Regulation of T Cell Activation by Notch Ligand, DLL4, Promotes IL-17 Production and Rorc Activation

The induction of acquired immune responses during pathogenic insult depends upon the rapid recognition of pathogenic signals followed by the initiation of the proper acquired immune response. Specific signals have been shown to induce these signals after recognition of pathogen associated molecular patterns (PAMPs)² that promote strong activation signals to induce innate cell activation. TLRs have been implicated in the initial activation scheme that quickly promotes activation of the immune responses, including innate cytokine production, MHC molecule expression, and costimulatory molecule activation (1, 2, 3). Subsequent Ag presentation and T cell activation is dictated by the APC after these initial events. The TLR-induced events depend predominantly on specific signaling pathways initiated by MyD88 adaptor protein-dependent activation that leads to the maturation of dendritic cells (DCs) and other APC populations (2, 4, 5, 6). A more recently identified family of MyD88-dependent molecules that are induced on APCs is Notch ligands that can alter the course of T cell activation (7, 8, 9, 10).

Notch is a receptor system that was originally shown to be involved in cell differentiation and survival. Notch signaling is initiated by the ligand engagement of the notch receptor. There are four notch receptors (N1–4) and five notch ligands (delta-like (Dll) 1, 3, and 4; Jagged 1 and 2) (11, 12). Upon binding by either delta-like or jagged ligands, Notch undergoes proteolytic cleavages catalyzed by Adam proteases and γ secretase complex, leading to the translocation of the notch intracellular domain (N-ICD) into the nucleus. Canonically notch interacts with the transcriptional repressor RBPj-κ (CSL). N-ICD interaction with RBPj-κ displaces transcriptional corepressors from RBPj-κ and also recruits Mastermind (MAML) protein. The new transcriptional complex of N-ICD-RBPj-κ-MAML converts RBPj-κ from a repressor to a transcriptional activator (11, 12, 13). Over the past several years, this complex signaling and activation system has been shown to determine fate decisions within immune cell populations, including DC, B cells, and T cells (13). It appears that depending upon what ligands on DCs (delta-like or jagged) are used to engage notch receptors on T cells during activation, a specific course of T cell differentiation can be dictated (8, 14). Still other studies using genetic models of defective Notch activation via conditional deletion of RBPj-κ or expression of dominant negative form of MAML on CD4⁺ T cells have demonstrated that Th2 type, but not Th1 type responses are dependent upon notch signaling pathways and upon Gata3 activation (7, 10, 15). Although no defects were seen by conditional deletion of RBPj-κ or expression of dominant negative form of MAML on Th1 (IFN-γ) responses, γ-secretase inhibitor (GSI) mediated inhibition of Notch revealed abrogation of IFN-γ production (9). More recent studies have demonstrated that delta-like 1 and 4 appear to regulate Th2 cytokine production and therefore regulate the differentiation potential of peripheral effector T cells (16, 17). Overall, however, little defined information as to the role of notch signaling for the regulation of T cell activation events exists. This is further exemplified by a number of studies that have demonstrated that Notch can be involved in Th1, Th2 as well as Treg cell differentiation (7, 8, 9, 10, 18, 19), depending on the ligand, immune environment, genetic makeup, or disease model in which the responses were derived.

A series of studies examining CD4⁺ T cell differentiation have further defined a novel class of T cells based upon their ability to produce IL-17, IL-21, and IL-22 (20, 21). This lineage of T cell is known as Th17 and has been shown to be pathogenic in autoimmunity, psoriasis, and in several other chronic disorders. The IL-17 family contains six members (IL-17A-F), with IL-17A being designated as the prototypic IL-17 cytokine. Along with its ability to induce rapid neutrophil accumulation, the production of IL-17 may provide a means for preferential innate immunity during bacterial infections at mucosal sites. Although the regulation of Th17 cells has not been fully defined, IL-6 and other STAT3 initiating cytokines in concert with TGFβ are necessary for Th17 differentiation. The transcription factor Rorc also appears to be required for Th17 differentiation in addition to the cytokine signals (22). Thus, a large body of literature has emerged on the role and regulation of Th17 during chronic immune responses.

