MFG-E8 (milk fat globule-epidermal growth factor 8) deficiency is strongly associated with acquisition of immune-mediated disorders due to the loss of tissue homeostasis. However, comparatively little is known regarding its functions in gastrointestinal tract disorders, in which immune homeostasis is a major concern. Herein, we report altered MFG-E8 expression in inflamed colons during the acute phase of murine experimental colitis and found that treatment with recombinant MFG-E8, but not its arginine-glycine-aspartate mutant counterpart, ameliorated colitis by reducing inflammation and improving disease parameters. To reveal the MFG-E8-mediated antiinflammatory mechanism, we employed an in vitro system, which showed the down-regulation of NF-κB in an LPS-dependent manner. Additionally, MFG-E8 altered αvβ3 integrin-mediated focal adhesion kinase phosphorylation by impeding the binding of one of its potent ligands osteopontin, which becomes activated during colitis. Taken together, our results indicated that MFG-E8 has a novel therapeutic potential for treatment of colitis.

Ulcerative colitis (UC)3 and Crohn’s disease (CD) are two major forms of inflammatory bowel disease (IBD), which are characterized by an elevated production of inflammatory mediators to induce inflammation, as well as tissue injury as a result of the migration and infiltration of innate immune cells (1, 2). Activated proinflammatory genes in the intestinal mucosa are in turn under the control of NF-κB, which becomes up-regulated and induces a variety of inflammatory events during colitis (3, 4). Active intestinal inflammation is also accompanied by the up-regulation of certain integrins, including αvβ3 and αvβ5, while blockade of the murine angiogenic endothelial marker αvβ3 effectively decreased both neoangiogenesis and inflammation in a murine model of colitis (5, 6, 7). Considering these inflammatory consequences, several conventional therapeutic approaches for IBD, mainly based on suppression and control of inflammation, have been proposed (8, 9, 10). Also, recently developed novel cytokine antagonist therapies have been found to be effective in certain IBD patients (11, 12, 13). Such molecular targeted inhibition of the inflammatory process may provide better therapeutic options for IBD, and various studies have been conducted to evaluate new innovative approaches.

Milk fat globule-epidermal growth factor 8 (MFG-E8), a glycoprotein secreted from different cell types, participates in phagocytosis of apoptotic cells by forming a link between phosphatidylserine on apoptotic cells and αvβ3 integrin on phagocytes (14, 15, 16, 17). Several lines of evidence show that severe inflammatory and autoimmune consequences in MFG-E8-null mice are due to the infiltration of apoptotic cells, which subsequently causes dysregulated immune functions with abnormal homeostasis (18, 19). An MFG-E8-mediated potential therapeutic benefit is evident in sepsis or GM-CSF-deficient conditions, as it ameliorates the detrimental effects of accumulated apoptotic cells in organ systems (20, 21). In addition to this familiar scavenging function, MFG-E8 was also found to be effective in accelerating mucosal healing during intestinal injury in a phosphatidylserine-dependent manner (22). Although MFG-E8 is involved in several cell surface-mediated regulatory events and modulates immune responses in numerous conditions, the mechanism underlying these features has not been clearly defined. Furthermore, its expression and role in intestinal homeostasis are not fully elucidated.

The aim of the present study was to analyze the expression of MFG-E8 in normal and inflamed intestinal mucosa, and to investigate whether it has a protective role in colitis. We decided to use recombinant MFG-E8 in a model of acute phase of colitis and elucidate its effects by evaluating colitis parameters. Our findings indicate that MFG-E8-mediated novel antiinflammatory effects are generated by NF-κB inhibition through the modulation of αvβ3 integrin signaling.

Dextran sodium sulfate (DSS, 5 kDa; Wako Pure Chemicals), Lipofectamine 2000 (Invitrogen), Ni-NTA columns (Qiagen), ultrapure Escherichia coli LPS (0111:B4 strain) and purified flagellin from Salmonella typhimurium (InvivoGen), mouse osteopontin (OPN) and dexamethasone (Sigma-Aldrich), recombinant integrin αvβ3 (R&D Systems), 6× His pTriEx-3hygro (Novagen), pNF-κB-Luc (Stratagene), pRL-TK (Promega), annexin V-Fluos (Roche), FITC-TUNEL (Promega), ELISA kits for IL-1β, TNF-α, and OPN (R&D Systems), and myeloperoxidase (MPO; Hycult Biotechnology) were acquired from their respective suppliers. The Abs used were: anti-mouse MFG-E8 (MBL International), PE-F4/80 (eBioscience), anti-His probe (H3), anti-p-IκB, anti-β3 integrin, anti-focal adhesion kinase (FAK), and anti-pFAK (Santa Cruz Biotechnology), anti-IκB, anti-OPN, and anti-IgG (R&D Systems), anti-αv integrin (Abcam), and anti-phospho-β3 (pY759) integrin (BD Biosciences).

Mouse wild-type and arginine-glycine-aspartate (RGD) mutant MFG-E8 proteins were prepared as described previously (18). Briefly, coding regions excluding the signal peptide sequence of MFG-E8 (NM_008594) were cloned into the EcoRI and XhoI sites of a 6× His pTriEx-3hygro vector to generate pMFG-E8, and transfected into HEK293 cells using Lipofectamine 2000. At 48 h after transfection, cells were lysed in mild lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 1 mM (p-amidinophenyl)methanesulphonyl fluoride hydrochloride (pH 8.0)) by sonication on ice and purified using Ni-NTA columns, then the purity was checked by SDS-PAGE and Western blotting assays. For SDS-PAGE, purified proteins were run on a 12% polyacrylamide gel and stained with Coomassie brilliant blue, while for Western blotting the proteins were allowed to react with anti-6× His Ab, and the corresponding signals were detected using ECL (GE Healthcare). Similarly, RGD mutant MFG-E8 was produced by introducing a point mutation to generate D89E containing a p-mutant MFG-E8 expression vector, after which expression was confirmed and purification performed using the mammalian expression systems described above. The functional efficiency of recombinant MFG-E8 protein was evaluated based on its ability to enhance phagocytosis of apoptotic cells using fluorescent microscopy, as described previously (23).

Seven-week-old male specific pathogen-free BALB/c mice (Charles River Laboratories) were housed according to our institutional guidelines with the approval of the Ethics Committee of Shimane Medical University. Primarily, a single group of normal mice (n = 3) were euthanized to screen tissue-specific MFG-E8 expression using Northern and Western blotting methods. To produce a DSS colitis model, a group containing five mice was fed 2.5% DSS in drinking water for 9 days, while the control group received only normal drinking water throughout the experiment. Then, purified recombinant wild-type or mutant MFG-E8 was diluted in PBS and 300 μl of the solution (30 μg/kg) was injected i.v. through the tail vein, starting from 2 days before DSS administration, which continued until euthanasia. The parameters for colitis evaluation recorded in the experiments were body weight, colon length, and rectal bleeding, as determined by visual inspection. After stopping DSS treatment, the mice were euthanized and the colon was measured with a ruler on a nonabsorbent surface. For histology, 3-μm-thick formalin-fixed, paraffin-embedded colon tissues were stained with H&E and examined under a light microscope by two investigators in a double-blinded fashion.

Total RNA was extracted from colonic tissues and cultured cells using Isogen (Nippon Gene) and then equal amounts of DNase I (Ambion)-treated RNA were reverse transcribed into cDNA using a QPCR cDNA kit (Stratagene). A real-time fluorescence PCR assay based on SYBR Green (Applied Biosystems) was then performed using the primers described in Table I.

Table I.

