Abstract
B and T lymphocyte attenuator (BTLA)-herpesvirus entry mediator (HVEM) signaling coinhibitory pathway is believed to impair antitumor immune competences. An intriguing unresolved question is whether blockade of BTLA-HVEM guides an effective therapeutic tool against established tumors. To address this issue, we constructed a eukaryotic expression plasmid (psBTLA) that expressed the extracellular domain of murine BTLA (soluble form of BTLA), which could bind HVEM, the ligand of BTLA, and block BTLA-HVEM interactions. The data in this study showed that treatment by injection of psBTLA resulted in down-regulation of IL-10 and TGF-β and promotion of dendritic cell function by increasing the expression of B7-1 and IL-12, but the adaptive antitumor immune responses achieved by psBTLA administration alone were limited and could not eradicate the tumor effectively. Next, we evaluated the immunotherapeutic efficacy and mechanism of combination therapy of heat shock protein 70 (HSP70) vaccine/psBTLA by using murine TC-1 cervical cancer mice as an ectopic tumor model. Our in vivo studies revealed that treatment with HSP70 vaccine alone did not lead to satisfactory tumor growth inhibition, whereas cotreatment with psBTLA significantly improved antitumor immunity and compensated the deficiency of HSP70 vaccine by increasing the expression of Th1 cytokines, IL-2, and IFN-γ and decreasing transcription levels of IL-10, TGF-β, and Foxp3 in the tumor microenvironment. Taken together, our findings indicate that blocking the BTLA-HVEM interaction with sBTLA enhances antitumor efficacy and results in a significant synergistic effect against existent tumor cells in vivo when combined with the HSP70 vaccine.
T cells encounter Ag and receive secondary signals from APCs. These secondary signals can be positive or negative. B and T lymphocyte attenuator (BTLA)4 is an inhibitory receptor that belongs to the CD28 superfamily (1, 2). BTLA is constitutively expressed by naive CD4+ and CD8+ T cells and is further up-regulated upon T cell activation. BTLA is also expressed on B cells, macrophages, NK cells, and bone marrow-derived dendritic cells (DC) (3, 4). Recently, the ligand for BTLA herpesvirus entry mediator (HVEM) has been identified as a member of the TNFR superfamily (5). HVEM is predominantly expressed by resting T cells, monocytes, and immature DC, as well as by endothelial cells (2, 5, 6). In T cells, coligation of BTLA with Ag receptors results in down-regulation of anti-CD3 mAb-induced secretion of IL-2 (7). BTLA is highly induced in anergic CD4+ T cells, indicating that it may have a role in maintaining T cell anergy. In accordance with the role of BTLA as an inhibitory receptor, mice lacking the full-length form of BTLA are hyperresponsive to TCR-mediated T cell activation (1).
Manipulation of T cell coinhibitory pathways can modify Ag-specific responses. For example, the use of a coinhibitory receptor antagonist, such as an Ab or extracellular domain targeting distinct T cell coinhibitory molecules, can provide a way to trigger an effective antitumor immune response. A recent study demonstrated that blocking BTLA-HVEM interactions using HSV glycoprotein D, which binds its N-terminal domain to the BTLA binding site of HVEM, augments the immunogenicity of vaccines (8). Although it seems evident that both BTLA and HVEM are involved in immune regulation, several questions remain unanswered regarding BTLA-HVEM connection and antitumor immune response. For instance, it is not known whether blockade of BTLA-HVEM interactions contributes to the inhibition of pre-existent tumor cells.
Heat shock proteins (HSPs) are highly conserved proteins found among prokaryotes and eukaryotes. The most important function of HSPs is as molecular chaperones, assisting in the correct folding of proteins synthesized de novo or which have been denatured by stress, such as heat shock (9). HSP70 has been used as an attractive molecular adjuvant to enhance adaptive immune T cell responses induced by DNA and fusion protein vaccines (10, 11). However, few studies have investigated the immunotherapeutic effects of using the HSP70 vaccine in conjunction with the manipulation of costimulatory molecules against established tumors.
In the present study, we sought to analyze whether the BTLA-HVEM coinhibitory pathway has a functional role in antitumor immune responses, and whether blockade of this pathway with the soluble form of BTLA (sBTLA) can be an effective therapeutic tool to improve immunotherapy against existent tumor cells. In addition, we tried to analyze the synergistic effect of the HSP70 vaccine in combination with sBTLA and to evaluate its effect in inducing memory cells upon rechallenge with tumor cells.
Materials and Methods
Animals and cell lines
Six- to 8-wk-old female C57BL/6 mice were purchased from the Center for Experimental Animals of the Chinese Academy of Medical Science. The animals were maintained in our facilities under pathogen-free conditions. All studies involving mice were approved by the Huazhong University of Science and Technology Animal Care and Use Committee. Chinese hamster ovary (CHO), murine TC-1, and murine melanoma B16F1 cell lines were purchased from the China Center for Type Culture Collection.
Construction of expression plasmid vectors sBTLA plasmid (psBTLA), soluble CD160 plasmid (psCD160)-GFP, and psBTLA-mutant
Eukaryotic expression vectors for psBTLA or psCD160-GFP carrying cDNA encoding the extracellular domain of murine BTLA (sBTLA) or CD160 (soluble CD160 (sCD160)-GFP) were constructed. The sequences for the primers used are described in Table I. Fragments obtained from splenocytes of C57BL/6 mice amplified by RT-PCR were digested with the restriction enzymes HindIII and XbaI (for sBTLA) or HindIII and EcoRI (for sCD160-GFP), inserted into compatible enzyme restriction sites of pcDNA3.1 or pEGFP-N1 (Invitrogen), and preserved in our laboratory. Then, sBTLA amino acid residue 15 leucine was mutated to histidine to decrease its affinity (12) using the QuikChange site-directed mutagenesis kit (Stratagene), according to the manufacturer. Briefly, the mutagenic oligonucleotide primers (Table I) were designed to mutate amino acid residue 15 of sBTLA in the entire psBTLA vector. The reaction products were treated with DpnI and then used to transform Escherichia coli DH5a cells. The sBTLA mutant sequence was confirmed by sequencing the entire gene.
