Mannan-binding lectin-associated serine protease 2 (MASP-2) is an enzyme of the innate immune system. MASP-2 forms complexes with the pattern recognition molecules mannan-binding lectin (MBL), H-ficolin, L-ficolin, or M-ficolin, and is activated when one of these proteins recognizes microorganisms and subsequently cleaves complement factors C4 and C2, thus initiating the activation of the complement system. Missense polymorphisms of MASP-2 exist in different ethnic populations. To further characterize the nature of these, we have produced and characterized rMASP-2s representing the following naturally occurring polymorphisms: R99Q, D120G, P126L, H155R, 156_159dupCHNH (CHNHdup), V377A, and R439H. Only very low levels of CHNHdup were secreted from the cells, whereas quantities similar to wild-type MASP-2 were found intracellularly, indicating that this mutation results in a misfolded protein. We found that D120G and CHNHdup could not associate with MBL, whereas R99Q, P126L, H155R, V377A, R439H, and wild-type MASP-2 bound equally well to MBL. Accordingly, when D120G and CHNHdup were mixed with MBL, no activation of complement factor C4 was observed, whereas R99Q, P126L, and V377A cleaved C4 with an activity comparable to wild-type MASP-2 and H155R slightly better. In contrast, the R439H variant was deficient in this process despite its normal binding to MBL. This variant was also not able to autoactivate in the presence of MBL and mannan. We find the R439H variant is common in Sub-Saharan Africans with a gene frequency of 10%. Our results indicate that individuals with different types of MASP-2 defects may be identified through genotyping.

Understanding the workings of the complement system is important for unraveling the innate immune defense and its interactions with the adaptive immune response (1, 2). The complement system includes more than 30 soluble and membrane-bound proteins. A number of these proteins are serine proteases found as zymogens in the circulation. To activate these proenzymes, three pathways have evolved over time, as follows: 1) the classical pathway is activated when the C1 complex recognizes patterns of Fc regions from Ig molecules; 2) the lectin pathway is activated when mannan-binding lectin (MBL)3 or one of the three ficolins (H-ficolin, L-ficolin, or M-ficolin) recognizes a pattern of carbohydrates or acetylated molecules; and 3) the alternative pathway is activated when the balance between inhibition and activation of C3 activation is shifted and is also important for amplifying the first two pathways. The recognition molecules of the lectin pathway are all found in complexes with the same set of proenzymes, the MBL-associated serine proteases (MASPs): MASP-1, MASP-2, and MASP-3, as well as MBL-associated protein of 19 kDa, MAp19 (3, 4, 5). MASP-1, MASP-2, and MASP-3 all present domain structures identical with those of the C1 proteases, C1r and C1s, and all five proenzymes are activated through the cleavage of the polypeptide chain between the A segment and the B segment, with the latter presenting the protease domain (exemplified by the structure of MASP-2 in Fig. 1). MAp19 presents the two N-terminal domains (of six domains) of MASP-2, and in addition, four unique amino acids, and is devoid of enzymatic activity (6). When MBL or ficolin in complex with MASP recognizes a ligand, the MASPs are activated. The physiological relevant substrates for activated MASP-1 and MASP-3 are still under debate, although MASP-1 has been shown to cleave C2 and to possess some thrombin-like activity (7, 8). The activity of MASP-2, in contrast, is clearer. Activated MASP-2 very efficiently cleaves the complement factors C4 and C2 to the fragments C4b and C4a, and C2b and C2a, respectively, and C4b and C2b join to form a C3 convertase (9, 10). MASP-2 is thus a central molecule in the activation of the complement system as it translates the recognition of microorganisms (or altered self) by four pattern recognition molecules, i.e., MBL, H-ficolin, L-ficolin, and M-ficolin, into initiation of the enzymatic cascades of the complement system.

FIGURE 1.

The polypeptide chain of MASP-2 with the variants produced in the present study indicated. MASP-2 is composed of an N-terminal CUB domain, followed by an EGF domain, a second CUB domain, two CCP domains (complement-control protein domains), an activation peptide, and a serine protease domain. The mature polypeptide chain of human MASP-2 is composed of 686 aa residues, including a 15-aa signal peptide. The numbering of the amino acids on the figure is referring to the protein, including the signal peptide. The amino acid changes introduced in the present study are indicated. When MASP-2 is activated, the polypeptide chain is cleaved at an arginine-isoleucine peptide bond (R444-I445) between the activation peptide and the remainder of the serine protease domain. The resulting two fragments, the A chain and B chain (the serine protease domain), are held together by a disulfide bond (between C434 in the activation peptide section and C552 in the serine protease domain, indicated on the figure by the line connecting the two dots). Some of the polymorphisms are in the SNP databases: P126L, rs56392418; H155R, rs2273343; R439H, rs12085877; V377A, rs2273346. The R99Q, D120G, and CHNHdup polymorphisms have been described in Lozano et al. (26 ), Stengaard-Petersen et al. (12 ), and Thiel et al. (11 ), respectively. The frequencies of the polymorphisms in various populations are described in Thiel et al. (11 ).

FIGURE 1.

The polypeptide chain of MASP-2 with the variants produced in the present study indicated. MASP-2 is composed of an N-terminal CUB domain, followed by an EGF domain, a second CUB domain, two CCP domains (complement-control protein domains), an activation peptide, and a serine protease domain. The mature polypeptide chain of human MASP-2 is composed of 686 aa residues, including a 15-aa signal peptide. The numbering of the amino acids on the figure is referring to the protein, including the signal peptide. The amino acid changes introduced in the present study are indicated. When MASP-2 is activated, the polypeptide chain is cleaved at an arginine-isoleucine peptide bond (R444-I445) between the activation peptide and the remainder of the serine protease domain. The resulting two fragments, the A chain and B chain (the serine protease domain), are held together by a disulfide bond (between C434 in the activation peptide section and C552 in the serine protease domain, indicated on the figure by the line connecting the two dots). Some of the polymorphisms are in the SNP databases: P126L, rs56392418; H155R, rs2273343; R439H, rs12085877; V377A, rs2273346. The R99Q, D120G, and CHNHdup polymorphisms have been described in Lozano et al. (26 ), Stengaard-Petersen et al. (12 ), and Thiel et al. (11 ), respectively. The frequencies of the polymorphisms in various populations are described in Thiel et al. (11 ).

Close modal

Uncovering mutations resulting in selective deficiencies in the immune system may not only further our understanding of basic mechanisms, but may also have significant clinical implications. We and others have defined a number of nonsynonymous polymorphisms in the gene encoding MASP-2. We have previously identified and characterized the distribution of naturally occurring missense polymorphisms of MASP-2 in different ethnic populations, i.e., Caucasians, Hong Kong Chinese, Sub-Saharan Africans, South-African Indians, and Inuits, and have observed associations with circulating levels of MASP-2 (11). In the present study, we characterize the functional effects of the resulting naturally occurring variants of the MASP-2 protein through the production of the recombinant forms of the different MASP-2 allotypes. Most have no effect on the function of the MBL pathway of complement activation, but one blocks, not the synthesis, but the secretion of the variant, another binds to MBL as potently as the wild type (wt), yet fails to activate complement, and yet another shows higher complement-activating capacity than the wt.

We generated expression vectors encoding MASP-2 with the amino acid changes R99Q, D120G, P126L, H155R, 156_159dupCHNH (in the following termed CHNHdup), V377A, and R439H. The positions of these amino acids are indicated in Fig. 1.