In the present studies, we provide evidence that Dll4 provides additional skewing signals to drive Th17 differentiation through the up-regulation of Rorc, while at the same time limiting Th2 cytokine production. IL-17 production was notch dependent and CSL directly associated with Rorc and IL-17 promoter regions that contained CSL binding sites. Thus, these studies may define a critical activating scheme for generation of this class of T cell during chronic diseases, such as autoimmunity, potentially via TLR-mediated signals that would specifically drive Dll4 up-regulation on APC. These data support our recent observation that treatment of mice with anti-Dll4 during mycobacteria protein-induced pulmonary granuloma formation reduces Th17 cytokine production (23).

Magnetic bead-isolated CD4⁺CD62L⁺CD25⁻ splenic naive T cells were purified using the MACS system (Miltenyi Biotec). In brief, the CD4⁺ T cells were isolated using anti-CD4⁺ magnetic beads by negative selection. The CD62L⁺ cells were then enriched from the CD4⁺ T cell population using anti-CD62L⁺ beads by positive selection. Cells were then plated and cultured in flat-bottom 96-well plates (luminex analysis) or six-well plates (Western blots and chromatin immunoprecipitation (ChIP) assays). The cells were activated under different skewing conditions. Th1 conditions: ova-peptide (1 μg/ml), anti-IL-4 (10 μg/ml), and anti-IL-12 (10 μg/ml); Th2 conditions: OVA-peptide, anti-IFN-γ (10 μg/ml); Th17 conditions: plate bound anti-CD3 (1 μg/ml) and soluble anti-CD28 (1 μg/ml) for CD4 T cells from BALB/c or C57BL/6 or IL-17^−/− mice or ova peptide for T cells from DO-11.10 mice together with TGFβ1 (2 ng/ml), IL-6 (20 ng/ml), anti-IL-4 (10 μg/ml) and anti-IFN-γ (10 μg/ml). Plate-bound recombinant Dll4 (rDll4) was used at a final concentration of 2.5 μg/ml.

BM was harvested from uninfected, naive mice and seeded in T-150 tissue culture flasks at 10⁶ cells/ml in RPMI 1640-based complete medium with GM-CSF/ml (R&D Systems). After 6 days, loosely adherent cells were collected and isolated with anti-CD11c by magnetic bead (Miltenyi Biotec) as previously described (24).

Total RNA was isolated from the CD4 T cells using TRIzol (Invitrogen) following the manufacturer’s instructions and was reverse transcribed in a 25 μl volume. mRNA expression was determined in 1 μl of cDNA by TaqMan real-time PCR with a PRISM 7500 sequence detection system using predeveloped gene-specific primers for GAPDH, IL-17A, and RORγ-t (Applied Biosystems). The Sybr primer sets for Dll1, Dll4, Jag1, Jag2, and GATA3 were purchased from Sigma-Aldrich and were described previously (8). Results are normalized to GAPDH expression and are presented as the folds increase in mRNA expression over the control group. Protein levels of cytokines were quantified using a Bio-Plex bead-based (luminex) cytokine assay purchased from Bio-Rad Laboratories.

Cytoplasmic or nuclear extracts were prepared using the NE-PER nuclear and cytoplasmic extraction kit from Pierce following the manufacturer’s protocol. Equal amount of the proteins were separated by SDS-PAGE and transferred on nitrocellulose membrane. The membrane was probed with primary Abs: rabbit anti-cleaved notch 1 (Val 1744) (Cell Signaling Technology); phospho STAT3; total STAT3, (Cell Signaling Technology); and anti-mouse monoclonal β-actin (Sigma-Aldrich). This was followed by incubation with the appropriate peroxidase-conjugated secondary Ab. Membranes were developed with ECL Western Blotting Detection Reagent (Pierce). In all the experiments, β-actin was used as the loading control.

