 6 2 2 3 2 
SQGERL 1S4 6 13 10 8 5 
SLGERL 1S4 6 6 2 8 8 
TGGERL 1S4 6 5 1 6 1 
SWGGEQ 2S6 
SLGAEV 1S1  
SWGDTL 2S4  
SGGAEQ 2S6  
SWGDTQ 2S5  
SSGERL 1S4  
TGGAEQ 2S1  
SWGAEQ 2S1  
SWGAEQ 2S6   
SGGAEV 1S1   
TGGTGQL 2S2   
TNTGQL 2S2   
SQGAEV 1S1   
SGGQAP 1S5    
SLGDEQ 2S6    
SFGGEQ 2S6    
TGGDEQ 2S6    
SLGGAV 1S1    
SSAETL 2S3    
STGGEV 1S1    
TAETL 2S3    
SLGREQ 2S6    
SRGERL 1S4    
SSGGEQ 2S6    
SSGTAP 1S5    
SSYEQ 2S6    
SWGDEQ 2S6    
TGGAAP 1S5    
TGGAEV 1S1    
STGERL 1S4    
SSGAEV 1S1    
SLDRAEV 1S1    
SLGGAQ 2S6    
STGGEQ 2S6    
Number of sequences   53 52 53 43 
CDR3β RegionaaaFrequency
M1M2M3M4
SLGGEQb 2S6 10 15 4 1 
SLGAEQ 2S1 6 2 2 3 2 
SQGERL 1S4 6 13 10 8 5 
SLGERL 1S4 6 6 2 8 8 
TGGERL 1S4 6 5 1 6 1 
SWGGEQ 2S6 
SLGAEV 1S1  
SWGDTL 2S4  
SGGAEQ 2S6  
SWGDTQ 2S5  
SSGERL 1S4  
TGGAEQ 2S1  
SWGAEQ 2S1  
SWGAEQ 2S6   
SGGAEV 1S1   
TGGTGQL 2S2   
TNTGQL 2S2   
SQGAEV 1S1   
SGGQAP 1S5    
SLGDEQ 2S6    
SFGGEQ 2S6    
TGGDEQ 2S6    
SLGGAV 1S1    
SSAETL 2S3    
STGGEV 1S1    
TAETL 2S3    
SLGREQ 2S6    
SRGERL 1S4    
SSGGEQ 2S6    
SSGTAP 1S5    
SSYEQ 2S6    
SWGDEQ 2S6    
TGGAAP 1S5    
TGGAEV 1S1    
STGERL 1S4    
SSGAEV 1S1    
SLDRAEV 1S1    
SLGGAQ 2S6    
STGGEQ 2S6    
Number of sequences   53 52 53 43 
a

mRNA from individual sorted cells isolated from TdT−/− mice at the acute phase following primary infection was reverse transcribed followed by two rounds of nested Vβ7-specific PCR amplification. The PCR products were purified and sequenced using the internal Vβ7 oligonucleotide primer.

b

Shown in bold are public sequences found in all 8 mice analyzed (4 × 1°, 4 × 2°).

Compared with the wt DbNP366-specific repertoire, which normally uses 5–10 clonotypes per individual, the TdT−/− DbNP366-specific set was virtually clonal, with 95–100% of the Vβ8.3+ response (which now constituted 77% of the DbNP366-specific repertoire) using a single CDR3β clonotype (SGGANTGQL). However, despite the extreme restriction at the amino acid level, there was some diversity in the nucleotide usage, with a total of four different nucleotide sequences encoding the SGGANTGQL clonotype, and two encoding the SGGGNTGQL sequence (Table III). Although the SGGANTGQL clonotype is often prominent in wt DbNP366-specific responses (11), it is one of several such clonotypes, the remainder of which were absent from the eight TdT−/− animals tested. Interestingly, the only other CDR3β observed in the TdT−/− mice (SGGGNTGQL) can be both dominant and public in wt responses, but it was never a major component of the TdT−/− animals (Table I and data not shown).

Table III.