We have previously described the construction of a pCI neo plasmid with an insert of wt MASP-2 (12). Stratagene’s QuickChange II XL site-directed mutagenesis kit (catalog 200521-5) was used for site-directed mutagenesis of the cDNA in this vector. PCR were performed with a mixture containing 5 μl of 10× reaction buffer, 50 ng of template (wt MASP-2 in pCI neo plasmid), 125 ng of forward and reverse primers (Table I), 1 μl of dNTP mix, 3 μl of Quick Solution reagent, 1 μl of PFU Ultra HF DNA polymerase, and water added to 50 μl. The conditions for the PCR were first 95°C for 1 min, and then 32 cycles of the following: 95°C, 50 s; 60°C, 50 s; and 68°C, 8 min, ending with 68°C for 7 min. A total of 10 μl of the resulting product was loaded on a 1% agarose gel to verify the length of the product. The rest of the product was digested for 1 h with 1 μl of DpnI at 37°C. XL10 Gold cells (Stratagene) were transformed with the DpnI-treated DNA, following the manufacturer’s instructions, and 200 μl of the mixture was plated on Luria-Bertani plates with 100 μg of ampicillin/ml. Single colonies were picked and used for the preparation of plasmid using Miniprep (Qiagen). The primers for the site-directed mutagenesis were designed using the program primer X (http://bioinformatics.org/primerx/) and the sequence of the MASP-2 gene (Pubmed NM 006610, GI 5729914).

Table I.

The primers used for site-directed mutagenesis

MutantsPrimer
R99Qa Forward: 5′-GCACAGACACGGAGCAGGCCCCTGGCAAGGAC-3′ 
 Reverse: 5′-GTCCTTGCCAGGGGCCTGCTCCGTGTCTGTGC-3′ 
P126L Forward: 5′-GACTACTCCAACGAGAAGCTGTTCACGGGGTTCGAG-3′ 
 Reverse: 5′-CTCGAACCCCGTGAACAGCTTCTCGTTGGAGTAGTC-3′ 
H155R Forward: 5′-CCCACCTGCGACCACCGCTGCCACAACCACCTG-3′ 
 Reverse: 5′-CAGGTGGTTGTGGCAGCGGTGGTCGCAGGTGGG-3′ 
CHNHdup Forward: 5′-GAAACCGCCCAGGTGGTTGTGGCAGTGGTTGTGGCAG-3′ 
 Reverse: 5′-CTGCCACAACCACTGCCACAACCACCTGGGCGGTTTC-3′ 
V377A Forward: 5′-CTACCCAGTGGCCGAGCGGAGTACATCACAGGTC-3′ 
 Reverse: 5′-GACCTGTGATGTACTCCGCTCGGCCACTGGGTAG-3′ 
R439H Forward: 5′-CTACCCAGTGGCCGAGCGGAGTACATCACAGGTC-3′ 
 Reverse: 5′-GACCTGTGATGTACTCCGCTCGGCCACTGGGTAG-3′ 
MutantsPrimer
R99Qa Forward: 5′-GCACAGACACGGAGCAGGCCCCTGGCAAGGAC-3′ 
 Reverse: 5′-GTCCTTGCCAGGGGCCTGCTCCGTGTCTGTGC-3′ 
P126L Forward: 5′-GACTACTCCAACGAGAAGCTGTTCACGGGGTTCGAG-3′ 
 Reverse: 5′-CTCGAACCCCGTGAACAGCTTCTCGTTGGAGTAGTC-3′ 
H155R Forward: 5′-CCCACCTGCGACCACCGCTGCCACAACCACCTG-3′ 
 Reverse: 5′-CAGGTGGTTGTGGCAGCGGTGGTCGCAGGTGGG-3′ 
CHNHdup Forward: 5′-GAAACCGCCCAGGTGGTTGTGGCAGTGGTTGTGGCAG-3′ 
 Reverse: 5′-CTGCCACAACCACTGCCACAACCACCTGGGCGGTTTC-3′ 
V377A Forward: 5′-CTACCCAGTGGCCGAGCGGAGTACATCACAGGTC-3′ 
 Reverse: 5′-GACCTGTGATGTACTCCGCTCGGCCACTGGGTAG-3′ 
R439H Forward: 5′-CTACCCAGTGGCCGAGCGGAGTACATCACAGGTC-3′ 
 Reverse: 5′-GACCTGTGATGTACTCCGCTCGGCCACTGGGTAG-3′ 
a

Variant of rMASP-2.

To confirm the mutations, the inserts were sequenced. The R99Q, P126L, H155R, and CHNHdup mutations were identified by sequencing with the primer MASP-2 MMR (GTACGACTTCGTCAAGCTGAG), whereas the V377A and R439H mutations were identified by sequencing with the primer Seq2 MASP-2 (GAGCTTCTGCAAGGT). Positive clones were then further sequenced with the following primers for double determination to verify the integrity of the sequence: pCI MASP-2 7249 Fw (TAG AAG CTT TAT TGC GGT AGT TTA TCA), MASP-2 Rev (CTGGGCGGTTTC), Seq CUB-2 upper (GTTCAGTGTCATTCTGGACT), Seq CCP-2 lower (ACCTACAAAGCTGTGATTC), MASP-2 SP (GCCTGGTCTGAAGCTGTT), Seq SPD lower (TTCTAGATAGTGAAACAGAG), and pCI MASP-2 2188 Rev (AAC TCA TCA ATG TAT CTT ATC ATG TCT GCT C).

We have previously made an expression plasmid containing the D120G form of MASP-2 (12). As a negative control for activation of MASP-2, we used the product of a previously made plasmid encoding the amino acid change R444Q (Fig. 1). This is a change at the P1 position of the cleavage between the A chain and the B chain. This mutant cannot be cleaved and is thus not activated.

Plasmids containing the MASP-2 cDNA inserts were used for the transfection of HEK293 cells (Freestyle 293-F cells; Invitrogen). Briefly, plasmids (1 μg/ml) were mixed with lipofectamine 2000 (Invitrogen) and OptiMEM (Invitrogen), according to the manufacturer’s instructions, and used for transfection of early passage 293-F cells (30 ml of 106 cells/ml). Cells were cultured for 4 days in Freestyle expression medium (Invitrogen), and supernatants were collected by centrifugation and stored at 4°C in the presence of 0.01% sodium merthiolate.

The concentration of MASP-2 in the culture supernatants or in plasma samples (see below) was measured by a sandwich immunoassay, as described in detail previously (13). In brief, the assay is based on microtiter wells coated with anti-MASP-2 mAb. Samples diluted 10-fold in buffer releasing MASP-2 from complexes with MBL or ficolins (MASP-2 assay buffer: 10 mM Tris, 1 M NaCl, 10 mM EDTA, 7.5 mM NaN3, and 0.05% Tween 20 (pH 7.4)) were incubated in wells coated with mAb 8B5 (anti-B chain), and after washing, a second, biotin-labeled anti-MASP-2 mAb (mAb 6G12, anti-N-terminal domains) was used as detecting Ab, followed by europium-labeled streptavidin and reading by time-resolved fluorometry. Concentrations are read on standard curves made from in-house standard plasma and calibrated against purified wt rMASP-2, and the test results are verified by including three internal controls.