Primers for construction and detection of sBTLA and sCD160-GFP, and for real-time quantitative PCRa
Gene Name . | Primers . |
---|---|
sBTLA (construction) | (+)GTGACAAGCTTTGGGAATGAAGACAGTGCC |
(−)GGTGGTCTAGAATTAGGCATTGGTGGCATCTG | |
sBTLA (detection) | (+)GGAGCATCCTTTGTGAGA |
(−)GAACAGCTATACGACCCATT | |
sBTLA (mutant) | (+)TGAAGAGTGTCCAGTGCAACATACTATTACGAGGAATTC |
(−)AATTCCTCGTAATAGTATGTTGCACTGGACACTCTTC | |
sCD160-GFP (construction) | (+)TGAAGCTTTCAACATTTCCGTGAAATTCCTGGG |
(−)TGGAATTCTCTTACCTGTGCTGAAGTCAGGGTGTGACCTTT | |
HVEM | (+)AACTTGCTGCAGCGCATCTC |
(−)TGCTCACTGCAGACCTGCTTC | |
BTLA | (+)GCCATTCAGTAACCATCCATGTG |
(−)GCAAGGTGTAAAGCAGCCAAGTC | |
IL-2 | (+)GGAGCAGCTGTTGATGGACCTAC |
(−)AATCCAGAACATGCCGCAGAG | |
IFN-γ | (+)CGGCACAGTCATTGAAAGCCTA |
(−)GTTGCTGATGGCCTGATTGTC | |
IL-10 | (+)GACCAGCTGGACAACATACTGCTAA |
(−)GATAAGGCTTGGCAACCCAAGTAA | |
TGF-β1 | (+)TTCCGCTGCTACTGCAAGTCA |
(−)GGGTAGCGATCGAGTGTCCA | |
foxp3 | (+)TGCCACCTGGGATCAATGT |
(−)CCAGCAGTGGGTAGGATCCTT | |
β-actin | (+)TTCCAGCCTTCCTTCTTGGGTAT |
(−)GTTGGCATAGAGGTCTTTACGG |
Gene Name . | Primers . |
---|---|
sBTLA (construction) | (+)GTGACAAGCTTTGGGAATGAAGACAGTGCC |
(−)GGTGGTCTAGAATTAGGCATTGGTGGCATCTG | |
sBTLA (detection) | (+)GGAGCATCCTTTGTGAGA |
(−)GAACAGCTATACGACCCATT | |
sBTLA (mutant) | (+)TGAAGAGTGTCCAGTGCAACATACTATTACGAGGAATTC |
(−)AATTCCTCGTAATAGTATGTTGCACTGGACACTCTTC | |
sCD160-GFP (construction) | (+)TGAAGCTTTCAACATTTCCGTGAAATTCCTGGG |
(−)TGGAATTCTCTTACCTGTGCTGAAGTCAGGGTGTGACCTTT | |
HVEM | (+)AACTTGCTGCAGCGCATCTC |
(−)TGCTCACTGCAGACCTGCTTC | |
BTLA | (+)GCCATTCAGTAACCATCCATGTG |
(−)GCAAGGTGTAAAGCAGCCAAGTC | |
IL-2 | (+)GGAGCAGCTGTTGATGGACCTAC |
(−)AATCCAGAACATGCCGCAGAG | |
IFN-γ | (+)CGGCACAGTCATTGAAAGCCTA |
(−)GTTGCTGATGGCCTGATTGTC | |
IL-10 | (+)GACCAGCTGGACAACATACTGCTAA |
(−)GATAAGGCTTGGCAACCCAAGTAA | |
TGF-β1 | (+)TTCCGCTGCTACTGCAAGTCA |
(−)GGGTAGCGATCGAGTGTCCA | |
foxp3 | (+)TGCCACCTGGGATCAATGT |
(−)CCAGCAGTGGGTAGGATCCTT | |
β-actin | (+)TTCCAGCCTTCCTTCTTGGGTAT |
(−)GTTGGCATAGAGGTCTTTACGG |
+, Forward primers; −, reverse primers.
Preparation of Ag-loaded DC
Bone marrow-derived DC was prepared, as previously described (13). Briefly, bone marrow cells were flushed from the femurs and tibias of mice under aseptic conditions, depleted of RBC, and then cultured at a concentration of 1 × 106 cells/ml in complete RPMI 1640 medium supplemented with 10 ng/ml GM-CSF and 10 ng/ml IL-4. On day 6, nonadherent and loosely adherent cells were harvested and separated by 14.5% metrizamide complete medium gradients. DC was collected by gentle pipette aspiration and washed twice with complete RPMI 1640 medium. The cells were then cultured in supernatants of CHO cells transfected with psBTLA (10 μg/ml), pcDNA3.1, or untransfected in the presence of 0.75 μg/ml HSP70-TC-1 peptide complex. After 18 h, Ag-loaded DC was harvested, irradiated (3000 rad), and resuspended in HBSS for additional experiments. TC-1 peptide and HSP70, at 75 and 250 μg/ml, respectively, were mixed and incubated for 2 h at 37°C in the presence of 1 mM ADP and 1 mM MgCl2 to promote binding (14).
Gene transfection in vitro and in vivo
Plasmid DNA used for gene therapy was prepared by the alkaline lysis method and purified with polyethylene glycol, followed by selective compaction with spermine (Sigma-Aldrich). LPS concentration in the plasmid DNA preparation, as determined by the Limulus amebocyte lysate assay, was of <1.5 endotoxin U/μg. All plasmid preparations for i.m. injections were resuspended in sterile 0.9% saline. Spectrophotometric analysis revealed 260/280 nm ratios >1.80. CHO cells were transfected with psBTLA plasmid using the Dosper liposomal transfection reagent, according to the manufacturer’s protocol (Boehringer Mannheim). The transfected cells were cultured in complete medium containing 1 mg/ml G418 to select the stably transfected clones. Supernatants from psBTLA-transfected cells were collected for additional experiments. In vivo transfection was done by direct injection of naked plasmid (100 μg in 100 μl of saline) into the muscle (i.m.) at the inoculation site every 3 days.