Nucleotide sequences encoding DbNP366-specific CDR3β aa clonotypes in TdT−/− mice

DbNP366-specific CDR3βaN AdditionsFrequency
Primary, d10Secondary, d8
M1M2M3M4M1M2M3M4
SGGANTGQL  44a 43 59 53 41 122 32 38 
agtgggggggcaaacaccgggcagctc 44 39 58 52 30 115 29 36 
agtgggggggcgaacaccgggcagctc  4 1 1 1 1 2  
agtgggggcgcaaacaccgggcagctc     10 4 1 2 
agtgggggagcaaacaccgggcagctc      2   
SGGGNTGQL  1  3  1    
agtggggggggaaacaccgggcagctc 1    1    
agtggggggggcaacaccgggcagctc   3      
Number of sequences  45 43 62 53 42 122 32 38 
DbNP366-specific CDR3βaN AdditionsFrequency
Primary, d10Secondary, d8
M1M2M3M4M1M2M3M4
SGGANTGQL  44a 43 59 53 41 122 32 38 
agtgggggggcaaacaccgggcagctc 44 39 58 52 30 115 29 36 
agtgggggggcgaacaccgggcagctc  4 1 1 1 1 2  
agtgggggcgcaaacaccgggcagctc     10 4 1 2 
agtgggggagcaaacaccgggcagctc      2   
SGGGNTGQL  1  3  1    
agtggggggggaaacaccgggcagctc 1    1    
agtggggggggcaacaccgggcagctc   3      
Number of sequences  45 43 62 53 42 122 32 38 
a

Numbers shown in bold are the frequencies of amino acid clonotypes in each mouse, and the numbers in italics depict the frequency of nucleotide sequences encoding those amino acid clonotypes.

In an attempt to explain this observation, detailed analysis was performed on the number of different ways that these normally public amino acid sequences can potentially be generated in the presence (demonstrated using a simulation of a random V(D)J recombination process that allowed for up to 10 N-additions and generated one million in-frame TCR CDR3β sequences using the Vβ8.3 and Jβ2S2 genes (10)) or absence of N-region addition. If both the diversity in nucleotide sequences as well as the varied possibilities for generating each nucleotide sequence (i.e., recombination mechanisms, referring to the fact that certain nucleotides in a CDR3β sequence have the potential to be encoded by more than one gene segment or by N-region addition (10)) are taken into account, SGGANTGQL, SGGGNTGQL, and SGGSNTGQL can all be independently generated in a vast number of different ways in wt mice (as demonstrated by the 130, 80, and 60 different ways, respectively, that these sequences were made in the simulation) (Table IV). This most likely contributes to the dominance and public nature of these clonotypes in the wt DbNP366-specific response (10, 26). In the absence of N-region addition, however, the SGGANTGQL clonotype, which is prominent in the TdT−/− responses, can be encoded by four different nucleotide sequences, three of which can also be made by several different possible recombination mechanisms. The SGGGNTGQL clonotype, which is less prevalent in the responses in the TdT−/− mice, can be encoded by two germline-encoded nucleotide sequences, but there is only one way that each of these can be made (Table IV). The public SGGSNTGQL clonotype that is observed in wt mice, but not the TdT−/− mice, cannot be made without at least one N-addition and, even with a single N-addition, can only be made two ways (Table IV). Thus, it appears that the dominance of SGGANTGQL and the infrequency (or absence) of the other two typically public DbNP366-specific clonotypes in TdT−/− mice most likely arise as a consequence of a shift in the precursor numbers of these clonotypes due to their differential dependence on N-region addition.

Table IV.

A comparison of the production mechanisms of public DbNP366-specific CDR3β amino acid sequences with and without N-addition

a Shown are the nucleotide sequences that encode commonly public DbNP366-specific CDR3β amino acid sequences and require a minimal number of N-additions to be produced. One possible V(D)J recombination mechanism is shown for each nucleotide sequence, with the nucleotides attributed by the germline Vβ, Dβ, and Jβ genes shown in blue, red, and green, respectively. N-additions are shown in black and p-additions are shown in bold text. The number of possible recombination mechanisms that can produce these TCR sequences with no N-additions are shown. These different recombination mechanisms involve different splicings of the germline TCR genes and different p-additions (see Ref. 10 for more detail on different recombination mechanisms). Also shown is the number of different recombination mechanisms, allowing for up to 10 N-additions, determined from a simulation of a random V(D)J recombination process that generated one million in-frame CDR3β sequences using the Vβ8.3 and Jβ2S2 germline genes (10 ).

Table IV.

A comparison of the production mechanisms of public DbNP366-specific CDR3β amino acid sequences with and without N-addition

a Shown are the nucleotide sequences that encode commonly public DbNP366-specific CDR3β amino acid sequences and require a minimal number of N-additions to be produced. One possible V(D)J recombination mechanism is shown for each nucleotide sequence, with the nucleotides attributed by the germline Vβ, Dβ, and Jβ genes shown in blue, red, and green, respectively. N-additions are shown in black and p-additions are shown in bold text. The number of possible recombination mechanisms that can produce these TCR sequences with no N-additions are shown. These different recombination mechanisms involve different splicings of the germline TCR genes and different p-additions (see Ref. 10 for more detail on different recombination mechanisms). Also shown is the number of different recombination mechanisms, allowing for up to 10 N-additions, determined from a simulation of a random V(D)J recombination process that generated one million in-frame CDR3β sequences using the Vβ8.3 and Jβ2S2 germline genes (10 ).

