Patients receiving hematopoietic stem cell transplantation or bone marrow transplantation (BMT) as therapy for various malignancies or autoimmune diseases have an increased risk for infectious complications posttransplant, especially in the lung. We have used BMT in mice and murine gammaherpesvirus, γHV-68, to study the efficacy of adaptive immune responses post-BMT. Five weeks posttransplant, mice have fully reconstituted their hematopoietic lineages in both the lung and periphery. When challenged with virus, however, BMT mice have a reduced ability to clear lytic virus from the lung. Defective viral control in BMT mice is not related to impaired leukocyte recruitment or defective APC function. Rather, BMT mice are characterized by defective CD4 cell proliferation, skewing of effector CD4 T cells from a Th1 to a Th17 phenotype, and an immunosuppressive lung environment at the time of infection that includes overexpression of TGF-β1 and PGE2 and increased numbers of regulatory T cells. Neither indomethacin treatment to block PG synthesis nor anti-CD25 depletion of regulatory T cells improved antiviral host defense post-BMT. Transplanting mice with transgenic bone marrow expressing a dominant-negative TGF-βRII under the permissive CD4 promoter created mice in which effector CD4 and CD8 cells were unresponsive to TGF-β1. Mice with TGF-β1–nonresponsive effector T cells had restored antiviral immunity and improved Th1 responses post-BMT. Thus, our results indicate that overexpression of TGF-β1 following myeloablative conditioning post-BMT results in impaired effector T cell responses to viral infection.

Hematopoietic stem cell transplantation (HSCT), including bone marrow transplantation (BMT), is a therapy that is used to treat both malignant and autoimmune diseases. The source of stem cells for HSCT can either be from the patient (autologous) or from a related or nonrelated donor (allogeneic). Autologous transplants are more frequent than allogeneic transplants (1), and both are associated with a myriad of post-BMT complications including graft failure and graft-versus-host disease (GVHD; in the allogeneic setting), toxicity related to preparative regimens, organ injury, and infections (2).

The lung is particularly vulnerable posttransplant, with pulmonary complications occurring in up to 60% of transplant recipients (3), including opportunistic infection by fungi (4), bacteria (5), and viruses (6). In the past, the development of CMV pneumonia has been a major cause of mortality, with deaths occurring in 85% of cases (7). More effective strategies for detecting virus and treating with antiviral therapy have caused a dramatic decrease in deaths related to CMV pneumonia in recent years (2, 8, 9). Improved outcomes, however, are dependent on treatment with antiviral drugs, and the emergence of viral strains in transplant centers that are resistant to drug therapy (8, 10) highlights the need to better understand the underlying immune responses that occur in transplant patients.

Infectious complications can occur in both autologous and allogeneic transplant recipients (3). Susceptibility to infection posttransplant can occur not only during the period of neutropenia but also postengraftment. Infections are more common in allogeneic recipients (3), presumably because of GVHD, removal of T cells from the inoculum and immunosuppressive therapies used as treatment. Interestingly, although rare, infections can occur late posttransplant in autologous recipients even in the absence of immunosuppressive therapy (11, 12), suggesting that long-term immune dysfunction results from transplantation. Indeed, our laboratory has reported previously that mice undergoing syngeneic BMT were more susceptible to lung infection by Pseudomonas aeruginosa, despite having completely restored their hematopoietic compartment in both the periphery and the lung. This inability to clear P. aeruginosa infection is related to dysfunctional innate immune responses, including defective phagocytosis and killing of bacteria by alveolar macrophages that is mediated by PGE2 (13).

In this study, we explored the possibility that adaptive immune responses were also compromised in the lung following BMT. We chose to study these responses at a time point following BMT when reconstitution of immune cells had occurred, using both syngeneic BMT and allogeneic BMT, which showed no sign of severe GVHD. These models allowed specific insight into the mechanisms of restoration of immune function following transplantation into an irradiated recipient. Importantly, immune dysfunction in these mice was not related to GVHD or immunosuppressive therapy, but simply the transplant procedure itself. Because of the prominence of herpesvirus infections in transplant recipients (3, 6, 14), we chose to use γHV-68 as a model pathogen. γHV-68 is genetically and biologically similar to EBV and human herpesvirus 8 (15). When delivered intranasally (i.n.) to mice, γHV-68 establishes a lytic infection principally in the respiratory epithelium and is subsequently able to establish latency in epithelial cells, B cells, and macrophages (16, 17). γHV-68 infection activates adaptive immune responses, and both CD4 and CD8 T cells are important in controlling infection (18). Specifically, IFN-γ production by CD4 cells has been reported to be critical for the immune response to this virus (19).

Mice that undergo BMT are less able to control lytic γHV-68 infection in the lung when compared with nontransplanted control mice. This difference cannot be explained by a deficiency in recruitment of immune cell subsets to the lung after infection. Our data suggest that overproduction of TGF-β1 in the lungs of BMT mice suppresses effector T cell function and skews cytokine profiles from Th1 to Th17, leading to increased susceptibility to gammaherpesvirus infection.

C57BL/6 and BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Mice expressing dominant-negative TGF-βRII under the permissive CD4 promoter on C57BL/6 × C3H (H-2b/k) background were generated as described previously (20). These CD4-DN-TGF-βRII mice were obtained from The Jackson Laboratory and then bred and genotyped at the University of Michigan (Ann Arbor, MI) by Dr. K. Bishop as described previously (21). Because of the nature of the promoter construct, these mice lack functional TGF-βRII in both CD4 and CD8 T cells (20). These mice were used as bone marrow donors for recipient C57BL/6 mice. This combination is technically not a syngeneic transplant, and the possibility existed that residual C57BL/6 host lymphocytes could have rejected the F1 bone marrow donor. However, we saw no evidence of impaired reconstitution in these mice. In other experiments, B6Ly5.2 mice, purchased from the Fredrick Cancer Research Facility (Fredrick, MD), were used as bone marrow donors for irradiated B6Ly5.1 (The Jackson Laboratory) recipients so that donor versus host leukocytes could be distinguished by staining for the CD45.1 and CD45.2 alleles using Abs commercially available from BD Pharmingen (San Diego, CA). Mice were housed in specific pathogen-free conditions and were monitored daily by veterinary staff. Experiments were approved by the University of Michigan Committee on the Use and Care of Animals.

We performed syngeneic BMT as described previously (13, 22). For most experiments, recipient mice were treated with 1350 rad of total body irradiation using a 137Cs irradiator, delivered in two doses separated by 3 h. A total of 5 × 106 donor bone marrow cells in 0.2 ml DMEM (Invitrogen, Carlsbad, CA) without serum were delivered to irradiated mice via tail vein injection. Mice were given acidified water (pH 3.3) for the first 4 wk post-BMT. Total numbers of hematopoietic cells were fully reconstituted in the lungs and spleen at 5 wk post-BMT. Alveolar macrophages in the lung were >80% donor derived at this time, whereas lung and splenic lymphocytes were >93% donor derived at this time point (23). Thus, all experiments were performed at 5–6 wk post-BMT. Allogeneic transplants (C57BL/6→BALB/c) were performed in the same manner as syngeneic transplants following conditioning at 1350 rad. At 5 wk post-BMT, both total lung cell numbers and lung CD4 T cell numbers were reconstituted in these mice. In some experiments, mice were conditioned with reduced intensity radiation (650 or 900 rad).

γHV-68 (5 × 104 PFU; American Type Culture Collection, Manassas, VA) was diluted in 20 μl PBS and delivered i.n. to mice that had been anesthetized with ketamine and xylazine. Quantification of lytic virus from right lungs of mice was determined by plaque assay, as described previously (24). Briefly, right lungs were dissected from mice 7 d after infection and homogenized in 1 ml DMEM with 10% FCS supplemented with Complete protease inhibitor (Sigma-Aldrich, St. Louis, MO). Supernatants from right lung homogenates were diluted and placed in triplicate on confluent monolayers of 3T12 cells (American Type Cell Culture Collection); plaques were enumerated 7 d later.

Frozen lung sections were prepared from infected mice, and γHV-68 was detected using a rabbit polyclonal anti–γHV-68 sera (25) provided by Dr. Skip Virgin (Washington University School of Medicine, St. Louis, MO). Staining was detected with a goat anti-rabbit secondary conjugated to alkaline phosphatase.

Supernatants from whole lung, homogenized in 1 ml PBS and supplemented with Complete protease inhibitor (Sigma-Aldrich) or cell culture, were assayed for cytokines using the DuoSet ELISA Development System kits (R&D Systems, Minneapolis, MN) following the manufacturer’s instructions. PGE2 was measured using an enzyme immunoassay kit from Cayman Chemicals (Ann Arbor, MI), according to the manufacturer’s instructions.