Primers for real-time PCR

Gene (Accession No.)Sequence (5′ to 3′)
MFG-E8 (NM_008594)  
 Forward CGGGCCAAGACAATGACATC 
 Reverse TCTCTCAGTCTCATTGCACACAAG 
αv Integrin (NM_008402)  
 Forward CTGGCTGTGTTGGTATTTGTAATGTAC 
 Reverse AGCTGTTCTCGTTCTTGCTCTTC 
β3 Integrin (NM_016780)  
 Forward CGTCAGCCTTTACCAGAATTATAGTG 
 Reverse TTTCCCGTAAGCATCAACAATG 
OPN (NM_009263)  
 Forward TCTGATGAGACCGTCACTGC 
 Reverse AGGTCCTCATCTGTGGCATC 
FN (NM_010233)  
 Forward GAGGAGGGAGATGAACCACA 
 Reverse GGGTCTACTCCACCGAACAA 
VN (NM_011707)  
 Forward CTCTCTGTCAGCCGTGTTTG 
 Reverse GTGGGATAAGGAGCCAGTGA 
β-actin (NM_007393)  
 Forward CGTGAAAAGATGACCCAGATCA 
 Reverse CACAGCCTGGATGGCTACGTA 
Gene (Accession No.)Sequence (5′ to 3′)
MFG-E8 (NM_008594)  
 Forward CGGGCCAAGACAATGACATC 
 Reverse TCTCTCAGTCTCATTGCACACAAG 
αv Integrin (NM_008402)  
 Forward CTGGCTGTGTTGGTATTTGTAATGTAC 
 Reverse AGCTGTTCTCGTTCTTGCTCTTC 
β3 Integrin (NM_016780)  
 Forward CGTCAGCCTTTACCAGAATTATAGTG 
 Reverse TTTCCCGTAAGCATCAACAATG 
OPN (NM_009263)  
 Forward TCTGATGAGACCGTCACTGC 
 Reverse AGGTCCTCATCTGTGGCATC 
FN (NM_010233)  
 Forward GAGGAGGGAGATGAACCACA 
 Reverse GGGTCTACTCCACCGAACAA 
VN (NM_011707)  
 Forward CTCTCTGTCAGCCGTGTTTG 
 Reverse GTGGGATAAGGAGCCAGTGA 
β-actin (NM_007393)  
 Forward CGTGAAAAGATGACCCAGATCA 
 Reverse CACAGCCTGGATGGCTACGTA 

Protein extraction and Western blotting assays were performed as described previously (23). Briefly, after blocking with 10% skim milk (Difco), the membrane was reacted with anti-mouse MFG-E8 Ab at a concentration of 1 μg/ml for 1 h at room temperature and the resulting signals were visualized using ECL reagent. Similarly, Western blotting assays of IκB, p-IκB, αv3 integrin, and β-actin were performed using their respective Abs in optimized conditions. For immunoprecipitation, mouse peritoneal macrophages were lysed in Nonidet P-40 buffer containing 150 mM Nacl, 1% Nonidet P-40, 50 mM Tris (pH 8.0), and 1 mM PMSF; after clarification, 200 μg of protein was immunoprecipitated with anti-β3 integrin Ab and protein G-Sepharose (GE Healthcare). Immunoprecipitants were subjected to Western blotting using anti-phospho-β3 and β3 integrin Abs. Similarly, pFAK (phospho-Y397) and FAK assays were performed as described above.

Frozen colonic tissue samples were sliced into 3-μm-thick sections and fixed in cold acetone for 20 min. After blocking endogenous peroxidase activity with 0.3% hydrogen peroxide in methanol, sections were incubated for 2 h at room temperature with 1 μg/ml MFG-E8 specific primary Ab and then processed with the corresponding protocols using an immunoperoxidase staining kit (Vectastain).

For in vitro experiments, mouse macrophage-like cells P388D1 from American Type Culture Collection were grown and plated on 24-well plates (2.5 × 104 cells/well) in RPMI 1640 with 10% FBS in a humidified chamber. After 18–24 h the cells had reached 50% confluence and were transiently transfected with pNF-κB-Luc (200 ng/well) and pRL-TK-Renilla-Luc (20 ng/well) using Lipofectamine 2000 (2.5 μl/well), and then NF-κB activity was measured using a dual-luciferase reporter assay system (Promega). In another experiment, custom FlexiTube small interfering RNAs (siRNAs) for αv3 integrin (Qiagen) were transfected into P388D1 cells according to the manufacturer’s protocol, and siRNA effects were checked by real-time PCR and Western blotting assays, as described above.

To investigate the binding of MFG-E8 to αvβ3 integrin, 96-well polyvinyl chloride microtiter plates were coated by pipetting 50 μl of recombinant αvβ3 integrin (20 μg/ml) diluted in coating buffer and incubated overnight at 4°C. Following incubation, the coating solution was removed and the plates were washed twice with PBS. The remaining protein-binding sites in the coated wells were blocked by adding 200 μl of 1% BSA. Recombinant MFG-E8 at different concentrations was then added to the αvβ3 integrin-coated wells and incubated for 2 h at room temperature. After subsequent washing, the wells were treated with HRP-labeled anti-mouse MFG-E8 Ab at a concentration of 1 μg/ml and the resulting absorbance was measured using a plate reader. Similarly, to measure the competitive binding of OPN and MFG-E8 to αvβ3, a fixed amount of exogenous OPN (500 ng/ml) was allowed to bind with αvβ3 integrin in coated wells in the presence of various concentrations of recombinant MFG-E8. After 2 h of incubation at room temperature, the unbound materials were removed by washing with PBS, and HRP-labeled anti-mouse OPN Ab (1 μg/ml) was added to each well. Finally, the resulting signals were measured at a wavelength of 450 nm and analyzed using the CurveExpert 1.3 software package.

Cytokines and MPO contents in colonic tissues and culture supernatants were estimated using EIA according to the manufacturer’s protocol. Briefly, total proteins from distal colonic tissues were extracted using lysis buffer (200 mM NaCl, 5 mM EDTA, 10 mM Tris, 10% glycine, and 1 mM PMSF (pH 7.4)) and subjected to EIA using mouse IL-1β, TNF-α, and MPO EIA kits. In vitro culture supernatants from mouse peritoneal macrophages treated with or without LPS, flagellin, OPN, or recombinant MFG-E8 were also checked for IL-1β and TNF-α contents by EIA, as described above. In another experiment, OPN contents in LPS-treated peritoneal macrophage culture supernatants were assayed using an OPN EIA kit.

All quantitative data are expressed as the mean ± SE. Student’s t test was used for statistical determinations. Values of p of <0.05 were considered statistically significant.

We examined MFG-E8 expression in different tissues of normal BALB/c mice and observed the ubiquitous presence of MFG-E8 with its two transcript variants (24) in a tissue-specific manner (Fig. 1). Next, to assess the time course changes of MFG-E8 expression during colitis, mice were given 2.5% DSS in drinking water, after which MFG-E8 expression in colonic tissues was checked at various time points. As shown in Fig. 2, A and B, MFG-E8 was down-regulated in inflamed colons during the DSS induction period (days 1–9), while it gradually became up-regulated during the healing phase (days 10–24), when DSS was no longer added to the drinking water. Moreover, to reveal any link between MFG-E8 down-regulation and DSS-induced colitis characterized by intestinal inflammation, we performed a dose-dependent experiment using low (1.5%) and high (3.5%) concentrations of DSS, and assessed MFG-E8 expression at different time points. Notably, in mild colitis shown by a low grade of inflammation, MFG-E8 expression was not reduced to the same extent as in severe colitis (Fig. 2,A). Thus, we concluded that the level of MFG-E8 down-regulation caused by different doses of DSS may be related to inflammation severity. Additionally, to confirm MFG-E8 localization, we performed immunohistochemical analyses using colonic tissue sections, which revealed its presence in lamina propria mononuclear cells that had become infiltrated during colitis (Fig. 2 C).

FIGURE 1.

Tissue-specific MFG-E8 expression in mice. Northern and Western blots demonstrating the expression of MFG-E8 in different tissues of normal mice (n = 3) are shown.

FIGURE 1.

Tissue-specific MFG-E8 expression in mice. Northern and Western blots demonstrating the expression of MFG-E8 in different tissues of normal mice (n = 3) are shown.

Close modal
FIGURE 2.

Differential expression of MFG-E8 in experimental colitis. Time course changes of MFG-E8 expression in inflamed colons (n = 90), as revealed by (A) real-time PCR using samples from 1.5%, 2.5%, and 3.5% DSS-treated mice, and (B) Western blotting with samples from 2.5% DSS-treated mice. *, p < 0.05 and **, p < 0.01 vs DSS (−). Error bars indicate the SEM values obtained from three independent experiments. C, Immunohistochemical localization of MFG-E8 in frozen colonic tissue sections from DSS-treated colitis mice shown with magnification. Left, ×200; right, ×400.