Close modal

Although the CDR3β amino acid motifs associated with DbPA224-specific recognition were obviously maintained in the TdT−/− repertoire, and several of these clonotypes could be identified in the wt DbPA224-specific repertoires (12), some previously unidentified or rare clonotypes dominated. Of the five public clonotypes (Table II, shown in bold) observed in the DbPA224-specific repertoire in TdT−/− animals (note that SWGGEQ was not observed in all mice following secondary infection), only three have been seen in wt DbPA224-specific repertoires across multiple individuals (SLGERL, 7 of 29 mice; SLGGEQ, 9 of 29 mice; SLGAEQ, 9 of 29 mice). This suggests that the restriction imposed by a lack of TdT has forced the appearance and/or dominance of typically rare clonotypes.

The following analyses (Fig. 2) exploit two distinct approaches for assessing TCRβ diversity. The first reflects diversity at a population level across all the mice that were analyzed, whereas the second measures TCRβ diversity within those individuals. The overall analysis of clonotype diversity at a population level showed that both the DbNP366- and DbPA224-specific CTL repertoires were significantly more restricted in TdT−/− compared with wt animals following both primary and secondary infection (Fig. 2,A). Interestingly, however, whereas the restriction in population diversity was also reflected within individuals for the DbNP366 repertoire (Fig. 2,B, left panel), the spectrum “within mouse” diversity was unchanged for the DbPA224-specific repertoire between wt and TdT−/− animals (Fig. 2 B, right panel), reflecting that ∼15–20 clonotypes were commonly observed in both cases (3, 12).

FIGURE 2.

CDR3β clonotypic diversity in TdT−/− mice. Individual CD8+Vβ8.3+DbNP366+ or CD8+Vβ7+DbPA224+ cells were sorted from wt or TdT−/− splenocytes harvested at acute primary (day 10) or secondary (day 8) time points after infection. mRNA was reverse transcribed, followed by nested Vβ8.3- or Vβ7-specific PCR. PCR products were purified and sequenced, and individual clonotypes were defined according to CDR3β sequence. Clonotypic diversity across all sequences (A) and within individuals (B) was measured using Simpson’s diversity index, and statistical analyses were performed using Student’s t test. ∗, p < 0.02; ∗∗, p < 0.0005.

FIGURE 2.

CDR3β clonotypic diversity in TdT−/− mice. Individual CD8+Vβ8.3+DbNP366+ or CD8+Vβ7+DbPA224+ cells were sorted from wt or TdT−/− splenocytes harvested at acute primary (day 10) or secondary (day 8) time points after infection. mRNA was reverse transcribed, followed by nested Vβ8.3- or Vβ7-specific PCR. PCR products were purified and sequenced, and individual clonotypes were defined according to CDR3β sequence. Clonotypic diversity across all sequences (A) and within individuals (B) was measured using Simpson’s diversity index, and statistical analyses were performed using Student’s t test. ∗, p < 0.02; ∗∗, p < 0.0005.

Close modal

In order for DbPA224-specific overall diversity to be narrowed without a corresponding restriction in individual diversity, the degree of clonotype sharing between individuals must be increased (Fig. 3). In fact, the proportion of an individual’s response that was shared by >40% of mice in the group (referred to as proportion of TCRs in common, or PTIC, in Fig. 3) was significantly enhanced for both the DbNP366- and DbPA224-specific repertoires in TdT−/− mice, effectively ensuring the public nature of both responses. The increase for the DbNP366 repertoire was primarily due to the fact that the repertoire was now clonal, whereas the greater sharing in the TdT−/− DbPA224-specific repertoire was highlighted by the fact that 5 of 39 CDR3β sequences were observed in all 8 of the mice analyzed (4 primary, 4 secondary) (Table II). Such use of public clonotypes is never observed for the wt DbPA224-specific response (12), with no single clonotype being observed in all mice analyzed. Thus, whereas TdT appeared to be dispensable for the generation of DbPA224-specific repertoire diversity within any given individual, it was critical for maintaining TCR diversity within the population at large.

FIGURE 3.

Degree of CDR3β clonotype sharing in TdT−/− mice. For CDR3β-sequencing details, see legend to Fig. 2. The proportion of TCRs in common (PTIC) shows the proportion of the clonotypic response from individual mice that is shared by at least 40% of mice sampled. Statistical analyses were performed using Student’s t test.

FIGURE 3.