Whole lungs or right lungs were prepared for flow cytometry by collagenase digestion, as described previously (26). A total of 2.5 × 106 cells were then stained using fluorochrome-conjugated Abs against the cell surface markers CD45, CD4, CD8, CD19, NK1.1, TCRβ, CD11c, I-Ab, and CD25 (BD Pharmingen) following incubation with anti-CD16/CD32 (Fc block; BD Pharmingen). Foxp3 staining was performed using PE anti-mouse/rat Foxp3 Staining Set (eBioscience, San Diego, CA), following the manufacturer’s instructions. For intracellular cytokine staining, cells were first stimulated with PMA (0.05 μg/ml; Sigma-Aldrich) and ionomycin (0.75 μg/ml; Sigma-Aldrich) for 6 h in the presence of GolgiStop protein transport inhibitor (BD Pharmingen). Anti–IL-17a Ab was obtained from BD Pharmingen and anti–IFN-γ from eBioscience. To enumerate lymphocyte subsets, gates were first set on CD45-expressing cells followed by gating on the lymphocyte-sized subset.

MLRs were performed as described previously (27). Briefly, 2 × 105 stimulator (irradiated, 1.6 Gy) and 1, 2, or 4 × 105 responder cells were cocultured in a 96-well plate for 4 d in RPMI 1640 medium (HyClone Laboratories, Logan, UT) supplemented with 10% FCS. A total of 1 μCi [3H]thymidine was added for the last 18 h of culture. Proliferation was determined by subtracting cpm of responders alone from cpm in wells containing both responders and stimulators. For some experiments, bone marrow-derived dendritic cells (BMDCs) were used as stimulators. BMDCs were prepared as previously described (28), with modifications. Total bone marrow was seeded at 2 × 106–5 × 106 cells in 100-mm petri dishes containing 10 ml RPMI 1640 medium and 20 ng/ml GM-CSF (PeproTech, Rocky Hill, NJ). Cells were fed an additional 10 ml media and GM-CSF at day 3, and nonadherent BMDCs were harvested from the plates at day 7. In other experiments, whole spleen cells were used as stimulators. Responder cells were either total spleen cells or CD4 cells magnetically purified from the spleen using MACS CD4 (L3T4) MicroBeads (Miltenyi Biotec, Auburn, CA). BMDCs were stained for expression of I-Ab, CD80, and CD86 using Abs from BD Pharmingen.

Type II alveolar epithelial cells (AECs) were isolated using dispase and DNase digestion of lower lungs as described previously (29, 30). Bone marrow-derived cells were removed via anti-CD32 and anti-CD45 magnetic depletion. Mesenchymal cells were removed by overnight adherence in a petri dish. The nonadherent cells, after this initial plating, were plated at 1 × 106 cells/well in 24-well plates coated with fibronectin for 72 h. The medium was changed to serum-free medium, and supernatants were collected 24 h later for determination of TGF-β1 levels by ELISA.

Real-time RT-PCR was performed on an ABI Prism 7000 thermocycler (Applied Biosystems, Foster City, CA) using a previously described protocol (22). Gene-specific primers and probes (Table I) were designed using Primer Express software (Applied Biosystems).

Table I.
Primers and probes for semiquantitative real-time RT-PCR
GeneOligoSequence
DNA polymerase (ORF9) F. primer ACAGCAGCTGGCCATAAAGG 
R. primer TCCTGCCCTGGAAAGTGATG 
Probe CCTCTGGAATGTTGCCTTGCCTCCA 
Capsid gene gB (ORF8) F. primer CGCTCATTACGGCCCAAA 
R. primer ACCACGCCCTGGACAACTC 
Probe TTGCCTATGACAAGCTGACCACCA 
β-Actin F. primer CCGTGAAAAGATGACCCAGATC 
R. primer CACAGCCTGGATGGCTACGT 
Probe TTTGAGACCTTCAACACCCCCAGCCA 
GeneOligoSequence
DNA polymerase (ORF9) F. primer ACAGCAGCTGGCCATAAAGG 
R. primer TCCTGCCCTGGAAAGTGATG 
Probe CCTCTGGAATGTTGCCTTGCCTCCA 
Capsid gene gB (ORF8) F. primer CGCTCATTACGGCCCAAA 
R. primer ACCACGCCCTGGACAACTC 
Probe TTGCCTATGACAAGCTGACCACCA 
β-Actin F. primer CCGTGAAAAGATGACCCAGATC 
R. primer CACAGCCTGGATGGCTACGT 
Probe TTTGAGACCTTCAACACCCCCAGCCA 

F, forward; R, reverse.

Regulatory T cell (Treg) depletion was performed by giving mice a single i.p. injection of 100 μl anti-CD25 ascites (PC61) at 4 wk post-BMT. Control mice were given 100 μg isotype control Ab.

Statistical significance between two groups was measured by Student t test using GraphPad Prism 5 software (GraphPad, La Jolla, CA). Data represent mean ± SEM; p < 0.05 was considered significant.

We first sought to understand whether syngeneic BMT mice were more prone to viral infection in the lung at 5 wk post-BMT. We transplanted mice using three conditioning regimens (650, 900, and 1350 rad). We infected the syngeneic BMT and nontransplanted control mice i.n. with 5 × 104 PFU γHV-68. Seven days postinfection, left lungs were harvested for RNA, and expression of lytic viral genes was determined using real-time RT-PCR (Table I). Expression of both viral capsid gene gB (Fig. 1A) and viral DNA polymerase (Fig. 1B) was increased in syngeneic BMT mice compared with nontransplanted control mice. This increased viral gene expression reached statistical significance in mice conditioned with 1350 rad. To confirm increased susceptibility to viral infection, syngeneic BMT mice (conditioned with 1350 rad) were infected i.n. with 5 × 104 PFU γHV-68. At day 7 postinfection, right lungs were harvested for plaque assay. Again, BMT mice displayed significantly higher levels of lytic virus compared with nontransplanted control mice (Fig. 1C). Immunohistochemistry on frozen lung sections using polyclonal anti–γHV-68 serum further confirmed increased viral loads in the BMT mice (Fig. 1D). At the 1350-rad conditioning dose, the increased susceptibility of syngeneic BMT mice to γHV-68 infection was also dependent on the dose of virus (Supplemental Fig. 1). On the basis of these titration experiments, all future experiments were carried out following 1350-rad conditioning with a viral challenge of 5 × 104 PFU. Interestingly, we have previously reported that only mice irradiated with 1350 rad underwent near complete myeloablation and reconstitution with donor leukocytes (23).

FIGURE 1.

Syngeneic BMT mice have higher viral burden in the lungs at day 7 postinfection 5 wk following BMT. Control and syngeneic BMT mice (conditioned with 650, 900, or 1350 rad) were infected i.n. with 5 × 104 PFU γHV-68 5 wk following BMT. A and B, At day 7 postinfection, left lungs were processed for RNA, and expression of lytic viral genes was measured using real-time RT-PCR. Expression of the viral capsid gene gB and viral DNA polymerase was significantly increased (p = 0.0085 and p = 0.0017, respectively) in the lungs of BMT mice conditioned with 1350 rad when compared with nontransplanted controls (n = at least 9 mice/group; data combined from two experiments). C, At day 7 postinfection, right lungs from BMT mice conditioned with 1350 rad and control mice were harvested for plaque assay (p = 0.0014; n = 10 control, 9 BMT; data combined from two experiments). D, Frozen sections of lungs from control and BMT mice (1350 rad) were prepared at day 7 postinfection and were stained with rabbit polyclonal antisera against γHV-68 or with nonimmune rabbit sera as control (original magnification ×100). The goat anti-rabbit secondary was linked to alkaline phosphatase.

FIGURE 1.

Syngeneic BMT mice have higher viral burden in the lungs at day 7 postinfection 5 wk following BMT. Control and syngeneic BMT mice (conditioned with 650, 900, or 1350 rad) were infected i.n. with 5 × 104 PFU γHV-68 5 wk following BMT. A and B, At day 7 postinfection, left lungs were processed for RNA, and expression of lytic viral genes was measured using real-time RT-PCR. Expression of the viral capsid gene gB and viral DNA polymerase was significantly increased (p = 0.0085 and p = 0.0017, respectively) in the lungs of BMT mice conditioned with 1350 rad when compared with nontransplanted controls (n = at least 9 mice/group; data combined from two experiments). C, At day 7 postinfection, right lungs from BMT mice conditioned with 1350 rad and control mice were harvested for plaque assay (p = 0.0014; n = 10 control, 9 BMT; data combined from two experiments). D, Frozen sections of lungs from control and BMT mice (1350 rad) were prepared at day 7 postinfection and were stained with rabbit polyclonal antisera against γHV-68 or with nonimmune rabbit sera as control (original magnification ×100). The goat anti-rabbit secondary was linked to alkaline phosphatase.

Close modal

To determine whether the increased susceptibility to viral infection seen in syngeneic BMT mice was related to a defect in inflammatory cell recruitment, lungs from BMT and nontransplanted control mice were enzymatically digested using collagenase, and leukocytes were isolated. Total cell numbers were determined in uninfected mice and in mice at day 7 postinfection with γHV-68. At 5 wk posttransplant, BMT mice had equivalent total cell numbers both before and at day 7 postinfection when compared with nontransplanted control mice (Fig. 2A). Inflammatory cell subsets were also identified following infection by cell surface markers using flow cytometry. At day 7 postinfection, BMT mice had equivalent numbers of T cells, B cells, NK cells, NKT cells, and APCs as nontransplanted control mice (Fig. 2B).

FIGURE 2.

