Tolerogenic dendritic cells (TDC) offer a promising therapeutic potential to ameliorate autoimmune diseases. Reported to inhibit adaptive immune responses, little is known about their innate immunity receptor repertoire. In this study, we compared three types of human TDC (IL-10-DC, dexamethasone (DX)-DC, and 1,25(OH)2D3-DC) by their TLR expression and response to a set of TLR ligands. TDC are endowed with the same TLR set as standard monocyte-derived dendritic cells but respond differentially to the TLR stimuli Pam3CSK4, polyinosinic-polycytidylic acid, LPS, and flagellin. TDC expressed low or no IL-12-related cytokines and remarkably elevated IL-10 levels. Interestingly, only TDC up-regulated the expression of TLR2 upon stimulation. This boosted the tolerogenic potential of these cells, because IL-10 production was up-regulated in TLR2-stimulated, LPS-primed DX-DC, whereas IL-12 and TNF-α secretion remained low. When comparing the TDC subsets, DX-DC and 1,25(OH)2D3-DC up-regulated TLR2 irrespective of the TLR triggered, whereas in IL-10-DC this effect was only mediated by LPS. Likewise, DX-DC and 1,25(OH)2D3-DC exhibited impaired ability to mature, reduced allostimulatory properties, and hampered capacity to induce Th1 differentiation. Therefore, both DX-DC and 1,25(OH)2D3-DC display the strongest tolerogenic and anti-inflammatory features and might be most suitable tools for the treatment of autoimmune diseases.

Dendritic cells (DC)4 comprise a heterogeneous family of professional APC that orchestrate the initiation of immune responses (1). Although the initiation of effective Ag-specific immunity to pathogens is a hallmark of DC function, DC also actively induce and maintain Ag-specific tolerance to self-Ags in the periphery (2).

DC express the broadest repertoire of TLR with 10 members of the TLR family described to date in human (3, 4, 5). TLR act as immune sensors of pathogen-associated molecular patterns from bacteria, viruses, and parasites. TLR play an essential role in triggering the signals that provide DC maturation and the initiation of adaptive immune responses against pathogens (3, 4). The most representative ligand for TLR4 is LPS (3), whereas TLR2 discriminates lipoproteins from Gram-positive bacteria in association with TLR1 or TLR6 (6, 7). In addition, self-proteins can be recognized by both TLR2 and TLR4 (8). TLR10, whose ligand and function are still unknown, is highly homologous to TLR2 (9). Flagellin from motile bacteria is sensed by TLR5 (10), and the intracellular TLR3, TLR7, TLR8, and TLR9 specialize in the recognition of nucleic acids (11, 12, 13). Interestingly, a distinctive TLR profile is exhibited by different DC subsets. Human blood myeloid DC express the whole set of functionally characterized TLRs in humans with the exception of TLR9 and TLR4, conferring on these cells the capacity to respond to a wide variety of bacterial and viral ligands (14, 15, 16, 17). This pattern of expression is shared by monocyte-derived DC (moDC), which additionally display TLR4 (17, 18, 19, 20). In contrast to Langerhans cells (21, 22), the high levels of TLR9 and TLR7 on plasmacytoid DC allow this DC subtype to specialize in antiviral responses (14, 15, 16, 17).

Immunosuppressive agents, cytokines, and growth factors influence the functions of DC (23, 24). Among others, IL-10, dexamethasone (DX), and 1α,25-dihydroxyvitamin D3 (1,25(OH)2D3) have been used to generate DC with tolerogenic properties (IL-10-DC, DX-DC, and 1,25(OH)2D3-DC, respectively) (25, 26, 27). These so-called tolerogenic DC (TDC) show an incomplete or altered activation and maturation status upon stimulation. This semimature state is defined by low to intermediate levels of MHC class II (MHC-II), costimulatory molecules (CD80, CD86, and CD40), and CCR7, in addition to a remarkably increased Ag uptake capacity (25, 26, 27, 28). A reduced ability to secrete proinflammatory cytokines such as IL-12p70, together with an enhanced IL-10 secretion, might be crucial for their tolerogenic features (24). TDC have been shown to induce T cell anergy (29, 30), T cell suppression (30, 31), and the generation of regulatory T cells (Treg) (32), as well as to protect against autoimmune diseases and allograft rejection in vivo (2, 24, 33). However, TLR engagement might turn their inhibitory properties into unwanted immune activation when applied in an autoimmune setting (34). Little is known about the TLR repertoire on TDC and how TLR agonists, different from LPS, affect TDC responses. This study addresses for the first time a detailed analysis of TLR expression (TLR1–10), as well as the effects of TLR ligands (Pam3CSK4, polyinosinic-polycytidylic acid (poly(I:C)), LPS, and flagellin) on three different types of in vitro generated human TDC.

Immature DC were obtained from buffy coats of healthy donors (Sanquin) as previously described (35). Briefly, human PBMC were isolated by Ficoll gradient and a subsequent positive selection by anti-CD14 microbeads (MACS; Miltenyi Biotec). Standard moDC were generated by culturing freshly isolated monocytes (≥ 95% purity) for 5 days in RPMI 1640 medium supplemented with 10% FCS, 2 mM l-glutamine, and 30 μg/ml penicillin/streptomycin in the presence of IL-4 and GM-CSF (500 U/ml and 800 U/ml, respectively; BioSource International). TDC were generated using the same culture medium supplemented with either IL-10 (10 ng/ml IL-10-DC; BioSource International), DX (10−6 M DX-DC; Sigma-Aldrich;), or calcitriol (10−8 M 1,25(OH)2D3,-DC; Sigma-Aldrich;). Cultures treated with either DX or 1,25(OH)2D3 yielded a reduced number of cells compared with nontreated and IL-10-treated cultures. The same percentage of viable cells were recovered regardless of the treatment used.

Cells were extensively washed and stimulated for an additional 18 h with the following TLR ligands: 10 ng/ml LPS, ligand for TLR4 (Salmonella typhosa; Sigma-Aldrich); 10 μg/ml Pam3CSK4, ligand for TLR2/1 (synthetic bacterial lipoprotein; InvivoGen), 5 μg/ml flagellin, ligand for TLR5 (from Salmonella typhimurium; InvivoGen), and 10 μg/ml poly(I:C), ligand for TLR3 (synthetic analog of dsRNA; Invivogen). Supernatants and cells were collected for further analysis.

Signaling inhibitors were added 1 h before the start of experiments under the specified stimulation conditions. SB203580 (p38MAPK inhibitor at 1 μM; Calbiochem), anacardic acid (p300/CBP HAT inhibitor at 10 μM; Calbiochem), and BAY11-7082 (inhibitor of IκBα phosphorylation and NF-κB translocation at 5 μM; Calbiochem) were gifts from Dr. S. I. Gringhuis (Vrije University Medical Center, Amsterdam, The Netherlands).

For restimulation assays, cells were first stimulated overnight by TLR agonists, washed, and subsequently stimulated for an additional 24 h in the presence of the TLR2 agonist Pam3CSK4. Cytokine production was assessed on cell culture supernatants.

Cells were collected at 18 h after the start of stimulation because maximal (minimal) gene expression was detected at this time point in the kinetics analysis performed (data not shown). Cells were lysed and mRNA was specifically isolated by capturing of poly(A)+ RNA in streptavidin-coated tubes using a mRNA capture kit (Roche). cDNA was synthesized using a reverse transcription system kit (Promega) following the manufacturer’s guidelines. cDNA was diluted 1/2 in nuclease-free water upon synthesis and stored at −20°C until analysis.

Specific primers for human TLR1–10, Ig-like transcript 3 (ILT3), glucocorticoid-induced leucine zipper (GILZ), CCR7, OX40 ligand (OX40-L), IL-23p19, IL-27p28, IL-27EIB3, TGF-β1 (Table I), and GAPDH (36) were designed by using the computer software Primer Express 2.0 (Applied Biosystems) and synthesized at Invitrogen. Primer specificity was computer tested by homology search with the human genome (basic local alignment search tool or BLAST; National Center for Biotechnology Information) and later confirmed by dissociation curve analysis. Real-time PCR was performed using the SYBR Green method in an ABI 7900HT sequence detection system (Applied Biosystems) as previously described (36). Briefly, 4 μl of the Power SYBR Green master mix (Applied Biosystems) were mixed with 2 μl of a solution containing 5 nmol/μl of both oligonucleotides and 2 μl of a cDNA solution (1/100 of the cDNA synthesis product). The cycle threshold (Ct) value is defined as the number of PCR cycles where the fluorescence signal exceeds the detection threshold value (fixed at 0.045 relative fluorescence units). GAPDH was selected as the endogenous reference gene from a set of 10 functionally unrelated housekeeping genes according to Garcia-Vallejo et al. (36). For each sample, the relative abundance of target mRNA was calculated from the obtained Ct values for both target and endogenous reference gene GAPDH by applying the following formula: relative mRNA expression = 2[Ct(GAPDH) − Ct(target)].

Table I.