Degree of CDR3β clonotype sharing in TdT−/− mice. For CDR3β-sequencing details, see legend to Fig. 2. The proportion of TCRs in common (PTIC) shows the proportion of the clonotypic response from individual mice that is shared by at least 40% of mice sampled. Statistical analyses were performed using Student’s t test.

Close modal

The DbNP366- and DbPA224-specific CD8+ T cell responses following influenza virus infection of B6 mice have been well characterized (15, 17, 24, 27). These epitopes elicit primary responses of similar magnitude, but, following secondary infection, the DbNP366-specific set dominates by a factor of 5- to 10-fold. Given the severely restricted TCR clonotype usage in the TdT−/− DbNP366-specific repertoire compared with the still relatively diverse TdT−/− DbPA224 response, it was of particular interest to determine whether there was any obvious difference in the magnitude and/or functionality of these populations. Freshly isolated spleen and BAL cells were analyzed by tetramer staining following primary and secondary infection. No difference in the magnitude of either epitope-specific response was observed for wt and TdT−/− spleen populations (Fig. 4). However, the extent of DbNP366-specific CTL localization to the virus-infected lung was significantly (p < 0.05) diminished in the TdT−/− mice following both primary and secondary challenge (Fig. 4). This effect was not observed for the more diverse DbPA224-specific response, indicating that repertoire limitation can diminish effector T cell magnitude in a site of pathogen-induced pathology. This effect may not just be a consequence of restrictions within the TCRβ repertoire, but may also reflect limitations within the TCRα compartment.

FIGURE 4.

Magnitude of epitope-specific CD8+ T cells in TdT−/− mice. Naive mice were either infected i.n. (1°, day 10) or i.p. (1°, day 34), whereas PR8-immune B6 mice were infected i.n. (2°, day 8) (see Materials and Methods), to analyze various phases of the immune response. Enriched splenocytes and BAL cells were stained with DbNP366-PE or DbPA224-PE tetramer, followed by anti-CD8α FITC. Shown are the total numbers of CD8+ tetramer+ cells, calculated from the cell counts per organ and the percentage of cells staining. ∗, p < 0.05, using two-tailed Student’s t test, comparing wt and TdT−/− responses.

FIGURE 4.

Magnitude of epitope-specific CD8+ T cells in TdT−/− mice. Naive mice were either infected i.n. (1°, day 10) or i.p. (1°, day 34), whereas PR8-immune B6 mice were infected i.n. (2°, day 8) (see Materials and Methods), to analyze various phases of the immune response. Enriched splenocytes and BAL cells were stained with DbNP366-PE or DbPA224-PE tetramer, followed by anti-CD8α FITC. Shown are the total numbers of CD8+ tetramer+ cells, calculated from the cell counts per organ and the percentage of cells staining. ∗, p < 0.05, using two-tailed Student’s t test, comparing wt and TdT−/− responses.

Close modal

Did these differential effects of TdT deficiency on the diversity of the DbNP366- and DbPA224-specific TCRβ repertoires in any way modify TCR avidity for the pMHCI complex? The measurement of tetramer dissociation kinetics provides a reliable and highly relevant measure of TCR/pMHCI avidity (16, 17, 18). Interestingly, irrespective of the stage of the immune response to influenza virus infection analyzed (primary acute, primary memory, and secondary acute), the DbNP366-specific CTL population from TdT−/− mice showed a substantially enhanced TCR off-rate when compared with DbNP366-specific cells from wt mice (Fig. 5). In contrast, the relative off-rates for the DbPA224-specific populations were equivalent for the two groups of mice (Fig. 5). Evidently, the single clonotype (found in both wt and TdT−/− mice) that dominates the CTL response to DbNP366 in the deficient animals is of lower TCR avidity than the wt population overall. However, we did not determine whether this is solely a consequence of the SGGANTGQL CDR3β profile, because there could also be differential TCRα use. Furthermore, although we found evidence of reduced TCR avidity for the TdT−/− DbNP366-specific set, this did not translate into different profiles of induced cytokine production following short-term in vitro stimulation with peptide (data not shown).

FIGURE 5.

Avidity of influenza-specific CD8+ T cells in TdT−/− mice. The kinetics of tetramer dissociation for splenic CD8+ T cells were analyzed directly ex vivo on day 10 after primary i.n. infection with the HK × 31virus (1°, day 10) (n = 5), on day 33 after priming i.p. with PR8 to establish memory (1°, day 33) (n = 3), or on day 8 after secondary i.n. challenge with HK × 31 (2°, day 8) (n = 3). Enriched CD8+ T cells were stained with the DbNP366-PE or DbPA224-PE tetramer for 1 h at room temperature. Cells were washed and incubated for designated times at 37°C in the presence of mAb to H-2Db, before costaining with anti-CD8α FITC. Shown are CD8+ tetramer+ cells expressed as a percentage of the maximum binding observed at time 0.