BMT mice do not have a defect in inflammatory cell recruitment. A, Whole lungs from uninfected or infected (5 × 104 PFU γHV-68 i.n., day 7 postinfection) nontransplanted control and syngeneic BMT mice were digested with collagenase, and total cells were enumerated. Total cell numbers between control and BMT mice did not differ significantly in the uninfected or infected groups (n = 4 mice/group; representative of at least three independent experiments). B, Seven days postinfection with γHV-68 (5 × 104 PFU, i.n.), whole lungs from control and BMT mice were digested in collagenase and analyzed by flow cytometry for expression of cell surface molecules. Numbers of each subset were not statistically different between control and BMT mice (data in each group is representative of at least two independent experiments; n = at least three mice per group).

FIGURE 2.

BMT mice do not have a defect in inflammatory cell recruitment. A, Whole lungs from uninfected or infected (5 × 104 PFU γHV-68 i.n., day 7 postinfection) nontransplanted control and syngeneic BMT mice were digested with collagenase, and total cells were enumerated. Total cell numbers between control and BMT mice did not differ significantly in the uninfected or infected groups (n = 4 mice/group; representative of at least three independent experiments). B, Seven days postinfection with γHV-68 (5 × 104 PFU, i.n.), whole lungs from control and BMT mice were digested in collagenase and analyzed by flow cytometry for expression of cell surface molecules. Numbers of each subset were not statistically different between control and BMT mice (data in each group is representative of at least two independent experiments; n = at least three mice per group).

Close modal

We next determined whether increased susceptibility to viral infection in BMT mice was related to impairments in APC function. We first analyzed cell surface expression of MHC class II and costimulatory molecules on BMDCs from syngeneic BMT mice and nontransplanted controls. We found that BMDCs from BMT and nontransplanted control mice expressed equivalent levels of the costimulatory molecules CD80 and CD86 as well as the MHC class II molecule I-Ab on the cell surface (Fig. 3A–C). Surface expression of these molecules was also similar between control and syngeneic BMT-purified lung-derived CD11c+ cells (from both uninfected mice and mice at day 7 post–γHV-68 infection) (Supplemental Fig. 2 and data not shown). To confirm the ability of the BMDCs from BMT mice to function as APCs, we set up MLRs using irradiated BMDCs from BMT or nontranplanted control mice as stimulators and BALB/c splenocytes as responders (Fig. 3D). Our results demonstrated that BMDCs from BMT mice were capable of stimulating T cell proliferation equivalent to or even more effectively than stimulators from nontransplanted controls. We next tested APCs that were freshly isolated from the BMT and control mice. Similar results were obtained when we tested unfractionated splenocytes from control or BMT mice as APCs (data not shown). Thus, these data suggested that APC function was intact in the BMT mice.

FIGURE 3.

BMT BMDCs are efficient stimulators in an MLR. BMDCs from nontransplanted control or BMT mice 5 wk posttransplant were grown for 7 d in GM-CSF and analyzed by flow cytometry for expression of I-Ab (A), CD80 (B), and CD86 (C). BMT BMDCs expressed levels of CD80 and CD86 comparable to that of control cells and slightly increased levels of I-Ab (n = 2 mice/group). Similar results were found in a separate experiment where BMDCs were matured for 24 h with IL-4 (data not shown). In D, 2 × 105 irradiated BMDCs from BMT or control mice were used as stimulators in an MLR using 1 × 105 and 2 × 105 BALB/c splenocytes as responders. BMT BMDCs were able to stimulate proliferation of responder cells at least as well as control cells; BMT BMDCs stimulated significantly more proliferation in the 2 × 105 responder group (p = 0.0003). Error bars represent differences between triplicate or quadruplicate wells. Similar results were found when irradiated splenocytes from BMT or control mice were used as MLR stimulators (data not shown).

FIGURE 3.

BMT BMDCs are efficient stimulators in an MLR. BMDCs from nontransplanted control or BMT mice 5 wk posttransplant were grown for 7 d in GM-CSF and analyzed by flow cytometry for expression of I-Ab (A), CD80 (B), and CD86 (C). BMT BMDCs expressed levels of CD80 and CD86 comparable to that of control cells and slightly increased levels of I-Ab (n = 2 mice/group). Similar results were found in a separate experiment where BMDCs were matured for 24 h with IL-4 (data not shown). In D, 2 × 105 irradiated BMDCs from BMT or control mice were used as stimulators in an MLR using 1 × 105 and 2 × 105 BALB/c splenocytes as responders. BMT BMDCs were able to stimulate proliferation of responder cells at least as well as control cells; BMT BMDCs stimulated significantly more proliferation in the 2 × 105 responder group (p = 0.0003). Error bars represent differences between triplicate or quadruplicate wells. Similar results were found when irradiated splenocytes from BMT or control mice were used as MLR stimulators (data not shown).

Close modal

We next explored whether T cells from BMT mice had impaired function. To assay T cell function, we set up MLRs using irradiated BALB/c splenocytes as stimulators and unfractionated syngeneic BMT or control spleen cells as responders. The BMT responder splenocytes were impaired in their proliferative response (Fig. 4A) despite the fact that there were no differences in the numbers of CD4 cells found in the spleens of control or BMT mice (data not shown). To directly compare the proliferative capacity of CD4 T cells, we next isolated splenic CD4 cells via magnetic purification and used these cells as responders against irradiated BALB/c splenocytes. Similar to the results seen with unfractionated splenocytes, purified CD4 T cells from BMT mice displayed impaired proliferative responses in this allo-MLR reaction (Fig. 4B).

FIGURE 4.

BMT cells are poor responders in an MLR. A total of 2 × 105 BALB/c-irradiated splenocytes were used as stimulators in an MLR. In A, BMT whole spleen cell responders proliferated significantly less than control cells. In B, purified CD4 cells from BMT or control spleens were used as responders in an MLR. BMT CD4 cells responded significantly less than control cells when 2 × 105 and 4 × 105 responders were used. Error bars represent differences between triplicate or quadruplicate wells.

FIGURE 4.

BMT cells are poor responders in an MLR. A total of 2 × 105 BALB/c-irradiated splenocytes were used as stimulators in an MLR. In A, BMT whole spleen cell responders proliferated significantly less than control cells. In B, purified CD4 cells from BMT or control spleens were used as responders in an MLR. BMT CD4 cells responded significantly less than control cells when 2 × 105 and 4 × 105 responders were used. Error bars represent differences between triplicate or quadruplicate wells.

Close modal

We have previously shown that syngeneic BMT mice overexpress PGE2 in the lungs at 5 wk post-BMT, leading to defects in antibacterial immunity in these mice (22). Because PGE2 has been linked to inhibition of T cell responses (31), we sought to determine whether increased PGE2 levels also correlated with impaired antiviral immunity. We found that PGE2 was significantly increased in the lungs of syngeneic BMT mice at day 7 postinfection with 5 × 104 PFU γHV-68 (Fig. 5A). However, treatment of mice with indomethacin (a cyclooxygenase [COX] inhibitor) during the infection did not improve viral clearance, despite reductions in PGE2 levels (Supplemental Fig. 3). These data suggest that although PGE2 is overproduced in the lungs of syngeneic BMT mice, it does not limit antiviral immunity.

FIGURE 5.

Syngeneic BMT mice overexpress PGE2 and TGF-β1. A, Whole lungs were harvested and assayed for PGE2 by ELISA at day 7 postinfection with 5 × 104 PFU γHV-68. Lungs of BMT mice produced significantly more PGE2 than nontransplanted controls (p = 0.0230; n = 5 mice/group; representative of two independent experiments). B, Lungs of uninfected BMT mice produced significantly more total TGF-β1 than control, as determined by ELISA (p = 0.0015; n = 5 mice/group; representative of two independent experiments). C, AECs were isolated from lungs of uninfected BMT, and control mice and were assayed for production of TGF-β1 by ELISA following 24-h culture in serum-free medium. BMT AECs produced significantly more TGF-β1 than control AECs (p < 0.0001; n = 6 mice/group; representative of two independent experiments).

FIGURE 5.

Syngeneic BMT mice overexpress PGE2 and TGF-β1. A, Whole lungs were harvested and assayed for PGE2 by ELISA at day 7 postinfection with 5 × 104 PFU γHV-68. Lungs of BMT mice produced significantly more PGE2 than nontransplanted controls (p = 0.0230; n = 5 mice/group; representative of two independent experiments). B, Lungs of uninfected BMT mice produced significantly more total TGF-β1 than control, as determined by ELISA (p = 0.0015; n = 5 mice/group; representative of two independent experiments). C, AECs were isolated from lungs of uninfected BMT, and control mice and were assayed for production of TGF-β1 by ELISA following 24-h culture in serum-free medium. BMT AECs produced significantly more TGF-β1 than control AECs (p < 0.0001; n = 6 mice/group; representative of two independent experiments).