The culture supernatants were subjected to size exclusion chromatography on a 10 mm × 30-cm Superose 6 HR column (GE Healthcare). The running buffer was TBS (10 mM Tris, 145 mM NaCl, and 7.5 mM NaN3 (pH 7.4)) with 1 mM CaCl2 and 0.01% (v/v) Emulphogen. The column was loaded with 200-μl samples of supernatants, which had been concentrated 10-fold on Centricon concentration units (Amicon, Millipore). Fractions of 0.25 ml were collected in polystyrene microtiter plates (Nunc) previously blocked by incubation with TBS containing 0.05% Tween 20 and washed with water. MASP-2 in fractions was quantified after 10-fold (for wt, R99Q, D120G, P126L, V377H, and R439H) or 2-fold (for H155R and CNHNdup) dilution in MASP-2 assay buffer.

Samples of rMASP-2 culture supernatants were analyzed by Western blotting. The electrophoresis was under reducing or nonreducing conditions, using Bis-Tris gels containing a 4–12% polyacrylamide gradient (XT Criterion; Bio-Rad) run in XT-MOPS buffer. Proteins were transferred onto a nitrocellulose membrane, and MASP-2 bands were detected with the mouse anti-human MASP-2 mAb 1.3B7 (14), followed by HRP-conjugated polyclonal rabbit anti-mouse IgG Ab (PO260; DakoCytomation) as primary and secondary Abs, respectively. The blot was developed by ECL (SuperSignal West Dura Extended Duration Substrate, 34075; Pierce), and the signal was detected by a cooled charge-coupled device camera (Kodak Image station 1000). Due to the low concentration of MASP-2 in the supernatants from H155R and CHNHdup, the proteins in these were concentrated by incubation for 15 min at room temperature of 400 μl of supernatant with 20 μl of PX5 beads (protein-binding beads from PATEOF), followed by centrifugation and addition of SDS-PAGE sample buffer to the beads and loading of this mixture. Relative molecular sizes were interpolated from curves constructed on the basis of marker proteins (Precision Plus All Blue; Bio-Rad).

To estimate the amount of intracellular MASP-2 cells transfected with the vector containing CHNHdup or wt MASP-2, cDNA inserts were collected by centrifugation and washed twice with PBS. The cells were subsequently lysed by addition of PBS containing 1% Triton X-100 and protease inhibitor mixture (CompleteMini; Roche) to the cells, followed by incubation for 5 min at 4°C. The lysates were centrifuged for 30 min, 4°C, at 10,000 × g, and the supernatants were collected. The cell culture supernatants and the detergent extracts were analyzed by Western blotting, as described above.

rMASP-2 variants were diluted serially in 10 mM Tris-HCl, 1 M NaCl, 5 mM CaCl2, 100 μg of human serum albumin/ml, and 0.05% Triton X-100 (pH 7.4), and added to an equal volume of rMBL (20 ng/ml of the same buffer). The mixtures thus all contained 10 ng of MBL/ml, but contained varying concentrations of MASP-2 supernatants. Duplicate samples of 100 μl were then transferred to mannan-coated microtiter wells and incubated overnight at 4°C. Wells were washed with TBS/Tween 20 containing 5 mM CaCl2, and incubated for 2 h with biotin-labeled anti-MASP-2 mAb (mAb 6G12). The wells were washed, and europium-labeled streptavidin, diluted in 10 mM Tris-HCl, 145 mM NaCl, and 25 μM EDTA (pH 7.4), was added. After incubation for 1 h, wells were washed and enhancement buffer was added, and the amount of europium in the wells was measured by time-resolved fluorometry.

Supernatants containing the rMASP-2 variants were diluted, mixed with rMBL, and incubated in mannan-coated microtiter wells, as described above. After wash, the wells were incubated for 90 min at 37°C with 100 μl of complement component C4 at 2 μg/ml barbital buffer (4 mM sodium barbital, 0.14 M NaCl, 2 mM CaCl2, 1 mM MgCl2, and 7.5 mM NaN3 (pH 7.4)). The wells were washed, and a mixture of two biotin-labeled anti-human C4 mAbs (162.2 and 162.1 from Bioporto) was added (the Abs were biotinylated in-house with 126 μg of biotin-normal human serum/mg IgG). After incubation for 2 h, wells were washed and developed with europium-labeled streptavidin, as above. Results are expressed relative to a standard curve obtained by applying dilutions of a standard serum, as previously described (15).

MASP-2 is activated by the cleavage of the 76-kDa polypeptide chain into a 52-kDa A chain and a 31-kDa B chain (9). This activation is largely dependent on the presence of MBL or ficolins. The ability of the various MASP-2s to be activated was analyzed by Western blotting after activation on a mannan surface. Microtiter plates were coated with 1 μg of mannan in 100 μl of coating buffer overnight at 4°C and blocked by incubation with human serum albumin at 1 mg/ml for 1 h, followed by wash in TBS containing 0.05% Tween 20. The MASP-2-containing culture supernatants were diluted in barbital buffer to reach equal MASP-2 concentrations, and were further mixed with rMBL to approximate final concentrations of 0.5 μg of rMBL/ml and 0.35 μg of MASP-2/ml (except for the CHNHdup mutant, in which only very low amounts of MASP-2 were present in the supernatant), and added to the mannan-coated wells. A total of 12 wells (100 μl/well) was used for each MASP-2 mutant. After incubation at 37°C for 2 h, the MBL/MASP complexes bound in the wells were collected, as follows: the first well of the 12 wells representing each mutant was emptied, and the bound protein was eluted by adding 120 μl of 24 mM Tris-HCl, 4 M urea, 5% (v/v) glycerol, and 1.5% (w/v) SDS (pH 6.7). After 10-min incubation, the content of the first well was transferred to the next, just emptied well and incubated for 10 min. This was repeated for the remaining wells. The eluates were reduced with 0.06 M DTT and analyzed by SDS-PAGE and Western blotting. The blot was incubated with anti-MASP-2/MAp19 Ab (mAb 1.3B7), followed by HRP-labeled rabbit anti-mouse Ig, as described above.

We also attempted to activate the MASP-2 by incubating supernatants with MBL and mannose-coated Toyopearl-Hw75 beads (onto which MBL binds), but the procedure described above was found much more efficient.

DNA was extracted from peripheral blood cells using the QIAamp DNA blood mini kit (Qiagen). A real-time TaqMan PCR technique using minor-groove-binder probes was used for screening the MASP-2 gene for the single nucleotide polymorphism (SNP), p.R439H, with a predesigned/validated TaqMan genotyping assay (C_22273114_20; Applied Biosystems). DNA amplification was conducted in 25 μl of PCR containing 20 ng of DNA, 900 nM primers, 200 nM probes, and TaqMan Universal PCR Master Mix (Applied Biosystems) on a real-time PCR instrument (ABI Prism 7000). The PCR profile was 2 min at 50°C, 10 min at 95°C, followed by 40 cycles of 15 s at 92°C and 1 min at 60°C. To determine genotypes, endpoint reading of the fluorescence generated during PCR amplification was done on the ABI Prism 7000 using Sequence Detection System software version 2.3 (Applied Biosystems).