FIGURE 2.

Differential expression of MFG-E8 in experimental colitis. Time course changes of MFG-E8 expression in inflamed colons (n = 90), as revealed by (A) real-time PCR using samples from 1.5%, 2.5%, and 3.5% DSS-treated mice, and (B) Western blotting with samples from 2.5% DSS-treated mice. *, p < 0.05 and **, p < 0.01 vs DSS (−). Error bars indicate the SEM values obtained from three independent experiments. C, Immunohistochemical localization of MFG-E8 in frozen colonic tissue sections from DSS-treated colitis mice shown with magnification. Left, ×200; right, ×400.

Close modal

Mice treated with 2.5% (w/v) DSS in their drinking water showed clinical, histological, and immunological signs of colitis (25). Recombinant wild-type and RGD mutant MFG-E8 were separately injected into mice during the DSS period, while other mice were injected with PBS instead of MFG-E8 and received normal drinking water and served as controls (Fig. 3,A). As shown in Fig. 3,B, in the mice who received DSS with PBS, body weight loss of ∼23% commenced on day 4 and continued to day 9, while mice injected with the wild-type MFG-E8, as opposed to those with mutant MFG-E8, showed significant improvement in body weight loss from day 4, which reached only 14% on day 9. Representative specimens from the dissected colons from the MFG-E8-treated group showed increased length as compared with those from the PBS- or mutant MFG-E8-treated DSS groups (Fig. 3, C and D). Histological examinations also showed that lamina propria infiltration by mononuclear cells as well as crypt epithelial damage were markedly decreased in the MFG-E8-treated colitic mice (Fig. 3,E). Furthermore, total histological scores in the distal parts of colon samples from MFG-E8-treated mice after 9 days of DSS administration were significantly lower than in those from the other groups (Table II).

FIGURE 3.

In vivo effects of recombinant MFG-E8 in DSS colitis. A, Protocol for experimental colitis and treatment with recombinant MFG-E8. B, Effects of MFG-E8 on body weight changes in 2.5% DSS-treated mice. Data are expressed as serial changes in percentage of weight change during DSS administration. *, p < 0.05 vs DSS (+) PBS; #, p < 0.05 vs DSS (+) mutant MFG-E8 (mtMFG-E8). C and D, Effects of MFG-E8 on colon length in 2.5% DSS-induced colitis. *, p < 0.05 vs DSS (−) PBS; #, p < 0.05 vs DSS (+) PBS. Error bars indicate the SEM values (n = 5 mice/group). E, Histological changes in distal colonic lesions on days 6 and 9 of DSS administration with or without MFG-E8 (original magnification ×100). F–H, Colonic tissue contents of proinflammatory cytokines and MPO at the same time points of DSS administration as above with or without MFG-E8. *, p < 0.05 vs DSS (−) PBS; #, p < 0.05 vs DSS (+) PBS. Error bars indicate the SEM values (n = 5 mice/group).

FIGURE 3.

In vivo effects of recombinant MFG-E8 in DSS colitis. A, Protocol for experimental colitis and treatment with recombinant MFG-E8. B, Effects of MFG-E8 on body weight changes in 2.5% DSS-treated mice. Data are expressed as serial changes in percentage of weight change during DSS administration. *, p < 0.05 vs DSS (+) PBS; #, p < 0.05 vs DSS (+) mutant MFG-E8 (mtMFG-E8). C and D, Effects of MFG-E8 on colon length in 2.5% DSS-induced colitis. *, p < 0.05 vs DSS (−) PBS; #, p < 0.05 vs DSS (+) PBS. Error bars indicate the SEM values (n = 5 mice/group). E, Histological changes in distal colonic lesions on days 6 and 9 of DSS administration with or without MFG-E8 (original magnification ×100). F–H, Colonic tissue contents of proinflammatory cytokines and MPO at the same time points of DSS administration as above with or without MFG-E8. *, p < 0.05 vs DSS (−) PBS; #, p < 0.05 vs DSS (+) PBS. Error bars indicate the SEM values (n = 5 mice/group).

Close modal
Table II.

Effect of recombinant MFG-E8 on histological parameters (day 9)a

SampleInflammationDepth of InjuryCrypt DamageTotal
DSS (−) PBS 0.17 ± 0.17 0.00 0.00 0.17 ± 0.17 
DSS (−) MFG-E8 0.17 ± 0.17 0.00 0.00 0.17 ± 0.17 
DSS (−) mtMFG-E8 0.00 0.00 0.00 0.00 
DSS (+) PBS 3.75 ± 0.41 3.75 ± 0.45 6.50 ± 0.63 14.13 ± 0.93 
DSS (+) MFG-E8 1.88 ± 0.35bc 2.88 ± 0.33 4.50 ± 0.46b 9.13 ± 0.67bc 
DSS (+) mtMFG-E8 4.13 ± 0.48 4.25 ± 0.59 5.63 ± 0.75 13.50 ± 0.93 
SampleInflammationDepth of InjuryCrypt DamageTotal
DSS (−) PBS 0.17 ± 0.17 0.00 0.00 0.17 ± 0.17 
DSS (−) MFG-E8 0.17 ± 0.17 0.00 0.00 0.17 ± 0.17 
DSS (−) mtMFG-E8 0.00 0.00 0.00 0.00 
DSS (+) PBS 3.75 ± 0.41 3.75 ± 0.45 6.50 ± 0.63 14.13 ± 0.93 
DSS (+) MFG-E8 1.88 ± 0.35bc 2.88 ± 0.33 4.50 ± 0.46b 9.13 ± 0.67bc 
DSS (+) mtMFG-E8 4.13 ± 0.48 4.25 ± 0.59 5.63 ± 0.75 13.50 ± 0.93 
a

During each histological examination, three different parameters were measured: severity of inflammation (based on polymorphonuclear neutrophil infiltration; 0–3: none, slight, moderate, severe), depth of injury (0–3: none, mucosal, mucosal and submucosal, transmural), and crypt damage (0–4: none, basal one-third damaged, basal two-thirds damaged, only surface epithelium intact, entire crypt and epithelium lost). The score for each parameter was multiplied by a factor reflecting the percentage of tissue involvement (×1, 0–25%; ×2, 26–50%; ×3, 51–75%; ×4, 76–100%), and all values were added to a sum, with a maximum possible score of 40.

b

p < 0.05 vs DSS (+) PBS;

c

p < 0.05 vs DSS (+) mtMFG-E8.

To investigate the effects of MFG-E8 on proinflammatory cytokine production, protein was extracted from colonic tissues, and IL-1β and TNF-α contents were measured. Notably, they were decreased in MFG-E8-treated, but not in the PBS- or mutant MFG-E8-treated, DSS groups (Fig. 3, F and G). Furthermore, MFG-E8 treatment significantly down-regulated the tissue content of MPO as compared with that in PBS- or mutant MFG-E8-treated DSS mice (Fig. 3,H). With the present experimental system, we assessed the effects of recombinant MFG-E8 using body weight change as a parameter of colitis, which was apparent at the beginning of day 6 of DSS treatment. Therefore, we also performed histology and immunology experiments using samples from day 6 as an additional time point. As shown in Fig. 3 E–H, although the effects of MFG-E8 on day 6 samples were evident, they were more distinct in samples from day 9. Taken together, these results demonstrate that recombinant MFG-E8 has a protective role in colitis.

We also noticed that the colitis was refractory in mice treated with the RGD mutant form of MFG-E8. In a previous study of apoptotic cell phagocytosis by Asano et al., the RGD mutant MFG-E8 (D89E) was shown to be a dominant negative form of MFG-E8 (18). While performing the present experiment to evaluate the functional efficacy of our purified recombinant proteins, we noticed inhibition of phagocytosis of apoptotic cells following addition of purified recombinant RGD mutant MFG-E8 to cocultured cells (macrophage and apoptotic thymocytes) (data not shown), whereas we did not observe any dominant negative effects on DSS-induced colitis or in subsequent in vitro studies. Therefore, it is possible that our RGD mutant protein was nonfunctional rather than having any dominant-negative effects on colitis.