Close modal

We next analyzed lungs for expression of total TGF-β1. We found that lungs of syngeneic BMT mice have significantly higher levels of TGF-β1 compared with nontransplanted control mice (Fig. 5B). We hypothesized that the increased levels of TGF-β1 may be attributable in part to epithelial cell damage as a result of the total body irradiation conditioning regimen (32). To determine whether AECs were a significant source of TGF-β1 post-BMT, we purified AECs from nontransplanted control and BMT mice at week 5 posttransplant. AECs were then cultured, and supernatants were analyzed for total TGF-β1 levels by ELISA. Fig. 5C demonstrates that AECs from syngeneic BMT mice are a source of TGF-β1 even 5 wk posttransplant. To determine whether radiation dose affected TGF-β1 levels in the lung, syngeneic transplants were performed following increasing doses of irradiation. TGF-β1 levels were similarly elevated in all groups (Supplemental Fig. 4A).

TGF-β1 and PGE2 have been reported to induce the generation of Foxp3-expressing Tregs (3335). Our data indicating elevated levels of both TGF-β1 and PGE2 in the lungs of BMT mice would suggest that increased Tregs in BMT mice might account for the suppressed viral clearance. We analyzed cells from collagenase-digested lungs by flow cytometry for expression of the cell surface molecules CD45 and CD4 and the intracellular transcription factor Foxp3 both in uninfected lungs and at day 7 postinfection with γHV-68. We consistently observed significant increases in the numbers of Tregs in BMT lungs at both baseline and at day 7 postinfection when compared with nontransplanted control animals (Fig. 6). Syngeneic transplants were then performed at increasing doses of irradiation to determine whether radiation dose correlated with increased Treg numbers in the lung; indeed, Treg numbers increased as radiation dose increased (Supplemental Fig. 4B).

FIGURE 6.

BMT mice have elevated numbers of Tregs in the lung. Whole lungs from BMT and control mice, uninfected or infected (5 × 104 PFU γHV-68, i.n., day 7), were digested with collagenase and analyzed by flow cytometry. Lungs from uninfected BMT mice had significantly more CD4+Foxp3+ cells than nontransplanted controls (p = 0.0002; n = 4 mice/group; representative of two independent experiments). At day 7 postinfection, BMT lungs had significantly higher numbers of CD4+Foxp3+ cells than nontransplant controls (p = 0.0104; n = 4 mice/group; representative of at least six independent experiments).

FIGURE 6.

BMT mice have elevated numbers of Tregs in the lung. Whole lungs from BMT and control mice, uninfected or infected (5 × 104 PFU γHV-68, i.n., day 7), were digested with collagenase and analyzed by flow cytometry. Lungs from uninfected BMT mice had significantly more CD4+Foxp3+ cells than nontransplanted controls (p = 0.0002; n = 4 mice/group; representative of two independent experiments). At day 7 postinfection, BMT lungs had significantly higher numbers of CD4+Foxp3+ cells than nontransplant controls (p = 0.0104; n = 4 mice/group; representative of at least six independent experiments).

Close modal

To determine whether our results in syngeneic BMT mice were also true in the setting of allogeneic transplant, fully allogeneic (C57BL/6→BALB/c) transplants were performed following 1350-rad conditioning. Notably, at 5 wk post-BMT, these mice displayed no evidence of severe GVHD, because there was no difference in weights of allogeneic and syngeneic BMT mice (Fig. 7A). Allogeneic BMT mice were then infected i.n. with 5 × 104 PFU γHV-68. Lytic virus in the lung was detected at day 7 postinfection by real-time RT-PCR for expression of the lytic viral genes DNA polymerase and viral capsid protein gB. Expression of both viral genes was significantly increased in the lungs of the allogeneic BMT mice (Fig. 7B, 7C). Similar to syngeneic transplants at this time point, allogeneic BMT mice did not show a difference in total lung cell numbers or numbers of CD4 cells in the lung when compared with nontransplanted control mice, suggesting that immune reconstitution was not impaired (data not shown).

FIGURE 7.

Allogeneic BMT mice show increased susceptibility to γHV-68 in absence of GVHD. A, Mice receiving syngeneic or allogeneic (C57BL/6→BALB/c) BMT were weighed twice per week as a measure of GVHD for 5 wk post-BMT (n = 5 syngeneic; 10 allogeneic per time point; data representative of two independent experiments). B and C, Left lungs were harvested from control and allogeneic BMT mice at day 7 postinfection with γHV-68, processed for RNA, and analyzed for expression of lytic viral genes. Viral gene expression was significantly increased in allogeneic BMT mice when compared with nontransplanted control mice (p = 0.0225 for viral capsid gene; p = 0.0367 for viral DNA polymerase; n = 3 control, 5 allogeneic BMT; data representative of two independent experiments).

FIGURE 7.

Allogeneic BMT mice show increased susceptibility to γHV-68 in absence of GVHD. A, Mice receiving syngeneic or allogeneic (C57BL/6→BALB/c) BMT were weighed twice per week as a measure of GVHD for 5 wk post-BMT (n = 5 syngeneic; 10 allogeneic per time point; data representative of two independent experiments). B and C, Left lungs were harvested from control and allogeneic BMT mice at day 7 postinfection with γHV-68, processed for RNA, and analyzed for expression of lytic viral genes. Viral gene expression was significantly increased in allogeneic BMT mice when compared with nontransplanted control mice (p = 0.0225 for viral capsid gene; p = 0.0367 for viral DNA polymerase; n = 3 control, 5 allogeneic BMT; data representative of two independent experiments).

Close modal

Allogeneic BMT mice also expressed significantly elevated levels of TGF-β1 in the lung 5 wk posttransplant, mirroring the results seen in syngeneic BMT mice (Fig. 8A). Additionally, allogeneic BMT mice also showed increased numbers of Tregs in the lungs, as determined by flow cytometry at day 7 postinfection with γHV-68 (Fig. 8B). Levels of both TGF-β1 and Tregs were similarly upregulated in both allogeneic and syngeneic BMT mice.

FIGURE 8.

Allogeneic BMT mice have increased TGF-β1 and increased Treg numbers in the lungs. A, TGF-β1 levels in the lungs of syngeneic and allogeneic BMT mice were determined by ELISA. Both BMT groups expressed similar increases in TGF-β1 levels (n= 3 control, 3 syngeneic, and 5 allogeneic). B, Control, syngeneic, and allogeneic BMT mice were infected with 5 × 104 PFU γHV-68. At day 7 postinfection, right lungs were digested in collagenase and analyzed by flow cytometry for expression of CD4 and Foxp3. CD4+Foxp3+ cells were significantly increased in both syngeneic and allogeneic BMT mice compared to nontransplanted controls (n= 7 control, 7 syngeneic, 3 allogeneic).

FIGURE 8.

Allogeneic BMT mice have increased TGF-β1 and increased Treg numbers in the lungs. A, TGF-β1 levels in the lungs of syngeneic and allogeneic BMT mice were determined by ELISA. Both BMT groups expressed similar increases in TGF-β1 levels (n= 3 control, 3 syngeneic, and 5 allogeneic). B, Control, syngeneic, and allogeneic BMT mice were infected with 5 × 104 PFU γHV-68. At day 7 postinfection, right lungs were digested in collagenase and analyzed by flow cytometry for expression of CD4 and Foxp3. CD4+Foxp3+ cells were significantly increased in both syngeneic and allogeneic BMT mice compared to nontransplanted controls (n= 7 control, 7 syngeneic, 3 allogeneic).

Close modal

We hypothesized that the elevated number of Tregs in the lungs of BMT mice was suppressing antiviral immunity. To test this hypothesis, syngeneic BMT mice were treated with either anti-CD25 or isotype control at 4 wk post-BMT. At 5 wk post-BMT (1 wk following Ab treatment), mice were infected i.n. with 5 × 104 PFU γHV-68. Left lungs were harvested for RNA, and expression of the lytic viral capsid gene gB and viral DNA polymerase was determined by real-time RT-PCR. There was no difference in viral gene expression between BMT mice treated with isotype and those treated with anti-CD25. Both BMT groups showed a significant increase in viral gene expression compared with isotype-treated nontransplant controls (Fig. 9A, 9B). Flow cytometry for lung CD4+Foxp3+ cells showed that Treg numbers in anti–CD25-treated BMT mice (1 wk following Ab treatment) were similar to those seen in isotype-treated, nontransplant control mice on the day of infection (Fig. 9C). Similar results were found at day 7 postinfection, showing that Treg depletion persisted throughout the infection period (data not shown).

FIGURE 9.

Depletion of Tregs does not restore antiviral immunity in syngeneic BMT mice. A and B, Syngeneic BMT mice were treated with a single dose of either anti-CD25 or isotype control Ab at 4 wk post-BMT. At 5 wk post-BMT (1 wk following Ab treatment), mice were infected with 5 × 104 PFU γHV-68. Left lungs were harvested for RNA at day 7 postinfection, and expression of lytic viral genes was determined by real-time RT-PCR. Expression of both the capsid gene gB and viral DNA polymerase was significantly increased in BMT mice treated with either isotype or anti-CD25 compared with isotype control-treated, nontransplanted animals (n = 5 mice/group). C, One week following Ab treatment, uninfected whole lungs were digested in collagenase and analyzed by flow cytometry for expression of CD4 and Foxp3. Numbers of CD4+Foxp3+ cells were significantly increased in the isotype-treated BMT mice but were at control levels in anti–CD25-treated mice (n = 5 mice/group). Similar results were found at day 7 postinfection with γHV-68 (data not shown).

FIGURE 9.