C57BL/6, BALB/c, and DO11.10 mice were obtained from The Jackson Laboratory. C57BL/6 Il17^−/− mice were the gift from Dr. K. Eaton (University of Michigan, Ann Arbor, MI). All mice were maintained in specific pathogen-free facilities in the Unit for Laboratory Animal Medicine at the University of Michigan. Mice used in experiments were age, strain, and sex matched.

CD4⁺ T cells were cultured for 36 h at 2 × 10⁵ cells/100 μl in 96-well plates under Th17 conditions in the presence or absence of Dll4. Brefeldin A and monensin were added for the last 6 h of culture as per manufacturer’s instructions. The cells were harvested, washed twice, and resuspended in 1% FCS buffer and Fc receptors were blocked by the addition of anti-CD16/32. Then, the cells were stained with mAb for CD4 (RM4-4) as per manufacturer’s instructions in a final volume of 200 ml in 96-well plates for 20 min at 4°C. For intracellular staining, cells were washed of excess surface stains, fixed and permeabilized using Cytofix/Cytoperm Plus Fixation/Permeabilization Kit according to the manufacturer’s instructions and stained using anti-IL-17 Ab for 30 min at 4°C in the dark. Cells were finally washed and resuspended in 200 μl of staining buffer and analyzed by flow cytometry. A minimum of 20,000 events was acquired for both cell surface and intracellular molecules on a BD-LSRII System flow cytometer (BD Biosciences). All the reagents were purchased from BD Pharmingen.

The ChIP procedure was performed using an assay kit (Upstate Biotechnology) according to the manufacturer’s instructions. In brief, 1 × 10⁶ isolated CD4⁺ T cells were skewed under Th17 conditions in the presence or absence of rDll4 for 20 h. DNA-protein structure was then cross-linked by 1% formaldehyde for 10 min at 37°C. Cells were collected and lysed in 400 μl of SDS lysis buffer. The resulting lysates were sonicated to obtain DNA fragments ranging from 200 to 1000 bp using a Branson Sonifier 450 (VWR) under the following condition: four times for periods of 30 s each. After centrifuging, the supernatant containing chromatin was diluted, and an aliquot (4% volume) was saved to indicate the input DNA in each sample. The remaining chromatin fractions were precleared with salmon sperm DNA/protein A agarose beads followed by immunoprecipitation with the following Abs: anti-RBPj-κ/CSL mAb (Cosmo Bio) or control anti rat Ig (Jackson ImmunoResearch Laboratories) overnight at 4°C with gentle rotation. Cross-linking was reversed for 4 h at 65°C and was followed by proteinase K digestion. DNA was purified by standard phenol/chloroform and ethanol precipitation and was subjected to Sybr Green real-time PCR. Mouse promoter primers are as follows rorγ-t: forward, 5′-CCCCTCACCTCTCAATTTGC; reverse, 5′-GCTTCTAGATGCTTCCCATACTTCTG; IL-17p1: forward, 5′-TCTGCTTGACTCGATTTTCAGGTA; reverse, 5′-GACGTGTGATGTCATCTCAAAATG; IL-17p2: forward, 5′-CAATTGCTCCTCCAAGGACAAG; reverse, 5′-CTGGCTTTGAGAAGAACGGATT; IL-17p3: forward, AATTCAAGGAGTTCATGCTTCTCA; reverse, 5′-GCTCACACACACCTCTGATTGC. These sequences were derived based upon the promoter region of IL-17 gene as previously described (25, 26).

All the recombinant proteins (Dll4, Jagged-1, TGFβ-1, IL-1, IL-6, IL-12, and IL-18) were purchased from R&D Systems. Functional Abs, anti-IL-4, anti-IFN-γ, anti-IL-12, anti-CD3e and anti-CD28 were purchased from eBiosciences. OVA, LPS, poly(I:C), and CpG were from Sigma-Aldrich. GSI-IX was purchased from Calbiochem.