FIGURE 5.

Avidity of influenza-specific CD8+ T cells in TdT−/− mice. The kinetics of tetramer dissociation for splenic CD8+ T cells were analyzed directly ex vivo on day 10 after primary i.n. infection with the HK × 31virus (1°, day 10) (n = 5), on day 33 after priming i.p. with PR8 to establish memory (1°, day 33) (n = 3), or on day 8 after secondary i.n. challenge with HK × 31 (2°, day 8) (n = 3). Enriched CD8+ T cells were stained with the DbNP366-PE or DbPA224-PE tetramer for 1 h at room temperature. Cells were washed and incubated for designated times at 37°C in the presence of mAb to H-2Db, before costaining with anti-CD8α FITC. Shown are CD8+ tetramer+ cells expressed as a percentage of the maximum binding observed at time 0.

Close modal

Because it has been shown previously that public T cell clonotypes generally contain fewer TdT-mediated N-region additions than the population average (8, 10), it might be thought that the absence of TdT would be more likely to perturb a private CTL repertoire (DbPA224) than a broadly public one (DbNP366). In fact, the substantially public TCRVβ8.3 DbNP366-specific response was greatly disrupted, promoting the emergence of only two clonotypes (identified by CDR3β sequence) within or between individual mice. Furthermore, the one TCR (SGGANTGQL) accounted for 95–100% of these Vβ8.3+ T cells, whereas other public TCRs that are prevalent in wt animals were not found at all in the TdT−/− mice. This extreme skewing of the selected DbNP366-specific TCR repertoire to SGGANTGQL has been described previously following immunization of H2b TdT−/− mice with plasmid DNA encoding the influenza nucleoprotein (8), although such priming was not shown to elicit the minority SGGGNTGQL Vβ8.3 clonotype or the further 20% or so of tetramer+ T cells that did not express a Vβ8.3 TCR, but were elicited here by active infection. Overall, these findings demonstrate that, whereas a lack of dependence on N-region addition could potentially increase the likelihood of a clonotype being public, it cannot account for all public clonotypes, or even the majority of TCRVβ8.3 DbNP366-specific public TCRs.

It has been suggested that the emergence of particular TCRβ clonotypes as dominant and public in an epitope-specific T cell response is linked to structural qualities that confer optimal recognition of the specific pMHC (28, 29). This does not appear to be the case for the epitope-specific responses studied. The lack of any public advantage is exemplified with the SGGGNTGQL clonotype, which can be generated in the absence of N-region addition, but is a minor component of the response in TdT−/− mice. Furthermore, the extreme selection of the low-avidity SGGANTGQL clonotype in the TdT−/− DbNP366-specific repertoire also argues against this being a superior fit for DbNP366. It further suggests that avidity does not play a substantial role in determining clonotype abundance following influenza virus infection. This seems to contradict studies in which clonal dominance for EBV and CMV viral epitopes has been correlated directly with TCR/pMHCI avidity (30, 31). However, unlike the influenza A virus, EBV and CMV both persist so that the continued, or sporadic, emergence of Ag may well facilitate the progressive enrichment of high-avidity T cells. Conversely, increasing the precursor frequency for low-avidity CTLs has been shown to abrogate the preferential expansion of high-avidity T cells when both populations are present at the same frequency (32). Perhaps the higher precursor frequency of the low-avidity SGGANTGQL TCR in the naive pool of the TdT−/− mice may explain the later dominance in the immune repertoire. This is certainly supported by the finding that the number of recombination mechanisms that can be used to generate a particular nucleotide sequence correlated with the prevalence of a particular amino acid clonotype in the immune response in both wt (10, 26) and TdT−/− mice. Together, it seems likely that whether a particular TCR emerges as public in any given set of responses is simply a matter of its capacity to achieve a sufficient fit with the pMHC complex, and its prevalence in the naive repertoire.

The observation that the TdT−/− DbPA224-specific repertoire diversity was significantly decreased overall, although remaining unchanged within individuals, was particularly intriguing. Apparently, the extent of diversity within the naive DbPA224-specific CTL pool confers an inherent plasticity on the responding repertoire. That is, there is sufficient naive DbPA224-specific TCR diversity such that elimination of clonotypes requiring N-region addition does not significantly restrict the response spectrum within individuals. However, these clonotypes must also be repeated at much higher prevalence in the naive repertoires of different TdT −/− mice, ensuring diminished diversity at the host population level.