Depletion of Tregs does not restore antiviral immunity in syngeneic BMT mice. A and B, Syngeneic BMT mice were treated with a single dose of either anti-CD25 or isotype control Ab at 4 wk post-BMT. At 5 wk post-BMT (1 wk following Ab treatment), mice were infected with 5 × 104 PFU γHV-68. Left lungs were harvested for RNA at day 7 postinfection, and expression of lytic viral genes was determined by real-time RT-PCR. Expression of both the capsid gene gB and viral DNA polymerase was significantly increased in BMT mice treated with either isotype or anti-CD25 compared with isotype control-treated, nontransplanted animals (n = 5 mice/group). C, One week following Ab treatment, uninfected whole lungs were digested in collagenase and analyzed by flow cytometry for expression of CD4 and Foxp3. Numbers of CD4+Foxp3+ cells were significantly increased in the isotype-treated BMT mice but were at control levels in anti–CD25-treated mice (n = 5 mice/group). Similar results were found at day 7 postinfection with γHV-68 (data not shown).

Close modal

To determine whether the increased levels of TGF-β1 in the lung contributed to impaired antiviral immunity in the BMT mice, we performed transplants by using bone marrow from mice that express a dominant-negative form of the TGF-βRII under the CD4 promoter (20). This particular promoter configuration is expressed in both CD4 and CD8 cells. This approach ensures that donor-derived T cells (CD4 and CD8) will be unresponsive to TGF-β1. Five weeks post-BMT, total cell numbers within the lung were not different in control, wild-type syngeneic BMT, and CD4-DN-TGF-βRII→C57BL/6 BMT mice (data not shown). At this time point, mice were infected i.n.with 5 × 104 PFU γHV-68. At day 7 postinfection, lungs from CD4-DN-TGF-βRII BMT, wild-type syngeneic BMT, and control (nontransplanted) mice were analyzed for expression of lytic viral genes by real-time RT-PCR. Our data demonstrate that CD4-DN-TGF-βRII BMT mice (in which the donor-derived effector CD4 and CD8 cells are unresponsive to TGF-β1) have restored immunity to γHV-68, as expression of the viral capsid gene (Fig. 10A) and viral DNA polymerase (Fig. 10B) was not significantly different from expression in nontransplanted control mice.

FIGURE 10.

Transplanting mice with CD4-DN-TGF-βRII bone marrow restores immunity to γHV-68. Control mice and mice transplanted with syngeneic wild-type or CD4-DN-TGF-βRII bone marrow were infected i.n. with 5 × 104 PFU γHV-68 and analyzed at day 7 postinfection. A, Expression of the viral capsid gene gB was significantly increased in the lungs of wild-type BMT mice compared with nontransplanted control mice; however, there was no significant difference between control and CD4-DN-TGF-βRII BMT groups. B, Expression of viral DNA polymerase was significantly increased in wild-type BMT lungs when compared with nontransplanted control mice. There was no significant difference between the control and CD4-DN-TGF-βRII BMT mice (n = 4–5 mice/group; data representative of two independent experiments). C, Right lungs were digested in collagenase and analyzed using flow cytometry. Both wild-type and CD4-DN-TGF-βRII BMT mice had significantly higher numbers of Tregs compared with nontransplanted controls (n = 5 mice/group; data representative of two independent experiments).

FIGURE 10.

Transplanting mice with CD4-DN-TGF-βRII bone marrow restores immunity to γHV-68. Control mice and mice transplanted with syngeneic wild-type or CD4-DN-TGF-βRII bone marrow were infected i.n. with 5 × 104 PFU γHV-68 and analyzed at day 7 postinfection. A, Expression of the viral capsid gene gB was significantly increased in the lungs of wild-type BMT mice compared with nontransplanted control mice; however, there was no significant difference between control and CD4-DN-TGF-βRII BMT groups. B, Expression of viral DNA polymerase was significantly increased in wild-type BMT lungs when compared with nontransplanted control mice. There was no significant difference between the control and CD4-DN-TGF-βRII BMT mice (n = 4–5 mice/group; data representative of two independent experiments). C, Right lungs were digested in collagenase and analyzed using flow cytometry. Both wild-type and CD4-DN-TGF-βRII BMT mice had significantly higher numbers of Tregs compared with nontransplanted controls (n = 5 mice/group; data representative of two independent experiments).

Close modal

We next analyzed lungs for the presence of Tregs in these CD4-DN-TGF-βRII BMT mice as well as in wild-type syngeneic BMT and nontransplanted control mice (Fig. 10C). Consistent with our previous observations, both groups of BMT mice showed elevated numbers of Tregs, suggesting that the generation of Tregs in the BMT mice was TGF-β1 independent or that the Tregs were of host origin rather than donor. To confirm the origin of the Tregs in BMT mice, we transplanted CD45.1 mice with bone marrow from CD45.2 mice and analyzed the donor versus host composition of the Treg compartment 1 wk postinfection with 5 × 104 PFU γHV-68. Despite the fact that 93% of the leukocytes (including essentially all of the effector T cells) in the lungs of BMT mice were donor derived, ∼60% of the Tregs are host derived, presumably arising from radioresistant precursors (data not shown). These data suggest that the CD4-DN-TGF-βRII BMT mice are able to effectively clear the viral infection despite the continued presence of increased numbers of Tregs in the lungs post-BMT.

Because TGF-β1 has been reported to be capable of limiting Th1 differentiation (36) and promoting Th17 differentiation (37), we next hypothesized that T cell differentiation may be altered in the lungs of BMT mice. We performed intracellular cytokine staining on CD4 T cells at day 7 postinfection with 5 × 104 PFU γHV-68 in both syngeneic BMT and nontransplanted control mice. Indeed, numbers of IFN-γ–expressing CD4 cells were significantly reduced in the lungs of BMT mice (Fig. 11A), whereas IL-17a–expressing CD4 cells were significantly increased (Fig. 11B). To determine whether the CD4-DN-TGF-βRII BMT mice would show altered T cell cytokine profiles when compared with syngeneic BMT mice, T cells were enriched from the spleens and stimulated with PMA and ionomycin (Fig. 12). T cells from CD4-DN-TGF-βRII BMT mice produced increased levels of IFN-γ and lower levels of IL-17a, suggesting that the T cell cytokine skewing was influenced by the ability of the effector T cells to respond to TGF-β1.

FIGURE 11.

Altered T cell differentiation in lungs of BMT mice in response to γHV-68. Syngeneic BMT and control mice were infected with 5 × 104 PFU γHV-68. At day 7 postinfection, lungs were digested in collagenase. Cells were then stimulated with PMA and ionomycin and analyzed by flow cytometry by using Abs against CD4, IFN-γ, and IL-17a. A, BMT mice showed a significant decrease in numbers of CD4+IFN-γ+ cells compared with nontransplanted control mice (p = 0.0207). B, BMT lungs had a significant increase (p = 0.0002) in numbers of CD4+IL-17a+ cells compared with nontransplant controls (n = 5 mice/group; data representative of two independent experiments).

FIGURE 11.

Altered T cell differentiation in lungs of BMT mice in response to γHV-68. Syngeneic BMT and control mice were infected with 5 × 104 PFU γHV-68. At day 7 postinfection, lungs were digested in collagenase. Cells were then stimulated with PMA and ionomycin and analyzed by flow cytometry by using Abs against CD4, IFN-γ, and IL-17a. A, BMT mice showed a significant decrease in numbers of CD4+IFN-γ+ cells compared with nontransplanted control mice (p = 0.0207). B, BMT lungs had a significant increase (p = 0.0002) in numbers of CD4+IL-17a+ cells compared with nontransplant controls (n = 5 mice/group; data representative of two independent experiments).

Close modal
FIGURE 12.

T cells from CD4-DN-TGF-βRII BMT mice express higher amounts of IFN-γ and lesser amounts of IL-17a. Splenocytes from syngeneic BMT and CD4-DN-TGF-βRII BMT mice were depleted of CD19-expressing cells via magnetic separation. Cells were then cultured with PMA and ionomycin for 24 h. Supernatants were harvested and assayed for expression of IFN-γ and IL-17a by ELISA. A, Syngeneic BMT cells expressed significantly less IFN-γ than CD4-DN-TGF-βRII BMT cells (p = 0.0004; n = 5 mice/group). B, Syngeneic BMT cells expressed significantly more IL-17a than CD4-DN-TGF-βRII BMT cells (p = 0.0006; n = 5 mice/group).

FIGURE 12.

T cells from CD4-DN-TGF-βRII BMT mice express higher amounts of IFN-γ and lesser amounts of IL-17a. Splenocytes from syngeneic BMT and CD4-DN-TGF-βRII BMT mice were depleted of CD19-expressing cells via magnetic separation. Cells were then cultured with PMA and ionomycin for 24 h. Supernatants were harvested and assayed for expression of IFN-γ and IL-17a by ELISA. A, Syngeneic BMT cells expressed significantly less IFN-γ than CD4-DN-TGF-βRII BMT cells (p = 0.0004; n = 5 mice/group). B, Syngeneic BMT cells expressed significantly more IL-17a than CD4-DN-TGF-βRII BMT cells (p = 0.0006; n = 5 mice/group).