To elucidate the detailed mechanism of the MFG-E8-dependent antiinflammatory effect on experimental colitis, we used bacterial LPS, which is a potent inducer of inflammatory signals in cultured murine peritoneal macrophages treated with or without MFG-E8 in vitro. As expected, LPS markedly induced IL-1β and TNF-α in culture supernatants, while cells pretreated with recombinant MFG-E8 significantly down-regulated the effects of LPS on cytokine production, whereas mutant MFG-E8 had no such effects on LPS-stimulated macrophages (Fig. 4, A and B). We then examined the effects of recombinant MFG-E8 on NF-κB status in LPS-treated P388D1 cells. Following LPS treatment, NF-κB activity became considerably elevated, while cells exogenously pretreated with recombinant MFG-E8 showed significant down-regulation of the LPS-induced NF-κB activity, whereas mutant MFG-E8 had no significant effects on this event (Fig. 4,C). Other than LPS, several pathogen-associated molecular patterns are also known to activate the innate immune responses in immune-reactive cells via TLRs, and therefore it is of interest to check whether recombinant MFG-E8 inhibits the flagellin (as an additional stimulant)-induced effects on mononuclear cells. Interestingly, we noticed an MFG-E8-dependent significant down-regulation of proinflamatory cytokine production, as well as NF-κB activity in flagellin-treated macrophages, although the RGD mutant protein had no such effects in these events (Fig. 4,D–F). According to these findings, macrophage cells are less responsive to flagellin compared with LPS stimulation, and we therefore conducted our subsequent in vitro studies using LPS as one of the stimulants for the initiation of inflammation in macrophages. We also observed that the optimum degradation and phosphorylation of IκB occurred at 30 min after LPS treatment, and that treatment with the wild-type MFG-E8, but not RGD mutant MFG-E8, considerably reduced the effects of LPS on NF-κB at that time point (Fig. 4, G and H).

FIGURE 4.

In vitro effects of recombinant MFG-E8. Peritoneal macrophages were pretreated with or without MFG-E8 (400 ng/ml) proteins for 2 h, followed by LPS (100 ng/ml) stimulation for 24 h. The culture supernatants were assessed for (A) IL-1β and (B) TNF-α using EIA. C, Assessment of NF-κB activity using a luciferase assay. Twenty-four hours after transfection, P388D1 cells were treated with recombinant MFG-E8 proteins for 2 h, followed by stimulation with LPS for 12 h, after which dual-luciferase assays were performed. *, p < 0.05 vs LPS (−); #, p < 0.05 vs LPS (+). Error bars indicate SEM values, which were obtained from three independent experiments. D and E, Peritoneal macrophages were pretreated with or without MFG-E8 (400 ng/ml) proteins for 2 h; following flagellin (100 ng/ml) stimulation for 24 h, the culture supernatants were assessed for IL-1β and TNF-α using EIA. F, In a 24-well plate, P388D1 cells (2.5 × 104 cells/well) were transfected with pNF-κB-Luc and pRL-TK-Renilla-Luc using Lipofectamine 2000. Twenty-four hours after transfection, the media was changed and pretreated with or without MFG-E8 protein (400 ng/ml) for 2 h; then, after 12 h of flagellin (100 ng/ml) stimulation, dual-luciferase assays were done. *, p < 0.05 vs flagellin (−); #, p < 0.05 vs flagellin (+). Error bars indicate SEM values obtained from three independent experiments. G, Time course changes of IκB degradation and phosphorylation in LPS-treated (100 ng/ml) mouse peritoneal macrophages. H, Effects of MFG-E8 on IκB degradation and phosphorylation in peritoneal macrophages (C, control; M, MFG-E8; R, RGD mutant MFG-E8) after 30 min of stimulation with LPS (100 ng/ml).

FIGURE 4.

In vitro effects of recombinant MFG-E8. Peritoneal macrophages were pretreated with or without MFG-E8 (400 ng/ml) proteins for 2 h, followed by LPS (100 ng/ml) stimulation for 24 h. The culture supernatants were assessed for (A) IL-1β and (B) TNF-α using EIA. C, Assessment of NF-κB activity using a luciferase assay. Twenty-four hours after transfection, P388D1 cells were treated with recombinant MFG-E8 proteins for 2 h, followed by stimulation with LPS for 12 h, after which dual-luciferase assays were performed. *, p < 0.05 vs LPS (−); #, p < 0.05 vs LPS (+). Error bars indicate SEM values, which were obtained from three independent experiments. D and E, Peritoneal macrophages were pretreated with or without MFG-E8 (400 ng/ml) proteins for 2 h; following flagellin (100 ng/ml) stimulation for 24 h, the culture supernatants were assessed for IL-1β and TNF-α using EIA. F, In a 24-well plate, P388D1 cells (2.5 × 104 cells/well) were transfected with pNF-κB-Luc and pRL-TK-Renilla-Luc using Lipofectamine 2000. Twenty-four hours after transfection, the media was changed and pretreated with or without MFG-E8 protein (400 ng/ml) for 2 h; then, after 12 h of flagellin (100 ng/ml) stimulation, dual-luciferase assays were done. *, p < 0.05 vs flagellin (−); #, p < 0.05 vs flagellin (+). Error bars indicate SEM values obtained from three independent experiments. G, Time course changes of IκB degradation and phosphorylation in LPS-treated (100 ng/ml) mouse peritoneal macrophages. H, Effects of MFG-E8 on IκB degradation and phosphorylation in peritoneal macrophages (C, control; M, MFG-E8; R, RGD mutant MFG-E8) after 30 min of stimulation with LPS (100 ng/ml).

Close modal

Next, to confirm the involvement of αvβ3 integrin in MFG-E8 functions, we utilized αvβ3 integrin siRNA in P388D1 cells and assessed NF-κB activity in LPS-treated conditions, after validating the siRNA efficiency of corresponding gene knockdown at both the mRNA and protein levels (Fig. 5, A and B). In P388D1 cells transfected with the control siRNA, MFG-E8 inhibited LPS-induced NF-κB activation, which was similar to the results observed in cells without siRNA transfection. On the other hand, in the presence of both αv and β3 integrin siRNAs, MFG-E8 did not show a significant inhibitory effect on NF-κB activation in LPS-treated cells (Fig. 5 C). These results suggest that the antiinflammatory role of MFG-E8 via inhibition of NF-κB is dependent on αvβ3 integrin signaling in P388D1 cells. Based on these observations, we speculated that MFG-E8 may competitively bind to αvβ3 integrin with certain potential ligands existing in the culture medium and inhibit αvβ3 integrin-mediated NF-κB activation in macrophages.

FIGURE 5.

Involvement of αvβ3 integrin for MFG-E8-mediated NF-κB inhibition. A and B, Efficiency of four different sets of siRNAs used for knockdown of αv3 integrin at the mRNA and protein levels. *, p < 0.05 vs NC-si. Error bars indicate SEM values, which were obtained from three independent experiments. C, Twenty-four hours after transfection with respective custom siRNAs (33 nM/well), which inhibited the expression of αv3 integrin (αv-si-2, β3-si-1) by ∼80%, P388D1 cells were treated with recombinant MFG-E8 for 2 h, followed by stimulation with LPS (100 ng/ml) for 12 h, after which dual-luciferase activities were measured. *, p < 0.05 vs LPS (−); #, p < 0.05 vs LPS (+). Error bars indicate SEM values, which were obtained from three independent experiments.

FIGURE 5.

Involvement of αvβ3 integrin for MFG-E8-mediated NF-κB inhibition. A and B, Efficiency of four different sets of siRNAs used for knockdown of αv3 integrin at the mRNA and protein levels. *, p < 0.05 vs NC-si. Error bars indicate SEM values, which were obtained from three independent experiments. C, Twenty-four hours after transfection with respective custom siRNAs (33 nM/well), which inhibited the expression of αv3 integrin (αv-si-2, β3-si-1) by ∼80%, P388D1 cells were treated with recombinant MFG-E8 for 2 h, followed by stimulation with LPS (100 ng/ml) for 12 h, after which dual-luciferase activities were measured. *, p < 0.05 vs LPS (−); #, p < 0.05 vs LPS (+). Error bars indicate SEM values, which were obtained from three independent experiments.