The ability of plasma to activate complement factor C4 via the MBL pathway was tested, as previously described (16). In brief, diluted serum samples are incubated in mannan-coated microtiter wells to allow for the binding of MBL-MASP complexes. This is performed in a buffer containing 1 M NaCl, allowing for the binding of MBL/MASP without activating the MASPs, and at the same time dissociating the C1 complex. After wash, purified human complement factor C4 is incubated in the wells at 37°C, allowing for activation of C4 and the covalent binding of C4b to the mannan surface. The amount of bound C4b is detected with anti-C4 Abs, as described above.

To analyze the consequences of naturally occurring amino acid substitutions in MASP-2, we produced mutated rMASP-2s representing such mutations. After transfection of human 293F cells, we measured the concentration of MASP-2 in the culture supernatants and found that the R99Q and the D120G mutants and the wtMASP-2 were produced in similar (8–10 μg/ml) amounts, whereas the P126L, R439H, and V377A mutants were produced at ∼10-fold lower levels, and the H155R MASP-2 was ∼100-fold lower than that of wtMASP-2 (Table II). The level of the CNHNdup mutant was close to the detection limit of the assay. The catching Ab in the assay used reacts with the serine protease domain and the developing Ab with the N-terminal domains of MASP-2; both regions are not directly influenced by the mutations introduced. The overall difference in the MASP-2 levels in the culture supernatants was also seen when analyzing by Western blotting (data not shown), indicating that the assay estimates all of the mutants correctly. The culture supernatants containing the mutant MASP-2s were analyzed by SDS-PAGE Western blotting, and all were found to contain MASP-2 running as a 76-kDa band both in the nonreduced state and under reducing conditions. Because the Ab used recognizes the A chain of MASP-2, this indicates that the MASP-2s are present in a nonactivated state, i.e., as pro-MASP-2. If the rMASP-2 were activated, we would have observed a 52-kDa band in reducing conditions due to cleavage into disulfide-linked A (52 kDa) and B (31 kDa) chains (Fig. 1).

Table II.

Production of rMASP-2s

MutantMASP-2 (ng/ml)a
R99Qb 8,721 
P126L 730 
D120G 10,383 
H155R 75 
CHNHdup 
V377A 868 
R439H 707 
Wild type 8,459 
MutantMASP-2 (ng/ml)a
R99Qb 8,721 
P126L 730 
D120G 10,383 
H155R 75 
CHNHdup 
V377A 868 
R439H 707 
Wild type 8,459 
a

The concentrations of MASP-2 in the culture supernatants are given. The data are representative of two experiments.

b

Variant of rMASP-2.

We found only very low amounts of MASP-2 in the culture supernatants from cells transfected with plasmid encoding CHNHdup (see above). To study whether MASP-2 was present inside the cells, we lysed cells producing wt or CHNHdup rMASP-2 and analyzed for the presence of MASP-2 in the lysate. MASP-2 was by SDS-PAGE Western blotting found to be present inside the cells expressing CHNHdup in amounts similar to what was found inside cells transfected with the plasmid encoding wt MASP-2 (Fig. 2). The molecular mass of the rCHNHdup MASP-2 was similar to the wt MASP-2 (Fig. 2), and the molecular mass of the MASP-2 found in the supernatant of the wt MASP-2 was similar to the MASP-2 found inside the cells.

FIGURE 2.

MASP-2 in culture supernatants and intracellularly. Recombinant wt MASP-2 and CHNHdup MASP-2 were expressed in 293-F cells. The cells were spun down and lysed by Triton X-100. The culture supernatants (Supernatant) and the lysates (Lysate) were analyzed by Western blotting, developing the blots with anti-MASP-2 Ab.

FIGURE 2.

MASP-2 in culture supernatants and intracellularly. Recombinant wt MASP-2 and CHNHdup MASP-2 were expressed in 293-F cells. The cells were spun down and lysed by Triton X-100. The culture supernatants (Supernatant) and the lysates (Lysate) were analyzed by Western blotting, developing the blots with anti-MASP-2 Ab.

Close modal

The proteins in the various culture supernatants were fractionated according to size on a Superose 6 column with an isotonic column buffer containing Ca2+, followed by estimation of MASP-2 in the fractions. All of the rMASP-2 variants and the wt rMASP-2 eluted at the same volume (Fig. 3); however, the CNHNdup variant was present in too low a concentration to give a signal in the analysis of the fractions from the gel permeation chromatography (Fig. 3 B). In the calcium-containing buffer, the MASP-2s eluted at a position corresponding to a molecular mass of ∼500 kDa. This seems to indicate that the MASPs at this condition form rather larger complexes than the reported homodimers (17, 18), but the rather elongated structure of the dimer suggested in those papers may influence the correct estimation of size of the MASP-2s by this technique.

FIGURE 3.

Gel permeation chromatography. Fractionation of 200 μl of 10-fold concentrated supernatant was performed on a Superose 6 column. The fractions were tested for MASP-2 content by time-resolved immunofluorometric assay. On the left y-axis is the concentration of MASP-2 in the fractions, whereas the right y-axis in A gives the absorption at 280 nm for the wt supernatant. The upper graph (A) shows the results when analyzing supernatants containing wt, R99Q, or D120G variants, and the lower graph (B) shows the results from supernatants containing P126L, CHNHdup, H155R, V377H, and R439H variants. Note the 10-fold difference in y-axis scale. The elution volume is given on the x-axis, and the elution positions of trypan blue (2000 kDa), thyroglobulin (669 kDa), ferritin (440 kDa), and catalase (232 kDa) are marked in A.

FIGURE 3.

Gel permeation chromatography. Fractionation of 200 μl of 10-fold concentrated supernatant was performed on a Superose 6 column. The fractions were tested for MASP-2 content by time-resolved immunofluorometric assay. On the left y-axis is the concentration of MASP-2 in the fractions, whereas the right y-axis in A gives the absorption at 280 nm for the wt supernatant. The upper graph (A) shows the results when analyzing supernatants containing wt, R99Q, or D120G variants, and the lower graph (B) shows the results from supernatants containing P126L, CHNHdup, H155R, V377H, and R439H variants. Note the 10-fold difference in y-axis scale. The elution volume is given on the x-axis, and the elution positions of trypan blue (2000 kDa), thyroglobulin (669 kDa), ferritin (440 kDa), and catalase (232 kDa) are marked in A.

Close modal

Based on the similarity with wt MASP-2 on Western blot analysis and on gel permeation chromatography, we assumed that the various rMASP-2s were present in a native conformation and we thus continued to study the functions of these. To investigate the ability of the mutated MASP-2s to bind to MBL, dilutions of culture supernatants with rMASP-2s were mixed with a fixed amount of rMBL and incubated in mannan-coated microtiter wells, and bound MBL/MASP-2 complexes were detected by reaction with an anti-MASP-2 Ab. As seen in Fig. 4, increasing amounts of MASP-2 resulted in increasing MASP-2 signal. No major difference in complex formation was seen between MBL and the different MASP-2 mutants, except for the D120G and the CHNHdup mutants, which showed no binding to MBL. Due to the very low amounts of MASP-2 in the culture supernatant from the CHNHdup expression, it was only possible to analyze the binding of this variant in the lower concentrations.

FIGURE 4.

Binding of MASP-2 variants to MBL. MBL and rMASP-2s were mixed and added to microtiter wells coated with mannan. The bound MASP-2 was detected by incubation with biotinylated anti-MASP-2 Ab, followed by europium-labeled streptavidin. The concentration of MASP-2 in the dilutions of the supernatants is given on the x-axis, and the signal (counts per second) on the y-axis.

