Expression of IL-24, an Activator of the JAK1/STAT3/SOCS3 Cascade, Is Enhanced in Inflammatory Bowel Disease

Inflammatory bowel disease (IBD),³ ulcerative colitis (UC), and Crohn’s disease (CD) are characterized by chronic inflammation, in which a dysfunction of the host immune response against common Ags such as dietary factors or bacteria may be involved (1, 2).

IL-24, a member of the IL-10 family of cytokines (together with IL-10, IL-19, IL-20, IL-22, IL-26, IL-28, and IL-29), was discovered by the subtraction hybridization of cDNA libraries prepared from melanoma cells treated with IFN-β and a protein kinase C inhibitor (mezerein) (3, 4). It was originally termed melanoma differentiation-associated protein 7 (3), and was renamed IL-24 (5). The human il24 gene is located in chromosome 1, within a 195-kb cytokine cluster containing the IL-10, IL-19, IL-20, and IL-24 genes (6). IL-24 shares a 20–30% amino acid homology with IL-10, IL-20, and IL-22 and interacts with two different heterodimeric receptor complexes, IL-20R1/IL-20R2 and IL-22R1/IL-20R2 (7, 8, 9). Binding to both receptors leads to the activation of STAT-3, similar to other members of the IL-10 family of cytokines (7, 8, 9, 10). Immune cells do not express IL-24 receptors (11), suggesting that IL-24 cannot stimulate the acquired immune response (12). In contrast, the restricted expression of the IL-24 receptor components IL-20R1 and IL-22R1 in nonimmune tissues suggests the innate immune response as the selective target of IL-24 (8, 11).

Under the appropriate stimulation, IL-24 expression has been identified in certain cell types (11, 13), such as cultured melanocytes (3), dermal keratinocytes (12), LPS-stimulated monocytes (13), and Th2-polarized T cells (13). Treatment with IFN-β plus mezerein induced a transient expression of IL-24 mRNA in some cancer cell lines (6). However, the precise cytokine regulation and molecular mechanisms of IL-24 induction still remain unclear.

IL-24 can function either as an intracellular cell death-inducing factor to cancer cells, or as a classical cytokine through its cell surface receptors. With respect to its anticancer actions, adenoviral vector-mediated expression of IL-24 selectively and efficiently induces cell death in a vast variety of cancer cells, especially melanoma cells, independent of receptor expression and JAK/STAT signaling (14, 15, 16, 17, 18). In contrast, through receptor binding IL-24 has been reported to induce the expression of proinflammatory cytokines from monocytes (5). In vivo, IL-24 is predominantly expressed by skin tissue cells during inflammatory conditions, such as psoriasis (12). IL-24 gene expression was also greatly increased at the edge of excisional skin wounds (19). Thus, the available data on IL-24 suggest a role as a cytokine during inflammation and tissue repair.

In this study, we investigated IL-24 expression in the inflamed mucosa of IBD patients. Furthermore, to characterize the molecular mechanisms responsible for IL-24 expression in the colonic mucosa, we analyzed IL-24 expression in nontransformed human colonic subepithelial myofibroblasts (SEMFs).

Recombinant human cytokines were purchased from R&D Systems. Inhibitors of p42/44 MAPKs (PD98059 and U0216), and an inhibitor for p38 MAPK (SB203580) were purchased from Cell Signaling Technology. An inhibitor of JNK was purchased from Calbiochem. C/EBP-specific, SOCS3-specific, and control small interfering RNA (siRNA) were purchased from Santa Cruz Biotechnology.

Goat anti-human IL-24 Abs (R&D Systems), mouse anti-α-smooth muscle actin (SMA) Abs (Sigma-Aldrich), goat anti-JAK1 and anti-JAK2 Abs, anti-MAPK, and anti-STAT-3 Abs (Cell Signaling Technology), goat anti-human c-Jun, c-Fos, and C/EBP-β Abs (Santa Cruz Biotechnology), rabbit anti-human IL-22R1 and IL-20R1 Abs (Abcam) were purchased from commercial suppliers.

Diagnosis for IBD was based on conventional clinical and endoscopic criteria. Surgically rejected or biopsy specimens from 24 patients who have UC and 21 patients who have CD were used with informed consent. The ethics committee of Shiga University of Medical Science approved this project.