The fact that the varied and private TCR repertoire normally induced by DbPA224 assumed a substantially public character in the TdT−/− mice supports the view that the generation of essentially private TCR repertoires is heavily dependent on TdT-mediated N-region additions. The homogenization of the response between mice that is a consequence of the lack of N-region diversity could potentially limit the capacity to control virus escape mutants at the population level. Certainly, there is evidence that such MHC allele-restricted virus selection can occur for large populations (33, 34), while recent studies suggest that limited TCR repertoire diversity facilitates virus escape within individuals (35, 36).

Furthermore, the relative importance of private vs public TCR repertoires has been directly demonstrated for heterologous immunity, defined as the reactivation of memory T cells generated by an earlier infection in response to subsequent exposure to a seemingly unrelated virus (37). Adoptive transfer of lymphocytic choriomeningitis virus-immune splenocytes from one individual into multiple, naive recipients that were then infected with vaccinia virus elegantly demonstrated that the extent of cross-reactivity to a newly encountered vaccinia epitope was a function of private, rather than public, lymphocytic choriomeningitis virus-specific TCR specificities (38, 39). Because heterologous immune responses are likely to be generally beneficial (39, 40, 41), the prevalence of TCR repertoires that are private for individuals has the potential to increase the diversity of response profiles for any given population, an effect that presumably enhances overall fitness. Taken together with the possibility (discussed above) that the extent of epitope-specific TCR repertoire diversity both within and between individuals is likely to minimize the emergence of viral escape mutants (35, 36), it seems likely that the TdT mechanism that facilitates the emergence of private TCR repertoires is advantageous in the evolutionary sense.

We thank Dr. Ann Feeney for providing the TdT−/− mice, Cory Reynolds for development of data analysis tools and technical assistance, and Elvia Olivas and Melissa Morris for technical assistance.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by Australian National Health and Medical Research Council Project Grants AI454595 (to P.C.D.), AI454312 (to K.K.), and AI350395 (to N.L.L.); a National Health and Medical Research Council Burnet Award; Science Technology Innovation funds from the Government of Victoria, Australia (AI29579); Australian Research Council Discovery Grant DP0771340 (to M.P.D., S.J.T., and V.V.); and National Institutes of Health Grants AI70251 (to P.C.D.) and AI065097 (to P.G.T.). K.K. is the recipient of a University of Melbourne Early Career Researcher grant. K.K. and N.L.L. are National Health and Medical Research Council R. Douglas Wright Fellows; M.P.D. is a Sylvia and Charles Viertel Senior Medical Research Fellow; and S.J.T. is a Pfizer Australia Research Fellow.

4

Abbreviations used in this paper: pMHC, peptide plus MHC; BAL, bronchoalveolar lavage; EID50, egg infectious dose; i.n., intranasal; HKx31, A/Hong Kongx31 virus; NP, nucleoprotein; PA, acid polymerase; PR8, A/Puerto Rico/8/34 influenza A virus; wt, wild type.