FIGURE 4.

Binding of MASP-2 variants to MBL. MBL and rMASP-2s were mixed and added to microtiter wells coated with mannan. The bound MASP-2 was detected by incubation with biotinylated anti-MASP-2 Ab, followed by europium-labeled streptavidin. The concentration of MASP-2 in the dilutions of the supernatants is given on the x-axis, and the signal (counts per second) on the y-axis.

Close modal

When pro-MASP-2 is activated in a MBL/MASP-2 complex, MASP-2 will efficiently cleave complement factor C4, generating C4b and C4a. C4b binds covalently to nearby amino or hydroxyl groups, in this case to the mannan coated in the wells (19). The various rMASP-2s were mixed with MBL and added to mannan-coated microtiter wells. Complement factor C4 was subsequently added, and the ability of the various MASP-2s to induce deposition of C4 fragments on the surface was detected with anti-C4 Abs. The D120G and the CHNHdup variants were found not to mediate C4 deposition in this setup in agreement with their apparent failure of binding to MBL (see above) (Fig. 5). Except for R439H, all of the MASP-2s that could bind to MBL were also found to be able to activate C4 (Fig. 5). The H155R mutant seemed to be more efficient than the others in this capacity. This mutant was found to be only marginally better than the others in binding to MBL (Fig. 4).

FIGURE 5.

Deposition of C4 fragments by complexes of MASP-2 variants with MBL. MBL and rMASP-2s were mixed and added to microtiter wells coated with mannan. After wash, the wells were incubated at 37°C with purified complement factor C4, and the amount of C4 fragments deposited was subsequently measured by incubation with biotinylated anti-C4 Abs, followed by europium-labeled streptavidin. The concentration of MASP-2 in dilutions of the supernatants is given on the x-axis, and the signal (counts per second) on the y-axis.

FIGURE 5.

Deposition of C4 fragments by complexes of MASP-2 variants with MBL. MBL and rMASP-2s were mixed and added to microtiter wells coated with mannan. After wash, the wells were incubated at 37°C with purified complement factor C4, and the amount of C4 fragments deposited was subsequently measured by incubation with biotinylated anti-C4 Abs, followed by europium-labeled streptavidin. The concentration of MASP-2 in dilutions of the supernatants is given on the x-axis, and the signal (counts per second) on the y-axis.

Close modal

When a MBL/MASP complex binds to an activating surface, pro-MASP-2 is known to autoactivate (20, 21, 22). When pro-MASP-2 is activated, the polypeptide chain is cleaved into two chains (52-kDa A and 31-kDa B chain) held together by a disulfide bond. To analyze the ability to autoactivate, we mixed MBL with the rMASP-2 variants, incubated the mixture in mannan-coated wells, and analyzed the bound material by SDS-PAGE under reducing conditions, followed by Western blotting. Initially, we tested the activation of MASP-2 after incubation for various lengths of time. In Fig. 6,A, one can see that some of the wt rMASP-2 is activated after 40 min at 37°C, and most of the MASP-2 is activated after 120 min. In comparison, the R439H mutant, which binds to MBL, but which does not mediate deposition of C4 (see above), does not get activated even after 120 min of incubation (Fig. 6,A). It appears that the reason for the inability to activate C4 is to be found in the lack of ability to autoactivate. All of the other rMASP-2 variants were seen to be activated after 120 min (Fig. 6,B), except for the R444Q mutant that we used as negative control. It is not possible to see the bands from CHNHdup on the figure due to the very low level of MASP-2 in the supernatants. It is not possible to see a band from the D120G variant on the lower Western blot on Fig. 6 B (Activated) because this variant does not bind to the MBL that is bound to the mannan-coated wells. Thus, no MASP-2 can be expected to be bound and subsequently eluted from the wells.

FIGURE 6.

Activation of rMASP-2s analyzed by Western blotting. A, Activation of rMASP-2 after various time periods. Recombinant wt or R439H MASP-2 was mixed with rMBL, added to mannan-coated microtiter wells, and left at 37°C for the times indicated below the figure. The lane marked “Start” is the preparation before addition to the wells. The wells were subsequently washed, and MBL and MASP-2 were eluted from the wells with SDS-PAGE sample buffer. The samples were then analyzed by SDS-PAGE at reducing conditions, followed by Western blotting developing with anti-MASP-2 Ab. On this and the following graph, the migration of the molecular mass markers is given on the right side of the figure in kDa. B, The various rMASP-2 variants (indicated above the lanes) were mixed with rMBL, added to mannan-coated microtiter wells, and left at 37°C. The upper part of the figure, marked “Start,” represents the preparation before addition to the wells, whereas the lower part, marked “Activated,” represents the mixtures left at 37°C. The wells were subsequently washed, and MBL and MASP-2 were eluted from the wells with SDS-PAGE sample buffer. The samples were then analyzed by SDS-PAGE Western blotting developing with anti-MASP-2 Ab.

FIGURE 6.

Activation of rMASP-2s analyzed by Western blotting. A, Activation of rMASP-2 after various time periods. Recombinant wt or R439H MASP-2 was mixed with rMBL, added to mannan-coated microtiter wells, and left at 37°C for the times indicated below the figure. The lane marked “Start” is the preparation before addition to the wells. The wells were subsequently washed, and MBL and MASP-2 were eluted from the wells with SDS-PAGE sample buffer. The samples were then analyzed by SDS-PAGE at reducing conditions, followed by Western blotting developing with anti-MASP-2 Ab. On this and the following graph, the migration of the molecular mass markers is given on the right side of the figure in kDa. B, The various rMASP-2 variants (indicated above the lanes) were mixed with rMBL, added to mannan-coated microtiter wells, and left at 37°C. The upper part of the figure, marked “Start,” represents the preparation before addition to the wells, whereas the lower part, marked “Activated,” represents the mixtures left at 37°C. The wells were subsequently washed, and MBL and MASP-2 were eluted from the wells with SDS-PAGE sample buffer. The samples were then analyzed by SDS-PAGE Western blotting developing with anti-MASP-2 Ab.

Close modal

Autoactivation of MASP-2 has previously been reported to be dependent on the presence of MBL (20, 21). We retested this by incubating wt rMASP-2 with MBL and mannose-coated beads and analyzed the activation of MASP-2 by Western blotting of reduced samples. We found that MASP-2 mixed with beads did not lead to any activated MASP-2. Mixing MASP-2 with MBL resulted in some activation of MASP-2, but the activation of MASP-2 was much more pronounced when MASP-2, MBL, and mannose beads were mixed (data not shown).

To date, the R439H mutant is unique in its ability to bind MBL without becoming activated after binding of the complex to a mannan surface (see above). We searched the SNP databases for the frequency and ethnic distribution of this polymorphism, and found that it was observed among Africans. To extend these data, we subsequently tested for the presence of this SNP in 194 Zambian Africans. As given in Table III, this SNP is clearly quite common with a gene frequency of 9%. Among the 194 individuals, we did not find any to be homozygous, although it should in principle be found in 1 of 124 individuals. Clearly, this is not a statistically significant observation.

Table III.

Frequency of R439H in native Zambians

Frequency
n = 194
Phenotype RR:a 82% (n = 159) 
 RH: 18% (n = 35) 
 HH: (n = 0) 
Allele frequency R: 91% (353) 
 H: 9% (35) 
Frequency
n = 194
Phenotype RR:a 82% (n = 159) 
 RH: 18% (n = 35) 
 HH: (n = 0) 
Allele frequency R: 91% (353) 
 H: 9% (35) 
a

R439 (R), H439 (H).