Conventional RT-PCR and real-time PCR
Total RNAs were isolated from cells or muscle tissues of normal mice or from tumor marginal tissues of tumor-bearing mice using TRIzol reagent (Invitrogen), according to the manufacturer’s instructions. RT-PCR was used to determine the relative quantities of mRNA in each tissue (OneStep RT-PCR kit; Qiagen). Twenty-eight PCR cycles were used for all of the analyses, and β-actin mRNA levels were used as the internal control. The sequences for the primers used for detecting the expression of various genes are described in Table I. mRNA expression levels were normalized to β-actin mRNA levels and are expressed as the n-fold difference relative to the control (calibrator).
Isolation of tumor-infiltrating cells
Tumor-infiltrating cells from tumor tissues were isolated, as described (14). Briefly, the tissues were minced and digested in PBS containing 0.1% collagenase (Sigma-Aldrich), 0.01% hyaluronidase (Sigma-Aldrich), and 0.002% DNase I (Promega) for 90 min at 37°C. The tissue debris that was not digested was allowed to settle. The cells released were then filtered through stainless steel mesh screens and washed three times with RPMI 1640 containing 5% FCS. Cells were separated on a Percoll (Pharmacia Biotech) density gradient by centrifugation for 30 min at 1500 × g at room temperature. The dense layer containing enriched lymphocytes was collected and washed for additional experiments.
Flow cytometry analysis
Splenocytes or HSP70-TC-1 peptide complex-stimulated DC, prepared as previously described, were washed with PBS and incubated with supernatants of CHO cells transfected with psBTLA and pcDNA3.1, or untransfected. After incubation for 1 h at 37°C, splenocytes were incubated with PE-labeled anti-mouse HVEM, whereas DC was cultured for 72 h and then incubated with PE-labeled anti-mouse B7-1. In some experiments, bone marrow-derived DC was stimulated with HSP70-TC-1 peptide complex (14) for 1, 3, or 5 days, and at different time points; the cells were harvested and incubated with PE-labeled anti-mouse BTLA or PE-labeled anti-mouse HVEM (eBioscience) for 1 h at 37°C. After washing with PBS, the cells were used for flow cytometric analysis. Cells were acquired on a flow cytometry FACSCalibur flow cytometer (BD Biosciences) and analyzed with CellQuest software (BD Biosciences).
Proliferation assay
Mouse splenocytes were cultured in 96-well culture plates in supernatants of CHO cells transfected with psBTLA and pcDNA3.1, or untransfected and stimulated by the addition of HSP70-TC-1 peptide complexes (14, 15) or DC pretreated with HSP70-TC-1 peptide complexes for 72 h (13). To analyze T cell proliferation, 1.0 μCi of [3H]thymidine was added during the last 10 h of culture. The incorporation of [3H]thymidine was measured with a MicroBeta TriLux liquid scintillation counter (Wallac).
ELISA
Mouse splenocytes or DC were stimulated with HSP70-TC-1 peptide complexes, as described for the proliferation assay. Splenocytes were then passaged and cultured for another 48 h. The levels of IFN-γ and IL-2 in the supernatants were measured by ELISA using murine IFN-γ or IL-2 ELISA kits. The level of IL-12 in the supernatants of DC was measured with an IL-12 ELISA kit (eBioscience), according to the manufacturer’s protocol.
Cytotoxicity assay
Splenocytes were stimulated with HSP70-TC-1 peptide complexes with the supernatants of CHO cells transfected with psBTLA and pcDNA3.1, or untransfected, as described above, and cultured for 7 days in the presence of 20 U/ml IL-2. Then the cells were used as effector cells for a cytotoxicity assay. In other experiments, splenocytes from tumor-bearing mice were individually stimulated with HSP70-TC-1 peptide complexes in vitro for 3 days and subsequently used as effector cells. A flow cytometry-based method (16) was used to analyze cytotoxicity. Briefly, CFSE-labeled TC-1 and B16F1 target cells were incubated with effector cells at different E:T ratios at 37°C for 4 h. After staining with 7-aminoactinomycin D to label dead or dying cells, cytotoxicity was evaluated by flow cytometry. Cytolysis was determined by 7-aminoactinomycin D+CFSE+ cells/total CFSE+ cells.
Animal treatment protocol
C57BL/6 mice were inoculated with TC-1 cells by injecting 1 × 105 cells into the right hind thigh muscle. From 2 days after inoculation, mice from treatment groups received 100 μg of plasmid DNA by i.m. injection into the right hind thigh (local naked DNA transfection), and the plasmid DNA transfection was repeated at indicated times, according to different experiments. Mice in the control groups received an equal volume of saline or an equal amount of pcDNA3.1 plasmid. In some experiments, HSP70-TC-1 peptide complexes (14) were used as a tumor vaccine. Mice were sacrificed, and tumors were dissected and weighed on days 14 and 28 after inoculation. Tumor incidence and survival of mice were recorded.
Histology and immunohistochemistry
Muscle tissues from inoculation sites were surgically excised, fixed for 12–24 h in 4% formalin, embedded in paraffin, and sectioned for H&E staining and immunohistochemistry. Anti-mouse CD8 mAb was purchased from Abcam.
Statistics
Results are expressed as the mean ± SD and are analyzed by an ANOVA test of repeated measures and the Kaplan-Meier test. Differences were considered to be statistically significant when p < 0.05 (∗, p < 0.05; ∗∗, p < 0.01).