Close modal

Previous studies have shown that several extracellular matrix proteins (ECMs), including OPN, vitronectin (VN), and fibronectin (FN), are potential ligands for αvβ3 integrin and regulate a variety of physiological and pathological functions in various organs (26, 27). To explore potential ligands related to the association of αvβ3 integrin with the antiinflammatory role of MFG-E8, we initially examined the expression of colonic ECMs during experimental colitis. As shown in Fig. 6,A, a robust induction of OPN was observed in the early phase of DSS-induced colitis, while other ligands (VN and FN) were increased during the regeneration phase of colitis after the end of DSS administration. Consistent with these in vivo results, we also noticed an increased production of OPN by peritoneal macrophages in an LPS-dependent manner (Fig. 6, B and C). Recently, several studies have shown that OPN is one of the potential ligands used by αvβ3 integrin to participate in innate immune responses during colitis or other autoimmune diseases via the activation of NF-κB (5, 28, 29, 30, 31). In consideration of those findings, we focused on OPN function to evaluate the antiinflammatory role of MFG-E8 in macrophages and designed several kinds of in vitro experiments. In this regard, we first confirmed MFG-E8 binding to αvβ3 integrin and investigated its relative binding affinity as compared with OPN based on a dose-response curve of varying MFG-E8 amounts with a fixed amount of OPN. As shown in Fig. 7,A, MFG-E8 exhibited a strong binding affinity to αvβ3 integrin with an apparent Kd value of ∼3.05 nM. Moreover, we also found that OPN binding to αvβ3 become decreased with increased concentrations of recombinant MFG-E8. In contrast, when the relative Kd value was ∼4.45 nM, it inhibited OPN by competitive binding to αvβ3 integrin (Fig. 7 B).

FIGURE 6.

OPN expression during inflammation. A, Real-time PCR showing the time-dependent expression of OPN, FN, and VN in distal colonic tissues of 2.5% DSS-treated mice (n = 30). *, p < 0.05 vs DSS (−). B and C, LPS (100 ng/ml)-dependent time course changes of OPN expression by peritoneal macrophages using real-time PCR and EIA at various time points. *, p < 0.05 vs LPS (−). Error bars indicate the SEM values obtained from four independent experiments.

FIGURE 6.

OPN expression during inflammation. A, Real-time PCR showing the time-dependent expression of OPN, FN, and VN in distal colonic tissues of 2.5% DSS-treated mice (n = 30). *, p < 0.05 vs DSS (−). B and C, LPS (100 ng/ml)-dependent time course changes of OPN expression by peritoneal macrophages using real-time PCR and EIA at various time points. *, p < 0.05 vs LPS (−). Error bars indicate the SEM values obtained from four independent experiments.

Close modal
FIGURE 7.

MFG-E8 relative binding assay and autocrine effects of OPN. A, MFG-E8 binding to αvβ3 integrin was determined by adding serially diluted recombinant MFG-E8 (0–800 ng/ml) to αvβ3-coated plates, after which Kd was determined as the amount of MFG-E8 required to saturate to half of the optimum binding point. B, Competitive binding of MFG-E8 with OPN for αvβ3 integrin was assessed by adding a fixed amount of recombinant OPN (500 ng/ml) with varying concentrations of MFG-E8 (0–800 ng/ml) to αvβ3-coated wells. OPN binding to αvβ3 was decreased with increasing concentrations of recombinant MFG-E8. Relative Kd was determined as the amount of MFG-E8 required to desaturate to half of the optimum amount of OPN needed to bind to αvβ3. The corresponding Kd value was determined from results of four independent experiments. C and D, Mouse peritoneal macrophages were cultured with either the IgG isotype control (5 μg/ml) or anti-mouse OPN Ab (5 μg/ml) and then stimulated for 12 h with LPS, after which EIA was performed for IL-1β and TNF-α using culture supernatants. *, p < 0.05 vs LPS (+) anti-IgG.

FIGURE 7.

MFG-E8 relative binding assay and autocrine effects of OPN. A, MFG-E8 binding to αvβ3 integrin was determined by adding serially diluted recombinant MFG-E8 (0–800 ng/ml) to αvβ3-coated plates, after which Kd was determined as the amount of MFG-E8 required to saturate to half of the optimum binding point. B, Competitive binding of MFG-E8 with OPN for αvβ3 integrin was assessed by adding a fixed amount of recombinant OPN (500 ng/ml) with varying concentrations of MFG-E8 (0–800 ng/ml) to αvβ3-coated wells. OPN binding to αvβ3 was decreased with increasing concentrations of recombinant MFG-E8. Relative Kd was determined as the amount of MFG-E8 required to desaturate to half of the optimum amount of OPN needed to bind to αvβ3. The corresponding Kd value was determined from results of four independent experiments. C and D, Mouse peritoneal macrophages were cultured with either the IgG isotype control (5 μg/ml) or anti-mouse OPN Ab (5 μg/ml) and then stimulated for 12 h with LPS, after which EIA was performed for IL-1β and TNF-α using culture supernatants. *, p < 0.05 vs LPS (+) anti-IgG.

Close modal

To explore the possible role of OPN in production of proinflammatory cytokines by macrophages, we blocked the function of secreted OPN using a neutralizing Ab with LPS-treated cells. Treatment with the neutralizing Ab for OPN significantly decreased the production of IL-1β and TNF-α (Fig. 7, C and D), indicating that OPN secreted by macrophages induces cytokine production via αvβ3 integrin in an autocrine-dependent manner. These results also support our speculation that MFG-E8 may inhibit αvβ3 integrin signaling mediated by other ligands (OPN) existing in culture medium treated with LPS. To precisely elucidate the antiinflammatory role of MFG-E8, we used recombinant OPN in various in vitro experiments (Fig. 8). Exogenous stimulation with recombinant OPN induced the production of IL-1β and TNF-α in LPS-treated macrophages, which was clearly related to NF-κB activation and IκB phosphorylation. As expected, treatment with MFG-E8 significantly decreased OPN-induced cytokine production and NF-κB activation in the cells in a dose-dependent manner (Fig. 8 A), whereas no effect was observed in cells treated with mutant MFG-E8. Taken together, these results clarify the potential role of OPN to induce inflammatory cascades via αvβ3 integrin-mediated NF-κB activation, whereas those are interrupted in the presence of MFG-E8.

FIGURE 8.

Paracrine effects of OPN. A, IL-1β and TNF-α in culture supernatants were treated with a fixed amount of recombinant OPN (500 ng/ml) or varying amounts of MFG-E8 as well as LPS (100 ng/ml) for 12 h and then measured using EIA. NF-κB in P388D1 cells was examined using a dual-luciferase assay. Transfected cells were treated with recombinant OPN, as well as MFG-E8 proteins at various concentrations, followed by stimulation with LPS for 12 h, after which dual-luciferase assays were performed. *, p < 0.05 and **, p < 0.01 vs LPS (−); #, p < 0.05 vs LPS (+) OPN. Error bars indicate the SEM values obtained from three independent experiments. B, Effects of OPN and MFG-E8 on IκB degradation and phosphorylation in peritoneal macrophages after 15 and 30 min of stimulation with LPS (100 ng/ml). Blots shown represent one of three independent experiments.

FIGURE 8.

Paracrine effects of OPN. A, IL-1β and TNF-α in culture supernatants were treated with a fixed amount of recombinant OPN (500 ng/ml) or varying amounts of MFG-E8 as well as LPS (100 ng/ml) for 12 h and then measured using EIA. NF-κB in P388D1 cells was examined using a dual-luciferase assay. Transfected cells were treated with recombinant OPN, as well as MFG-E8 proteins at various concentrations, followed by stimulation with LPS for 12 h, after which dual-luciferase assays were performed. *, p < 0.05 and **, p < 0.01 vs LPS (−); #, p < 0.05 vs LPS (+) OPN. Error bars indicate the SEM values obtained from three independent experiments. B, Effects of OPN and MFG-E8 on IκB degradation and phosphorylation in peritoneal macrophages after 15 and 30 min of stimulation with LPS (100 ng/ml). Blots shown represent one of three independent experiments.