The MASP-2 levels in the 194 Zambian Africans were previously determined (11). When we divided the individuals in wt/wt and wt/R439H individuals, we found no significant difference in MASP-2 levels (Fig. 7,A). The activity of the MBL/MASP complexes in heterozygous individuals was found to be similar to the wt individuals, i.e., in individuals with higher MBL levels (above 1 μg/ml), no apparent difference was seen in C4b-depositing activity (Fig. 7 B). As seen in the figure, the assay clearly depends on the MBL concentration, i.e., the more MBL, the more C4b deposition.

FIGURE 7.

MASP-2 in R439H heterozygotes. A, The concentration of MASP-2 in Zambians. A median of 203 ng/ml (159 tested) and 157 ng/ml (39 tested) is found in wt and R439H heterozygous individuals, respectively (given as a line on the figure). Using Mann-Whitney rank sum test (because normality test failed), there is no statistically significant difference. B, The MBL pathway activity of serum from wt and heterozygotes with regard to p.R439H. Deposition of C4b on a mannan surface is given on the y-axis, and the MBL concentration in the sera is given on the x-axis.

FIGURE 7.

MASP-2 in R439H heterozygotes. A, The concentration of MASP-2 in Zambians. A median of 203 ng/ml (159 tested) and 157 ng/ml (39 tested) is found in wt and R439H heterozygous individuals, respectively (given as a line on the figure). Using Mann-Whitney rank sum test (because normality test failed), there is no statistically significant difference. B, The MBL pathway activity of serum from wt and heterozygotes with regard to p.R439H. Deposition of C4b on a mannan surface is given on the y-axis, and the MBL concentration in the sera is given on the x-axis.

Close modal

Activation of the complement system in response to infections by pathogens is an essential component of the immune defense (1, 2). However, activation of the complement system is also needed for efficient removal of altered-self structures, e.g., dying cells or mutated cells (23). Tagging structures with complement factors may occur via several types of recognition. The present study concentrates on the description of activities of the lectin pathway, which is a relatively newly discovered initiation pathway; however, it is suggested to be the oldest pathway in evolutionary terms (4).

The serine protease MASP-2 mediates the activation of downstream complement components through the four known pattern recognition molecules of the lectin pathway (3). Information on the concentration and function of MASP-2 may thus be clinically relevant. A number of MASP-2 variants are found, and we wished to examine the function of these.

MASPs are homodimers that circulate as zymogens in complex with MBL or one of the three ficolins to become activated once the pattern recognition molecule binds to a target surface, such as a bacterial cell. The serine protease domain of MASP-2 has a chymotrypsin-like structure and has trypsin-like substrate specificity, cleaving after arginine residues (24). Activation leads to cleavage of the MASP polypeptide chain, between an arginine-isoleucine peptide bond at the N-terminal end of the serine protease domain, and thus, the C-terminal end of the activation peptide (Fig. 1). Activated MASP-2 is able to cleave C4 with very high efficiency, with Km in the nanomolar range (25).

We and others have described a number of amino acid exchange variants of MASP-2 (11, 26). Of the reported variants, we decided not to produce rMASP-2 representing R118C because we have not found this allele in any of the populations that we have studied (11).

Other groups have used insect cell lines for the generation of recombinant human and mouse MASP-2 (27, 28) or Chinese hamster ovary cells for expression of rat MASP-2 (21). We chose to use the human endothelial kidney cell line 293 to get as close as possible to natural production. It would appear even better to use hepatocytes, which are the primary source of MASP-2 in humans. However, endogenous MASP-2 production from the hepatocytes might then have distorted the results.

We found a decent (0.7–10 μg/ml) concentration of MASP-2 in the culture supernatants of most of the cells transfected with plasmids encoding the naturally occurring MASP-2 variants. For reasons unknown to us, the H155R variant was found at a quite low concentration in the culture supernatant, but we were able to obtain sufficient material for the present studies. The variant CHNHdup was present in too low an amount in the culture supernatant to allow for many of the experiments, and could only be detected after concentration of the supernatant. In contrast, we found that the amount of MASP-2 inside CHNHdup plasmid-transfected 293-F cells was equal to the amount of MASP-2 inside cells transfected with the wt plasmid. This indicates that the CHNH variant is misfolded and cannot be correctly processed and exported, but rather is retained in the endoplasmatic reticulum by quality control mechanisms, retranslocated to the cytosol, and finally, degraded by the ubiquitin proteasome pathway (29). Hence, the incorrectly folded mutant MASP-2 does not accumulate intracellular, and we see approximately equal amounts in lysates from cells producing CHNHdup and wt rMASP-2. We have previously found that individuals heterozygous for the CHNHdup variant have lower concentrations of MASP-2 in serum than individuals not possessing this allotype (11). We suggest that this is due to the lack of secretion of the misfolded form of the protein. Apparently, the other normal gene is not able to fully compensate for this. As discussed below, this variant has also lost the ability to bind to MBL. This lack of complex formation would possibly lead to a faster clearance from the blood. The stretch of amino acids, H157, N158, H159, and L160, was suggested by Gregory et al. (18) to be involved in homodimerization of human MAp19. The variant 156_159dupCHNH presents a duplication of 4 aa right in this area, and this could possibly disrupt dimerization of the proteins. We could not study whether this is true because too little material could be collected from the culture supernatants.

The various other forms of rMASP-2 unexpectedly all eluted corresponding to macromolecules of ∼500 kDa when analyzed by size permeation chromatography in isotonic calcium-containing buffer (Fig. 3). We do not know whether this indicates the formation of higher oligomeric forms, or whether the MASPs somehow associate with other proteins in the culture supernatant. The molecular masses estimated by size-exclusion chromatography rely crucially on the relative shapes of the protein under study compared with the standard proteins used for calibration. This may add to this quite high apparent molecular mass we find because the dimers of MASP-2 have been reported to be rather elongated (18). In an EDTA-containing buffer, the elution corresponds to the expected size of dimers (data not shown). With regard to the polypeptide chain of MASP-2, the CUB1-epidermal growth factor (EGF)-CUB2 domains (CUB domain found in complement component Clr/Cls, Uegf, and bone morphogenic protein 1) are involved in a calcium-dependent homodimer formation (17, 18, 30). Together with the amino acids mentioned above, H155 also was suggested to be involved in dimerization (18), but we do not see any effect of the H155R mutation (exchanging a basic residue with another basic residue) in the present investigation.