Oligonucleotides used for quantitative real-time PCR

GeneGene IDaForward OligonucleotideReverse Oligonucleotide
TLR1 7096 tgctgccaattgctcatttg gaaggccctcagggtcttct 
TLR2 7097 ggcttctctgtcttgtgaccg gagccctgagggaatggag 
TLR3 7098 tccctttgattgcacgtgtg tcagggatgttggtatgggtc 
TLR4 7099 ctgcaatggatcaaggaccag ccattcgttcaacttccacca 
TLR5 7100 gctggtgccttgaagcctt gacccaaccaccaccatgat 
TLR6 10333 cacagacagctttgtacaccgtg tgtgcttggtgcatgagga 
TLR7 51284 gctccggaaaaggctctgt ggtgagcttgcgggtttgt 
TLR8 51311 cagcagtttcctcgtctcgag cagcagtgtccgaagggaag 
TLR9 54106 cccagctacatcccgatacct ctggcattcagccaggaga 
TLR10 81793 tgaagaaggtagcctgccca atcacgcaaaagaacccagaa 
ILT3 11006 cgtcagggaaaacacaggaca gaggacgttggaaatcagcct 
GILZ 1831 ggtggagaagaactcccagct ccagggtcttcaacagggtgt 
CCR7 1236 cctgtgtgggcatctggatac caggagctctgggatggaga 
OX40-L 7292 agccaggccaagattcgag agccaggccaagattcgag 
IL-23p19 51561 gcttgcaaaggatccacca tccgatcctagcagcttctca 
IL-27p28 246778 gctttgcggaatctcacctg tgaagcgtggtggagatgaag 
IL-27EBI3 10148 ggctccctacgtgctcaatg gggtcgggcttgatgatgt 
TGF-β1 7040 gcccactgctcctgtgaca cggtagtgaacccgttgatgt 
GeneGene IDaForward OligonucleotideReverse Oligonucleotide
TLR1 7096 tgctgccaattgctcatttg gaaggccctcagggtcttct 
TLR2 7097 ggcttctctgtcttgtgaccg gagccctgagggaatggag 
TLR3 7098 tccctttgattgcacgtgtg tcagggatgttggtatgggtc 
TLR4 7099 ctgcaatggatcaaggaccag ccattcgttcaacttccacca 
TLR5 7100 gctggtgccttgaagcctt gacccaaccaccaccatgat 
TLR6 10333 cacagacagctttgtacaccgtg tgtgcttggtgcatgagga 
TLR7 51284 gctccggaaaaggctctgt ggtgagcttgcgggtttgt 
TLR8 51311 cagcagtttcctcgtctcgag cagcagtgtccgaagggaag 
TLR9 54106 cccagctacatcccgatacct ctggcattcagccaggaga 
TLR10 81793 tgaagaaggtagcctgccca atcacgcaaaagaacccagaa 
ILT3 11006 cgtcagggaaaacacaggaca gaggacgttggaaatcagcct 
GILZ 1831 ggtggagaagaactcccagct ccagggtcttcaacagggtgt 
CCR7 1236 cctgtgtgggcatctggatac caggagctctgggatggaga 
OX40-L 7292 agccaggccaagattcgag agccaggccaagattcgag 
IL-23p19 51561 gcttgcaaaggatccacca tccgatcctagcagcttctca 
IL-27p28 246778 gctttgcggaatctcacctg tgaagcgtggtggagatgaag 
IL-27EBI3 10148 ggctccctacgtgctcaatg gggtcgggcttgatgatgt 
TGF-β1 7040 gcccactgctcctgtgaca cggtagtgaacccgttgatgt 
a

Identifier.

Cells (2 × 104/well) were incubated with primary Ab (uncoupled, PE-, or FITC-labeled) for 30 min at 4°C in staining buffer (PBS, 0.5% BSA, and 0.02% sodium azide). Cells were washed and resuspended in staining buffer before flow cytometry analysis on FACScalibur or FACScan flow cytometers (BD Biosciences). Only cells stained with noncoupled Abs were subsequently incubated with a secondary FITC-labeled goat anti-mouse IgG (Zymed Laboratories) for 30 min at 4°C; cells were then washed and resuspended for further analysis as described above.

Commercial anti-CD80-PE (L307.4; IgG1), anti-CD86-PE (2331; IgG1), anti-HLA DR-PE (G46.6; IgG2a), anti-DC-SIGN-FITC (CD209 and 120507; IgG2b) (where DC-SIGN is DC-specific ICAM-grabbing nonintegrin), anti-CD1a-PE (HI149; IgG1), and isotype-matched controls were purchased from BD Biosciences. Anti-CD83-PE (HB15a; IgG2b) and anti-CD14-PC5 (RM052; IgG2a) were supplied by Coulter. Anti-TLR2 (TLR2.1; IgG2a) and anti-TLR4 (HTA125; IgG2a) were purchased from Santa Cruz Biotechnology. Ascites liquid or supernatants against anti-CD11b (bear 1; IgG1), anti-CD11c (Shcl3; IgG2b), and anti-DC-SIGN (AZN-D1, IgG1) were obtained from our stock.

Culture supernatants were harvested after 18 h of DC stimulation and frozen at −80°C until analysis. We analyzed for the presence of IL-10, IL-12p40, IL-6, and TNF-α by ELISA according to manufacturer’s instructions (BioSource International). Human IL-12p70 detection was determined as described previously (37).

For primary MLR assays, CD4+ T cells were negatively selected from PBMC using the CD4+ T cell isolation kit II (Miltenyi Biotec). CD4+ T cells (1 × 105) were cocultured with graded numbers of irradiated, allogeneic APC (TLR-stimulated moDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC) in 96-well, round-bottom plates. After 6 days, plates were pulsed with [3H]thymidine (0,5 μCi/well; Amersham Biosciences). After an additional 18 h of incubation, [3H]thymidine incorporation was measured on a Wallac-LKB Betaplate 1205 (PerkinElmer Wallac) liquid scintillation counter.

For anergy induction assays, 106 naive CD4+CD45+ T cells were cultured with allogeneic 105 TLR-stimulated APC (moDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC) in 24-well plates in IMDM supplemented with 10% human AB serum (PAA Laboratories) for 6 days. Primed T cells were recovered, washed, and rested for 3 days in the presence of IL-7 (10 ng/ml) and IL-15 (5 ng/ml). On day 9 after primary stimulation, primed T cells were washed and restimulated by coculturing 105 T cells with LPS-activated moDC from the original donor at a 1:50 ratio in 96-well plates. After 6 days, plates were pulsed and measured as described above.

Naive CD45RA+CD4+ T cells were negatively isolated from PBMCs by using a naive CD4+ T cell isolation kit (>95% purity) (Miltenyi Biotec). For Th1/Th2 differentiation assays, DC were either stimulated with TLR agonists or left untreated for 2 days. DC (5 × 103/well) were intensively washed and cocultured with naive CD4+ T cells (5 × 104/well). On days 3–5, recombinant human IL-2 (100 U/ml; Strathmann Biotec) was added and the cultures were expanded for the next 12–14 days. Cultures were refreshed once with recombinant human IL-2 and medium at days 7–9. Expanded T cells were restimulated on days 12–14 with PMA (30 ng/ml; Sigma-Aldrich) and ionomycin (1 μg/ml; Sigma-Aldrich) for a total of 6 h; brefeldin A (10 μg/ml; Sigma-Aldrich) was present during the last 5 h. T cells were fixated on Cytofix/Cytoperm solution (BD Biosciences) and single-cell production of IL-4 and IFN-γ was determined by intracellular staining with anti-human IFN-γ-FITC (25723.211; IgG2b) and anti-human IL4-PE (3010.211; IgG1) (both from BD Biosciences) in saponin buffer (PBA, 0,5% saponin). Cells were washed and resuspended in saponin buffer prior to flow cytometric analysis (FACScalibur or FACScan; BD Biosciences).

Unless otherwise stated, data are presented as the mean ± SD of at least three donors. Statistical analyses were performed using the statistical package SPSS (license no. AZVU-7061649). Statistical significance was set at p < 0.05 and was evaluated by using the Mann-Whitney U test.

To study the phenotypic and functional properties of conventional DC and TDC, we cultured freshly isolated human monocytes in the presence of GM-CSF and IL-4 and the tolerogenic stimuli IL-10, DX, or 1,25(OH)2D3 to generate either conventional moDC or IL-10-DC, DX-DC, or 1,25(OH)2D3-DC. We then investigated the expression of maturation-related markers, as well as the release of the proinflammatory cytokine IL-12p70 and the immunosuppressive cytokine IL-10 (Fig. 1). LPS treatment of moDC resulted in maturation as measured by an up-regulation of the maturation marker CD83, the costimulatory molecules CD80 and CD86, and MHC-II (Fig. 1,A). LPS-induced maturation was also achieved on TDC, although the up-regulation of costimulatory molecules was hampered on both DX-DC and 1,25(OH)2D3-DC, which already showed relatively high expression of these markers before LPS treatment. Unexpectedly, IL-10-DC showed similar levels of costimulatory molecules as did moDC upon LPS-induced maturation, although lower expression of CD83 (Fig. 1 A).

FIGURE 1.

IL-10-, DX-, and 1,25(OH)2D3-DC display tolerogenic DC features. Monocytes were differentiated into immature DC in the presence of IL-4 and GM-CSF (moDC) for 5 days. IL-10-, DX-, and 1,25(OH)2D3-DC were obtained by adding IL-10, DX, or calcitriol to the cultures as described in Materials and Methods. Cells were harvested and after extensive washing stimulated with 10 ng/ml Salmonella typhosa LPS for 18 h to induce maturation. A, CD80, CD86, CD83, or HLA-DR expression was analyzed by flow cytometry. Filled histograms represent immature DC and solid line histograms represent LPS-stimulated DC. Dashed line histograms correspond to isotype control mAb staining. B, IL-10 and IL-12p70 release was measured by ELISA in supernatants harvested after LPS stimulation. Concentration of IL-10 and IL-12p70 (in pg/ml) is shown as the ratio of IL-10/IL-12p70 and as raw data in the table above the bar graph. Nondetectable levels of IL-12p70 were set at 50% of the lowest detectable standard point. A representative example from five independent experiments is depicted. C, ILT3 (i) and GILZ (ii) transcript levels were determined by real-time RT-PCR using GAPDH as the endogenous reference gene (Rel. Ab., Relative abundance). A representative example from five independent experiments is depicted. D, LPS-stimulated DC were cultured with allogeneic CD4+ T cells at different ratios for 5 days. Cell proliferation was evaluated in triplicate by [3H]thymidine uptake. Data represent the mean ± SD of triplicates in a representative experiment of the six that were independently performed. E, Naive CD4+CD45+ T cells were primed with allogeneic LPS-stimulated DC for 6 days. After a 3-day resting period, anergy induction was examined by the restimulation of primed CD4+ T cells with LPS-activated moDC from the original donor at a 1:50 ratio for 5 days. Cell proliferation was evaluated in triplicate by [3H]thymidine uptake. Data represent the mean ± SD of triplicates in a representative experiment of the two that were independently performed. n.d., Nondetermined.

FIGURE 1.

IL-10-, DX-, and 1,25(OH)2D3-DC display tolerogenic DC features. Monocytes were differentiated into immature DC in the presence of IL-4 and GM-CSF (moDC) for 5 days. IL-10-, DX-, and 1,25(OH)2D3-DC were obtained by adding IL-10, DX, or calcitriol to the cultures as described in Materials and Methods. Cells were harvested and after extensive washing stimulated with 10 ng/ml Salmonella typhosa LPS for 18 h to induce maturation. A, CD80, CD86, CD83, or HLA-DR expression was analyzed by flow cytometry. Filled histograms represent immature DC and solid line histograms represent LPS-stimulated DC. Dashed line histograms correspond to isotype control mAb staining. B, IL-10 and IL-12p70 release was measured by ELISA in supernatants harvested after LPS stimulation. Concentration of IL-10 and IL-12p70 (in pg/ml) is shown as the ratio of IL-10/IL-12p70 and as raw data in the table above the bar graph. Nondetectable levels of IL-12p70 were set at 50% of the lowest detectable standard point. A representative example from five independent experiments is depicted. C, ILT3 (i) and GILZ (ii) transcript levels were determined by real-time RT-PCR using GAPDH as the endogenous reference gene (Rel. Ab., Relative abundance). A representative example from five independent experiments is depicted. D, LPS-stimulated DC were cultured with allogeneic CD4+ T cells at different ratios for 5 days. Cell proliferation was evaluated in triplicate by [3H]thymidine uptake. Data represent the mean ± SD of triplicates in a representative experiment of the six that were independently performed. E, Naive CD4+CD45+ T cells were primed with allogeneic LPS-stimulated DC for 6 days. After a 3-day resting period, anergy induction was examined by the restimulation of primed CD4+ T cells with LPS-activated moDC from the original donor at a 1:50 ratio for 5 days. Cell proliferation was evaluated in triplicate by [3H]thymidine uptake. Data represent the mean ± SD of triplicates in a representative experiment of the two that were independently performed. n.d., Nondetermined.