Close modal

Although our in vitro results indicate that OPN induces proinflammatory cytokine production via αvβ3 integrin signaling, its effect was clearly observed only in the LPS-treated conditions. Tyrosine phosphorylation of the β3 integrin subunit is an essential event for αvβ3 integrin-mediated functions (32, 33), as it facilitates the binding of its potential ligands and subsequently activates FAK to mediate several downstream signaling pathways (34, 35, 36). Thus, we examined whether time course changes of LPS stimulation alter the status of β3 integrin and FAK status in peritoneal macrophages. Following 15–60 min of stimulation with LPS, increased phosphorylation of the β3 integrin subunit as well as FAK were clearly observed in the cells (Fig. 9,A), suggesting that LPS-induced activation of the integrin further promotes the binding of its potential ligands to induce integrin-dependent cellular responses. To further investigate whether OPN binding to activated αvβ3 integrin generates the phosphorylation of FAK, cells were treated with LPS then exposed to recombinant OPN with or without MFG-E8 proteins, after which the phosphorylation of FAK was examined in total FAK pools. As shown in Fig. 9 B, OPN stimulation induced abundant phosphorylation of FAK (lanes 3 and 7), while that was markedly inhibited by wild-type MFG-E8 (lanes 4 and 8), but not by mutant MFG-E8 (lanes 5 and 9). These findings indicate the possible role of MFG-E8 to interfere with αvβ3 integrin-mediated OPN functions by modulating FAK phosphorylation. Interestingly, phosphorylation of FAK was also observed in LPS-treated cells without OPN stimulation (lanes 2 and 6).

FIGURE 9.

Effects of MFG-E8 on focal adhesion kinase in LPS-treated peritoneal macrophages. A, Western blotting was performed using cultured peritoneal macrophages treated with LPS (100 ng/ml) for various time points with the anti-pβ3 integrin (pY759) Ab from β3 integrin immunoprecipitated samples and anti-pFAK Ab from FAK immunoprecipitated samples. B, Western blotting results showing pFAK among total FAK in peritoneal macrophages treated with LPS, OPN, or MFG-E8 proteins for the indicated time periods. Blots shown are representative of three independent experiments. C, Proposed model of MFG-E8-mediated antiinflammatory effects in immune-reactive cells. An external stimulus factor, such as LPS, activates inflammatory cascades via TLR-4-mediated pathways by utilizing a variety of signaling events. Although LPS-mediated NF-κB induction is common, it also activates FAK and subsequently αvβ3 integrin to generate inside-out signaling for enhanced binding of its potential ligands. OPN, which becomes activated during colitis or in an LPS-treated condition, recognizes activated αvβ3 integrin and performs outside-in signaling via FAK phosphorylation. Exogenous MFG-E8 interferes with OPN binding to αvβ3 integrin and affects downstream signaling for NF-κB activation by modulating FAK phosphorylation.

FIGURE 9.

Effects of MFG-E8 on focal adhesion kinase in LPS-treated peritoneal macrophages. A, Western blotting was performed using cultured peritoneal macrophages treated with LPS (100 ng/ml) for various time points with the anti-pβ3 integrin (pY759) Ab from β3 integrin immunoprecipitated samples and anti-pFAK Ab from FAK immunoprecipitated samples. B, Western blotting results showing pFAK among total FAK in peritoneal macrophages treated with LPS, OPN, or MFG-E8 proteins for the indicated time periods. Blots shown are representative of three independent experiments. C, Proposed model of MFG-E8-mediated antiinflammatory effects in immune-reactive cells. An external stimulus factor, such as LPS, activates inflammatory cascades via TLR-4-mediated pathways by utilizing a variety of signaling events. Although LPS-mediated NF-κB induction is common, it also activates FAK and subsequently αvβ3 integrin to generate inside-out signaling for enhanced binding of its potential ligands. OPN, which becomes activated during colitis or in an LPS-treated condition, recognizes activated αvβ3 integrin and performs outside-in signaling via FAK phosphorylation. Exogenous MFG-E8 interferes with OPN binding to αvβ3 integrin and affects downstream signaling for NF-κB activation by modulating FAK phosphorylation.

Close modal

MFG-E8 was originally identified in the process of phagocytic clearance of apoptotic cells (17), while the present novel findings indicate its antiinflammatory function via the modulation of NF-κB activity during acute colitis. Our results showed a decreased production of MFG-E8 during the initiation of colitis, whereas it was up-regulated during the healing phase to restore homeostasis mechanisms. In the present study, we investigated whether down-regulation of MFG-E8 is dependent on the severity of inflammation. Our results were consistent with those of other studies of atherosclerotic mice characterized by severe inflammation (37), and they indicate a reduced level of suppressive activity by regulatory T cells and enhanced atherosclerotic plaque formation. We also noted that MFG-E8 effectively ameliorates the development of experimental colitis by attenuating inflammation and disease status. Using an in vitro model, we further confirmed that the antiinflammatory effects of MFG-E8 are mediated via αvβ3 integrin by modulating the family of protein tyrosine kinases, which finally inhibit NF-κB activation.

Recent reports have revealed the essential role of MFG-E8 to maintain normal tissue homeostasis by clearing apoptotic cells from the body, and preserving the balance between pro- and antiinflammatory cytokines during inflammation (18, 19). Because the pathogenesis of IBD is mainly due to a disorder of intestinal immune homeostasis, a therapeutic role of MFG-E8 without notable side effects is an important finding. Based on our speculation, we treated mice with recombinant MFG-E8 and observed its benefits to control intestinal inflammation, which led us to consider that the antiinflammatory role of recombinant MFG-E8 might be generated via enhanced clearance of apoptotic cells during acute colitis. However, previous studies that used an MFG-E8 knockout murine model reported no increase in accumulated apoptotic cells in small intestinal crypts (22), while apoptotic B cells were found infiltrated only in the germinal centers in spleens of MFG-E8-null mice (19). Those results suggest that the in vivo molecular mechanisms used by MFG-E8 to remove apoptotic cells vary depending on tissue type. Thus, we speculated that MFG-E8-mediated antiinflammatory effects are facilitated not only by removal of apoptotic cells, but there may be some other mechanisms by which recombinant MFG-E8 performs an antiinflammatory role during colitis.

Expression of proinflammatory cytokines is under the control of the potent transcription factor NF-κB and is increased in intestinal lamina propria of patients with IBD (38, 39). Recently, we reported that decoy oligodeoxynucleotides targeting NF-κB attenuate intestinal inflammation in murine experimental colitis, indicating that blockade of NF-κB-mediated signaling is a potent therapeutic strategy for IBD (25). In the present study, lower levels of proinflammatory cytokines in inflamed colonic mucosa were observed in MFG-E8-treated mice, and thus we speculated that MFG-E8 may inhibit intestinal inflammation via modulation of NF-κB-related pathways. To reveal a plausible antiinflammatory mechanism of MFG-E8, we established an in vitro model by utilizing LPS, one of the potent inducers of the inflammatory cascade in immune-reactive cells, and observed that treatment with recombinant MFG-E8 significantly down-regulated LPS-induced proinflammatory cytokines by modulating NF-κB. Once the involvement of NF-κB in this event was confirmed, we investigated how MFG-E8 inhibits NF-κB activation in LPS-dependent conditions. Several reports have shown that RGD mutant MFG-E8 protein decreases phagocytosis of apoptotic cells by macrophages due to the inability of binding to αvβ3 integrin (18, 19). In the present study, RGD mutant MFG-E8 protein did not show any inhibitory effects toward NF-κB activation in LPS-treated cells, suggesting that the antiinflammatory role of MFG-E8 may depend on αvβ3 integrin-mediated intracellular signaling. To explore this, we investigated the relevance of the αvβ3 integrin using an RNA interference technique and noticed that blocking of αvβ3 integrin reversed the potential effects of MFG-E8 for inhibiting NF-κB in LPS-treated in vitro conditions. These findings clarify the two major points of our study: first, the involvement of αvβ3 integrin to generate MFG-E8 effects; and second, the possibility of the presence of certain ligands that competitively share the same αvβ3 integrin with MFG-E8.