Results were expressed as means ± SE. Statistical significance was determined by Student’s t test or one-way ANOVA with Newman-Keuls post test. Significant differences were regarded as p < 0.05.

In previous publications the up-regulation of notch ligands on DCs was initiated by pathogenic stimuli that demonstrated that delta-like proteins were dependent upon MyD88-mediated signaling (16, 18). To further verify these responses and determine the extent of their regulation, our studies examined a number of stimuli related to viral and/or inflammatory responses. These included TLR-specific signals, poly(I:C) (TLR3), LPS (TLR4), and CpG (TLR9), as well as respiratory syncytial virus, which activates by both RIG-I and TLR-mediated pathways. Our previous studies have outlined the role of Dll4 in regulating Th2 cytokine responses during respiratory syncytial virus infection. All of these stimuli significantly up-regulated delta-like 4 and to a lesser extent delta-like 1, but did not significantly induce jagged1 and jagged2 expression (Fig. 1). Furthermore, we also stimulated the DCs with IL-1β and IL-18, two IL-1R family MyD88-dependent signals, but they did not induce the expression of any of the notch ligands. Together these data reflect the idea that Th1-inducing TLR pathogenic signals promote delta-like but not jagged notch molecules.

Given the above observations indicating up-regulation of Dll4 following TLR activation, we were interested in investigating a TLR stimulation condition that may drive specific cytokine production profiles. We used whole splenocytes from TCR transgenic DO-11.10 mice and stimulated them with ova or ova and LPS in the presence or absence of anti Dll4 Ab. The above studies indicated that LPS preferentially induces strong Dll4 expression. The data indicate that stimulating the cells with ova alone is not able to drive IL-17 production, correlating to the inability of ova to induce Dll4 in DC (data not shown). However, there was a robust increase in IL-17 production in the group receiving both ova and LPS (with control Ab), which was significantly inhibited by treating the cells with anti-Dll4 Ab (Fig. 2). We also observed a marked increase in IFN-γ with ova and LPS (a potent Th1 inducer) however anti-Dll4 had no significant effect in modulating the Th1 response. Taken together, the data indicate a novel role of Dll4 in IL-17 production that is regulated by TLR activation.

In subsequent experiments set up to assess the role of the specific Dll4 agonist responses in differentiation of immune responses, we used isolated CD4⁺ T cells from BALB/c mice activated with anti-CD3 and anti-CD28 under Th17 skewing conditions (IL-6, TGF-β, anti-IL-4 and anti-IFN-γ) in the presence or absence of Dll4 or Jagged1 (Jag1) protein, as previous studies have recognized that these two ligands have differential effects on T cell differentiation. We examined whether Dll4 differentially altered IL-17 production. In the primary response when Dll4 was provided along with Th17 skewing cytokines, IL-17 production was greatly enhanced and Th2 cytokines IL-5 and IL-13 were markedly inhibited, while IFN-γ remained unchanged (Fig. 3,A). In contrast, notch ligand Jagged1 had no effect on any of the cytokines, further confirming the specific regulatory role of Dll4 in IL-17 production. When a more prolonged Th17 skewing regime was used a secondary CD3/CD28 stimulation used Dll4 and further augmented IL-17 production (Fig. 3,B). We further examined whether the increased IL-17 produced in response to Dll4 was due to an increased number of CD4⁺ T cells producing IL-17 and found that although Dll4 was able to marginally increase the number of IL-17 producing T cells under primary skewing conditions (Fig. 3 C), this increase was not statistically significant.

Previous studies have demonstrated a role for delta-like ligands in the inhibition of the Th2 responses, and we were interested in whether the altered Th2 response could be due to the skewing conditions itself or mediated directly by IL-17. To further confirm we examined the potential regulatory role of IL-17 itself. Isolated CD4⁺ T cell from the spleen of wild-type (WT) and IL-17 knockout mice (Il17^−/−) mice were stimulated with anti-CD3 and anti-CD28 in the presence or absence of Dll4 under Th17 skewing conditions. There was a significant increase in IL-17 levels in the WT and of course, no increase in the knockout mice (Fig. 3 D). However, we observed a similar pattern of IL-13 production in the WT and Il17^−/− mice. Thus, IL-17 itself was not having a regulatory effect on the Th2 cytokine response.