During sample collection, all patients were clinically and endoscopically active with colitis activity index for UC (20) and CD activity index (21). Five patients who have UC and six patients who have CD received surgical operation due to resistance to medication or due to other complications (e.g., massive bleeding, fistula formation, or perforation). Histological examinations were performed in macroscopically and microscopically nonaffected (n = 13 in UC; and n = 11 in CD) or affected (n = 11; and n = 10 in CD) areas from each patient. All patients were treated with salicylates, and 12/24 UC and 10/21 CD patients received treatment with corticosteroids. Seven patients with UC and seven patients with CD were treated with azathioprine. Biopsy samples derived from infectious and ischemic colitis (n = 7) were obtained by colonoscopy. Normal colorectal tissues were obtained by the surgical resection of colon cancer at distal tumor sites (n = 7 samples).

Immunohistochemical analyses were performed according to the method described in our previous report (22). Images were then obtained with a digital confocal laser scanning system MRC-600 (Bio-Rad).

Primary colonic SEMF cultures were prepared according to a method reported by Mahida et al. (23). The cellular characteristics and culture conditions have also been described in our previous report (24). The human colon cancer cell lines HT-29 (25), Caco-2 (26), and SW480 (27) were obtained from the American Type Culture Collection.

Antigenic IL-24 in all samples was quantified by sandwich ELISA kits purchased from R&D Systems.

The expression of mRNA in the samples was assessed by RT-PCR and real-time PCR analyses. RT-PCR was performed according to the methods described in our previous report (28). The oligonucleotide primers used in this study are shown in Table I (3, 9, 29, 30, 31, 32, 33). Real-time PCR was performed using a LightCycler 2.0 system (Roche Applied Science). The PCR was conducted using a SYBR Green PCR Master Mix (Applied Biosystems). The data were normalized vs β-actin for human IL-24.

Nuclear extracts were prepared from cells exposed to the cytokines for 1.5 h by the method of Dignam et al. (34). The consensus oligonucleotides for AP-1 (5′-CGCTTGATGAGTCAGCCGGAA) and C/EBP (5′-TGCAGATTGCGCAATCTGCA) were purchased from Promega and Santa Cruz Biotechnology, respectively. The oligonucleotides were 5′ end-labeled with T4 polynucleotide kinase (Promega) and [γ-³²P]ATP (Amersham Biosciences). The binding reactions were performed according to previously described methods (35).

Three different regions of the human IL-24 promoter extending to −1280 bp upstream of the transcription start site were amplified by PCR using human genomic DNA as a template. This region contains consensus binding sites for AP-1 (at bp −1023, −714, and −109) and C/EBP (at bp −1132, −1032 and −114) (36). The following primers were used: IL-24 (−1280 bp) TATGGTACCAGTCACAACTACTCATCT; IL-24 (−784 bp) CATGGTACCATC- TAGAGCTGAGTGCCT; IL-24 (−550 bp) TCAGGTACCACTCCTCAA- CTTCCTGGCCC; and IL-24 (+31 bp) AAGTCTAGACAGAAGTAAAGGTTTGCA (GenBank accession no. NM_006850.2; http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&Cmd=ShowDetailView&TermToSearch=11009). The 5′ sequence of each primer was modified for a KpnI restriction site (underlined), and the 5′ region of IL-24 (+31) was modified for a BglII restriction site (underlined), respectively. These were ligated into KpnI-BglII sites of the luciferase reporter plasmids pGL3-Basic (Promega) and termed plasmids IL-24(−1280), IL-24(−784), and IL-24(−550). Transient transfections were performed using Lipofectamine Plus reagent (Life Technologies) according to the manufacturer’s protocol. The detailed procedures were described in our previous report (37).

The stimulated cells were lysed in SDS sample buffer containing orthovanadate. Western blots were then performed according to a method previously described (35). The detection was performed using the ECL Western blotting system (Amersham Biosciences).

We used a recombinant adenovirus expressing a dominant negative mutant of c-Jun (Ad-DN-c-Jun), and a recombinant adenovirus containing bacterial β-galactosidase cDNA (Ad-LacZ). The dominant negative mutant c-Jun (TAM67) lacks the transactivational domain of aa 3–122 of the wild-type c-Jun (38), but retains the DNA binding domain. The detailed procedures were described in our previous report (39).