OPN is an extracellular matrix phosphoprotein and contains the RGD domain, which is predominantly expressed in macrophages, activated T cells, osteoblasts, and epithelial cells (40) and induces the production of NF-κB-mediated inflammatory cytokines after binding to αvβ3 integrin (29). In the present study, we observed increased OPN expression in DSS-induced inflamed colonic tissues, and our in vitro experiments with the neutralizing Abs for OPN and recombinant OPN clearly showed that OPN is a potent mediator to induce proinflammatory cytokines in peritoneal macrophages via NF-κB activation. Recently, Zhong et al. reported that OPN-null mice demonstrated significantly inhibited disease activity of DSS-induced colitis as compared with wild-type mice, as shown by reduced levels of rectal bleeding, weight loss, and histological intestinal injury (41), which supports our speculation that OPN plays an important role in the development of intestinal inflammation. Additionally, the present findings clarified that wild-type MFG-E8 protein but not the RGD mutant significantly inhibited OPN-induced production of proinflammatory cytokines in both autocrine (Fig. 7, C and D) and paracrine (Fig. 8) models using cultured macrophages. Taken together, these results suggest the possibility that MFG-E8 interferes with OPN binding to αvβ3 integrin for downstream signaling toward NF-κB activation.

In the present in vivo and in vitro experiments, the effects of recombinant MFG-E8 were evident only in DSS colitis or LPS-treated conditions, which indicates that an inflammatory environment is required for effective MFG-E8 functioning. Although the essential pathway of TLR-4-mediated signaling for NF-κB activation has been widely recognized (42), there may also be other surface molecules that play a complementary role in TLR-4-induced events. Integrins are a class of receptors that have been linked to LPS signaling, and a recent study revealed that TLR-4 signaling mediates FAK phosphorylation, with subsequent phosphorylation of integrin leading to increasing binding of its ligands (43). After ligand binding, the activation of integrin also results in recruitment of phosphorylated FAK (pFAK), leading to NF-κB activation (35, 36). Consistent with the above reports, we found that in vitro treatment of macrophages with LPS resulted in increased phosphorylation of FAK and β3 integrin to generate “inside-out signaling” (TLR-4 signaling → pFAK → αvβ3 integrin activation), and such treatment facilitated enhanced binding of exogenous OPN to generate downstream “outside-in signaling” (OPN binding to activated αvβ3 integrin → pFAK → NF-κB activation) by augmenting FAK phosphorylation. By targeting this pathway, we found that MFG-E8 markedly reduced LPS-induced NF-κB activation by blocking OPN binding and modulated αvβ3 integrin-dependent and FAK-mediated downstream signaling (Fig. 9 C).

Recent studies have reported that high levels of both plasma and tissue OPN were observed in patients with IBD (44, 40, 29), suggesting that OPN, which regulates proinflammatory and T cell-mediated immune responses, may be part of a new therapeutic strategy for the disease. Although our present findings showed a beneficial antiinflammatory role of recombinant MFG-E8 in acute murine model of colitis, there are several points that require further clarification before clinical use. Since IBD refers to a chronic, relapsing form of intestinal disorder, the role of MFG-E8 in chronic models of colitis must be addressed further. Additionally, although we assessed the effects of MFG-E8 with noncolitic healthy mice, it was given for only a short period, and the long-term effects of MFG-E8 in regard to physiological, immunological, and clinical aspects should be evaluated in the future. The present findings also suggest the possibility of a downstream pathway initiated by activation of the family of protein tyrosine kinases, which implicates the need of future studies to determine the nature of the downstream pathway that links the LPS-induced activation of αvβ3 integrin and outside-in-mediated signaling for NF-κB during inflammation. Furthermore, LPS-mediated integrin activation leads to induction of other signaling pathways, including the MAPK family. Herein, we evaluated NF-κB as one of the LPS-dependent integrin-mediated signaling events and also focused on other pathways.

In summary, we investigated the antiinflammatory effects of MFG-E8 against experimental colitis in mice and report for the first time that MFG-E8 attenuated intestinal inflammation, indicating the potential of targeting NF-κB-mediated proinflammatory cytokines in the development of new therapies for IBD.

We thank Rika Tohma and Keiko Masuzaki for their technical support.

The authors have no financial conflicts of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports, and Culture of Japan.

3

Abbreviations used in this paper: UC, ulcerative colitis; CD, Crohn’s disease; IBD, inflammatory bowel disease; MFG-E8, milk fat globule-epidermal growth factor 8; DSS, dextran sodium sulfate; OPN, osteopontin; MPO, myeloperoxidase; FAK, focal adhesion kinase; RGD, arginine-glycine-aspartate; siRNA, small interfering RNA; EIA, enzyme immune assay; ECM, extracellular matrix protein; VN, vitronectin; FN, fibronectin.