Close modal

MoDC released elevated levels of IL12-p70 in comparison to IL-10, as reflected in the low IL-10/IL-12p70 ratio observed after LPS stimulation (Fig. 1,B). In contrast to moDC, IL-10-DC displayed a higher IL-10/IL-12p70 ratio as reflected by a reduction in IL-12p70 production and an increase in the secretion of the immunosuppressive cytokine IL-10 (Fig. 1,B). Similarly, DX-DC and 1,25(OH)2D3-DC showed a remarkable enhancement of IL-10 secretion and a poor ability to release IL-12p70. The elevated IL-10/IL-12p70 ratio showed by DX-DC and 1,25(OH)2D3-DC suggests a more tolerogenic phenotype of these cells (Fig. 1 B).

The expression of the inhibitory receptor ILT3 and, more recently, the transcription factor GILZ have been associated with a tolerogenic potential of DC (24, 38, 39, 40). Accordingly, TDC showed higher levels of both ILT3 and GILZ transcripts as compared with moDC (Fig. 1 C). Specifically, GILZ was remarkably higher on DX-DC and ILT3 on 1,25(OH)2D3-DC.

TDC have been previously shown to be T cell anergy inductors (29, 30) and poor stimulators of T cell proliferation (25, 26, 27). To evaluate the ability of TDC to induce T cell proliferation, moDC or TDC were cocultured with allogeneic T CD4+ lymphocytes in a primary MLR. MoDC were potent inducers of CD4+ T cell proliferation as assessed by an elevated incorporation of [methyl-3H]thymidine (Fig. 1,D). In contrast, TDC exhibited a significantly reduced allostimulatory capacity with at least a 2-fold decrease in T cell proliferation compared with moDC. This demonstrates that 1,25(OH)2D3-DC are the least potent in promoting allo-T cell proliferation and that DX-DC and IL-10-DC efficiently decrease lymphocyte proliferation. To assess whether T cells exposed to TDC are indeed anergic, naive CD4+CD45+ T cells were primed with control moDC or TDC in a first MLR round and re-stimulated in a second round with fully competent moDC (LPS-activated moDC) from the same donor as the initial TDC. T cell proliferation was evaluated as described above. Whereas T cells primarily exposed to control moDC induced a vigorous proliferative T cell response (Fig. 1 E), T cells exposed to IL-10-DC or DX-DC showed a reduced ability to proliferate when rechallenged with immunocompetent moDC, indicating that tolerogenic IL-10-DC and DX-DC have anergized this population. DC modulated with 1,25(OH)2D3 hardly induced T cell proliferation in the first round, and only small cell numbers could be collected from primary cultures (data not shown; absolute cell counts were 0.2 × 10−3 ± 0.05 cpm). Hence, anergy induction could not be determined for the 1,25(OH)2D3-modulated cells due to the lack of primed T cells to rechallenge, indicating that these DC actively delete T cells.

Taken together, these data indicate that the TDC used in our study clearly differ from conventional moDC in terms of maturation, cytokine profile, allostimulatory T cell capacity, and anergy induction. The features displayed by the DC generated in the present study are similar to those reported with other protocols (25, 26, 27). Within the three TDC cultures, it seems that primarily the DX-DC and 1,25(OH)2D3-DC are more tolerogenic than the IL-10 DC.

TLR expression on conventional DC has been extensively studied in both humans and mice (3). However, little is known about the TLR repertoire on TDC. To evaluate the TLR repertoire on human TDC, we investigated the expression of TLR1 to TLR10 by quantitative PCR in moDC, as well as in the three types of TDC phenotyped above: IL-10-DC, DX-DC, and 1,25(OH)2D3-DC.

In resting conditions, moDC and TDC displayed an identical repertoire of TLR (Table II). They all expressed similar levels of TLR1 to TLR8 and very low levels of TLR10. TLR4 and TLR2 were highly expressed on both immunogenic and TDC, which could be confirmed at the protein level (data not shown). As expected, TLR9, which is restricted to plasmacytoid DC, was not detected in any of the cells examined.

Table II.

TLR expression levels on tolerogenic DCa

moDCIL-10-DCDX-DC1,25(OH)2D3-DC
TLR1 1.23 ± 0.24 1.15 ± 0.17 1.36 ± 0.15 1.49 ± 0.24 
TLR2 3.95 ± 1.06 3.24 ± 0.99 7.14 ± 0.81 2.88 ± 1.05 
TLR3 0.31 ± 0.08 0.30 ± 0.08 0.18 ± 0.09 0.26 ± 0.17 
TLR4 2.48 ± 0.66 2.9 ± 1.00 7.56 ± 1.56b 2.72 ± 0.97 
TLR5 0.35 ± 0.10 0.66 ± 0.13 4.68 ± 1.13b 0.44 ± 0.24 
TLR6 0.75 ± 0.15 0.62 ± 0.16 0.50 ± 0.08 0.49 ± 0.19 
TLR7 0.16 ± 0.05 0.10 ± 0.05 0.38 ± 0.12 0.15 ± 0.07 
TLR8 1.35 ± 0.39 0.74 ± 0.15 0.54 ± 0.09b 1.84 ± 0.74 
TLR10 0.02 ± 0.00 0.10 ± 0.07 0.10 ± 0.05 0.08 ± 0.06 
moDCIL-10-DCDX-DC1,25(OH)2D3-DC
TLR1 1.23 ± 0.24 1.15 ± 0.17 1.36 ± 0.15 1.49 ± 0.24 
TLR2 3.95 ± 1.06 3.24 ± 0.99 7.14 ± 0.81 2.88 ± 1.05 
TLR3 0.31 ± 0.08 0.30 ± 0.08 0.18 ± 0.09 0.26 ± 0.17 
TLR4 2.48 ± 0.66 2.9 ± 1.00 7.56 ± 1.56b 2.72 ± 0.97 
TLR5 0.35 ± 0.10 0.66 ± 0.13 4.68 ± 1.13b 0.44 ± 0.24 
TLR6 0.75 ± 0.15 0.62 ± 0.16 0.50 ± 0.08 0.49 ± 0.19 
TLR7 0.16 ± 0.05 0.10 ± 0.05 0.38 ± 0.12 0.15 ± 0.07 
TLR8 1.35 ± 0.39 0.74 ± 0.15 0.54 ± 0.09b 1.84 ± 0.74 
TLR10 0.02 ± 0.00 0.10 ± 0.07 0.10 ± 0.05 0.08 ± 0.06 
a

TLR expression was measured by real-time quantitative PCR on moDC and on tolerogenic IL-10-DC, DX-DC, and 1,25(OH)2D3-DC. Relative abundance using GAPDH as the endogenous reference gene is shown. Data represent the average ± SD from at least five independent experiments. TLR9 expression was below detection limit in all cells analyzed. Data represent the average ± SD from at least five donors.

b

p < 0.05, indicating significant differences to moDC (Mann-Whitney U test).

Although the set of TLR among all the cell types was equivalent, there were significant differences in the expression levels of several TLR only in DX-DC. Consistent with a recent report, TLR2 and TLR4 were enhanced on DX-DC (41). However, we only found significant differences in TLR4 and TLR5 expression on DX-DC when compared with moDC. On the contrary, TLR8 expression was significantly reduced in the modulated DX-DC.

Because we found differences in the expression level of TLR among the different DC populations, we aimed to evaluate the effects of TLR ligands on the maturation/activation status of tolerogenic DC. To this purpose we investigated the expression of the costimulatory molecules CD86, CD80, and OX40-L, and the chemokine receptor CCR7 on DC triggered by Pam3CSK4 (TLR2 ligand), poly(I:C) (TLR3 ligand), LPS (TLR4 ligand), or flagellin (TLR5 ligand) (Fig. 2).

FIGURE 2.

TDC display low to moderate levels of maturation/activation. A and B, CD86 (A) and CD80 (B) expression was analyzed by flow cytometry on moDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC stimulated for 18 h with LPS (TLR4 ligand), Pam3CSK4 (TLR2 ligand), poly(I:C) (TLR3 ligand), or flagellin (TLR5 ligand). Unstimulated cells were used as negative control. The mean fluorescence intensity from a representative example of three independently performed experiments is presented. C and D, CCR7 (C) and OX40-L (D) mRNA expression was measured by real-time RT-PCR on moDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC stimulated for 18 h with LPS (TLR4 ligand), Pam3CSK4 (TLR2 ligand), poly(I:C) (TLR3 ligand), or flagellin (TLR5 ligand). Unstimulated cells were used as negative control. The relative abundance (Rel. Ab.) using GAPDH as the endogenous reference gene is shown. Data represent the average ± SD of three independent experiments.

FIGURE 2.

TDC display low to moderate levels of maturation/activation. A and B, CD86 (A) and CD80 (B) expression was analyzed by flow cytometry on moDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC stimulated for 18 h with LPS (TLR4 ligand), Pam3CSK4 (TLR2 ligand), poly(I:C) (TLR3 ligand), or flagellin (TLR5 ligand). Unstimulated cells were used as negative control. The mean fluorescence intensity from a representative example of three independently performed experiments is presented. C and D, CCR7 (C) and OX40-L (D) mRNA expression was measured by real-time RT-PCR on moDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC stimulated for 18 h with LPS (TLR4 ligand), Pam3CSK4 (TLR2 ligand), poly(I:C) (TLR3 ligand), or flagellin (TLR5 ligand). Unstimulated cells were used as negative control. The relative abundance (Rel. Ab.) using GAPDH as the endogenous reference gene is shown. Data represent the average ± SD of three independent experiments.

Close modal

DC maturation was strongly induced on TLR-stimulated moDC, as demonstrated by the marked increase in CD86 and CD80 expression (Fig. 2, A and B); triggering also induced maturation on IL-10-DC, DX-DC, and 1,25(OH)2D3-DC, although with remarkable differences in the levels of the maturation markers. DX-DC and 1,25(OH)2D3-DC showed a partial maturation upon exposure to TLR ligands, whereas IL-10-DC acquired a more advanced maturation state, very similar to that of moDC (Fig. 2, A and B).