1
Cibotti, R., J. P. Cabaniols, C. Pannetier, C. Delarbre, I. Vergnon, J. M. Kanellopoulos, P. Kourilsky.
1994
. Public and private Vβ T cell receptor repertoires against hen egg white lysozyme (HEL) in nontransgenic versus HEL transgenic mice.
J. Exp. Med.
180
:
861
-872.
2
Turner, S. J., P. C. Doherty, J. McCluskey, J. Rossjohn.
2006
. Structural determinants of T-cell receptor bias in immunity.
Nat. Rev. Immunol.
6
:
883
-894.
3
Turner, S. J., K. Kedzierska, N. L. La Gruta, R. Webby, P. C. Doherty.
2004
. Characterization of CD8+ T cell repertoire diversity and persistence in the influenza A virus model of localized, transient infection.
Semin. Immunol.
16
:
179
-184.
4
Welsh, R. M..
2006
. Private specificities of heterologous immunity.
Curr. Opin. Immunol.
18
:
331
-337.
5
Gilfillan, S., A. Dierich, M. Lemeur, C. Benoist, D. Mathis.
1993
. Mice lacking TdT: mature animals with an immature lymphocyte repertoire.
Science
261
:
1175
-1178.
6
Komori, T., A. Okada, V. Stewart, F. W. Alt.
1993
. Lack of N regions in antigen receptor variable region genes of TdT-deficient lymphocytes.
Science
261
:
1171
-1175.
7
Cabaniols, J. P., N. Fazilleau, A. Casrouge, P. Kourilsky, J. M. Kanellopoulos.
2001
. Most α/β T cell receptor diversity is due to terminal deoxynucleotidyl transferase.
J. Exp. Med.
194
:
1385
-1390.
8
Fazilleau, N., J. P. Cabaniols, F. Lemaitre, I. Motta, P. Kourilsky, J. M. Kanellopoulos.
2005
. Vα and Vβ public repertoires are highly conserved in terminal deoxynucleotidyl transferase-deficient mice.
J. Immunol.
174
:
345
-355.
9
Gilfillan, S., M. Bachmann, S. Trembleau, L. Adorini, U. Kalinke, R. Zinkernagel, C. Benoist, D. Mathis.
1995
. Efficient immune responses in mice lacking N-region diversity.
Eur. J. Immunol.
25
:
3115
-3122.
10
Venturi, V., K. Kedzierska, D. A. Price, P. C. Doherty, D. C. Douek, S. J. Turner, M. P. Davenport.
2006
. Sharing of T cell receptors in antigen-specific responses is driven by convergent recombination.
Proc. Natl. Acad. Sci. USA
103
:
18691
-18696.
11
Kedzierska, K., S. J. Turner, P. C. Doherty.
2004
. Conserved T cell receptor usage in primary and recall responses to an immunodominant influenza virus nucleoprotein epitope.
Proc. Natl. Acad. Sci. USA
101
:
4942
-4947.
12
Turner, S. J., G. Diaz, R. Cross, P. C. Doherty.
2003
. Analysis of clonotype distribution and persistence for an influenza virus-specific CD8+ T cell response.
Immunity
18
:
549
-559.
13
Kilbourne, E. D..
1969
. Future influenza vaccines and the use of genetic recombinants.
Bull. W. H. O.
41
:
643
-645.
14
Allan, W., Z. Tabi, A. Cleary, P. C. Doherty.
1990
. Cellular events in the lymph node and lung of mice with influenza: consequences of depleting CD4+ T cells.
J. Immunol.
144
:
3980
-3986.
15
Flynn, K. J., G. T. Belz, J. D. Altman, R. Ahmed, D. L. Woodland, P. C. Doherty.
1998
. Virus-specific CD8+ T cells in primary and secondary influenza pneumonia.
Immunity
8
:
683
-691.
16
Kalergis, A. M., N. Boucheron, M. A. Doucey, E. Palmieri, E. C. Goyarts, Z. Vegh, I. F. Luescher, S. G. Nathenson.
2001
. Efficient T cell activation requires an optimal dwell-time of interaction between the TCR and the pMHC complex.
Nat. Immunol.
2
:
229
-234.
17
La Gruta, N. L., P. C. Doherty, S. J. Turner.
2006
. A correlation between function and selected measures of T cell avidity in influenza virus-specific CD8+ T cell responses.
Eur. J. Immunol.
36
:
2951
-2959.
18
La Gruta, N. L., S. J. Turner, P. C. Doherty.
2004
. Hierarchies in cytokine expression profiles for acute and resolving influenza virus-specific CD8+ T cell responses: correlation of cytokine profile and TCR avidity.
J. Immunol.
172
:
5553
-5560.
19
Magurran, A. E..
2004
.
Measuring Biological Diversity
Blackwell Publishing, Oxford.
20
Venturi, V., K. Kedzierska, S. J. Turner, P. C. Doherty, M. P. Davenport.
2007
. Methods for comparing the diversity of samples of the T cell receptor repertoire.
J. Immunol. Methods
321
:
182
-195.
21
Colwell, R. K..
2005
.
Estimates: statistical estimation of species richness and shared species from samples
22
Deckhut, A. M., W. Allan, A. McMickle, M. Eichelberger, M. A. Blackman, P. C. Doherty, D. L. Woodland.
1993