In plasma, MASP-2 is found in complexes with MBL and with the three ficolins. MASP-2 binds to similar sites in the collagenous regions of the ficolins and MBL. A conserved lysine residue, i.e., K75 (numbering including signal peptide) in human MBL, K70 in human H-ficolin, K44 in human L-ficolin, and K73 in human M-ficolin, within this region is critical for binding and is believed to form contacts with the MASPs (5, 31). Other amino acids nearby are of somewhat lesser importance, although they do influence the binding patterns of the different MASPs to a varying degree. With regard to the polypeptide chain of MASP-2, the first two domains (CUB1-EGF) are involved in the interaction with MBL and ficolins, and the third domain (CUB2) has a stabilizing effect on this interaction. The x-ray crystallography studies of the CUB1-EGF-CUB2 domains from rat MASP-2 and human MAp19 suggest that the interaction between MASP-2 and MBL requires a calcium binding site present in the EGF domain as well as one present in the CUB1 domain. We analyzed the ability of the various variant MASP-2s to form complexes with MBL. We find that the two variants, R99Q and P126L, which are found in the CUB1 domain, and the variant H155R, which is found in the EGF domain, have retained the MBL-binding activity, whereas D120G (CUB1 domain) and CHNHdup (EGF domain) (see Fig. 1) cannot associate with MBL. The V377A variant (CCP2 domain) and the R439H variant (activation peptide) also bind well to MBL. We have previously reported on the lack of binding of the D120G variant (12). This is best explained by the loss of the calcium binding site in the CUB1 domain of MASP-2 by this mutant because D120 is directly involved in binding of the calcium ion. Mutation of some nearby residues also interfere with binding to MBL: when the amino acid residue Y74 or Y121 (numbering including signal peptide) of MAp19 was mutated to alanine, this led to no binding to MBL, and the mutation of E98 or E124 to alanine resulted in very low binding activity, as examined by Gregory et al. (18), who suggested that these amino acids are directly involved in the interaction with MBL. No polymorphisms have been seen in these particular amino acids, but apparently the nearby mutation of R99Q (a basic amino acid residue exchanged to an amide) does not interfere with the interaction of the neighboring E98 with MBL, and the mutation P126L (a secondary amine exchanged to an aliphatic group) does not interfere with the interaction mediated by E124.

The enzymatic activity of the various mutated MASP-2s was analyzed by studying the ability of the MASPs in complex with MBL to induce the deposition of C4 fragments onto a mannan-coated surface. Consistent with the finding that the MASP-2 mutants, D120G and CHNHdup, cannot bind to MBL, these mutants failed to induce C4 fragment deposition. In contrast, the variants R99Q, P126L, and V377A cleaved C4 with an activity comparable to that of the wt MASP-2. The H155R variant had the highest C4-cleaving activity. We do not have an explanation for this, but as mentioned, the amino acid at this position may be involved in the interaction between MASP-2 polypeptide chains, and it could be that this interaction has increased due to the exchange of amino acid residue.

The R439H variant behaved strikingly different from the others, displaying considerably reduced enzymatic activity despite binding to MBL. We and others have previously noted that when purified MASP-2 is mixed with purified MBL without any ligand autoactivation of MASP-2 occurs (20, 21). This activation of MASP-2 is much more efficient when a ligand is present such as provided by a mannan surface, most likely a consequence of conformational rearrangements analogous to those of C1 complex activation. Whereas the wt MASP-2 and the other C4-cleaving variants were capable of autoactivation, the R439H variant was found incapable of autoactivating, providing a likely explanation for its lack of C4-cleaving enzymatic activity (Fig. 6). The R439H mutation (exchanging a basic residue with another more bulky basic residue) is positioned in the activation peptide, 5 aa N terminally from the R444 cleavage site (Fig. 1). This indicates that a polypeptide sequence minimally including these 5 aa is needed for substrate recognition, or alternatively, it may suggest that the folding of the serine protease domain is influenced by the sequence of amino acids in the activation peptide. The structure of a CCP2-serine protease fragment and of a similar fragment in which the active serine in the protease domain was mutated has been solved, and the data indicate flexibility in the activation peptide between the CCP2 and the protease domain (22, 24).

It has been suggested that MASP-2 not only binds to C4 through the active protease domain, but also via parts of the two CCP domains (CCP1-CCP2) next to the protease domain (22, 25), such an area often referred to as an exosite. Based on modeling experiments, this exosite has been suggested to include the amino acids R376, E378, E397, and E398 in CCP2 (24). The probably very small change in functional activity resulting from changing of valine to alanine in position 377 (see above) did not seem to influence this C4 binding site.

Because it could possibly have a clinical consequence to be homozygous for the R439H allele, and thus to be functionally defect in the lectin pathway, we examined for the R439H variant in black Zambians and found 18% to be heterozygous, i.e., a gene frequency of 9%, similar to the frequency reported on rs12085877 in the National Center for Biotechnology Information SNP database for the allele in Sub-Saharan Africans. In the database, the allele was reported not to be present in 120 Europeans and 180 Asians, whereas it was found in 30 (heterozygotes) (25%) of 120 samples from Sub-Saharan Africans, indicating a gene frequency of 12.2% for the allele. This high frequency suggests that it may be possible to identify individuals with defects in the enzymatic activity of MASP-2. However, we have to date only identified heterozygous individuals among the 194 individuals tested. These heterozygous individuals show a normally functioning MBL/MASP-2 pathway (taking into account the difference in MBL concentration of the different individuals) as measured by the ability of their sera to deposit C4 fragments onto a mannan surface, mimicking a naturally occurring pathogen-associated molecular pattern (Fig. 7,B). Two other polymorphisms seem to be restricted to Sub-Saharan Africans, p.R99Q and p.P126L (11). In the present study, we have had access to too few samples to be able to examine whether certain combinations of the various polymorphisms will influence the lectin pathway. The distribution of MASP-2 levels was similar among the heterozygous and the wt individuals (Fig. 7 A).

The finding that naturally occurring variant forms of MASP-2 differ in MBL-binding activity and enzymatic activity might have implications for the susceptibility to infections of individuals with the various genotypes. With regard to polymorphisms associated with deficiency of MASP-2, it is to be expected, as has been experienced with other parts of the immune system, that the consequences of impaired MASP-2 function may only become apparent if the individual encounters pathogens in situations in which other parts of the antimicrobial defense systems are stressed or lacking. The identification of a variant that shows higher complement-activating capacity suggests also that a potential dysregulation of complement activation, possibly enhancing the harmful effects of the complement system, may be the result of MASP-2 polymorphisms.

We believe that our results will further the understanding of the lectin pathway of complement activation and the clinical implications of deficiencies caused by nonfunctional and gain-of-function mutations.

We are grateful for the expert technical help from Lisbeth Jensen.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was partly supported by the Danish Research Council and Novo Nordic Foundation.

3

Abbreviations used in this paper: MBL, mannan-binding lectin; EGF, epidermal growth factor; MASP, MBL-associated serine protease; wt, wild type; SNP, single nucleotide polymorphism.