The siRNA for human C/EBPβ and a control siRNA were used. Human colonic SEMFs were cultured in complete medium that did not contain antibiotics for 4 days. The cells were then seeded onto a 6-well plate 1 day before the transfection, and cultured to 60–70% confluence on the following day. For the RNA interference experiments, Lipofectamine LTX and Lipofectamine PLUS Reagent (Invitrogen) were used.

Subconfluent SEMF cultures (70–90%) were grown in 24-well plates, washed, and incubated in DMEM containing 0.2% FBS for 24 h to induce growth arrest. Agonists were added for 24 h. [³H]Thymidine (1 μCi/well) was added for the final 12 h of the incubation, as described in our previous report (40).

The statistical significance difference was determined by the Mann-Whitney U test (Statview version 4.5). Differences resulting in p values less than 0.05 were considered to be statistically significant.

To evaluate the expression of IL-24 mRNA in the mucosa, IL-24 mRNA expression was analyzed by RT-PCR and real-time PCR in the IBD mucosa. As shown in Fig. 1,A, IL-24 mRNA expression was clearly detected in the samples from the active lesions of patients who have UC and CD. Similarly, real-time PCR analysis revealed a significant increase in IL-24 mRNA expression in samples from the active lesions of patients who have UC and CD (Fig. 1 B), as compared with samples from the normal and inactive IBD mucosa. IL-24 mRNA expression was not detected in samples from infectious and ischemic colitis.

To characterize the cellular origin of IL-24 in the inflamed mucosa, the samples were double immunostained with anti-α-SMA, a marker for myofibroblasts, and anti-human IL-24 Abs (Fig. 2). In the normal mucosa, α-SMA (Fig. 2, red fluorescence) was clearly immunostained in the subepithelial regions, but IL-24 was not detected. In contrast, IL-24 protein was clearly detected, mainly in the subepithelial regions in the active mucosa of patients who have UC and CD (Fig. 2, green fluorescence). The α-SMA/IL-24 double immunopositive cells were detected (Fig. 2, yellow), and the IL-24 immunopositive cells coincided with part of the α-SMA immunopositive cells (Fig. 2, right column). These observations indicated that α-SMA immunopositive SEMFs are a major source of IL-24 in the inflamed mucosa of IBD patients.

Based on the in vivo expression of IL-24 in the inflamed IBD mucosa, we examined IL-24 expression in isolated human colonic SEMFs. Colonic SEMFs were stimulated with various cytokines and LPS for 12 h, and the IL-24 mRNA expression was determined by real-time PCR (Fig. 3,A, top blot). Very weak IL-24 mRNA expression was detected in unstimulated colonic SEMFs, and IL-1β stimulation significantly enhanced this IL-24 mRNA expression. IL-17 or LPS weakly enhanced IL-24 mRNA expression, but these stimulations were much weaker than those induced by IL-1β. Similar effects on IL-24 protein secretion were also observed (Fig. 3,A, bottom). In contrast, in the colonic epithelial cell lines (HT-29, SW480, and Caco-2), IL-1β failed to induce IL-24 mRNA expression (Fig. 3 B).

These effects were confirmed at the protein level. Colonic SEMFs were stimulated with various concentrations of IL-1β for 24 h, and then IL-24 secretion was determined by ELISA. As shown in Fig. 3,C, IL-1β dose-dependently induced IL-24 secretion. Furthermore, the colonic SEMFs were incubated with IL-1β (10 ng/ml), and then IL-24 protein secretion was sequentially analyzed by ELISA. This IL-24 secretion was observed in a time-dependent manner (Fig. 3 D).

Multiple recognition sites for the AP-1 and C/EBP transcription factors are present in the promoter region of the il24 gene (36). The IL-24(−1280) plasmid contains three AP-1 and three C/EBP sites, and IL-24(−784) plasmid has two AP-1 sites and one C/EBP site. IL-24(−550) contains one AP-1 and one C/EBP site. As shown in Fig. 4 A, IL-1β significantly increased the relative luciferase activity in SEMFs transfected with the IL-24(−1280) and IL-24(−784) plasmids, but the effects of IL-1β were not detected in cells transfected with the IL-24(−550) plasmid. These results suggest a major role for AP-1 and C/EBP binding between bp −550 to 1280 for the effects of IL-1β.

Next, we performed EMSA to determine whether IL-1β stimulation actually results in the formation of active AP-1 DNA or C/EBP DNA binding complexes. As shown in Fig. 4 B, stimulation with IL-1β (10 ng/ml) induced the formation of AP-1 DNA and C/EBP DNA binding complexes, and these bindings were blocked by cold probe or supershifted by Abs against pan-Fos, pan-Jun, and C/EBP-β.