To achieve an efficient migration from peripheral tissues to secondary lymph nodes, DC up-regulate, among others, CCR7 (42). Therefore, we analyzed CCR7 mRNA expression on tolerogenic DC and moDC exposed to TLR ligands. Exposure to TLR ligands resulted in CCR7 up-regulation in the case of LPS as reported (43, 44), but also with Pam3CSK4, flagellin, and poly(I:C) (Fig. 2 C). Nevertheless, LPS-stimulated moDC exhibited a significantly higher CCR7 expression than any of the tolerogenic DC subtypes analyzed; IL-10-DC was the TDC with the highest CCR7 levels.

Furthermore, OX40-L, critical in the global regulation of peripheral immunity vs tolerance (45), showed a moderate to clear reduction on tolerogenic IL-10-DC, DX-DC, and 1,25(OH)2D3-DC compared with moDC (Fig. 2 D).

We next compared the capacity of TLR-stimulated moDC and tolerogenic DC to induce T cell proliferation of allogeneic T CD4+ lymphocytes in a MLR assay. We analyzed the activation of Pam3CSK4 (TLR2 ligand), flagellin (TLR5 ligand) and poly(I:C) (TLR3 ligand) (Fig. 3, A–C). Except for IL-10-DC, TDC showed a weak ability to stimulate T cells in any of the stimulatory conditions assayed (Fig. 3). These experiments demonstrate that DX-DC and 1,25(OH)2D3-DC possess a reduced T cell stimulatory capacity. In addition to the primary cocultures, we analyzed the potency of the TDC to induce anergy by performing similar secondary cocultures as described in Fig. 1,E. Activation of TDC by Pam3CSK4, flagellin, and poly(I:C) also showed induction of T cell anergy (Fig. 3, D–F) of the DX-DC and the IL-10 DC. Again, activation of 1,25(OH)2D3-modulated DC with these TLR stimuli led to low T cell counts in primary cultures, probably due to active deletion of T cells, resulting in reduced T cell counts for starting secondary cultures.

FIGURE 3.

Tolerogenic DX-DC and 1,25(OH)2D3-DC show a reduced alloproliferation ability regardless of the TLR stimulus. AC, MoDC and TDC were incubated with the TLR2 ligand Pam3CSK4 (A and D), the TLR5 ligand flagellin (B and E), or the TLR3 ligand poly(I:C) (C and F) for 18 h and then cocultured with allogeneic CD4+ T cells for 5–6 days in different ratios. Proliferation was determined in triplicate by [3H]thymidine uptake. Data represent the mean ± SD of triplicates in a representative example of three independent experiments. DF, Naive CD4+CD45+ T cells were primed with allogeneically stimulated DC for 6 days. After a 3-day resting period, anergy induction was examined by restimulation of primed CD4+ T cells with LPS-activated moDC from the original donor at a 1:50 ratio for 5 days. Cell proliferation was evaluated in triplicate by [3H]thymidine uptake. Data represent the mean ± SD of triplicates in a representative experiment of two independently performed.

FIGURE 3.

Tolerogenic DX-DC and 1,25(OH)2D3-DC show a reduced alloproliferation ability regardless of the TLR stimulus. AC, MoDC and TDC were incubated with the TLR2 ligand Pam3CSK4 (A and D), the TLR5 ligand flagellin (B and E), or the TLR3 ligand poly(I:C) (C and F) for 18 h and then cocultured with allogeneic CD4+ T cells for 5–6 days in different ratios. Proliferation was determined in triplicate by [3H]thymidine uptake. Data represent the mean ± SD of triplicates in a representative example of three independent experiments. DF, Naive CD4+CD45+ T cells were primed with allogeneically stimulated DC for 6 days. After a 3-day resting period, anergy induction was examined by restimulation of primed CD4+ T cells with LPS-activated moDC from the original donor at a 1:50 ratio for 5 days. Cell proliferation was evaluated in triplicate by [3H]thymidine uptake. Data represent the mean ± SD of triplicates in a representative experiment of two independently performed.

Close modal

TLR-dependent maturation results in the release of cytokines preferentially involved in Th1 proinflammatory responses (46). To investigate the pattern of cytokine release upon TLR triggering, tolerogenic DC and moDC were stimulated with the TLR agonists LPS, Pam3CSK4, poly(I:C), and flagellin and cytokine production was measured.

Given the important role of IL-10 and TGF-β1 in the induction of immunosuppressive responses, we examined the production of both cytokines by DC populations (Fig. 4). Unlike moDC, tolerogenic DC responded to TLR-mediated signals with a considerable production and secretion of IL-10, especially in the case of TLR4 or TLR5 agonists (Fig. 4). Interestingly, DX-DC achieved the highest IL-10 levels. TGF-β1 transcripts were detected in all DC subtypes; however, only DX-DC and 1,25(OH)2D3-DC showed enhanced TGF-β1 mRNA expression upon TLR3-triggering (Fig. 4).

FIGURE 4.

TLR triggering on TDC leads to an anti-inflammatory cytokine program. MoDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC were stimulated for 18 h with the TLR2 ligand Pam3CSK4, the TLR4 ligand LPS, the TLR3 ligand poly(I:C), or the TLR5 ligand flagellin. The release of IL-10 (A), TNF-α (C), IL-6 (D), IL-12p70 (E), and IL-12p40 (F) was determined by ELISA in the supernatants of the cell cultures. Cells were also harvested for mRNA isolation and cDNA synthesis. The transcript levels of TGF-β1 (B), IL-23p19 (G), IL-27p28 (H), and IL-27EBI3 (I) were determined by real time RT-PCR using GAPDH as the endogenous reference gene (Rel. Ab., Relative abundance). Data are the average ± SD from six experiments. Statistical significance vs MoDC was determined by a Mann-Whitney test; ∗, p < 0.05.

FIGURE 4.

TLR triggering on TDC leads to an anti-inflammatory cytokine program. MoDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC were stimulated for 18 h with the TLR2 ligand Pam3CSK4, the TLR4 ligand LPS, the TLR3 ligand poly(I:C), or the TLR5 ligand flagellin. The release of IL-10 (A), TNF-α (C), IL-6 (D), IL-12p70 (E), and IL-12p40 (F) was determined by ELISA in the supernatants of the cell cultures. Cells were also harvested for mRNA isolation and cDNA synthesis. The transcript levels of TGF-β1 (B), IL-23p19 (G), IL-27p28 (H), and IL-27EBI3 (I) were determined by real time RT-PCR using GAPDH as the endogenous reference gene (Rel. Ab., Relative abundance). Data are the average ± SD from six experiments. Statistical significance vs MoDC was determined by a Mann-Whitney test; ∗, p < 0.05.

Close modal

We also examined the production of the proinflammatory IL-12-related cytokines. All tolerogenic DC showed no IL-12p70 release upon TLR stimulation, whereas moDC responded to TLR4-engagement with elevated levels of IL-12p70, the bioactive form of IL-12 (p35/p40). Furthermore, given the elevated transcripts levels of IL-23p19, IL-27p28, and IL-27EBI3, together with the high IL-12p40 released by moDC, large amounts of IL-23 (p40/p19) and IL-27 (EBI3/p28) may be released by moDC. In contrast, the potential of tolerogenic DC to produce IL-23 and IL-27 may be considerably reduced due to lower transcripts levels of IL-23p19 and/or reduced mRNA levels of either one or both of the IL-27-forming subunits (Fig. 4).

Other cytokines, such as TNF-α and IL-6, showed an LPS-dependent reduction in supernatants from IL-10-DC and DX-DC compared with moDC (Fig. 4). Interestingly, all TLR ligands increased TNF-α and IL-6 secretion in the tolerogenic 1,25(OH)2D3-DC.

DC are capable of driving the differentiation of naive T cells into committed Th1, Th2, or Th17 cells depending on the cellular microenvironment, the cytokines released, and the pathogen recognized (47, 48). Given the different cytokine secretion of TDC vs moDC, we investigated whether TLR-stimulated TDC could polarize distinctive T cell responses. Highly purified naive CD4+ T cells were cocultured with stimulated tolerogenic DC in long-term assays. T cell polarization was measured by intracellular staining of IFN-γ/IL-4 after restimulation of T cells (Fig. 5).

FIGURE 5.

TDC show a reduced ability to polarize Th1 responses. MoDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC were incubated with LPS (TLR4 ligand), Pam3CSK4 (TLR2 ligand), poly(I:C) (TLR3 ligand), or flagellin (TLR5 ligand) for 48 h. Cells were extensively washed and cocultured with highly purified naive CD4+CD45RA+CD45RO T cells for 14 days. Subsequently, T cells were restimulated with PMA and ionomycin in the presence of brefeldin A. IL-4 and IFN-γ expression was determined by intracellular staining and analyzed by flow cytometry. A representative experiment of the three performed is presented.

FIGURE 5.

TDC show a reduced ability to polarize Th1 responses. MoDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC were incubated with LPS (TLR4 ligand), Pam3CSK4 (TLR2 ligand), poly(I:C) (TLR3 ligand), or flagellin (TLR5 ligand) for 48 h. Cells were extensively washed and cocultured with highly purified naive CD4+CD45RA+CD45RO T cells for 14 days. Subsequently, T cells were restimulated with PMA and ionomycin in the presence of brefeldin A. IL-4 and IFN-γ expression was determined by intracellular staining and analyzed by flow cytometry. A representative experiment of the three performed is presented.

Close modal

MoDC stimulated by TLR agonists mainly polarized Th1 responses as reflected by the higher percentages of IFN-γ-producing cells, although a mixed phenotype of Th1/Th2-differentiated T cells was observed in all of the conditions analyzed. Flagellin provided the most evident Th1 polarization by moDC, resulting in a large population of cells already differentiated to produce IFN-γ (70%) after 2 wk of culture. Unlike moDC, TLR5-stimulated TDC showed an impaired ability to differentiate naive T cells. A dramatic reduction in IFN-γ producing cells (15–20%) together with an increase in the number of IL-4 producing cells that finally could favor Th2 differentiation was observed when naive CD4+ T lymphocytes were primed with flagellin-exposed tolerogenic DC.

Irrespective of the TLR ligand used, IL-10-DC were unable to inhibit Th1 polarization. Our results suggest that both DX-DC and 1,25(OH)2D3-DC may polarize T cells toward a Th2/Treg lineage rather than a Th1 lineage, in contrast to IL-10-DC and moDC.