To verify that the addition of Dll4 was inducing the responses through a Notch receptor mediated signaling event our studies used GSI in the Th17 skewing cultures. GSI specifically inhibits notch activation by inhibiting the cleavage of N-ICD from membrane-associated notch receptor. Our data indicate that when isolated CD4⁺ T cells were incubated with GSI in the presence of Dll4 IL-17 production was significantly reduced (Fig. 4,A). To verify that Dll4 activated the notch signaling pathway under Th17 conditions, lysates were prepared from CD4⁺ T cells and stimulated in the presence and absence of Dll4. We observed an increase in the nuclear accumulation of the N-ICD with Dll4 stimulation, thus indicating that Dll4 causes the N-ICD to be cleaved under these conditions (Fig. 4,B). To verify that Dll4 induced other Th17 pathway cytokines and cytokine receptors that play a crucial role in Th17 differentiation we assessed Il22 and Il23r and found them up-regulated along with Il17a and Il17f (members of IL-17 family) in the skewed cultures when Dll4 was present (Fig. 4 C). In addition, to verify that signaling occurred in a canonical Notch pathway we also assessed Hes5 and observed the expected increased expression after addition of Dll4. Overall, our data suggest that Dll4 using notch signaling augments early Th17 differentiation.

Previous studies have indicated that notch/notch ligand interaction differentially regulates the expression of specific transcription factor expression in T cells. In particular, recent studies using mice genetically unable to express active Notch on CD4⁺ T cells have suggested that without Notch signaling Th2 cells cannot differentiate, while Th1 responses can proceed (7, 10, 15). The latter studies using genetically modified animals examined this further and concluded that the lack of Th2 development was linked to Gata3 activation. In the present studies we were interested in whether the enhanced expression of Il17 in the presence of Dll4 was related to Rorc expression, a required transcription factor for Th17 differentiation. When Rorc expression was examined in isolated CD4⁺ T cells stimulated under Th17 skewing conditions Rorc was significantly induced and further enhanced when cells were incubated with Dll4 in a time dependent fashion (Fig. 5 A). Moreover there was a coordinated decrease in Gata3 expression under Th17 skewed conditions but no additional change with Dll4.

A second required factor for differentiation of Th17 is STAT3 protein activation (27, 28). In similar studies as above, we examined the activation/phosphorylation of STAT3 during Th17 skewing to determine whether Dll4 induced an increase in activated STAT3 in isolated CD4⁺ T cells. The data in Fig. 5 B indicate that while STAT3 phosphorylation was enhanced under Th17 skewed conditions, there was no alteration in STAT3 activation in the presence of Dll4 in the Th17-skewed culture conditions. Thus, the increased IL-17 in the presence of Dll4 appears to be associated with increased expression of Rorc, but does not alter STAT3 activation.

To determine the possibility that notch may regulate Rorc and/or Il17 directly, we searched for CSL (RBPj-κ, transcription factor involved in notch activation) binding sites within the upstream Rorc and Il17 promoter regions. We detected one site on Rorc and three putative sites on Il17A loci. A consensus CSL binding site on Rorc was 0.56 kb upstream of the translational start site (TSS). Primer sets flanking the CSL binding regions on Rorc were designed to amplify the immunoprecipitated ChIP DNA by quantitative RT-PCR (Fig. 6). The CD4⁺ T cells were treated in the presence or absence of Dll4 under Th17 skewed conditions for 20 h and were immunoprecipitated with anti-CSL mAb. We chose 20 h because in our system we detected robust notch activation during the same time above. Our data indicate that the putative CSL binding site on Rorc upstream of the TSS was crucial for CSL binding and the abundance of CSL binding to Rorc was significantly increased under Th17 skewing conditions in the presence of Dll4 as compared with Th17 skewing group without Dll4. The specificity of the interaction was ascertained by using a control Ig during immunoprecipitation that had no effect. These data correlated to the ability of Dll4 treatment to increase the expression of Rorc mRNA expression above.