Furthermore, we evaluated the effects of a recombinant adenovirus expressing a dominant negative mutant of c-Jun (Ad-DN-c-Jun) and C/EBP-β-specific siRNA. As shown in Fig. 4C, Ad-DN-c-Jun significantly decreased the IL-1β-induced IL-24 mRNA expression. Similarly, in the C/EBP-β siRNA-transfected cells, IL-24 expression induced by IL-1β was significantly reduced (Fig. 4D). These findings indicate that the IL-1β-induced IL-24 mRNA expression actually mediated by AP-1 and C/EBP-β activation.

Previously, we demonstrated that IL-1β induces MAPK activation in colonic SEMFs (41). To investigate the role of MAPKs in the IL-1β-induced IL-24 mRNA expression in SEMFs, we evaluated the effects of p42/44 MAPK inhibitors (PD98059 and U0216) (42, 43), a p38 MAPK inhibitor (SB203580) (44), and a JNK inhibitor (JNK Inhibitor I) (45). As shown in Fig. 5 A, p42/44 and p38 MAPK inhibitors significantly reduced the IL-β-induced IL-24 mRNA expression, but JNK inhibitor had no effect.

Next, we evaluated the possibility that the IL-1β-induced IL-24 mRNA expression was dependent on increased mRNA stability. Colonic SEMFs were stimulated for 12 h in medium alone or with IL-1β, and then treated with actinomycin D for various time periods to block further RNA transcription (Fig. 5 B). In those cells treated with medium alone, IL-24 mRNA expression decreased by 70% at 5 h after the addition of actinomycin D. Treatment with IL-β actually prolonged the rate of DAF mRNA degradation; 80% of the IL-24 mRNA still remained after 5 h. SB203580, a p38 MAPK inhibitor, abolished these effects of IL-1β. These findings suggest that some of the effects of IL-1β may be mediated by an induction of IL-24 mRNA stabilization via p38 MAPK activation.

IL-24 signaling has been reported as being mediated through both IL-20R1/IL-20R2 and IL-22R1/IL-20R2 (7, 8, 9), and expression of IL-20R1 and IL-22R1 is restricted in nonimmune cells. However, in vivo expression in human colonic mucosa remains unclear. As shown in Fig. 6, immunohistochemical studies showed an expression of IL-22R1, IL-20R1, and IL-20R2 in epithelial cells from normal colonic mucosa. Epithelial expression of IL-22R1, IL-20R1, and IL-20R2 was also detected in IBD mucosa. Furthermore, IL-20R1, IL-22R1, and IL-20R2 mRNA was detected in the three colonic epithelial cell lines and in colonic SEMFs (Fig. 7 A).

To define the biological activities of SEMF-derived IL-24 in the inflamed mucosa, we investigated how IL-24 modulates the functions of colonic epithelial cell lines. First, we evaluated the effects of IL-24 on the activation of JAK1/2, STAT 1/3, p42/44 (ERK1/2), p38, and JNK in HT-29 cells. As shown in Fig. 7, IL-24 induced the phosphorylation of JAK-1 and STAT-3 as early as 5 min after stimulation. However, we could not detect any STAT-1 phosphorylation (Fig. 6,B) or JAK-2 activation (data not shown). Thus, JAK1/STAT-3 activation is a major pathway for IL-24 signaling in HT-29 cells. Like JAK1/STAT-3 phosphorylation, IL-24 also induced the phosphorylation of p42/p44, p38 MAPKs, and JNK in HT-29 cells (Fig. 7).

Based on finding of IL-24 receptor expression in our system, we investigated the effects of IL-24 on proliferation of colonic epithelial cell lines. As shown in Fig. 8 A, IL-24 had no effects on [³H]thymidine incorporation in HT-29 cells. Similar results were also observed in Caco-2 and SW480 cells (data not shown).

It has not been reported whether IL-24 can induce SOCS3 in any cell types. As shown in Fig. 8, B and C, in HT-29 cells IL-24 rapidly induced SOCS3 mRNA expression, followed by SOCS3 protein expression. In contrast, we could not detect any mRNA expression of proinflammatory cytokines such as IL-8 and IL-6 (data not shown), although IL-24 has been reported to induce IL-6 and TNF-α in monocytes (5).