1
Walport, M. J..
2001
. Complement.
N. Engl. J. Med.
344
:
1058
-1066.
2
Markiewski, M. M., J. D. Lambris.
2007
. The role of complement in inflammatory diseases from behind the scenes into the spotlight.
Am. J. Pathol.
171
:
715
-727.
3
Thiel, S..
2007
. Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins.
Mol. Immunol.
44
:
3875
-3888.
4
Fujita, T..
2002
. Evolution of the lectin-complement pathway and its role in innate immunity.
Nat. Rev. Immunol.
2
:
346
-353.
5
Wallis, R..
2007
. Interactions between mannose-binding lectin and MASPs during complement activation by the lectin pathway.
Immunobiology
212
:
289
-299.
6
Stover, C. M., S. Thiel, M. Thelen, N. J. Lynch, T. Vorup-Jensen, J. C. Jensenius, W. J. Schwaeble.
1999
. Two constituents of the initiation complex of the mannan-binding lectin activation pathway of complement are encoded by a single structural gene.
J. Immunol.
162
:
3481
-3490.
7
Matsushita, M., T. Fujita.
1992
. Activation of the classical complement pathway by mannose-binding protein in association with a novel C1s-like serine protease.
J. Exp. Med.
176
:
1497
-1502.
8
Ambrus, G., P. Gal, M. Kojima, K. Szilagyi, J. Balczer, J. Antal, L. Graf, A. Laich, B. E. Moffatt, W. Schwaeble, et al
2003
. Natural substrates and inhibitors of mannan-binding lectin-associated serine protease-1 and -2: a study on recombinant catalytic fragments.
J. Immunol.
170
:
1374
-1382.
9
Thiel, S., T. Vorup-Jensen, C. M. Stover, W. Schwaeble, S. B. Laursen, K. Poulsen, A. C. Willis, P. Eggleton, S. Hansen, U. Holmskov, et al
1997
. A second serine protease associated with mannan-binding lectin that activates complement.
Nature
386
:
506
-510.
10
Matsushita, M., S. Thiel, J. C. Jensenius, I. Terai, T. Fujita.
2000
. Proteolytic activities of two types of mannose-binding lectin-associated serine protease.
J. Immunol.
165
:
2637
-2642.
11
Thiel, S., R. Steffensen, I. J. Christensen, W. K. Ip, Y. L. Lau, I. J. Reason, H. Eiberg, M. Gadjeva, M. Ruseva, J. C. Jensenius.
2007
. Deficiency of mannan-binding lectin associated serine protease-2 due to missense polymorphisms.
Genes Immun.
8
:
154
-163.
12
Stengaard-Petersen, K., S. Thiel, M. Gadjeva, M. Moller-Kristensen, R. Sorensen, L. T. Jensen, A. G. Sjöholm, L. Fugger, J. C. Jensenius.
2003
. Inherited deficiency of mannan-binding lectin-associated serine protease 2.
N. Engl. J. Med.
349
:
554
-560.
13
Møller-Kristensen, M., J. C. Jensenius, L. Jensen, N. Thielens, V. Rossi, G. Arlaud, S. Thiel.
2003
. Levels of mannan-binding lectin-associated serine protease-2 in healthy individuals.
J. Immunol. Methods
282
:
159
-167.
14
Thiel, S., S. V. Petersen, T. Vorup-Jensen, M. Matsushita, T. Fujita, C. M. Stover, W. Schwaeble, J. C. Jensenius.
2000
. Interaction of C1q and mannan-binding lectin (MBL) with C1r.C1s, MBL-associated serine proteases 1 and 2, and the MBL-associated protein MAp19.
J. Immunol.
165
:
878
-887.
15
Petersen, S. V., S. Thiel, L. Jensen, R. Steffensen, J. C. Jensenius.
2001
. An assay for the mannan-binding lectin pathway of complement activation.
J. Immunol. Methods
257
:
107
-116.
16
Thiel, S., M. Møller-Kristensen, L. Jensen, J. C. Jensenius.
2002
. Assays for the functional activity of the mannan-binding lectin pathway of complement activation.
Immunobiology
205
:
446
-454.
17
Chen, C. B., J. Wallis.
2001
. Stoichiometry of complexes between mannose-binding protein and its associated serine proteases: defining functional units for complement activation.
J. Biol. Chem.
276
:
25894
-25902.
18
Gregory, L. A., N. M. Thielens, M. Matsushita, R. Sorensen, G. J. Arlaud, J. C. Fontecilla-Camps, C. Gaboriaud.
2004
. The x-ray structure of human mannan-binding lectin-associated protein 19 (MAp19) and its interaction site with mannan-binding lectin and L-ficolin.
J. Biol. Chem.
279
:
29391
-29397.
19
Møller-Kristensen, M., S. Thiel, A. G. Hansen, J. C. Jensenius.
2003
. On the site of C4 deposition upon complement activation via the mannan-binding lectin pathway or the classical pathway.
Scand. J. Immunol.
57
:
556
-561.
20
Vorup-Jensen, T., S. V. Petersen, A. G. Hansen, K. Poulsen, W. Schwaeble, R. B. Sim, K. B. M. Reid, S. J. Davis, S. Thiel, J. C. Jensenius.
2000
. Distinct pathways of mannan-binding lectin (MBL)- and C1-complex autoactivation revealed by reconstitution of MBL with recombinant MBL-associated serine protease-2.
J. Immunol.
165
:
2093
-2100.
21
Chen, C. B., R. Wallis.
2004
. Two mechanisms for mannose-binding protein modulation of the activity of its associated serine proteases.
J. Biol. Chem.
279
:
26058
-26065.
22
Gal, P., V. Harmat, A. Kocsis, T. Bian, L. Barna, G. Ambrus, B. Vegh, J. Balczer, R. B. Sim, G. Naray-Szabo, P. Zavodszky.
2005
. A true autoactivating enzyme: structural insight into mannose-binding lectin-associated serine protease-2 activations.
J. Biol. Chem.
280
:
33435
-33444.
23
Trouw, L. A., A. M. Blom, P. Gasque.
2008
. Role of complement and complement regulators in the removal of apoptotic cells.
Mol. Immunol.
45
:
1199
-1207.
24
Harmat, V., P. Gal, J. Kardos, K. Szilagyi, G. Ambrus, B. Vegh, G. Naray-Szabo, P. Zavodszky.
2004
. The structure of MBL-associated serine protease-2 reveals that identical substrate specificities of C1s and MASP-2 are realized through different sets of enzyme-substrate interactions.
J. Mol. Biol.
342
:
1533
-1546.
25
Rossi, V., F. Teillet, N. M. Thielens, I. Bally, G. J. Arlaud.
2005
. Functional characterization of complement proteases C1s/mannan-binding lectin-associated serine protease-2 (MASP-2) chimeras reveals the higher C4 recognition efficacy of the MASP-2 complement control protein modules.
J. Biol. Chem.
280
:
41811
-41818.
26
Lozano, F., B. Suárez, A. Muñoz, J. C. Jensenius, J. Mensa, J. Vives, J. P. Horcajada.
2005
. Novel MASP2 variants detected among North African and Sub-Saharan individuals.
Tissue Antigens
66
:
131
-135.
27
Rossi, V., S. Cseh, I. Bally, N. M. Thielens, J. C. Jensenius, G. J. Arlaud.
2001
. Substrate specificities of recombinant mannan-binding lectin-associated serine proteases-1 and -2.
J. Biol. Chem.
276
:
40880
-40887.
28
Iwaki, D., T. Fujita.
2005
. Production and purification of recombinants of mouse MASP-2 and sMAP.
J. Endotoxin Res.
11
:
47
-50.
29
Trombetta, E. S., A. J. Parodi.
2003
. Quality control and protein folding in the secretory pathway.
Annu. Rev. Cell. Dev. Biol.
19
:
649
-676.
30
Feinberg, H., J. C. Uitdehaag, J. M. Davies, R. Wallis, K. Drickamer, W. I. Weiss.
2003
. Crystal structure of the CUB1-EGF-CUB2 region of mannose-binding protein associated serine protease-2.
EMBO J.
22
:
2348
-2359.
31
Teillet, F., M. Lacroix, S. Thiel, D. Weilguny, T. Agger, G. J. Arlaud, N. M. Thielens.
2007
. Identification of the site of human mannan-binding lectin involved in the interaction with its partner serine proteases: the essential role of Lys55.
J. Immunol.
178
:
5710
-5716.