Results
The evaluation of BTLA and HVEM expression and immunoregulatory effects of sBTLA
To determine BTLA and HVEM expression in tumor-bearing mice, BTLA and HVEM mRNA levels were evaluated in spleens and tumor marginal tissues at consistent time after tumor inoculation. As shown in Fig. 1 A, both BTLA and HVEM expression levels gradually increased in spleens and tumor marginal tissues after i.m. inoculation. Our flow cytometry assay verified that no expression of BTLA and HVEM was detected in the cultured TC-1 cell (supplemental Fig. 1A).5 To identify the source of BTLA and HVEM, tumor-infiltrating lymphocytes (TILs) from tumor tissue were analyzed by flow cytometry. Most of the TILs expressed BTLA and HVEM on day 3 after inoculation, and the expression levels of BTLA and HVEM increased doubly on day 14 (supplemental Fig. 1B).
The immunoregulatory effects of sBTLA. A, Evaluation of BTLA and HVEM expression in tumor-bearing mice. C57BL/6 mice were inoculated with 1 × 105 TC-1 cells in the right hind legs. Total RNA was isolated from the spleens and tumor marginal tissues of three mice on days 3, 7, 14, 21, and 28 after tumor inoculation. Transcription levels of BTLA and HVEM genes were analyzed by real-time PCR. B, Expression of sBTLA in CHO cells after transfection with psBTLA. The expression of sBTLA mRNA was determined by RT-PCR, and protein secreted in CHO culture supernatant was detected by Western blot 72 h after transfection. C, Analysis of the binding of sBTLA to HVEM on splenocytes by flow cytometry. Splenocytes were incubated with supernatants of CHO, CHO/pcDNA3.1, or CHO/psBTLA and stained with anti-HVEM-PE, anti-CD3-FITC (gray histograms), or isotype control (open histograms) mAb. D, Augmentation of splenocyte activity by CHO-expressed sBTLA. Splenocytes from three naive mice were stimulated separately with HSP70 vaccine (activated) alone or in conjunction with the supernatants of CHO/psBTLA and CHO/pcDNA3.1. Cell proliferation was determined by [3H]thymidine incorporation. E, IL-2 and IFN-γ in the supernatants were detected by ELISA. F, Cytotoxicity of splenocytes against TC-1 cells. Splenocytes from three naive mice were activated individually in vitro with HSP70 vaccine in the presence or absence of CHO-expressed sBTLA, and then incubated in triplicate with either TC-1 cells or melanoma B16F1 cells. Control lymphocytes were cultured in the absence of HSP70 vaccine and CHO-expressed sBTLA before incubation with target cells. Data are representative of two independent experiments.
The immunoregulatory effects of sBTLA. A, Evaluation of BTLA and HVEM expression in tumor-bearing mice. C57BL/6 mice were inoculated with 1 × 105 TC-1 cells in the right hind legs. Total RNA was isolated from the spleens and tumor marginal tissues of three mice on days 3, 7, 14, 21, and 28 after tumor inoculation. Transcription levels of BTLA and HVEM genes were analyzed by real-time PCR. B, Expression of sBTLA in CHO cells after transfection with psBTLA. The expression of sBTLA mRNA was determined by RT-PCR, and protein secreted in CHO culture supernatant was detected by Western blot 72 h after transfection. C, Analysis of the binding of sBTLA to HVEM on splenocytes by flow cytometry. Splenocytes were incubated with supernatants of CHO, CHO/pcDNA3.1, or CHO/psBTLA and stained with anti-HVEM-PE, anti-CD3-FITC (gray histograms), or isotype control (open histograms) mAb. D, Augmentation of splenocyte activity by CHO-expressed sBTLA. Splenocytes from three naive mice were stimulated separately with HSP70 vaccine (activated) alone or in conjunction with the supernatants of CHO/psBTLA and CHO/pcDNA3.1. Cell proliferation was determined by [3H]thymidine incorporation. E, IL-2 and IFN-γ in the supernatants were detected by ELISA. F, Cytotoxicity of splenocytes against TC-1 cells. Splenocytes from three naive mice were activated individually in vitro with HSP70 vaccine in the presence or absence of CHO-expressed sBTLA, and then incubated in triplicate with either TC-1 cells or melanoma B16F1 cells. Control lymphocytes were cultured in the absence of HSP70 vaccine and CHO-expressed sBTLA before incubation with target cells. Data are representative of two independent experiments.
A competitive blocking experiment was set up by constructing a sBTLA-expressing vector (psBTLA) as a strategy to block the BTLA-HVEM pathway. CHO cells were transfected with psBTLA and RT-PCR, and Western blot showed the stable expression levels of sBTLA in CHO cells and culture supernatant (Fig. 1,B). Naive mouse splenocytes pretreated with supernatants of psBTLA-transfected, pcDNA3.1-transfected, or untransfected CHO cells were incubated with anti-HVEM-PE or anti-CD3-FITC Abs. Flow cytometry analysis revealed a noticeable decreased conjugation of HVEM with specific Ab in splenocytes pretreated with supernatants of psBTLA-transfected CHO cells compared with other two groups treated with control supernatant. However, there was no obvious change of CD3 conjugation with its specific Ab in all three groups (Fig. 1,C). These findings demonstrate that sBTLA protein from supernatants of psBTLA-transfected CHO cells (CHO-secreted sBTLA) can competitively bind to HVEM, the BTLA’s ligand, on splenocytes, and should block BTLA-HVEM pathway. Based on these findings, we further measured the cellular proliferation and IL-2 and IFN-γ production in mouse splenocytes stimulated with HSP70-TC-1 peptide complexes in the presence or absence of CHO-expressed sBTLA, and showed that cellular proliferation (Fig. 1,D) and IL-2 and IFN-γ production (Fig. 1,E) were significantly (p < 0.05) increased in the presence of sBTLA. Moreover, CHO-expressed sBTLA enhanced the specific cytotoxicity of activated lymphocytes against TC-1 tumor cells, but not melanoma B16 cells (Fig. 1 F). These results indicate that blocking the BTLA signal with sBTLA can enhance antitumor immune response in vitro.