Recently, IL-22 has been reported to stimulate mucin synthesis (46). To look for similar functions, we evaluated the effects of IL-24 on mucin gene expression in HT-29 cells. IL-24 (100 ng/ml) induced significant increase in MUC1 (8.1-fold), MUC3 (4.5-fold), and MUC4 (6.8-fold) mRNA expression (Fig. 9,A). These were sufficient effects, but weaker than those induced by IL-22 (Fig. 9,B). To clarify the role of STAT-3 activation, we used STAT-3 specific siRNA. As shown in Fig. 9,C, STAT-3-specific siRNA effectively reduced total and phosphorylated STAT-3 expression in HT-29 cells. Stimulation with IL-24 induced a significant increase in the mRNA expression of MUC1, MUC3, and MUC4 in HT-29 cells (Fig. 9 D), and this increased expression was significantly abolished by STAT-3-specific siRNA. Similar observations were detected in SW480 cells (data not shown).

Recent studies have focused on the functions of IL-24 as an intracellular cytotoxic factor against cancer cells (15, 16, 17). In particular, when IL-24 is administered via an adenoviral vector, it selectively and efficiently kills cancer cells derived from various tissues (14, 16, 17, 47, 48). In contrast, the biological functions as a cytokine still remain unclear. In this report, we demonstrated some novel findings concerning the expression and function of IL-24: 1) IL-24 expression is increased in the inflamed mucosa from IBD patients, and colonic SEMFs are a major local source; 2) Among various cytokines, IL-1β is the sole cytokine that can induce IL-24 mRNA expression in colonic SEMFs. This was mediated by both transcriptional and posttranscriptional mechanisms; 3) IL-24-activated JAK1/STAT-3 signaling pathways and induced SOCS3 expression in colonic epithelial cells; and 4) IL-24 stimulated MUC gene expression via STAT-3 activation.

There are few reports concerning the in vivo expression of IL-24 under normal and pathological conditions. Soo et al. (19) found that IL-24 expression was greatly increased at the edge of cutaneous wounds in an animal model. A recent study by Kunz et al. (12) showed that IL-24 was expressed by keratinocytes from patients with psoriasis. However, there are no reports concerning IL-24 expression in the gut. In the present study, we demonstrated that IL-24 mRNA expression was significantly increased in the inflamed mucosa of patients with IBD. Furthermore, these IL-24-expressing cells coincided with α-SMA immunopositive cells located in the subepithelial regions, suggesting α-SMA immunopositive SEMFs as the local source of IL-24 in the inflamed mucosa of patients with IBD. Because IL-24 expression was not detected in the normal mucosa and infectious/ischemic colitis, a specific role for IL-24 in IBD is suspected.

The molecular mechanisms responsible for IL-24 expression have not fully been identified in any cell types. To investigate the regulatory mechanisms involved in IL-24 expression in the IBD mucosa, we used colonic SEMFs isolated from the normal human colonic mucosa (23). Among the various cytokines, IL-1β exerted remarkable effects on IL-24 induction. IL-17 and LPS weakly stimulated IL-24 expression, but these were negligible as compared with IL-1β. However, IL-1β could not induce IL-24 expression in any colonic epithelial cell lines, and this was compatible with the immunohistochemical observation that IL-24 was not detected in colonic epithelial cells.

Previously, Madireddi et al. (36) demonstrated a role for the transcription factors AP-1 and C/EBP in the basal promoter activity of the il24 gene during melanoma cell differentiation. However, the role of these transcription factors in the cytokine-induced promoter activity of the il24 gene has not been investigated. In the present study, we set out to determine the relevant transcriptional processes in IL-1β-induced IL-24 mRNA expression. From the results of the il24 promoter luciferase assays, IL-1β significantly increased il24 gene promoter activity in SEMFs transfected with the reporter plasmids containing the AP-1 and C/EBP binding sequences. The EMSA demonstrated that IL-1β actually induced AP-1 and C/EBP DNA-binding activity in colonic SEMFs. The supershift assay indicated that the C/EBP DNA-binding activity was mediated by C/EBP-β molecules. Furthermore, the expression of dominant negative c-Jun and the knockdown of C/EBP-β by siRNA significantly reduced the IL-1β-induced IL-24 mRNA expression in SEMFs. Based on these observations, we concluded that the AP-1- and C/EBP-β-mediated transcriptional activation of the il24 gene contributes to an IL-1β-induced up-regulation of IL-24 mRNA expression in colonic SEMFs.