TLR-induced maturation elicits a down-regulation of some TLR transcripts, resulting in a decreased response to TLR-ligands in mature DC (5, 49). To investigate whether tolerogenic DC also down-regulate their TLR upon maturation, we examined TLR transcripts in tolerogenic DC triggered by the TLR4 ligand LPS. All DC subtypes, including moDC, showed a profound decrease in TLR4, TLR5, and TLR6 (Table III). In contrast to moDC, TLR2 expression was significantly increased after LPS stimulation in all three tolerogenic DC cultures, both at the transcript (Fig. 6,A; Table III) and the protein levels (Fig. 6 B).

Table III.

TLR repertoire on LPS-stimulated tolerogenic DCa

moDCIL-10-DCDX-DC1,25(OH)2D3-DC
TLR1 0.62 ± 0.19 0.97 ± 0.23 1.67 ± 0.80 1.55 ± 0.37b 
TLR2 2.94 ± 0.66 7.88 ± 1.81b 37.23 ± 4.11b 9.25 ± 1.48b 
TLR3 0.60 ± 0.30 1.25 ± 0.72 0.08 ± 0.04b 0.43 ± 0.21 
TLR4 1.06 ± 0.36 1.46 ± 0.84 5.19 ± 1.63b 1.24 ± 0.21 
TLR5 0.03 ± 0.01 0.15 ± 0.08 0.32 ± 0.14b 0.04 ± 0.01 
TLR6 0.07 ± 0.02 0.17 ± 0.05 0.23 ± 0.08 0.17 ± 0.05 
TLR7 0.50 ± 0.25 0.27 ± 0.08 0.05 ± 0.02b 0.12 ± 0.08b 
TLR8 2.03 ± 1.11 1.92 ± 0.36 0.63 ± 0.26 2.03 ± 0.33 
TLR10 0.02 ± 0.01 0.04 ± 0.01 0.03 ± 0.03 0.00 ± 0.00 
moDCIL-10-DCDX-DC1,25(OH)2D3-DC
TLR1 0.62 ± 0.19 0.97 ± 0.23 1.67 ± 0.80 1.55 ± 0.37b 
TLR2 2.94 ± 0.66 7.88 ± 1.81b 37.23 ± 4.11b 9.25 ± 1.48b 
TLR3 0.60 ± 0.30 1.25 ± 0.72 0.08 ± 0.04b 0.43 ± 0.21 
TLR4 1.06 ± 0.36 1.46 ± 0.84 5.19 ± 1.63b 1.24 ± 0.21 
TLR5 0.03 ± 0.01 0.15 ± 0.08 0.32 ± 0.14b 0.04 ± 0.01 
TLR6 0.07 ± 0.02 0.17 ± 0.05 0.23 ± 0.08 0.17 ± 0.05 
TLR7 0.50 ± 0.25 0.27 ± 0.08 0.05 ± 0.02b 0.12 ± 0.08b 
TLR8 2.03 ± 1.11 1.92 ± 0.36 0.63 ± 0.26 2.03 ± 0.33 
TLR10 0.02 ± 0.01 0.04 ± 0.01 0.03 ± 0.03 0.00 ± 0.00 
a

TLR expression was measured by real-time quantitative PCR on moDC and the tolerogenic IL-10-DC, DX-DC and 1,25(OH)2D3-DC harvested at day 5 after overnight LPS stimulation (10 ng/ml). Relative abundance using GAPDH as the endogenous reference gene is shown. Data represent the average ± SD from at least five independent experiments. TLR9 expression was below detection limit in all cells analyzed. Data represent the average ± SD from at least five donors.

b

p < 0.05, indicating significant differences to moDC (Mann-Whitney U test).

FIGURE 6.

Only TDC enhance TLR2 expression upon exposure to certain TLR stimuli. A, TLR1, TLR2, or TLR6 expression was measured by real-time RT-PCR on moDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC after 18 h of LPS stimulation using GAPDH as the endogenous reference gene (Rel. Ab.). Data are presented as the average ± SD of the relative abundance from at least five independent experiments. Significant differences to moDC were determined by a Mann-Whitney U test; ∗, p < 0.05. B, TLR2 expression was measured by flow cytometry on LPS-stimulated tolerogenic DC. The percentage of positive cells and mean fluorescence intensity (MFI) of the positive cells are shown. Dashed line histograms correspond to isotype control mAb staining. Data are representative of three different experiments performed. C, TLR2 expression was measured by real-time RT-PCR using GAPDH as the endogenous reference gene on mo-DC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC after 18 h of incubation with Pam3CSK4 (TLR2 ligand), poly(I:C) (TLR3 ligand), or flagellin (TLR5). Data represent the fold increase in TLR2 relative abundance on TLR-stimulated cells vs nonstimulated cells. D, TLR2 expression was measured on TLR2-, TLR3-, and TLR5-triggered DX-DC by flow cytometry. Filled histograms represent TLR2 expression on resting cells, solid line histograms correspond to stimulated cells, and dashed line histograms represent isotype control mAb staining. Data are representative of the three different experiments performed. E, TLR4-stimulated DX-DC were pretreated with MAPK p38 inhibitor SB203580 for 1 h before an 18-h stimulation with LPS, and TLR2 expression was evaluated by real time RT-PCR using GAPDH as the endogenous reference gene. One representative experiment of the three performed is presented. F, IL-10 production was determined in supernatants from LPS-primed DX-DC (18 h) and restimulated with the TLR2 agonist Pam3CSK4 for an additional 24 h.

FIGURE 6.

Only TDC enhance TLR2 expression upon exposure to certain TLR stimuli. A, TLR1, TLR2, or TLR6 expression was measured by real-time RT-PCR on moDC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC after 18 h of LPS stimulation using GAPDH as the endogenous reference gene (Rel. Ab.). Data are presented as the average ± SD of the relative abundance from at least five independent experiments. Significant differences to moDC were determined by a Mann-Whitney U test; ∗, p < 0.05. B, TLR2 expression was measured by flow cytometry on LPS-stimulated tolerogenic DC. The percentage of positive cells and mean fluorescence intensity (MFI) of the positive cells are shown. Dashed line histograms correspond to isotype control mAb staining. Data are representative of three different experiments performed. C, TLR2 expression was measured by real-time RT-PCR using GAPDH as the endogenous reference gene on mo-DC, IL-10-DC, DX-DC, and 1,25(OH)2D3-DC after 18 h of incubation with Pam3CSK4 (TLR2 ligand), poly(I:C) (TLR3 ligand), or flagellin (TLR5). Data represent the fold increase in TLR2 relative abundance on TLR-stimulated cells vs nonstimulated cells. D, TLR2 expression was measured on TLR2-, TLR3-, and TLR5-triggered DX-DC by flow cytometry. Filled histograms represent TLR2 expression on resting cells, solid line histograms correspond to stimulated cells, and dashed line histograms represent isotype control mAb staining. Data are representative of the three different experiments performed. E, TLR4-stimulated DX-DC were pretreated with MAPK p38 inhibitor SB203580 for 1 h before an 18-h stimulation with LPS, and TLR2 expression was evaluated by real time RT-PCR using GAPDH as the endogenous reference gene. One representative experiment of the three performed is presented. F, IL-10 production was determined in supernatants from LPS-primed DX-DC (18 h) and restimulated with the TLR2 agonist Pam3CSK4 for an additional 24 h.

Close modal

Because TLR2 can heterodimerize with TLR1 or TRL6 (43, 44), we examined TLR1 and TLR6 mRNA expression upon LPS stimulation in all populations (Fig. 6,A). Whereas TLR1 levels remained constant (Fig. 6,A; Tables II and III), TLR6 transcripts diminished upon LPS stimulation. Therefore, TLR2/TLR1 heterodimerization might be favored on semimature tolerogenic DC.

To determine whether TLR2 up-regulation on tolerogenic DC is restricted to TLR4 triggering, we investigated TLR2 expression on TDC stimulated with either Pam3CSK4 (TLR2 ligand), flagellin (TLR5 ligand), and poly(I:C) (TLR3 ligand), respectively (Fig. 6, C and D). All of these TLR agonists were capable of enhancing TLR2 transcripts and protein levels on DX-DC and 1,25(OH)2D3-DC (Fig. 6, C and D), whereas moDC showed a clear TLR2 down-regulation and IL-10-DC failed to increase TLR2 expression under these conditions (Fig. 6 C).

The regulation of TLR2 expression in epithelial cells has been shown to be dependent on the intracellular signaling protein p38MAPK (50). Using the specific inhibitor SB203580, we could demonstrate the involvement of p38MAPK in the LPS-dependent up-regulation of TLR2 on DX-DC (Fig. 6 E). TLR2 up-regulation could be also partially abrogated on LPS-treated IL-10-DC and 1,25(OH)2D3-DC pretreated with SB203580 (data not shown). Likewise, p38MAP kinase inhibition before TLR2, TLR3, and TLR5 engagement on DX-DC and 1,25(OH)2D3-DC resulted in a partial block of TLR2 up-regulation (data not shown).

Next we examined whether TLR2-mediated signals on primed cells could influence cytokine production. DX-DC were first triggered by LPS to induce an increase in TLR2 expression. After washing out the agonist, DX-DC were additionally stimulated for 24 h in the presence of the TLR2 agonist Pam3CSK4, and cytokine production was assessed. We observed an increased IL-10 production by TLR2-stimulated LPS-primed DX-DC (Fig. 6 F), whereas IL-10 was undetectable on moDC under the same conditions (data not shown). TLR2 up-regulation lead to a reduced proinflammatory profile, because levels of proinflammatory cytokines such as IL-12p70 and IL12-p40 were absent and TNF-α and IL-6 remained low (data not shown).

Despite extensive literature on TLR expression on DC subsets in both mice and humans, little is known about the TLR repertoire on TDC and their response upon TLR-ligand engagement. In this study we analyzed and compared for the first time the TLR repertoire and the innate characteristics of three different types of TDC.

DC can be manipulated to induce peripheral tolerance by a variety of cytokines, growth factors, and immunosuppressive agents (2, 24). The addition of IL-10, DX, or 1,25(OH)2-D3 during the differentiation process yields DC displaying tolerogenic features that inhibit T cell proliferation. T cells exposed to IL-10-DC or DX-DC showed a reduced ability to proliferate when rechallenged with immunocompetent moDC, indicating that tolerogenic IL-10-DC and DX-DC have anergized this population. DC modulated with 1,25(OH)2D3 hardly induced T cell proliferation in the first round and only small cell numbers could be collected from primary cultures, indicating that the tolerogenic mechanism of 1,25(OH)2D3, primarily exist in the active deletion of T cells. The IL-10-DC, DX-DC, and 1,25(OH)2D3-DC included in our study showed an incomplete or altered status of DC maturation as defined by low to intermediate expression levels of MHC II, costimulatory molecules (CD80 and CD86), and CCR7, in addition to a poor ability to stimulate allogeneic T cells. Moreover, the expression of molecules associated with DC tolerogenicity, such as ILT3 (24) or GILZ (39), was increased in all three modulated DC. The reduced ability to secrete the proinflammatory cytokine IL-12p70 together with enhanced IL-10 secretion might be crucial for the development of their tolerogenic function. The features displayed by these modulated DC are compatible with the documented features of tolerogenic DC (25, 26, 27).