Close modal

We have shown that mice undergoing either syngeneic or allogeneic BMT are more susceptible to pulmonary infection by the gammaherpesvirus γHV-68. At 5 wk post-BMT, mice have completely restored lung cell numbers and are able to recruit equivalent numbers of leukocyte cell subsets to the lung following infection with γHV-68. We found that syngeneic BMT BMDCs and lung APCs have a cell surface phenotype comparable to that of nontransplanted control cells and that BMT APCs are capable of stimulating T cell proliferation in an MLR. However, proliferation of BMT CD4 T cells is significantly reduced when compared with nontransplanted control cells in an MLR. Irradiation at all doses increased the production of TGF-β1 in the lungs of BMT mice. Transplantation following conditioning at 900 or 1350 rad also increased the numbers of Tregs in the lungs, a majority of which are host derived. Depletion of Tregs from BMT mice did not restore antiviral immunity. However, mice transplanted with bone marrow that expresses a dominant-negative TGF-βRII in CD4 and CD8 cells have restored antiviral immunity to γHV-68 compared with wild-type BMT mice. Impaired antiviral immunity in wild-type BMT mice is associated with diminished production of IFN-γ and increased production of IL-17a by CD4 T cells. In contrast, restored antiviral immunity in the CD4-DN-TGF-βRII BMT mice is associated with enhanced production of IFN-γ and decreased IL-17a.

In this study, we have established that mice undergoing syngeneic or allogeneic BMT have increased viral burden in the lung postinfection with γHV-68 at a time point following immune reconstitution (Figs. 1, 7). In these models, lung cell numbers are equivalent between BMT and nontransplanted control mice, and we observed no differences in recruitment of inflammatory cells to the lung at day 7 postinfection (Fig. 2 and data not shown). An important aspect of these models is that the observed immune defects are the result of the transplantation process and are not the consequence of immunomodulatory drugs or severe GVHD even in the allogeneic BMT mice. These data correlate with clinical data that show that HSCT patients are susceptible to infection at late time points posttransplant, even in the absence of immunosuppressive therapy (11, 12). Our results are in accordance with previous work from our laboratory, which established that defects in innate immunity cause mice undergoing syngeneic BMT to have increased susceptibility to pulmonary infection by the Gram-negative bacteria Pseudomonas aeruginosa (13). In this study, we expand upon those observations and report that adaptive immune responses are also dysfunctional in both syngeneic and allogeneic BMT mice that are not experiencing severe GVHD. Our murine studies suggest that both autologous and allogeneic BMT mice are similarly susceptible to viral infection. Clinically, however, there is a higher incidence of infection in the setting of allogeneic HSCT. These differences between the human and mouse outcomes may reflect the fact that human allogeneic HSCT recipients often undergo immunosuppressive drug regimens and experience GVHD or that human autologous HSCT recipients may receive infusions of mature T cells which were not provided in our murine studies.

The magnitude of the host defense defect is influenced both by the dose of radiation used for conditioning and also by the dose of virus used for infection. Significant increases in viral load occurred in mice conditioned with 1350 rad of total body irradiation. In our hands, conditioning with 1350 rad results in ∼95% reconstitution within the spleen and 82% reconstitution of alveolar macrophages. In contrast, 800 rad permitted ∼88% reconstitution in the spleen, but only 36% reconstitution of donor-derived alveolar macrophages (23). Thus, increased susceptibility noted in the mice conditioned with 1350 rad may be related to increased myeloablation, increased radiation toxicity, and/or enhanced donor cell reconstitution. BMT mice showed significant elevations in viral replication (as noted by expression of a viral capsid protein) at all doses of virus tested. However, the magnitude of the difference between control and BMT mice following 1350-rad conditioning was increased with higher viral inoculums (Supplemental Fig. 1). It is difficult to determine whether the increases in viral titer noted in the BMT mice are clinically meaningful. Even when receiving high doses of γHV-68, neither BMT nor control mice showed overt signs of illness, such as ruffled fur or weight loss. The fact that BMT mice do not succumb to infection with γHV-68 is likely because this virus rapidly establishes latency in the lung (38).

We first hypothesized that the increased viral burden found in the lungs of BMT mice could be related to defective Ag presentation. Dendritic cells (DCs) are the principal APCs, linking innate to adaptive immunity and thus initiating the T cell response to pathogens (39). Our data indicate that BMT BMDCs are phenotypically similar to cells isolated from nontransplanted control mice in terms of expression of the costimulatory molecules CD80 and CD86 as well as MHC class II (Fig. 3A–C). Additionally, lung APCs in control and BMT mice also showed equivalent MHC class II and costimulatory molecule expression (Supplemental Fig. 2). Using an MLR as a general measure of APC function, we found that BMT BMDCs were efficient stimulators of T cell proliferation, in some cases even more effective than control (Fig. 3D). To ensure that the potential inhibitory phenotype of the BMT APCs was not being lost during in vitro culture of BMDCs, we tested freshly isolated splenocytes as stimulators in an MLR. Similar results were found when irradiated BMT spleen cells were used as stimulators (data not shown), suggesting that BMT-derived APCs are functional when freshly isolated as well. These results correlate with data from human patients undergoing HSCT; it has been shown that DCs generated from peripheral blood precursors posttransplant are effective stimulators in an MLR (40). Indeed, at 6 mo posttransplant, these cells were even more potent APCs than DCs generated prior to transplant (40). Thus, we conclude that the defects in antiviral immunity post-BMT are not attributable to impairments in APC function.

It has been established that CD4 T cells have a significant role in controlling infection with γHV-68, acting both as helper cells and independently to control viral load (41). In this study, we observed that CD4 cells isolated from BMT spleen were impaired in their ability to respond in an MLR when compared with cells from nontransplanted control mice (Fig. 4). As IL-2 levels were actually enhanced in BMT mice at day 7 postinfection (data not shown), there does not appear to be a defect in IL-2 production in response to stimulation. It is possible that the systemic elevations in PGE2 production that we have noted previously post-BMT (22) may impair the T cell responses in these mice (42). Although this may contribute to the MLR results, we think this is unlikely to be a major factor in adaptive response to this virus as experiments treating the mice with indomethacin (a COX inhibitor) during the infection did not improve viral clearance, despite reductions in PGE2 levels (Supplemental Fig. 3). Our findings are similar to clinical data showing that T cells from HSCT recipients have impaired responses in an MLR for 1 y posttransplant (40).

We were intrigued to discover that the lungs of BMT mice expressed an immunosuppressive cytokine phenotype prior to infection. In addition to PGE2 (22), the lungs of uninfected syngeneic and allogeneic BMT mice have significantly higher levels of TGF-β1 when compared with lungs of nontransplanted control mice (Figs. 5, 8). Lung AECs are at least one source of enhanced TGF-β1 in the lung, and this may reflect a host response to radiation damage (43). TGF-β1 has been shown to suppress immune cell responses in several ways. It has been reported that TGF-β1 can modulate leukocyte trafficking, with the ability to limit expression of certain adhesion molecules on endothelial cells (44), decrease T cell adhesion to endothelial cells (45, 46), and limit VCAM-1–dependent transendothelial migration (47). In contrast, TGF-β1 treatment has also been associated with increased neutrophil recruitment to the lung (48). However, we think it is unlikely that these mechanisms are influencing antiviral immunity in our BMT mice, because there was no difference in numbers of immune cell subsets present in the lung postinfection (Fig. 2). Another possibility is that TGF-β1 could be influencing T cell effector function either directly (49) or via the induction of Tregs (33).

We found that the numbers of CD4+Foxp3+ Tregs were increased in the lungs of syngeneic and allogeneic BMT mice both prior to infection and at day 7 postinfection (Figs. 6, 8). Tregs are a specific subset of CD4 cells, which function to suppress immune responses of effector T cells (50). In the setting of BMT (especially allogeneic BMT), these cells have been best described in their ability to induce graft tolerance and suppress GVHD (51). It has been demonstrated previously that host-derived cells make up the large majority of the Treg compartment in the spleen for a prolonged period following syngeneic BMT (52); in this study, we demonstrate similar results in the lung and demonstrate that Treg numbers increased in a radiation dose-dependent manner (Supplemental Fig. 4). Thus, it appears that Tregs may accumulate (perhaps by homeostatic proliferation of radioresistant host Tregs) (52) in direct proportion to the size of the niche created by conditioning. In an effort to determine the contribution of the Tregs to the impaired antiviral immunity noted post-BMT, we depleted Tregs using anti-CD25 and compared viral host defense in these mice or mice treated with an isotype control. Treatment with anti-CD25 effectively reduced the levels of CD4+Foxp3+ cells to the levels seen in untransplanted control mice (Fig. 9). However, despite the reduction in Tregs, the ability of the BMT mice to clear virus was still impaired. These data are consistent with recent studies demonstrating that adoptive transfer of Tregs into mice receiving an allogeneic BMT could limit GVHD but did not impair the ability of the BMT mice to respond to lethal cytomegalovirus infection (53). In sum, we interpret these results to suggest that Tregs do not impair antiviral host defense post-BMT.