Similar to the identification of a consensus CSL binding site on Rorc our studies also examined putative binding sites on the IL-17 promoter region. The CSL binding sites on Il17 promoter were identified at ∼1.2, 2.4, and 4.7 kb upstream of the translational start site and flanking primer sets were designed to specifically amplify ChIP DNA using quantitative PCR (Fig. 7). As above, a 20-h time point was used to examine anti-CSL immunoprecipitated DNA for binding in the presence or absence of Dll4 activation. Examining all three of the consensus CSL binding sites, only the binding site 2.4 kb upstream from the transcriptional start site (p2) demonstrated an increase in CSL binding after Dll4 treatment (Fig. 7,A). The 1.2 kb (p3) site had no noticeable effect and the 4.8 kb site had a very modest increase on the interaction indicating a nonessential CSL binding site. To further investigate the specificity of the binding in regards to Notch activation, similar studies were set up with Dll4 treatment groups in the presence or absence of GSI to block the N-ICD cleavage. The data in Fig. 7 B demonstrate that the increased binding of CSL to the Il17 promoter region at 2.4 kb upstream of the TSS was significantly reduced when GSI was used. Taken together our observations indicate two possible novel mechanisms used by Notch in regulating IL-17 production in CD4⁺ T cells. Firstly, N-ICD/CSL may directly interact and increase the expression of transcription factor Rorc that has been shown to promote Th17 differentiation in CD4⁺ T cells and secondly, N-ICD/CSL may interact directly with the Il17 promoter at a specific putative CSL binding site 2.4 kb upstream of exon 1 and up-regulate Il17 expression.

The regulation of T cell differentiation can be influenced by multiple molecular signals that together fine tune T cell responses. The data generated in these studies demonstrate the enhancing role of Notch ligand Dll4 in Th17 differentiation. We also provide evidence of putative mechanisms by which Dll4 dictates Th17 differentiation. It is clear from numerous studies that Notch family molecules can have a diverse role in determining the fate of T cells during activation. Studies using genetic models have demonstrated that Notch is required for Th2 but not Th1 responses (7, 10, 15), while other results have shown diverse functions of Notch depending upon the ligand and/or the immune environment (8, 14, 16, 17, 29). In the present studies, we have confirmed that Dll4 has the ability to alter Th2 cell development in an Ag-specific response. In fact, using a pathogenic stimulus, LPS (TLR4), it appeared the entire phenotype of the skewing response moved away from a primarily Th1 response and toward a mixed cytokine environment, including high levels of IL-17 that were significantly reduced when dll4 was blocked. Interestingly, IL-17 production was only detected when a strong pathogenic (TLR) signal was applied to T cell activation, likely due to the up-regulation of the appropriate skewing signals, as previously demonstrated (18), including IL-6, TGF-β, and now Dll4. To follow these studies, we examined the role of Dll4 in naive CD4⁺ T cell cultures that were under Th17 skewing conditions and found that Dll4, but not jagged1, could enhance the skewing of T cells toward IL-17 production. This appears to manifest itself both during development (afferent) as well as in secondary responses when the previously activated T cell still can be differentiated and skewing continues. Although it is not likely that notch signaling responses can by themselves cause skewing of immune responses (30), GSI completely inhibited Dll4-enhanced IL-17 production further confirming the crucial role of notch signaling in this aspect.