In this study we demonstrated that three different types of in vitro modulated tolerogenic DC display the same set of TLR as immunogenic moDC, although with slight differences in their expression levels, especially TLR2 and TLR4 on DX-DC, as previously described (41). Because TLR activation is essential to initiate DC maturation and the subsequent induction of adaptive responses (1, 4), we investigated whether TLR triggering by TLR2 (Pam3CSK4), TLR3 (poly(I:C)), TLR4 (LPS), and TLR5 (flagellin) ligands resulted in equivalent immunological outcomes for both tolerogenic and immunogenic populations. Our data clearly demonstrate that tolerogenic DC responded differently to TLR-mediated signals than immunogenic DC

Firstly, we showed that the above-mentioned TLR ligands induced different patterns of maturation on TDC than on moDC. Whereas maturation of moDC was induced by TLR stimulation (1, 47), TDC partially retained their ability to undergo maturation, displaying low to intermediate levels of CD80, CD86, and CCR7. Secondly, TDC exhibited a significantly reduced ability to stimulate allogeneic T cells in primary cultures and, more importantly, acted as inducers of T cell anergy in restimulation assays. Thirdly, upon TLR-mediated activation, in contrast to moDC the TDC secreted considerable amounts of the anti-inflammatory and suppressive cytokine IL-10 (51) but were incapable of releasing IL-12p70, especially upon TLR4 and TLR5 triggering. Also, the potential of TDC to produce other proinflammatory IL-12-related cytokines (IL-23 and IL-27) was reduced compared with that of moDC due to the lower IL-23p19 and IL-27p28 transcript levels. This cytokine profile of the TDC is consistent with the reduced Th1-inducing capacity (47, 48) that was specially hampered on TDC upon TLR5 stimulation.

Furthermore, TDC not only showed reduced allostimulatory T cell responses irrespective of the TLR triggered, but also were capable of anergizing primed T cells regardless of the given primary stimuli. TLR-mediated signals on TDC might be important in recovering the homeostatic conditions after inflammation and/or the induction of Treg. Modulated TDC are reported to generate Treg involved in T cell suppression (52, 53). All tolerogenic populations analyzed up-regulated IL-10 upon stimulation, especially DX-DC. IL-10 is a key cytokine for its ability to induce Treg differentiation and the inhibition of the effector functions of several cell types (50). The high levels of IL-10 secreted by TLR-triggered DX-DC, together with the low expression of proinflammatory cytokines (TNF-α, IL-6, and IL12-related), indicates that DX-DC would be the best inducers of anti-inflammatory responses. Moreover, the lower levels of costimulatory molecules in combination with their defined anti-inflammatory cytokine profile and their anergy capacity may account for their reduced potential to drive differentiation of naive T cells into effector T cells as suggested elsewhere (54, 55). Because IL-12-related cytokines are necessary to sustain IFN-γ production and Th1 differentiation (56), we hypothesized that TDC may polarize Th2-like responses (57). Indeed, we observed a dramatic reduction in IFN-γ-producing cells (15–20%) in conjunction with an increase in the number of IL-4-producing cells. Importantly, 1,25(OH)2D3-DC possess the strongest capacity to drive the polarization of Th2-like responses irrespective of the TLR triggered. In addition to their semimature phenotype, tolerogenic 1,25(OH)2D3-DC secreted high amounts of IL-6 upon stimulation that is known to suppress IL12-mediated Th1 cell skewing (58). In the absence of detectable amounts of IL-4, the cytokine IL-6 is not able to induce a pure Th2 response but is at least capable of preventing the induction of Th1 responses (Fig. 5), as shown by others (59). Whereas TLR signaling on immunologically competent DC was reported to differentially modulate Th cell responses depending on the ligand used (60, 61), stimulated TDC instructed anergy induction and a Th2-like anti-inflammatory program regardless of the TLR triggered. Optimal effects in Th1 interference were also observed by DX-DC stimulated with LPS and flagellin.

Analysis of TLR transcripts after LPS stimulation strikingly revealed TLR2 up-regulation only by TDC. It has been documented that TLR2 is up-regulated in response to injury (62), glucocorticoids (50), proinflammatory cytokines (63), or bacterial products (63). We extend these data by showing that TLR2 up-regulation on tolerogenic DX-DC and 1,25(OH)2D3-DC was also achieved by triggering TLR4, TLR2, TLR5, or TLR3, whereas on IL-10-DC the up-regulation of TLR2 was only TLR4 mediated. TLR2 associated with TLR6 in Yersinia pestis-infected mouse DC to induce tolerogenic DC and Tr1 cells, whereas TLR2/TLR1 association promoted inflammatory DC and T cell differentiation (64). Our findings suggest that TLR2/1 and TLR2/6 heterodimers are potentially expressed on stimulated TDC, although the former dimer might be favored. Given the importance of TLR2 in host defense (65), it is tempting to speculate that TLR2 up-regulation on TDC would enhance the inflammatory responses to infection. However, we demonstrated that DX-DC, expressing high levels of TLR2 upon LPS priming, responded to TLR2 stimulation with an anti-inflammatory-like program characterized by enhanced IL-10 production, low levels of TNF-α, and no IL-12p70/p40. This refractoriness to TLR2 restimulation was also described recently on murine bone marrow DC (66). In line with this, patients with severe sepsis undergo long-term systemic and local immunosuppression despite their increased TLR2 expression (67, 68, 69). TLR2-derived signals from Candida albicans or schistosome infections, among others, drive immunosuppression by IL-10 production and Treg induction (70, 71).

Furthermore, TLR2 has been shown to participate in the induction of peripheral tolerance (72) and, recently, in the promotion of T regulatory responses leading to protection against autoimmune diseases in vivo (73, 74). Dillon et al. showed that the TLR2 ligand zymosan induces regulatory DC and TGF-β1-producing macrophages that promote immunological tolerance (72). TLR2 signaling is also crucial for Treg induction and suppression of IL-23, Th17, and Th1-mediated autoimmune responses in an experimental autoimmune encephalomyelitis model (74). Likewise, TLR2 controls the function of Treg and regulates IFN-γ producing Th1 cells in a model of arthritis (73). Also, TLR2 activation in mice mediates IL-10 up-regulation and Treg survival (70, 75). In humans, hsp60 triggers TLR2 to enhance the suppressive function of human Treg cells (76, 77, 78). Therefore, TLR2 triggering on activated TDC may contribute to a negative feedback of inflammation and/or tolerance induction.

The regulation of TLR2 expression has been only partly elucidated (50, 79, 80). In human monocytes and murine macrophages, TLR2 up-regulation is mediated by chromatin remodeling (80) and histone acetylation (79), respectively, whereas in epithelial cells p38MAP kinase acts as a negative regulator of TLR2 up-regulation (81). In contrast to epithelial cells, our results and those of An et al. (82) indicate that p38MAP kinase is partly responsible for the TLR2 up-regulation observed on stimulated TDC. Preliminary results using inhibitors of NF-κB translocation and acetylation transferases suggest an additional role for the transcription factor NF-κB and histone acetylation in the up-regulation of TLR2 on stimulated tolerogenic DC (data not shown). Whether these events facilitate the access of transcription factors such as NF-κB (79) or others (83) to the TLR2 promotor for modulating TLR2 enhancement and other functional capacities on TDC requires further studies.

Based on our study we conclude that tolerogenic DX-DC and 1,25(OH)2D3-DC may be the best candidates for immunotherapy due to their strong tolerogenic properties and their resistance to a full TLR-mediated maturation. Furthermore, TLR2 up-regulation and activation might even enhance their tolerogenic properties.

We thank Dr. S. I. Gringhuis (Vrije University Medical Center) for providing the signaling inhibitors.

The authors have no financial conflict of interest.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported in part by Postdoctoral Fellowship Grant EX2005-010 from the Ministry of Education and Science of Spain (to S.C.), Multiple Sclerosis Research Grant 06-598 (to J.J.G.-V.), Juvenile Diabetes Research Foundation Program Grant 7-2005-877 (to W.W.J.U. and S.L.), and Netherlands Organization for Scientific Research (NWO) Pioneer Grant 900-02-002 (to J.J G.-V. and Y.v.K.).

4

Abbreviations used in this paper: DC; dendritic cell; Ct, cycle threshold; DX, dexamethasone; GILZ, glucocorticoid-induced leucine zipper; ILT3, Ig-like-transcript 3; MHC-II, MHC class II; moDC, monocyte-derived DC; (1,25(OH)2D3, 1α,25-dihydroxyvitamin D3; OX40-L, OX40 ligand; poly(I:C), polyinosinic-polycytidylic acid; TDC, tolerogenic DC; Treg, regulatory T cell.