Our analysis of the CD45.1 into CD45.2 BMT mice demonstrate that although the Treg compartment is a mixture of both donor- and host-derived cells, the effector CD4 and CD8 cells are essentially donor derived (>93%). Transplanting CD4-DN-TGF-βRII bone marrow into recipient mice led to a restoration of antiviral immunity, despite the persistence of increased numbers of Tregs in the lung (Fig. 10). Our interpretation of these data is that impaired antiviral immunity post-BMT requires the ability of the effector T cells to respond to TGF-β1. It has been shown that TGF-β1 can limit T cell responses (49), but the mechanism by which TGF-β1 is acting on T cells to limit antiviral immunity in this context is, as yet, unclear. We speculate that lung injury following irradiation may cause increased TGF-β1 production, which then acts to suppress T cell effector function. It is curious that TGF-β1 levels are elevated at all radiation doses tested, yet antiviral immunity is only significantly impaired at the 1350-rad dose. Thus, it is likely that the defects in host defense involve both elevated TGF-β1 but also additional changes induced by myeloablative conditioning. We hypothesize that myeloablative conditioning may increase the sensitivity of the repopulated T cells to TGF-β1. We examined the expression of the TGF-β1 receptors I and II on T cells from control and BMT mice and found no differences (data not shown). Interestingly, however, treatment of T cells from control and syngeneic BMT mice with 5 ng/ml TGF-β1 for 24 h resulted in ∼3-fold greater induction in COX-2, a known TGF-β1–responsive gene (54) over unstimulated levels in the BMT T cells when compared with control T cells (data not shown). These results suggest that myeloablative conditioning alters the host environment in such a way that the repopulating T cells are more sensitive to TGF-β1 signal transduction, but the exact mechanism by which this occurs will require further study.

Control of γHV-68 infection is critically dependent on the ability of the CD4 T cells to produce IFN-γ (19). Our results demonstrate that the number of IFN-γ–expressing effector CD4 T cells is significantly diminished in the lungs of BMT mice on day 7 postinfection when compared with control mice (Fig. 11). Additionally, the CD4 T cells in the BMT mice overproduce IL-17a. It is possible that the increased levels of TGF-β1 or increased TGF-β1 signaling noted in BMT mice may drive the differentiation of the effector CD4 T cells toward a Th17 phenotype as opposed to a Th1 phenotype. In support of this hypothesis, splenic T cells from the CD4-DN-TGF-βRII BMT mice, which are unresponsive to TGF-β1, produce more IFN-γ and less IL-17a than do T cells from wild-type syngeneic BMT mice. Of note, there is also a trend toward increased levels of IL-6 in the lungs of syngeneic BMT mice compared with control mice (70.3 ± 3.1 versus 60.7 ± 3.9 pg/ml; n = 6; p = 0.08). Our findings of improved antiviral host defense in the CD4-DN-TGF-βRII BMT mice correlate with previous studies, which have demonstrated effective polarization of CD4 cells to Th1 effectors in the donor mice (20). Although it is likely that the impaired host defense in BMT mice is a direct result of the diminished capacity for effector CD4 T cells to produce IFN-γ post-BMT, it is possible that IL-17a directly inhibits antiviral host defense. Our future studies will attempt to differentiate between these two possibilities.

In summary, we have found that mice undergoing syngeneic or allogeneic BMT have an increased susceptibility to pulmonary infection with γHV-68 at a time point when full reconstitution of hematopoietic cells has occurred. Our data suggest that BMT mice do not have impaired Ag presentation capacity and also suggest that increased numbers of Tregs are not responsible for impaired antiviral immunity post-BMT. Rather, BMT mice are characterized by elevated TGF-β1 production, diminished T cell-proliferative responses, and a skewing of effector CD4 T cells from a Th1 to a Th17 phenotype. When mice were transplanted with CD4-DN-TGF-βRII bone marrow, antiviral immunity was restored. Collectively, these data suggest that induction of TGF-β1 in the lung following BMT may be a factor contributing to impaired anti-viral immunity in transplant recipients.

We thank Drs. Susan Faust and Keith Bishop for the provision of the CD4-DN-TGF-βRII mice, Dr. John Erb-Downward for advice on intracellular cytokine staining, and Drs. Tracy R. Luckhardt and Linda F. van Dyk for helpful discussions.

Disclosures The authors have no financial conflicts of interest.

This work was supported by National Institutes of Health Grants AI065543 and HL087846.

The online version of this article contains supplemental material.

Abbreviations used in this paper:

AEC

alveolar epithelial cell

BMDC

bone marrow-derived dendritic cell

BMT

bone marrow transplantation

COX

cyclooxygenase

DC

dendritic cell

F

forward

GVHD

graft-versus-host disease

i.n.

intranasal(ly)

HSCT

hematopoietic stem cell transplantation

R

reverse

Treg

regulatory T cell.