The differentiation of T cell subsets is dependent upon the expression of specific transcription factors. The expression of Rorc that demarcates Th17 cells was significantly up-regulated in the presence of Dll4. The simultaneous decrease in Gata3 expression, the signature regulatory transcription factor for Th2 cytokines, displayed no additional alteration in the presence of Dll4 under Th17 skewing conditions. Previous studies have demonstrated that Dll4 down-regulates Gata3 under Th2 skewing conditions (16). Interestingly, these latter observations suggest a complicated regulatory pattern for Gata3, as two independent studies have shown that Notch signaling is required for the expression of Gata3 and Th2 cytokines (7, 15). Future investigations will surely need to define how the different Notch ligands and receptors interact and control the divergent responses for the regulation of the T cell responses. One other possibility in the present studies was a direct regulation of the Th2 cytokines by IL-17 itself in an autocrine or paracrine fashion. However, our data with CD4⁺ T cells from the Il17^−/− mice demonstrated that even under the skewed conditions IL-17 does not play a role in down regulating Th2 cytokines under Th17 skewed conditions. The coordinated temporal down-regulation of Gata3 with the increased expression of Rorc under Th17 skewing conditions may indicate that Rorc can provide direct regulation of Th2 responses as suggested (31).

In CD4⁺ T cells, Rorc and Stat3 are predominant regulators of the Il17 gene. Importantly, these studies indicate a direct connection between Dll4-induced notch activation and Il17 gene regulation with RBPj-κ/CSL. Notch activation and interaction of N-ICD with the transcription factor RBPj-κ/CSL converts RBPj-κ/CSL from a transcriptional repressor to a transcriptional activator leading to the expression of notch dependent genes. We found a consensus RBPj-κ/CSL binding site on the Il17 promoter 2.4 kb from the TSS that may regulate Il17 expression after Dll4 coactivation. Moreover the interaction was completely lost when notch signaling was inhibited by GSI. Previously, an inductive model of Notch mediated Th2 differentiation by direct regulation of Gata3 and Il4 genes by RBPj-κ/CSL has been shown (16). Our studies also revealed a similar direct connection between Dll4-induced RBPj-κ/CSL and Rorc through a consensus RBPj-κ/CSL binding site, suggesting that Dll4 augments IL-17 production by specific multiple interactive mechanisms. In contrast, notch activation via Dll4 did not alter STAT3 phosphorylation.

These novel findings demonstrating enhanced Th17 skewing with Dll4-induced N-ICD release are likely influenced by the immune environment created by the TLR stimuli that would include the generation of high levels of IL-6. It appears that Dll4 enhances the skewing effect in the presence of other Th17 relevant signals as indicated using specific skewing conditions for Th17 cell generation. In this regard, Dll4-induced Notch signals may only function to modify the immune responses dependent upon the contextual nature that the signal is provided. Thus, although Notch activation in T cells is an important signal it may serve primarily as a guide for activating/regulating the T cell for a particular immune environment. In the case of Dll4, which is dependent upon pathogenic signals and PAMPs through TLR activation (16, 18), the immune environment would skew away from Th2 type responses facilitating pathogen clearance. Although beneficial in most cases, clearly if an individual had an underlying immune dysfunction, such as autoimmunity, a detrimental bystander effect could result in exacerbation of disease. This would potentially promote disease-altering effects in the system that is biased toward development of anti-pathogen defenses. However, under these same conditions, exacerbation of disease with pathogenic challenges, as in the case of autoimmune diseases, could lead to the worse scenario and severe tissue/organ damage. Evidence of this is reflected in recent studies that have observed differential changes in development of autoimmune responses upon manipulation of different notch ligands or in the overall blockade of notch activation (32, 33). In fact, recent studies have drawn direct correlations between specific Notch receptors and IL-17 production in autoimmunity (32) as well as during pulmonary granuloma formation (23).

Overall, these studies extend our understanding of how specific notch ligand signals can direct the immune responses by alteration of specific gene regulation. The coordination of these responses, while complex, depends upon the innate immune system and recognition of specific pathogenic cues.

We thank Dr. William Carson for providing primers for Rorc promoter sequences used in this study and Dr. Ivan Maillard for helpful discussions.

The authors have no financial conflict of interest.