psBTLA transfection promotes antitumor immune response in vivo
To test the antitumor efficacy of sBTLA in vivo, psBTLA was injected into muscles of naive mice or into tumor of tumor-bearing mice. Local psBTLA treatment led to the sBTLA expression (Fig. 2,A) and tumor growth inhibition (Fig. 2,B). The transcription levels of the BTLA and HVEM genes were determined by RT-PCR and real-time PCR, and presented the phenomenon of BTLA up-regulation and HVEM down-regulation in tumor tissues when treated with psBTLA (Fig. 2,C). Furthermore, the expression levels of cytokines, including IL-2, IFN-γ, IL-10, and TGF-β, were analyzed in the tumor microenvironment. As shown in Fig. 2,C, psBTLA treatment brought on increased levels of IL-2 and IFN-γ and decreased levels of IL-10 and TGF-β. H&E staining showed the more crowded TILs in psBTLA treatment group compared with saline- or psDNA3.1-treated groups (Fig. 2 D). These findings demonstrate a requirement for BTLA-HVEM coinhibitory pathway in the progression of tumor growth, and suggest that blocking BTLA-HVEM interactions promotes antitumor immune responses in vivo.
Antitumor effects of sBTLA by local gene transfection. A, Expression of sBTLA in muscle tissue after psBTLA local gene transfection. Naked plasmid DNA was injected into mice i.m. (n = 3 per group), and mRNA and protein levels were determined by RT-PCR and Western blot, respectively, 72 h after transfection. B, Inhibitory effects of in vivo transfection of psBTLA on tumor growth. Mice (n = 5 per group at each time point) were inoculated with TC-1 cells and treated with psBTLA (four times for 14 days and eight times for 28 days), as described in Materials and Methods. C, Effects of sBTLA on immune effects in local tumor tissues. Mice were inoculated with TC-1 cells and treated with saline, pcDNA3.1, or psBTLA. On days 14 and 28 after tumor inoculation, total RNA was isolated from tumor marginal tissues of three mice in each group at each time point, and the transcription levels of BTLA, HVEM, IL-2, IFN-γ, IL-10, and TGF-β were analyzed by RT-PCR and real-time PCR. D, Microscopic findings of TILs with different treatments. Tumor tissues on day 14 after tumor inoculation were sliced and stained with H&E staining. Images are representative of multiple microscopic fields observed (×200) in three mice per group. Data are representative of two independent experiments.
Antitumor effects of sBTLA by local gene transfection. A, Expression of sBTLA in muscle tissue after psBTLA local gene transfection. Naked plasmid DNA was injected into mice i.m. (n = 3 per group), and mRNA and protein levels were determined by RT-PCR and Western blot, respectively, 72 h after transfection. B, Inhibitory effects of in vivo transfection of psBTLA on tumor growth. Mice (n = 5 per group at each time point) were inoculated with TC-1 cells and treated with psBTLA (four times for 14 days and eight times for 28 days), as described in Materials and Methods. C, Effects of sBTLA on immune effects in local tumor tissues. Mice were inoculated with TC-1 cells and treated with saline, pcDNA3.1, or psBTLA. On days 14 and 28 after tumor inoculation, total RNA was isolated from tumor marginal tissues of three mice in each group at each time point, and the transcription levels of BTLA, HVEM, IL-2, IFN-γ, IL-10, and TGF-β were analyzed by RT-PCR and real-time PCR. D, Microscopic findings of TILs with different treatments. Tumor tissues on day 14 after tumor inoculation were sliced and stained with H&E staining. Images are representative of multiple microscopic fields observed (×200) in three mice per group. Data are representative of two independent experiments.
Blocking BTLA-HVEM interactions enhances DC function
The BTLA-HVEM pathway is an inhibitory checkpoint for DC homeostasis (17), and BTLA expression levels increase on DC when they mature upon Ag stimulation (18). We hypothesized that interruption of BTLA-HVEM interactions by sBTLA would benefit DC function, which may explain the mode of action for the antitumor effects of sBTLA. To test this, we first analyzed BTLA and HVEM expression levels on DC after HSP70 vaccine stimulation. As shown in Fig. 3,A, both BTLA and HVEM expression levels were increased after HSP70 vaccine stimulation. When DC were stimulated with HSP70 vaccine together with sBTLA-containing supernatants, expression of both B7-1 and cytokines, such as IL-12, was increased when compared with controls (Fig. 3, B and C). Likewise, splenocyte proliferation and IL-2 and IFN-γ production increased when splenocytes were cultured with DC pretreated with HSP70 vaccine and sBTLA-containing supernatants (Fig. 3, D and E). Moreover, we further evaluated the phenotype of DC from tumor-draining lymph nodes. As shown in Fig. 3,F, BTLA and HVEM expression gradually increased on DC after HSP70 vaccine stimulation. When combined with psBTLA treatment, B7-1 expression on DC was further up-regulated obviously compared with treatment with HSP70 vaccine alone (Fig. 3 G).
sBTLA regulates DC function. A, Analysis of BTLA and HVEM expression on DC after Ag stimulation. BTLA and HVEM expression on DC were analyzed by flow cytometry at days 1, 3, and 5 after stimulation with HSP70 vaccine. The expression levels of B7-1 (B) and IL-12 (C) in DC. After HSP70 vaccine stimulation, DC were cultured in the presence of the supernatants of CHO/psBTLA, CHO/pcDNA3.1, or untransfected CHO cells for 3 days. B7-1 and IL-12 in the supernatants were analyzed by flow cytometry and ELISA separately. The expression levels of IL-2, IFN-γ (D), and cell proliferation (E) in splenocytes. Splenocytes from three naive mice were stimulated with DC that were pretreated, as previously described. IL-2 and IFN-γ in the supernatants were detected by ELISA. Cell proliferation was determined by [3H]thymidine incorporation. F and G, Analysis of DC phenotype in vivo. C57BL/6 mice were inoculated with TC-1 cells and treated with HSP70 vaccine. DC were collected from inguinal lymph nodes at 1, 4, and 7 days posttreatment and were stained with anti-CD11c-FITC and anti-BTLA-PE, anti-HVEM-PE (gray histograms), or isotype control (white histograms) mAb. CD11c+ DC were gated for flow cytometry analysis (F). B7-1 expression (G) was analyzed on inguinal lymph node DC from mice that received the treatment with pcDNA3.1, HSP70 vaccine, or HSP70 vaccine plus psBTLA at 7 days posttreatment.