1
Banchereau, J., R. M. Steinman.
1998
. Dendritic cells and the control of immunity.
Nature
392
:
245
-252.
2
Steinman, R. M., D. Hawiger, M. C. Nussenzweig.
2003
. Tolerogenic dendritic cells.
Annu. Rev. Immunol.
21
:
685
-711.
3
Iwasaki, A., R. Medzhitov.
2004
. Toll-like receptor control of the adaptive immune responses.
Nat. Immunol.
5
:
987
-995.
4
Medzhitov, R..
2001
. Toll-like receptors and innate immunity.
Nat. Rev. Immunol.
1
:
135
-145.
5
Takeda, K., T. Kaisho, S. Akira.
2003
. Toll-like receptors.
Annu. Rev. Immunol.
21
:
335
-376.
6
Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, C. J. Kirschning.
1999
. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by Toll-like receptor 2.
J. Biol. Chem.
274
:
17406
-17409.
7
Takeuchi, O., S. Sato, T. Horiuchi, K. Hoshino, K. Takeda, Z. Dong, R. L. Modlin, S. Akira.
2002
. Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins.
J. Immunol.
169
:
10
-14.
8
Asea, A., M. Rehli, E. Kabingu, J. A. Boch, O. Bare, P. E. Auron, M. A. Stevenson, S. K. Calderwood.
2002
. Novel signal transduction pathway utilized by extracellular HSP70: role of Toll-like receptor (TLR) 2 and TLR4.
J. Biol. Chem.
277
:
15028
-15034.
9
Hasan, U., C. Chaffois, C. Gaillard, V. Saulnier, E. Merck, S. Tancredi, C. Guiet, F. Briere, J. Vlach, S. Lebecque, et al
2005
. Human TLR10 is a functional receptor, expressed by B cells and plasmacytoid dendritic cells, which activates gene transcription through MyD88.
J. Immunol.
174
:
2942
-2950.
10
Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill, A. Aderem.
2001
. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.
Nature
410
:
1099
-1103.
11
Alexopoulou, L., A. C. Holt, R. Medzhitov, R. A. Flavell.
2001
. Recognition of double-stranded RNA and activation of NF-κB by Toll-like receptor 3.
Nature
413
:
732
-738.
12
Heil, F., H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira, G. Lipford, H. Wagner, S. Bauer.
2004
. Species-specific recognition of single-stranded RNA via Toll-like receptor 7 and 8.
Science
303
:
1526
-1529.
13
Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira.
2000
. A Toll-like receptor recognizes bacterial DNA.
Nature
408
:
740
-745.
14
Ito, T., R. Amakawa, T. Kaisho, H. Hemmi, K. Tajima, K. Uehira, Y. Ozaki, H. Tomizawa, S. Akira, S. Fukuhara.
2002
. Interferon-α and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets.
J. Exp. Med.
195
:
1507
-1512.
15
Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, Y. J. Liu.
2001
. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens.
J. Exp. Med.
194
:
863
-869.
16
Krug, A., A. Towarowski, S. Britsch, S. Rothenfusser, V. Hornung, R. Bals, T. Giese, H. Engelmann, S. Endres, A. M. Krieg, G. Hartmann.
2001
. Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12.
Eur. J. Immunol.
31
:
3026
-3037.
17
Jarrossay, D., G. Napolitani, M. Colonna, F. Sallusto, A. Lanzavecchia.
2001
. Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells.
Eur. J. Immunol.
31
:
3388
-3393.
18
Matsumoto, M., K. Funami, M. Tanabe, H. Oshiumi, M. Shingai, Y. Seto, A. Yamamoto, T. Seya.
2003
. Subcellular localization of Toll-like receptor 3 in human dendritic cells.
J. Immunol.
171
:
3154
-3162.
19
Muzio, M., D. Bosisio, N. Polentarutti, G. D'amico, A. Stoppacciaro, R. Mancinelli, V. C. van't, G. Penton-Rol, L. P. Ruco, P. Allavena, A. Mantovani.
2000
. Differential expression and regulation of Toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells.
J. Immunol.
164
:
5998
-6004.
20
Visintin, A., A. Mazzoni, J. H. Spitzer, D. H. Wyllie, S. K. Dower, D. M. Segal.
2001
. Regulation of Toll-like receptors in human monocytes and dendritic cells.
J. Immunol.
166
:
249
-255.
21
Flacher, V., M. Bouschbacher, E. Verronese, C. Massacrier, V. Sisirak, O. Berthier-Vergnes, B. de Saint-Vis, C. Caux, C. Dezutter-Dambuyant, S. Lebecque, J. Valladeau.
2006
. Human Langerhans cells express a specific TLR profile and differentially respond to viruses and Gram-positive bacteria.
J. Immunol.
177
:
7959
-7967.
22
van der Aar, A. M., R. M. Sylva-Steenland, J. D. Bos, M. L. Kapsenberg, E. C. de Jong, M. B. Teunissen.
2007
. Loss of TLR2, TLR4, and TLR5 on Langerhans cells abolishes bacterial recognition.
J. Immunol.
178
:
1986
-1990.
23
Penna, G., N. Giarratana, S. Amuchastegui, R. Mariani, K. C. Daniel, L. Adorini.
2005
. Manipulating dendritic cells to induce regulatory T cells.
Microbes Infect.
7
:
1033
-1039.
24
Rutella, S., S. Danese, G. Leone.
2006
. Tolerogenic dendritic cells: cytokine modulation comes of age.
Blood
108
:
1435
-1440.
25
Penna, G., L. Adorini.
2000
. 1α,25-Dihydroxyvitamin D3 inhibits differentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive T cell activation.
J. Immunol.
164
:
2405
-2411.
26
Piemonti, L., P. Monti, P. Allavena, M. Sironi, L. Soldini, B. E. Leone, C. Socci, C. Di, V.
1999
. Glucocorticoids affect human dendritic cell differentiation and maturation.
J. Immunol.
162
:
6473
-6481.
27
Steinbrink, K., M. Wolfl, H. Jonuleit, J. Knop, A. H. Enk.
1997
. Induction of tolerance by IL-10-treated dendritic cells.
J. Immunol.
159
:
4772
-4780.
28
Piemonti, L., P. Monti, P. Allavena, B. E. Leone, A. Caputo, V. Di Carlo.
1999
. Glucocorticoids increase the endocytic activity of human dendritic cells.
Int. Immunol.
11
:
1519
-1526.
29
Steinbrink, K., H. Jonuleit, G. Muller, G. Schuler, J. Knop, A. H. Enk.
1999
. Interleukin-10-treated human dendritic cells induce a melanoma-antigen-specific anergy in CD8+ T cells resulting in a failure to lyse tumor cells.
Blood
93
:
1634
-1642.
30
Steinbrink, K., E. Graulich, S. Kubsch, J. Knop, A. H. Enk.
2002
. CD4+ and CD8+ anergic T cells induced by interleukin-10-treated human dendritic cells display antigen-specific suppressor activity.
Blood
99
:
2468
-2476.
31
Kubsch, S., E. Graulich, J. Knop, K. Steinbrink.
2003
. Suppressor activity of anergic T cells induced by IL-10-treated human dendritic cells: association with IL-2- and CTLA-4-dependent G1 arrest of the cell cycle regulated by p27Kip1.
Eur. J. Immunol.
33
:
1988
-1997.
32
Penna, G., A. Roncari, S. Amuchastegui, K. C. Daniel, E. Berti, M. Colonna, L. Adorini.
2005
. Expression of the inhibitory receptor ILT3 on dendritic cells is dispensable for induction of CD4+Foxp3+ regulatory T cells by 1,25-dihydroxyvitamin D3.
Blood
106
:
3490
-3497.
33
Rutella, S., R. M. Lemoli.
2004
. Regulatory T cells and tolerogenic dendritic cells: from basic biology to clinical applications.
Immunol. Lett.
94
:
11
-26.
34
Lang, K. S., M. Recher, T. Junt, A. A. Navarini, N. L. Harris, S. Freigang, B. Odermatt, C. Conrad, L. M. Ittner, S. Bauer, et al
2005
. Toll-like receptor engagement converts T-cell autoreactivity into overt autoimmune disease.
Nat. Med.
11
:
138
-145.
35
Sallusto, F., A. Lanzavecchia.
1994
. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor α.
J. Exp. Med.
179
:
1109
-1118.
36
Garcia-Vallejo, J. J., B. Van Het Hof, J. Robben, J. A. Van Wijk, I. Van Die, D. H. Joziasse, W. Van Dijk.
2004
. Approach for defining endogenous reference genes in gene expression experiments.
Anal. Biochem.
329
:
293
-299.
37
Snijders, A., C. M. Hilkens, T. C. van der Pouw Kraan, M. Engel, L. A. Aarden, M. L. Kapsenberg.
1996
. Regulation of bioactive IL-12 production in lipopolysaccharide-stimulated human monocytes is determined by the expression of the p35 subunit.
J. Immunol.
156
:
1207
-1212.
38
Cohen, N., E. Mouly, H. Hamdi, M. C. Maillot, M. Pallardy, V. Godot, F. Capel, A. Balian, S. Naveau, P. Galanaud, et al
2006
. GILZ expression in human dendritic cells redirects their maturation and prevents antigen-specific T lymphocyte response.
Blood
107
:
2037
-2044.
39
Hamdi, H., V. Godot, M. C. Maillot, M. V. Prejean, N. Cohen, R. Krzysiek, F. M. Lemoine, W. Zou, D. Emilie.
2007
. Induction of antigen-specific regulatory T lymphocytes by human dendritic cells expressing the glucocorticoid-induced leucine zipper.
Blood
110
:
211
-219.
40
Berrebi, D., S. Bruscoli, N. Cohen, A. Foussat, G. Migliorati, L. Bouchet-Delbos, M. C. Maillot, A. Portier, J. Couderc, P. Galanaud, et al
2003
. Synthesis of glucocorticoid-induced leucine zipper (GILZ) by macrophages: an anti-inflammatory and immunosuppressive mechanism shared by glucocorticoids and IL-10.
Blood
101
:
729
-738.
41
Rozkova, D., R. Horvath, J. Bartunkova, R. Spisek.
2006
. Glucocorticoids severely impair differentiation and antigen presenting function of dendritic cells despite upregulation of Toll-like receptors.
Clin. Immunol.
120
:
260
-271.
42
Sanchez-Sanchez, N., L. Riol-Blanco, J. L. Rodriguez-Fernandez.
2006
. The multiple personalities of the chemokine receptor CCR7 in dendritic cells.
J. Immunol.
176
:
5153
-5159.
43
D'amico, G., G. Frascaroli, G. Bianchi, P. Transidico, A. Doni, A. Vecchi, S. Sozzani, P. Allavena, A. Mantovani.
2000
. Uncoupling of inflammatory chemokine receptors by IL-10: generation of functional decoys.
Nat. Immunol.
1
:
387
-391.
44
Sordi, V., G. Bianchi, C. Buracchi, A. Mercalli, F. Marchesi, G. D'amico, C. H. Yang, W. Luini, A. Vecchi, A. Mantovani, et al
2006
. Differential effects of immunosuppressive drugs on chemokine receptor CCR7 in human monocyte-derived dendritic cells: selective upregulation by rapamycin.