The stabilization of their mRNAs contributes to the strong and rapid induction of genes during the inflammatory response (49). The il24 gene has three AU rich elements in its 3′ untranslated region (36), which is implicated as key determinants in regulating transcript stability (50). The p38 MAPK also plays a role in the induction of mRNA stabilization by inflammatory stimuli (49, 50). In this study, we showed that IL-1β induced a marked increase in IL-24 mRNA stability, indicating that posttranscriptional mechanisms mediated the IL-1β-induced up-regulation of the il24 gene. SB203580 abolished this IL-1β-induced IL-24 mRNA stabilization, suggesting that the p38 MAPK may play a role in IL-1β-induced il24 transcript stabilization.

In vivo expression of IL-24R remains unclear. As shown in Fig. 6, we observed that IL-20R1, IL-22R1, and IL-22R2 are expressed by colonic epithelial cells in vivo, and they were also detected in colonic epithelial cell lines. These suggest that colonic epithelial cells are targets of IL-24 in the mucosa. So, we used human colonic epithelial cell lines (HT-29, Caco-2, and SW480) to elucidate the biological activity of IL-24. IL-24 induced a rapid activation of JAK-1 and STAT-3 molecules, and induced SOCS3 expression in these cell lines, although IL-24 did not modulate proliferation of these cells. To our knowledge, this is the first study reporting that IL-24 activates the JAK1/STAT-3/SOCS3 cascade. SOCS3 is a negative feedback modulator of STAT-3 activation by inhibiting JAK downstream of the cytokine signal (51). Thus, the biological activity of IL-24 may be controlled by a SOCS3-mediated negative feedback mechanism in these cells. Furthermore, it has been reported that the STAT-3-mediated activation of the innate immune response contributes to a suppression of colitis (52, 53, 54), whereas the STAT-3-mediated activation of the acquired immune response plays a pathogenic role in colitis by enhancing the survival of pathogenic T cells (2, 52, 53, 54, 55, 56). IL-24 specifically targets innate immune pathways (8), and epithelial cells are major expression sites for IL-24 receptors (IL-22R1, IL-20R1, and IL-20R2) in human colonic mucosa. These suggest that the IL-24-induced selective activation of STAT-3 in colonic epithelial cells, but not in acquired immune cells, may contribute to the suppression of mucosal inflammation.

Recently, Sugimoto and Mizoguchi et al. (46) showed that IL-22 contributes to the improvement of colitis-associated mucus layer destruction by enhancing the production of membrane-bound mucins, such as MUC-1 and MUC3. Membrane-bound mucins form a static external barrier at the epithelial surface (46, 57), and play a role in a reduction of colitis (58, 59, 60, 61). In the present study, we found that IL-24 can stimulate the expression of membrane-bound MUC genes (MUC-1 (8.1-fold increase), MUC-3 (4.5-fold), and MUC-4 (6.8-fold)) through the STAT-3 pathway in intestinal epithelial cells. These were sufficient effects, but weaker than those induced by IL-22. In contrast to a marked protective role of IL-22 in epithelial-barrier function (46, 62), several studies showed proinflammatory properties for IL-22 (40, 62, 63). For example, IL-22 (100 ng/ml) induced TNF-α and IL-8 mRNA expression in colonic epithelial HT-29 cells (62). There are paradoxical reports regarding the role of IL-22 in IBD mucosa (64). However, in our preliminary study IL-24 did not induce such proinflammatory responses in HT-29 cells (data not shown). Lack of evidence for proinflammatory properties of IL-24 suggests that IL-24 mainly play a protective role in the pathophysiology of IBD via a stimulation of STAT-3 activation in cells mediating the innate immune response (54).

In conclusion, we demonstrated that IL-24 expression is enhanced in the inflamed mucosa of active IBD patients. Our data suggest that IL-24 targets epithelial cells and plays anti-inflammatory and protective roles in intestinal mucosa. Recently, a replication-incompetent adenovirus expressing IL-24 has undergone evaluation in a phase I clinical trial for solid tumors, and has demonstrated safety (65). So, based on further characterization of biological activities of IL-24, this cytokine has the potential of clinical application to regulate the inflammatory pathways in IBD.

The authors have no financial conflict of interest.