sBTLA regulates DC function. A, Analysis of BTLA and HVEM expression on DC after Ag stimulation. BTLA and HVEM expression on DC were analyzed by flow cytometry at days 1, 3, and 5 after stimulation with HSP70 vaccine. The expression levels of B7-1 (B) and IL-12 (C) in DC. After HSP70 vaccine stimulation, DC were cultured in the presence of the supernatants of CHO/psBTLA, CHO/pcDNA3.1, or untransfected CHO cells for 3 days. B7-1 and IL-12 in the supernatants were analyzed by flow cytometry and ELISA separately. The expression levels of IL-2, IFN-γ (D), and cell proliferation (E) in splenocytes. Splenocytes from three naive mice were stimulated with DC that were pretreated, as previously described. IL-2 and IFN-γ in the supernatants were detected by ELISA. Cell proliferation was determined by [3H]thymidine incorporation. F and G, Analysis of DC phenotype in vivo. C57BL/6 mice were inoculated with TC-1 cells and treated with HSP70 vaccine. DC were collected from inguinal lymph nodes at 1, 4, and 7 days posttreatment and were stained with anti-CD11c-FITC and anti-BTLA-PE, anti-HVEM-PE (gray histograms), or isotype control (white histograms) mAb. CD11c+ DC were gated for flow cytometry analysis (F). B7-1 expression (G) was analyzed on inguinal lymph node DC from mice that received the treatment with pcDNA3.1, HSP70 vaccine, or HSP70 vaccine plus psBTLA at 7 days posttreatment.
Administration of sBTLA enhances the antitumor immune response of HSP70 vaccine
Because DC function can be improved by blocking BTLA-HVEM interactions in vitro, we hypothesized that combining sBTLA treatment with the HSP70 vaccine would result in a stronger antitumor immune response against pre-existent tumor cells. To test this, tumor-bearing mice were treated with HSP70-TC-1 peptide complexes plus psBTLA, as previously mentioned. As shown in Fig. 4,A, both BTLA and HVEM transcription was decreased compared with HSP70 vaccine-alone group. In addition, IL-2 and IFN-γ gene expression were further increased with the combination treatment (Fig. 4,B), whereas transcription of the IL-10, TGF-β, and Foxp3 genes, which displayed increased transcription with HSP70 vaccine treatment alone, was decreased (Fig. 4,C). Next, the major question we address is whether this biased antitumor immune response could generate stronger cytotoxicity against tumor cells. Cell cytotoxicity assay showed an enhanced cytotoxicity against TC-1 tumor cells in activated lymphocytes treated with the sBTLA/HSP70 vaccine combination, but not melanoma B16 cells, compared with individual treatment-alone groups (Fig. 4,D). Immunohistochemistry analysis revealed individual treatment with either HSP70 vaccine or sBTLA moderately increased the amount of CD8+ TILs in the tumor marginal tissue. HSP70 vaccine treatment combined with sBTLA further enhanced the infiltrating amount of CD8+ TILs (Fig. 5). These results indicate that the combination of sBTLA and HSP70 vaccine administration promotes antitumor immunity in tumor microenvironment, resulting in a strong antitumor immune response in vivo.
sBTLA enhances the antitumor immune response of the HSP70 vaccine. Mice were inoculated with TC-1 cells and treated with pcDNA3.1, psBTLA, HSP70 vaccine, HSP70 vaccine/pcDNA3.1, and HSP70 vaccine/psBTLA. A–C, Expression of BTLA, HVEM, IL-2, IFN-γ, IL-10, TGF-β, and FoxP3 within the tumor microenvironment on days 14 and 28 after tumor inoculation. The transcription levels were analyzed by real-time PCR. D, Cytotoxicity of splenocytes against TC-1 cells. On day 14 after tumor inoculation, splenocytes were isolated from tumor-bearing mice for cytotoxicity assays with either TC-1 or B16F1 cells as target cells. The pcDNA3.1-treated group was used as control. Data are representative of two independent experiments.
sBTLA enhances the antitumor immune response of the HSP70 vaccine. Mice were inoculated with TC-1 cells and treated with pcDNA3.1, psBTLA, HSP70 vaccine, HSP70 vaccine/pcDNA3.1, and HSP70 vaccine/psBTLA. A–C, Expression of BTLA, HVEM, IL-2, IFN-γ, IL-10, TGF-β, and FoxP3 within the tumor microenvironment on days 14 and 28 after tumor inoculation. The transcription levels were analyzed by real-time PCR. D, Cytotoxicity of splenocytes against TC-1 cells. On day 14 after tumor inoculation, splenocytes were isolated from tumor-bearing mice for cytotoxicity assays with either TC-1 or B16F1 cells as target cells. The pcDNA3.1-treated group was used as control. Data are representative of two independent experiments.
HSP70 vaccine combined with sBTLA increases infiltration of CD8+ T cells in tumor tissue. The tissues were removed from tumor marginal area at day 28 in different treatment groups (n = 5 per group) and stained with anti-mouse CD8 mAb. The number of CD8+ T cells was counted from five high-power fields (×200) in three mice per group.