Transplantation
82
:
826
-834.
45
Ito, T., Y. H. Wang, O. Duramad, S. Hanabuchi, O. A. Perng, M. Gilliet, F. X. Qin, Y. J. Liu.
2006
. OX40 ligand shuts down IL-10-producing regulatory T cells.
Proc. Natl. Acad. Sci. USA
103
:
13138
-13143.
46
Medzhitov, R., C. Janeway, Jr.
2000
. Innate immune recognition: mechanisms and pathways.
Immunol. Rev.
173
:
89
-97.
47
Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu, B. Pulendran, K. Palucka.
2000
. Immunobiology of dendritic cells.
Annu. Rev. Immunol.
18
:
767
-811.
48
Costa-Rodríguez, E. V., G. Napolitani, A. Lanzavecchia, F. Sallusto.
2007
. Interleukins 1β and 6 but not transforming growth factor-β are essential for the differentiation of interleukin 17-producing human T helper cells.
Nat. Immunol.
8
:
942
-949.
49
Liew, F. Y., D. Xu, E. K. Brint, L. A. O'Neill.
2005
. Negative regulation of Toll-like receptor-mediated immune responses.
Nat. Rev. Immunol.
5
:
446
-458.
50
Shuto, T., A. Imasato, H. Jono, A. Sakai, H. Xu, T. Watanabe, D. D. Rixter, H. Kai, A. Andalibi, F. Linthicum, et al
2002
. Glucocorticoids synergistically enhance nontypeable Haemophilus influenzae-induced Toll-like receptor 2 expression via a negative cross-talk with p38 MAP kinase.
J. Biol. Chem.
277
:
17263
-17270.
51
Moore, K. W., M. R. de Waal, R. L. Coffman, A. O'Garra.
2001
. Interleukin-10 and the interleukin-10 receptor.
Annu. Rev. Immunol.
19
:
683
-765.
52
Wakkach, A., N. Fournier, V. Brun, J. P. Breittmayer, F. Cottrez, H. Groux.
2003
. Characterization of dendritic cells that induce tolerance and T regulatory 1 cell differentiation in vivo.
Immunity
18
:
605
-617.
53
Gregori, S., M. Casorati, S. Amuchastegui, S. Smiroldo, A. M. Davalli, L. Adorini.
2001
. Regulatory T cells induced by 1α,25-dihydroxyvitamin D3 and mycophenolate mofetil treatment mediate transplantation tolerance.
J. Immunol.
167
:
1945
-1953.
54
de Jong, E. C., H. H. Smits, M. L. Kapsenberg.
2005
. Dendritic cell-mediated T cell polarization.
Springer Semin. Immunopathol.
26
:
289
-307.
55
Smits, H. H., E. C. de Jong, E. A. Wierenga, M. L. Kapsenberg.
2005
. Different faces of regulatory DCs in homeostasis and immunity.
Trends Immunol.
26
:
123
-129.
56
Trinchieri, G..
2003
. Interleukin-12 and the regulation of innate resistance and adaptive immunity.
Nat. Rev. Immunol.
3
:
133
-146.
57
Mazzoni, A., D. M. Segal.
2004
. Controlling the Toll road to dendritic cell polarization.
J. Leukocyte Biol.
75
:
721
-730.
58
Diehl, S., M. Rincon.
2002
. The two faces of IL-6 on Th1/Th2 differentiation.
Mol. Immunol.
39
:
531
-536.
59
Jones, S. A..
2005
. Directing transition from innate to acquired immunity: defining a role for IL-6.
J. Immunol.
175
:
3463
-3468.
60
Agrawal, S., A. Agrawal, B. Doughty, A. Gerwitz, J. Blenis, D. T. Van, B. Pulendran.
2003
. Cutting edge: different Toll-like receptor agonists instruct dendritic cells to induce distinct Th responses via differential modulation of extracellular signal-regulated kinase-mitogen-activated protein kinase and c-Fos.
J. Immunol.
171
:
4984
-4989.
61
Dillon, S., A. Agrawal, D. T. Van, G. Landreth, L. McCauley, A. Koh, C. Maliszewski, S. Akira, B. Pulendran.
2004
. A Toll-like receptor 2 ligand stimulates Th2 responses in vivo, via induction of extracellular signal-regulated kinase mitogen-activated protein kinase and c-Fos in dendritic cells.
J. Immunol.
172
:
4733
-4743.
62
Schauber, J., R. A. Dorschner, A. B. Coda, A. S. Buchau, P. T. Liu, D. Kiken, Y. R. Helfrich, S. Kang, H. Z. Elalieh, A. Steinmeyer, et al
2007
. Injury enhances TLR2 function and antimicrobial peptide expression through a vitamin D-dependent mechanism.
J. Clin. Invest.
117
:
803
-811.
63
Matsuguchi, T., T. Musikacharoen, T. Ogawa, Y. Yoshikai.
2000
. Gene expressions of Toll-like receptor 2, but not Toll-like receptor 4, is induced by LPS and inflammatory cytokines in mouse macrophages.
J. Immunol.
165
:
5767
-5772.
64
Depaolo, R. W., F. Tang, I. Kim, M. Han, N. Levin, N. Ciletti, A. Lin, D. Anderson, O. Schneewind, B. Jabri.
2008
. Toll-like receptor 6 drives differentiation of tolerogenic dendritic cells and contributes to LcrV-mediated plague pathogenesis.
Cell Host Microbe
4
:
350
-361.
65
Takeuchi, O., K. Hoshino, S. Akira.
2000
. Cutting edge: TLR2-deficient and MyD88-deficient mice are highly susceptible to Staphylococcus aureus infection.
J. Immunol.
165
:
5392
-5396.
66
Yanagawa, Y., K. Onoe.
2007
. Enhanced IL-10 production by.
J. Immunol.
178
:
6173
-6180.
67
Armstrong, L., A. R. Medford, K. J. Hunter, K. M. Uppington, A. B. Millar.
2004
. Differential expression of Toll-like receptor (TLR)-2 and TLR-4 on monocytes in human sepsis.
Clin. Exp. Immunol.
136
:
312
-319.
68
Harter, L., L. Mica, R. Stocker, O. Trentz, M. Keel.
2004
. Increased expression of Toll-like receptor-2 and -4 on leukocytes from patients with sepsis.
Shock
22
:
403
-409.
69
Viemann, D., G. Dubbel, S. Schleifenbaum, E. Harms, C. Sorg, J. Roth.
2005
. Expression of Toll-like receptors in neonatal sepsis.
Pediatr. Res.
58
:
654
-659.
70
Netea, M. G., R. Sutmuller, C. Hermann, C. A. Van der Graaf, J. W. Van der Meer, J. H. van Krieken, T. Hartung, G. Adema, B. J. Kullberg.
2004
. Toll-like receptor 2 suppresses immunity against Candida albicans through induction of IL-10 and regulatory T cells.
J. Immunol.
172
:
3712
-3718.
71
van der Kleij, D., E. Latz, J. F. Brouwers, Y. C. Kruize, M. Schmitz, E. A. Kurt-Jones, T. Espevik, E. C. de Jong, M. L. Kapsenberg, D. T. Golenbock, et al
2002
. A novel host-parasite lipid cross-talk. schistosomal lyso-phosphatidylserine activates Toll-like receptor 2 and affects immune polarization.
J. Biol. Chem.
277
:
48122
-48129.
72
Dillon, S., S. Agrawal, K. Banerjee, J. Letterio, T. L. Denning, K. Oswald-Richter, D. J. Kasprowicz, K. Kellar, J. Pare, T. Van Dyke, et al
2006
. Yeast zymosan, a stimulus for TLR2 and dectin-1, induces regulatory antigen-presenting cells and immunological tolerance.
J. Clin. Invest.
116
:
916
-928.
73
Abdollahi-Roodsaz, S., L. A. Joosten, M. I. Koenders, I. Devesa, M. F. Roelofs, T. R. Radstake, M. Heuvelmans-Jacobs, S. Akira, M. J. Nicklin, F. Ribeiro-Dias, W. B. van den Berg.
2008
. Stimulation of TLR2 and TLR4 differentially skews the balance of T cells in a mouse model of arthritis.
J. Clin. Invest.
118
:
205
-216.
74
Manicassamy, S., R. Ravindran, J. Deng, H. Oluoch, T. L. Denning, S. P. Kasturi, K. M. Rosenthal, B. D. Evavold, B. Pulendran.
2009
. Toll-like receptor 2-dependent induction of vitamin A-metabolizing enzymes in dendritic cells promotes T regulatory responses and inhibits autoimmunity.
Nat. Med.
15
:
401
-409.
75
Sutmuller, R. P., M. H. den Brok, M. Kramer, E. J. Bennink, L. W. Toonen, B. J. Kullberg, L. A. Joosten, S. Akira, M. G. Netea, G. J. Adema.
2006
. Toll-like receptor 2 controls expansion and function of regulatory T cells.
J. Clin. Invest.
116
:
485
-494.
76
Zanin-Zhorov, A., G. Tal, S. Shivtiel, M. Cohen, T. Lapidot, G. Nussbaum, R. Margalit, I. R. Cohen, O. Lider.
2005
. Heat shock protein 60 activates cytokine-associated negative regulator suppressor of cytokine signaling 3 in T cells: effects on signaling, chemotaxis, and inflammation.
J. Immunol.
175
:
276
-285.
77
Zanin-Zhorov, A., R. Bruck, G. Tal, S. Oren, H. Aeed, R. Hershkoviz, I. R. Cohen, O. Lider.
2005
. Heat shock protein 60 inhibits Th1-mediated hepatitis model via innate regulation of Th1/Th2 transcription factors and cytokines.
J. Immunol.
174
:
3227
-3236.
78
Zanin-Zhorov, A., L. Cahalon, G. Tal, R. Margalit, O. Lider, I. R. Cohen.
2006
. Heat shock protein 60 enhances CD4+CD25+ regulatory T cell function via innate TLR2 signaling.
J. Clin. Invest.
116
:
2022
-2032.
79
Johnson, C. M., R. I. Tapping.
2007
. Microbial products stimulate human Toll-like receptor 2 expression through histone modification surrounding a proximal NF-κB-binding site.
J. Biol. Chem.
282
:
31197
-31205.
80
Wang, T., W. P. Lafuse, K. Takeda, S. Akira, B. S. Zwilling.
2002
. Rapid chromatin remodeling of Toll-like receptor 2 promoter during infection of macrophages with Mycobacterium avium.
J. Immunol.
169
:
795
-801.
81
Imasato, A., C. Desbois-Mouthon, J. Han, H. Kai, A. C. Cato, S. Akira, J. D. Li.
2002
. Inhibition of p38 MAPK by glucocorticoids via induction of MAPK phosphatase-1 enhances nontypeable Haemophilus influenzae-induced expression of Toll-like receptor 2.
J. Biol. Chem.
277
:
47444
-47450.
82
An, H., Y. Yu, M. Zhang, H. Xu, R. Qi, X. Yan, S. Liu, W. Wang, Z. Guo, J. Guo, Z. Qin, X. Cao.
2002
. Involvement of ERK, p38 and NF-κB signal transduction in regulation of TLR2, TLR4 and TLR9 gene expression induced by lipopolysaccharide in mouse dendritic cells.
Immunology
106
:
38
-45.
83
Mikami, F., J. H. Lim, H. Ishinaga, U. H. Ha, H. Gu, T. Koga, H. Jono, H. Kai, J. D. Li. .
2006
. The transforming growth factor-β-Smad3/4 signaling pathway acts as a positive regulator for TLR2 induction by bacteria via a dual mechanism involving functional cooperation with NF-κB and MAPK phosphatase 1-dependent negative cross-talk with p38 MAPK.
J. Biol. Chem.
281
:
22397
-22408.