. Prominent usage of Vβ8.3 T cells in the H-2Db-restricted response to an influenza A virus nucleoprotein epitope.
J. Immunol.
151
:
2658
-2666.
23
Kedzierska, K., N. L. La Gruta, J. Stambas, S. J. Turner, P. C. Doherty.
2008
. Tracking phenotypically and functionally distinct T cell subsets via T cell repertoire diversity.
Mol. Immunol.
45
:
607
-618.
24
Belz, G. T., W. Xie, J. D. Altman, P. C. Doherty.
2000
. A previously unrecognized H-2Db-restricted peptide prominent in the primary influenza A virus-specific CD8+ T-cell response is much less apparent following secondary challenge.
J. Virol.
74
:
3486
-3493.
25
Zhong, W., E. L. Reinherz.
2004
. In vivo selection of a TCR Vβ repertoire directed against an immunodominant influenza virus CTL epitope.
Int. Immunol.
16
:
1549
-1559.
26
Venturi, V., D. A. Price, D. C. Douek, M. P. Davenport.
2008
. The molecular basis for public T-cell responses?.
Nat. Rev. Immunol.
8
:
231
-238.
27
La Gruta, N. L., K. Kedzierska, K. Pang, R. Webby, M. Davenport, W. Chen, S. J. Turner, P. C. Doherty.
2006
. A virus-specific CD8+ T cell immunodominance hierarchy determined by antigen dose and precursor frequencies.
Proc. Natl. Acad. Sci. USA
103
:
994
-999.
28
Kjer-Nielsen, L., C. S. Clements, A. W. Purcell, A. G. Brooks, J. C. Whisstock, S. R. Burrows, J. McCluskey, J. Rossjohn.
2003
. A structural basis for the selection of dominant αβ T cell receptors in antiviral immunity.
Immunity
18
:
53
-64.
29
Stewart-Jones, G. B., A. J. McMichael, J. I. Bell, D. I. Stuart, E. Y. Jones.
2003
. A structural basis for immunodominant human T cell receptor recognition.
Nat. Immunol.
4
:
657
-663.
30
Callan, M. F., N. Steven, P. Krausa, J. D. Wilson, P. A. Moss, G. M. Gillespie, J. I. Bell, A. B. Rickinson, A. J. McMichael.
1996
. Large clonal expansions of CD8+ T cells in acute infectious mononucleosis.
Nat. Med.
2
:
906
-911.
31
Price, D. A., J. M. Brenchley, L. E. Ruff, M. R. Betts, B. J. Hill, M. Roederer, R. A. Koup, S. A. Migueles, E. Gostick, L. Wooldridge, et al
2005
. Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses.
J. Exp. Med.
202
:
1349
-1361.
32
Rechtsteiner, G., T. Warger, M. Hofmann, H. G. Rammensee, H. Schild, M. P. Radsak.
2006
. Precursor frequency can compensate for lower TCR expression in T cell competition during priming in vivo.
Eur. J. Immunol.
36
:
2613
-2623.
33
Moore, C. B., M. John, I. R. James, F. T. Christiansen, C. S. Witt, S. A. Mallal.
2002
. Evidence of HIV-1 adaptation to HLA-restricted immune responses at a population level.
Science
296
:
1439
-1443.
34
Neumann-Haefelin, C., S. McKiernan, S. Ward, S. Viazov, H. C. Spangenberg, T. Killinger, T. F. Baumert, N. Nazarova, I. Sheridan, O. Pybus, et al
2006
. Dominant influence of an HLA-B27 restricted CD8+ T cell response in mediating HCV clearance and evolution.
Hepatology
43
:
563
-572.
35
Cornberg, M., A. T. Chen, L. A. Wilkinson, M. A. Brehm, S. K. Kim, C. Calcagno, D. Ghersi, R. Puzone, F. Celada, R. M. Welsh, L. K. Selin.
2006
. Narrowed TCR repertoire and viral escape as a consequence of heterologous immunity.
J. Clin. Invest.
116
:
1443
-1456.
36
Price, D. A., S. M. West, M. R. Betts, L. E. Ruff, J. M. Brenchley, D. R. Ambrozak, Y. Edghill-Smith, M. J. Kuroda, D. Bogdan, K. Kunstman, et al
2004
. T cell receptor recognition motifs govern immune escape patterns in acute SIV infection.
Immunity
21
:
793
-803.
37
Rehermann, B., E. C. Shin.
2005
. Private aspects of heterologous immunity.
J. Exp. Med.
201
:
667
-670.
38
Kim, S. K., M. Cornberg, X. Z. Wang, H. D. Chen, L. K. Selin, R. M. Welsh.
2005
. Private specificities of CD8 T cell responses control patterns of heterologous immunity.
J. Exp. Med.
201
:
523
-533.
39
Urbani, S., B. Amadei, P. Fisicaro, M. Pilli, G. Missale, A. Bertoletti, C. Ferrari.
2005
. Heterologous T cell immunity in severe hepatitis C virus infection.
J. Exp. Med.
201
:
675
-680.
40
Chen, H. D., A. E. Fraire, I. Joris, M. A. Brehm, R. M. Welsh, L. K. Selin.
2001
. Memory CD8+ T cells in heterologous antiviral immunity and immunopathology in the lung.
Nat. Immunol.
2
:
1067
-1076.
41
Selin, L. K., S. M. Varga, I. C. Wong, R. M. Welsh.
1998
. Protective heterologous antiviral immunity and enhanced immunopathogenesis mediated by memory T cell populations.
J. Exp. Med.
188
:
1705
-1715.