HSP70 vaccine combined with sBTLA increases infiltration of CD8+ T cells in tumor tissue. The tissues were removed from tumor marginal area at day 28 in different treatment groups (n = 5 per group) and stained with anti-mouse CD8 mAb. The number of CD8+ T cells was counted from five high-power fields (×200) in three mice per group.
Combination therapy generates powerful antitumor effects in vivo
Data we presented above indicated combination therapy of HSP70 vaccine/sBTLA promotes antitumor immune response. Tumor growth inhibition experiments were set up to confirm our hypothesis directly. As shown in Fig. 6 A, HSP70 vaccine/sBTLA combination therapy led to a remarkable synergistic suppression of tumor growth; the tumor average weight in this group was much lower than that in HSP70 vaccine- or sBTLA treatment-alone group (p < 0.05) and pcDNA3.1 treatment group (p < 0.01). In meantime, treatment with HSP70 protein without peptide or with B16 peptide, an unrelated tumor cell line, showed no suppression on TC-1 tumor growth. To further support the phenomenon of specific binding of sBTLA, a sBTLA mutant, a histidine residue replaced leucine at 15-aa residue, was constructed (12) and showed a disabled binding to HVEM and no synergistic antitumor effects when combined with HSP70 vaccine (supplemental Fig. C).
The antitumor effects of the HSP70 vaccine combined with sBTLA. A, Tumor growth inhibition experiment. Tumors were removed and weighed on days 14 and 28 after inoculation (n = 5 per group). B and C, Tumor incidence and survival rate after HSP70 vaccine/psBTLA treatment. After inoculation with 1 × 104 or 1 × 105 TC-1 cells, mice were treated with HSP70 vaccine every 2 days for 1 wk and treated with psBTLA every 3 days for 4 wk (T-4w) or 8 wk (T-8w). D, Effect of combination therapy on memory cell production. Mice (n = 5 per group) were challenged with 1 × 104 TC-1 cells by i.m. injection and treated with HSP70 vaccine/psBTLA, described as before. Mice were rechallenged with 1 × 104 TC-1 cells 60 days after the initial tumor inoculation. E, Tumor growth prevention of combination treatment. Mice were immunized by HSP70 vaccine, followed by treatment with psBTLA, pcDNA3.1, or saline administered every 3 days after the vaccination. A total of 1 × 104 TC-1 cells was inoculated by i.m. injection 2 wk after vaccination. Data are representative of two independent experiments.
The antitumor effects of the HSP70 vaccine combined with sBTLA. A, Tumor growth inhibition experiment. Tumors were removed and weighed on days 14 and 28 after inoculation (n = 5 per group). B and C, Tumor incidence and survival rate after HSP70 vaccine/psBTLA treatment. After inoculation with 1 × 104 or 1 × 105 TC-1 cells, mice were treated with HSP70 vaccine every 2 days for 1 wk and treated with psBTLA every 3 days for 4 wk (T-4w) or 8 wk (T-8w). D, Effect of combination therapy on memory cell production. Mice (n = 5 per group) were challenged with 1 × 104 TC-1 cells by i.m. injection and treated with HSP70 vaccine/psBTLA, described as before. Mice were rechallenged with 1 × 104 TC-1 cells 60 days after the initial tumor inoculation. E, Tumor growth prevention of combination treatment. Mice were immunized by HSP70 vaccine, followed by treatment with psBTLA, pcDNA3.1, or saline administered every 3 days after the vaccination. A total of 1 × 104 TC-1 cells was inoculated by i.m. injection 2 wk after vaccination. Data are representative of two independent experiments.
Dose- and time-dependent experiments showed that HSP70 vaccine/sBTLA combination therapy suppressed tumor growth effectively and kept animals alive longer when mice were inoculated with 1 × 104 tumor cells and treated with HSP70 vaccine every 2 days for 1 wk and together treated with psBTLA every 3 days for 8 wk, much better than that in other groups receiving different amount of tumor with different treatment (Fig. 6, B and C).
BTLA- or HVEM-deficient mice display an increased number of memory CD8+ T cells (19). To test whether combination therapy could generate effective memory cells in tumor-bearing mice model, mice were rechallenged with TC-1 cells 60 days after the initial tumor inoculation. Tumor incidence was recorded after tumor rechallenge. The more effective inhibition of tumor growth was achieved (80%; four of five mice) in group pretreated with combination therapy when compared with nonimmunization group (Fig. 6,D), indicating immunological memory against the tumor had been generated in HSP70 vaccine/sBTLA combination therapy animals. Based on our experimental data, an optimal antitumor strategy was suggested, as follows: animals were immunized by HSP70 vaccine plus sBTLA 2 wk before TC-1 cell (1 × 104) inoculation. As shown in Fig. 6 E, all five mice in inoculation were completely protected against tumor production.
Discussion
Ag and secondary signals are imperative for the activation of adaptive immune responses. Secondary signals include costimulatory and coinhibitory signals, and the overall balance of these signals contributes to the quality and magnitude of the ensuing immune response. Promoting costimulatory or blocking coinhibitory signals has become the most impressive strategy for the regulation of immune responses, and has had satisfactory achievements (14, 20, 21, 22, 23).
BTLA-HVEM signaling is a newly discovered coinhibitory pathway that can impair lymphocyte and APC activation (3, 17). In this study, we found increased expression of BTLA and HVEM genes in the tumor microenvironment, which indicates that the BTLA inhibitory pathway may play an important role in tumor progression. To inhibit the interaction between BTLA and HVEM, we constructed a eukaryotic expression plasmid carrying cDNA encoding the extracellular domain of murine BTLA (sBTLA) and transfected into CHO. In this study, we demonstrate that sBTLA protein secreted from supernatants of psBTLA-transfected CHO cells can competitively bind to HVEM, potentially interfere with BTLA-HVEM interactions, and enhance adaptive antitumor immune responses. Our data showed that local psBTLA treatment in vivo led to the tumor growth inhibition, but the adaptive antitumor immune responses promoted by treatment with psBTLA alone were limited and could not eradicate the tumor effectively. Nevertheless, psBTLA transfection contributed to the remodulation of the tumor microenvironment, resulting in down-regulation of IL-10 and TGF-β. Moreover, psBTLA transfection also enhanced the function of DC by increasing the expression of B7-1 and IL-12. These advantages became the basis for the search of the proper molecule to use in a combined therapeutic strategy.