1
Sands, B. E..
2007
. Inflammatory bowel disease: past, present, and future.
J. Gastroenterol.
42
:
16
-25.
2
Xavier, R. J., D. K. Podolsky.
2007
. Unravelling the pathogenesis of inflammatory bowel disease.
Nature
26
:
427
-434.
3
Isaacs, K. L., R. B. Sartor, S. Haskill.
1992
. Cytokine messenger RNA profiles in inflammatory bowel disease mucosa detected by polymerase chain reaction amplification.
Gastroenterology
103
:
1587
-1595.
4
Schreiber, S., S. Nikolaus, J. Hampe.
1998
. Activation of nuclear factor κB inflammatory bowel disease.
Gut
42
:
477
-484.
5
Danese, S., M. Sans, C. de la Motte, C. Graziani, G. West, M. H. Phillips, R. Pola, S. Rutella, J. Willis, A. Gasbarrini, et al
2006
. Angiogenesis as a novel component of inflammatory bowel disease pathogenesis.
Gastroenterology
130
:
2060
-2073.
6
Chidlow, J. H., W. Langston, J. J. Greer, D. Ostanin, M. Abdelbaqi, J. Houghton, A. Senthilkumar, D. Shukla, A. P. Mazar, M. B. Grisham, et al
2006
. Differential angiogenic regulation of experimental colitis.
Am. J. Pathol.
169
:
2014
-2030.
7
Danese, S., M. Sans, D. M. Spencer, I. Beck, F. Doñate, M. L. Plunkett, C. de la Motte, R. Redline, D. E. Shaw, A. D. Levine, et al
2007
. Angiogenesis blockade as a new therapeutic approach to experimental colitis.
Gut
56
:
855
-862.
8
Baumgart, D. C., W. J. Sandborn.
2007
. Inflammatory bowel disease: clinical aspects and established and evolving therapies.
Lancet
369
:
1641
-1657.
9
Podolsky, D. K..
2003
. The future of IBD treatment.
J. Gastroenterol.
38
:
63
-66.
10
Kusugami, K., K. Ina, T. Ando, K. Hibi, Y. Nishio, H. Goto.
2004
. Immunomodulatory therapy for inflammatory bowel disease.
J. Gastroenterol.
39
:
1129
-1137.
11
Domènech, E..
2006
. Inflammatory bowel disease: current therapeutic options.
Digestion
73
:
67
-76.
12
Lichtenstein, G. R., S. Yan, M. Bala, M. Blank, B. E. Sands.
2005
. Infliximab maintenance treatment reduces hospitalizations, surgeries, and procedures in fistulizing Crohn’s disease.
Gastroenterology
128
:
862
-869.
13
Ito, H., M. Takazoe, Y. Fukuda, T. Hibi, K. Kusugami, A. Andoh, T. Matsumoto, T. Yamamura, J. Azuma, N. Nishimoto, et al
2004
. A pilot randomized trial of a human anti-interleukin-6 receptor monoclonal antibody in active Crohn’s disease.
Gastroenterology
126
:
989
-996.
14
Stubbs, J. D., C. Lekutis, K. L. Singer, A. Bui, D. Yuzuki, U. Srinivasan, G. Parry.
1990
. cDNA cloning of a mouse mammary epithelial cell surface protein reveals the existence of epidermal growth factor-like domains linked to factor VIII-like sequences.
Proc. Natl. Acad. Sci. USA
87
:
8417
-8421.
15
Hanayama, R., M. Tanaka, K. Miwa, S. Nagata.
2004
. Expression of developmental endothelial locus-1 in a subset of macrophages for engulfment of apoptotic cells.
J. Immunol.
172
:
3876
-3882.
16
Miyasaka, K., R. Hanayama, M. Tanaka, S. Nagata.
2004
. Expression of milk fat globule epidermal growth factor 8 in immature dendritic cells for engulfment of apoptotic cells.
Eur. J. Immunol.
34
:
1414
-1422.
17
Hanayama, R., M. Tanaka, K. Miwa, A. Shinohara, S. Nagata.
2002
. Identification of a factor that links apoptotic cells to phagocytes.
Nature
417
:
182
-187.
18
Asano, K., M. Miwa, K. Miwa, R. Hanayama, H. Nagase, S. Nagata, M. Tanaka.
2004
. Masking of phosphatidylserine inhibits apoptotic cell engulfment and induces autoantibody production in mice.
J. Exp. Med.
200
:
459
-467.
19
Hanayama, R., M. Tanaka, K. Miyasaka, K. Aozasa, M. Koike, S. Nagata.
2004
. Autoimmune disease and impaired uptake of apoptotic cells in MFG-E8-deficient mice.
Science
304
:
1147
-1150.
20
Misaka, M., R. Wu, W. Dong, P. Das, D. Yang, P. Wang.
2006
. Dendritic cell-derived exosomes containing milk fat globule epidermal growth factor-factor VIII attenuate proinflammatory responses in sepsis.
Shock
25
:
586
-593.
21
Jinushi, M., Y. Nakazaki, M. Dougan, D. R. Carrasco, M. Mihm, G. Dranoff.
2007
. MFG-E8-mediated uptake of apoptotic cells by APCs links the pro- and antiinflammatory activities of GM-CSF.
J. Clin. Invest.
117
:
1902
-1913.
22
Bu, H. F., X. L. Zuo, X. Wang, M. A. Ensslin, V. Koti, W. Hsueh, A. S. Raymond, B. D. Shur, X. D. Tan.
2007
. Milk fat globule-EGF factor 8/lactadherin plays a crucial role in maintenance and repair of murine intestinal epithelium.
J. Clin. Invest.
117
:
3673
-3683.
23
Aziz, M. M., S. Ishihara, M. A. Rumi, Y. Mishima, N. Oshima, C. Kadota, I. Moriyama, Y. Y. Li, F. B. Rahman, A. Otani, et al
2008
. Prolactin induces MFG-E8 production in macrophages via transcription factor C/EBPb-dependent pathway.
Apoptosis
13
:
609
-620.
24
Watanabe, T., R. Totsuka., S. Miyatani, S. Kurata, S. Sato, I. Katoh, S. Kobayashi, Y. Ikawa.
2005
. Production of the long and short forms of MFG-E8 by epidermal keratinocytes.
Cell Tissue Res.
321
:
185
-193.
25
Moriyama, I., S. Ishihara, M. A. Rumi, MD Aziz, Y. Mishima, N. Oshima, C. Kadota, Y. Kadowaki, Y. Amano, Y. Kinoshita.
2008
. Decoy oligodeoxynucleotide targeting activator protein-1 (AP-1) attenuates intestinal inflammation in murine experimental colitis.
Lab. Invest.
88
:
652
-663.
26
Stupack, D. G., D. A. Cheresh.
2002
. Get a ligand, get a life: integrins, signaling and cell survival.
J. Cell Sci.
115
:
3729
-3738.
27
Harris, E. S., T. M. McIntyre, S. M. Prescott, G. A. Zimmerman.
2000
. The leukocyte integrins.
J. Biol. Chem.
275
:
23409
-23412.
28
Ashkar, S., G. F. Weber, V. Panoutsakopoulou, M. E. Sanchirico, M. Jansson, S. Zawaideh, S. R. Rittling, D. T. Denhardt, M. J. Glimcher, H. Cantor.
2000
. Eta-1 (osteopontin): an early component of type-1 (cell-mediated) immunity.
Science
287
:
860
-864.
29
Mishima, R., F. Takeshima, T. Sawai, K. Ohba, K. Ohnita, H. Isomoto, K. Omagari, Y. Mizuta, Y. Ozono, S. Kohno.
2007
. High plasma osteopontin levels in patients with inflammatory bowel disease.
J. Clin. Gastroenterol.
41
:
167
-172.
30
Da Silva, A. P., A. Pollett, S. R. Rittling, D. T. Denhardt, J. Sodek, R. Zohar.
2006
. Exacerbated tissue destruction in DSS-induced acute colitis of OPN-null mice is associated with downregulation of TNF-α expression and non-programmed cell death.
J. Cell Physiol.
208
:
629
-639.
31
Chabas, D., S. E. Baranzini, D. Mitchell, C. C. Bernard, S. R. Rittling, D. T. Denhardt, R. A. Sobel, C. Lock, M. Karpuj, R. Pedotti, et al
2001
. The influence of the proinflammatory cytokine, osteopontin, on autoimmune demyelinating disease.
Science
294
:
1731
-1735.
32
Blystone, S. D., M. P. Williams, S. E. Slater, E. J. Brown.
1997
. Requirement of integrin β3 tyrosine 747 for β3 tyrosine phosphorylation and regulation of avb3 avidity.
J. Biol. Chem.
272
:
28757
-28761.
33
Chandhoke, S. K., M. Williams, E. Schaefer, L. Zorn, S. D. Blystone.
2004
. β3 integrin phosphorylation is essential for Arp3 organization into leukocyte αVβ3-vitronectin adhesion contacts.
J. Cell Sci.
117
:
1431
-1441.
34
Khadaroo, R. G., A. Kapus, K. A. Powers, M. I. Cybulsky, J. C. Marshall, O. D. Rotstein.
2003
. Oxidative stress reprograms lipopolysaccharide signaling via Src kinase-dependent pathway in RAW 264.7 macrophage cell line.
J. Biol. Chem.
278
:
47834
-47841.
35
Barberis, L., K. K. Wary, G. Fiucci, F. Liu, E. Hirsch, M. Brancaccio, F. Altruda, G. Tarone, F. G. Giancotti.
2000
. Distinct roles of the adaptor protein Shc and focal adhesion kinase in integrin signaling to ERK.
J. Biol. Chem.
275
:
36532
-36540.
36
Schlaepfer, D. D., C. R. Hauck, D. J. Sieg.
1999
. Signaling through focal adhesion kinase.
Prog. Biophys. Mol. Biol.
71
:
435
-478.
37
Ait-Oufella, H., K. Kinugawa, J. Zoll, T. Simon, J. Boddaert, S. Heeneman, O. Blanc-Brude, V. Barateau, S. Potteaux, R. Merval, et al
2007
. Lactadherin deficiency leads to apoptotic cell accumulation and accelerated atherosclerosis in mice.
Circulation
115
:
2168
-2177.
38
Lenardo, M. J., D. Baltimore.
1989
. NF-kappa B: a pleiotropic mediator of inducible and tissue-specific gene control.
Cell
58
:
227
-229.
39
Reinecker, H. C., M. Steffen, T. Witthoeft, I. Pflueger, S. Schreiber, R. P. MacDermott, A. Raedler.
1993
. Enhanced secretion of tumour necrosis factor-alpha, IL-6, and IL-1 beta by isolated lamina propria mononuclear cells from patients with ulcerative colitis and Crohn’s disease.
Clin. Exp. Immunol.
94
:
174
-181.
40
Sato, T., T. Nakai, N. Tamura, S. Okamoto, K. Matsuoka, A. Sakuraba, T. Fukushima, T. Uede, T. Hibi.
2005
. Osteopontin/Eta-1 upregulated in Crohn’s disease regulates the Th1 immune response.
Gut
54
:
1254
-1262.
41
Zhong, J., E. R. Eckhardt, H. S. Oz, D. Bruemmer, W. J. de Villiers.
2006
. Osteopontin deficiency protects mice from Dextran sodium sulfate-induced colitis.
Inflamm. Bowel Dis.
12
:
790
-796.
42
Aderm, A., R. J. Ulevitch.
2000
. Toll-like receptors in the induction of the innate immune response.
Nature
406
:
782
-787.
43
Zeisel, M. B., V. A. Druet, J. Sibilia, J. P. Klein, V. Quesniaux, D. Wachsmann.
2005
. Cross talk between MyD88 and focal adhesion kinase pathways.
J. Immunol.
174
:
7393
-7397.
44
Agnholt, J., J. Kelsen, L. Schack, C. L. Hvas, J. F. Dahlerup, E. S. Sorensen.
2007
. Osteopontin, a protein with cytokine-like properties, is associated with inflammation in Crohn’s disease.
Scand. J. Immunol.
65
:
453
-460.