Combination therapy has been an attractive strategy due to its mutual complementary advantages and its general application in antitumor immune therapy. The proper combination of different therapeutic molecules is based on the choice of suitable molecules and the elucidation of the mechanisms through which they synergize each other’s functions (24, 25, 26, 27). HSPs are obtained from tumors or virus-infected cells. Their function in binding cellular peptides makes them attractive candidates for use in cancer vaccines (28, 29, 30, 31). However, among the disadvantages of HSPs is their ability to up-regulate the immunosuppressive cytokines, IL-10 and TGF-β, during the effector phase of immune therapy. Our data illustrated that treatment with HSP70 vaccine alone resulted in increased expression of the Th1-associated cytokine genes, IFN-γ and IL-2, but had little impact on the expression of immunosuppressive cytokines (Fig. 4,C). Therefore, treatment with HSP70 vaccine alone did not lead to satisfactory tumor growth inhibition later during the immune therapy (Fig. 6 A). This effect results in an unsatisfactory therapeutic immune response against established tumors, most of which is due to the increase in coinhibitory molecule expression in the tumor microenvironment (15). However, the data indicate that there is room for further improvement of antitumor immune responses when the HSP70 vaccine is used alone.
To compensate for the disadvantages of HSPs, psBTLA administration as additional immune regulator was chosen for combination therapy with HSP70 vaccine. Our data showed that blocking BTLA-HVEM interactions with psBTLA in conjunction with HSP70 vaccine not only increased expression of IL-2 and IFN-γ, but also decreased the transcription levels of IL-10 and TGF-β. psBTLA/HSP70 vaccine combination therapy led to the accumulation of CD8+ T cells within the tumor microenvironment. These responses subsequently led to the successful eradication of a small number of tumor cells and to the inhibition of a larger number of tumor cells in vivo. In addition, genetic expression of Foxp3 in the tumor microenvironment was also decreased. This may indicate a decrease in suppressor T cells (32, 33, 34) as a result of the decrease in IL-10 and TGF-β (15, 16). The decrease in suppressor T cells may lead to the down-regulation of HVEM transcripts in the tumor microenvironment and the enhancement of antitumor immunity because suppressor T cells can increase HVEM expression to inhibit effector T cell function (35). Moreover, combination therapy induced a stronger immunologic memory effect, confirming previously reported results with BTLA-deficient T cells (19).
Binding of sBTLA to HVEM may not only block the BTLA pathway, but may also block the CD160 pathway and enhance the costimulatory LIGHT pathway. Cross-blocking studies with CD160 and BTLA indicated that their binding sites on the CRD1 domain of HVEM overlap to some extent, and colocalization experiments showed that CD160 and BTLA do not associate before interacting first with HVEM (36). Thus, sBTLA may interrupt CD160 binding to HVEM and promote CD4+ T cell activation. In our study, we constructed psCD160-enhanced GFP (EGFP), which expresses soluble CD160-EGFP fusion protein. We found that binding of psCD160-EGFP to HVEM on lymphocytes can be inhibited by sBTLA (supplemental Fig. D). These results indicate that sBTLA can also block the interaction of CD160 with HVEM, which may be beneficial for antitumor immunity. Moreover, HVEM strongly inhibited T cell responses despite the coexpression of LIGHT with CD160 and BTLA on activated human T cells (36). These results suggest that LIGHT costimulatory signaling can be inhibited by CD160 and BTLA. Similarly, our results indicate that sBTLA can increase LIGHT gene expression in the tumor microenvironment (data not shown), which may equally contribute to the augmentation of T cell responses. Blocking the BTLA/CD160-HVEM coinhibitory pathway and enhancing the LIGHT costimulatory pathway may be involved in the mechanism responsible for the antitumor effects mediated by HSP70 vaccine combined with sBTLA treatment.
In this study, we further showed that long-term treatment with HSP70 vaccine in combination with psBTLA is more beneficial and does not induce autoimmunity because we did not observe any abnormal changes in treated mice, as indicated by functional tests of the liver and kidney (data not shown).
In summary, the global impact of cervical cancer on women’s health is staggering, and therapeutic vaccines against the causative infectious agents remain elusive. A major roadblock to the development of vaccines against cervical cancer is our inability to generate sufficiently strong immune responses. The immunogenicity of vaccines can be enhanced through adjuvants that have traditionally targeted immunostimulatory pathways. In this study, we have shown that blockade of the HVEM inhibitory pathway, by targeting the BTLA binding site with sBTLA, potently enhances HSP70 vaccine-induced immune responses, and may thus provide a venue to improve therapeutic vaccine efficacy against existent tumor cells.
Acknowledgments
We thank Jun Li, Hainian Gu, Juan Du, Liping Zhou, Xiaolan Li, Wei Xiao, and Meirong Zheng for excellent technical assistance.
Disclosures
The authors have no financial conflict of interest.
Footnotes
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
This work was supported by the National Science Foundation of China (30600667; 30672227; 30700895; 30770913; and 3001586), the “973” Program of China (2009CB521800), and the Ph.D. Programs Foundation of Ministry of Education of China (200804871095).
Abbreviations used in this paper: BTLA, B and T lymphocyte attenuator; CHO, Chinese hamster ovary; DC, dendritic cell; eGFP, enhanced GFP; HSP, heat shock protein; HVEM, herpesvirus entry mediator; psBTLA, soluble BTLA plasmid; psCD160, soluble CD160 plasmid; sBTLA, soluble form of BTLA; sCD160, soluble CD160; TIL, tumor-infiltrating lymphocyte.
The online version of this article contains supplemental material.