1
Horowitz
M. M.
,
Loberiza
F. R.
,
Bredeson
C. N.
,
Rizzo
J. D.
,
Nugent
M. L.
.
2001
.
Transplant registries: guiding clinical decisions and improving outcomes.
Oncology (Williston Park)
15
:
649
659; discussion 663–644, 666
.
2
Copelan
E. A.
2006
.
Hematopoietic stem-cell transplantation.
N. Engl. J. Med.
354
:
1813
1826
.
3
Soubani
A. O.
,
Miller
K. B.
,
Hassoun
P. M.
.
1996
.
Pulmonary complications of bone marrow transplantation.
Chest
109
:
1066
1077
.
4
Wald
A.
,
Leisenring
W.
,
van Burik
J. A.
,
Bowden
R. A.
.
1997
.
Epidemiology of Aspergillus infections in a large cohort of patients undergoing bone marrow transplantation.
J. Infect. Dis.
175
:
1459
1466
.
5
Lossos
I. S.
,
Breuer
R.
,
Or
R.
,
Strauss
N.
,
Elishoov
H.
,
Naparstek
E.
,
Aker
M.
,
Nagler
A.
,
Moses
A. E.
,
Shapiro
M.
, et al
.
1995
.
Bacterial pneumonia in recipients of bone marrow transplantation: a five-year prospective study.
Transplantation
60
:
672
678
.
6
Konoplev
S.
,
Champlin
R. E.
,
Giralt
S.
,
Ueno
N. T.
,
Khouri
I.
,
Raad
I.
,
Rolston
K.
,
Jacobson
K.
,
Tarrand
J.
,
Luna
M.
, et al
.
2001
.
Cytomegalovirus pneumonia in adult autologous blood and marrow transplant recipients.
Bone Marrow Transplant.
27
:
877
881
.
7
Kotloff
R. M.
,
Ahya
V. N.
,
Crawford
S. W.
.
2004
.
Pulmonary complications of solid organ and hematopoietic stem cell transplantation.
Am. J. Respir. Crit. Care Med.
170
:
22
48
.
8
Kontoyiannis
D. P.
,
Lewis
R. E.
,
Marr
K.
.
2009
.
The burden of bacterial and viral infections in hematopoietic stem cell transplant.
Biol. Blood Marrow Transplant.
15
(
Suppl. 1
):
128
133
.
9
Atkinson
K.
,
Nivison-Smith
I.
,
Dodds
A.
,
Concannon
A.
,
Milliken
S.
,
Downs
K.
.
1998
.
A comparison of the pattern of interstitial pneumonitis following allogeneic bone marrow transplantation before and after the introduction of prophylactic ganciclovir therapy in 1989.
Bone Marrow Transplant.
21
:
691
695
.
10
Gohring
K.
,
Feuchtinger
T.
,
Mikeler
E.
,
Lang
P.
,
Jahn
G.
,
Handgretinger
R.
,
Hamprecht
K.
.
2009
.
Dynamics of the emergence of a human cytomegalovirus UL97 mutant strain conferring ganciclovir resistance in a pediatric stem-cell transplant recipient.
J. Mol. Diagn.
11
:
364
368
.
11
Burns
L. J.
2009
.
Late effects after autologous hematopoietic cell transplantation.
Biol. Blood Marrow Transplant.
15
(
Suppl 1.
):
21
24
.
12
Jantunen
E.
,
Itälä
M.
,
Siitonen
T.
,
Koivunen
E.
,
Leppä
S.
,
Juvonen
E.
,
Kuittinen
O.
,
Lehtinen
T.
,
Koistinen
P.
,
Nyman
H.
, et al
.
2006
.
Late non-relapse mortality among adult autologous stem cell transplant recipients: a nation-wide analysis of 1,482 patients transplanted in 1990–2003.
Eur. J. Haematol.
77
:
114
119
.
13
Ojielo
C. I.
,
Cooke
K.
,
Mancuso
P.
,
Standiford
T. J.
,
Olkiewicz
K. M.
,
Clouthier
S.
,
Corrion
L.
,
Ballinger
M. N.
,
Toews
G. B.
,
Paine
R.
 III
,
Moore
B. B.
.
2003
.
Defective phagocytosis and clearance of Pseudomonas aeruginosa in the lung following bone marrow transplantation.
J. Immunol.
171
:
4416
4424
.
14
Ljungman
P.
2002
.
Prevention and treatment of viral infections in stem cell transplant recipients.
Br. J. Haematol.
118
:
44
57
.
15
Efstathiou
S.
,
Ho
Y. M.
,
Hall
S.
,
Styles
C. J.
,
Scott
S. D.
,
Gompels
U. A.
.
1990
.
Murine herpesvirus 68 is genetically related to the gammaherpesviruses Epstein-Barr virus and herpesvirus saimiri.
J. Gen. Virol.
71
:
1365
1372
.
16
Stewart
J. P.
,
Usherwood
E. J.
,
Ross
A.
,
Dyson
H.
,
Nash
T.
.
1998
.
Lung epithelial cells are a major site of murine gammaherpesvirus persistence.
J. Exp. Med.
187
:
1941
1951
.
17
Flaño
E.
,
Husain
S. M.
,
Sample
J. T.
,
Woodland
D. L.
,
Blackman
M. A.
.
2000
.
Latent murine gamma-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages.
J. Immunol.
165
:
1074
1081
.
18
Doherty
P. C.
,
Christensen
J. P.
,
Belz
G. T.
,
Stevenson
P. G.
,
Sangster
M. Y.
.
2001
.
Dissecting the host response to a gamma-herpesvirus.
Philos. Trans. R. Soc. Lond. B Biol. Sci.
356
:
581
593
.
19
Sparks-Thissen
R. L.
,
Braaten
D. C.
,
Hildner
K.
,
Murphy
T. L.
,
Murphy
K. M.
,
Virgin
H. W.
 IV
.
2005
.
CD4 T cell control of acute and latent murine gammaherpesvirus infection requires IFNγ.
Virology
338
:
201
208
.
20
Gorelik
L.
,
Flavell
R. A.
.
2000
.
Abrogation of TGFβ signaling in T cells leads to spontaneous T cell differentiation and autoimmune disease.
Immunity
12
:
171
181
.
21
Faust
S. M.
,
Lu
G.
,
Marini
B. L.
,
Zou
W.
,
Gordon
D.
,
Iwakura
Y.
,
Laouar
Y.
,
Bishop
D. K.
.
2009
.
Role of T cell TGFβ signaling and IL-17 in allograft acceptance and fibrosis associated with chronic rejection.
J. Immunol.
183
:
7297
7306
.
22
Ballinger
M. N.
,
Aronoff
D. M.
,
McMillan
T. R.
,
Cooke
K. R.
,
Olkiewicz
K.
,
Toews
G. B.
,
Peters-Golden
M.
,
Moore
B. B.
.
2006
.
Critical role of prostaglandin E2 overproduction in impaired pulmonary host response following bone marrow transplantation.
J. Immunol.
177
:
5499
5508
.
23
Hubbard
L. L.
,
Ballinger
M. N.
,
Wilke
C. A.
,
Moore
B. B.
.
2008
.
Comparison of conditioning regimens for alveolar macrophage reconstitution and innate immune function post bone marrow transplant.
Exp. Lung Res.
34
:
263
275
.
24
McMillan
T. R.
,
Moore
B. B.
,
Weinberg
J. B.
,
Vannella
K. M.
,
Fields
W. B.
,
Christensen
P. J.
,
van Dyk
L. F.
,
Toews
G. B.
.
2008
.
Exacerbation of established pulmonary fibrosis in a murine model by gammaherpesvirus.
Am. J. Respir. Crit. Care Med.
177
:
771
780
.
25
Weck
K. E.
,
Dal Canto
A. J.
,
Gould
J. D.
,
O’Guin
A. K.
,
Roth
K. A.
,
Saffitz
J. E.
,
Speck
S. H.
,
Virgin
H. W.
.
1997
.
Murine gamma-herpesvirus 68 causes severe large-vessel arteritis in mice lacking interferon-γ responsiveness: a new model for virus-induced vascular disease.
Nat. Med.
3
:
1346
1353
.
26
Huffnagle
G. B.
,
Strieter
R. M.
,
Standiford
T. J.
,
McDonald
R. A.
,
Burdick
M. D.
,
Kunkel
S. L.
,
Toews
G. B.
.
1995
.
The role of monocyte chemotactic protein-1 (MCP-1) in the recruitment of monocytes and CD4+ T cells during a pulmonary Cryptococcus neoformans infection.
J. Immunol.
155
:
4790
4797
.
27
Kruisbeek
A. M.
,
Shevach
E.
,
Thornton
A. M.
.
2004
.
Proliferative assays for T cell function
. In
Current Protocols in Immunology.
Coligan
J. E.
,
Bierer
B. E.
,
Margulies
D. H.
,
Shevach
E. M.
,
Strober
W.
,
Coico
R.
John Wiley & Sons, Inc.
,
Hoboken, NJ
3.12.1
3.12.20
.
28
Lutz
M. B.
,
Kukutsch
N.
,
Ogilvie
A. L.
,
Rössner
S.
,
Koch
F.
,
Romani
N.
,
Schuler
G.
.
1999
.
An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow.
J. Immunol. Methods
223
:
77
92
.
29
Charbeneau
R. P.
,
Christensen
P. J.
,
Chrisman
C. J.
,
Paine
R.
 III
,
Toews
G. B.
,
Peters-Golden
M.
,
Moore
B. B.
.
2003
.
Impaired synthesis of prostaglandin E2 by lung fibroblasts and alveolar epithelial cells from GM-CSF–/– mice: implications for fibroproliferation.
Am. J. Physiol. Lung Cell. Mol. Physiol.
284
:
L1103
L1111
.
30
Corti
M.
,
Brody
A. R.
,
Harrison
J. H.
.
1996
.
Isolation and primary culture of murine alveolar type II cells.
Am. J. Respir. Cell Mol. Biol.
14
:
309
315
.
31
Shapiro
A. C.
,
Wu
D.
,
Meydani
S. N.
.
1993
.
Eicosanoids derived from arachidonic and eicosapentaenoic acids inhibit T cell proliferative response.
Prostaglandins
45
:
229
240
.
32
Martin
M.
,
Lefaix
J.
,
Delanian
S.
.
2000
.
TGF-β1 and radiation fibrosis: a master switch and a specific therapeutic target?
Int. J. Radiat. Oncol. Biol. Phys.
47
:
277
290
.
33
Zheng
S. G.
2008
.
The critical role of TGF-β1 in the development of induced Foxp3+ regulatory T cells.
Int. J. Clin. Exp. Med.
1
:
192
202
.
34
Bryn
T.
,
Yaqub
S.
,
Mahic
M.
,
Henjum
K.
,
Aandahl
E. M.
,
Taskén
K.
.
2008
.
LPS-activated monocytes suppress T-cell immune responses and induce FOXP3+ T cells through a COX-2-PGE2–dependent mechanism.
Int. Immunol.
20
:
235
245
.
35
Baratelli
F.
,
Lin
Y.
,
Zhu
L.
,
Yang
S. C.
,
Heuzé-Vourc’h
N.
,
Zeng
G.
,
Reckamp
K.
,
Dohadwala
M.
,
Sharma
S.
,
Dubinett
S. M.
.
2005
.
Prostaglandin E2 induces FOXP3 gene expression and T regulatory cell function in human CD4+ T cells.
J. Immunol.
175
:
1483
1490
.
36
Lúdvíksson
B. R.
,
Seegers
D.
,
Resnick
A. S.
,
Strober
W.
.
2000
.
The effect of TGF-β1 on immune responses of naïve versus memory CD4+ Th1/Th2 T cells.
Eur. J. Immunol.
30
:
2101
2111
.
37
Veldhoen
M.
,
Hocking
R. J.
,
Atkins
C. J.
,
Locksley
R. M.
,
Stockinger
B.
.
2006
.
TGFβ in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17–producing T cells.
Immunity
24
:
179
189
.
38
Ackermann
M.
2006
.
Pathogenesis of gammaherpesvirus infections.
Vet. Microbiol.
113
:
211
222
.
39
Schuurhuis
D. H.
,
Fu
N.
,
Ossendorp
F.
,
Melief
C. J.
.
2006
.
Ins and outs of dendritic cells.
Int. Arch. Allergy Immunol.
140
:
53
72
.
40
Avigan
D.
,
Wu
Z.
,
Joyce
R.
,
Elias
A.
,
Richardson
P.
,
McDermott
D.
,
Levine
J.
,
Kennedy
L.
,
Giallombardo
N.
,
Hurley
D.
, et al
.
2000
.
Immune reconstitution following high-dose chemotherapy with stem cell rescue in patients with advanced breast cancer.
Bone Marrow Transplant.
26
:
169
176
.
41
Sparks-Thissen
R. L.
,
Braaten
D. C.
,
Kreher
S.
,
Speck
S. H.
,
Virgin
H. W.
 IV
.
2004
.
An optimized CD4 T-cell response can control productive and latent gammaherpesvirus infection.
J. Virol.
78
:
6827
6835
.
42
Nataraj
C.
,
Thomas
D. W.
,
Tilley
S. L.
,
Nguyen
M. T.
,
Mannon
R.
,
Koller
B. H.
,
Coffman
T. M.
.
2001
.
Receptors for prostaglandin E2 that regulate cellular immune responses in the mouse.
J. Clin. Invest.
108
:
1229
1235
.
43
Anscher
M. S.
,
Kong
F. M.
,
Jirtle
R. L.
.
1998
.
The relevance of transforming growth factor β1 in pulmonary injury after radiation therapy.
Lung Cancer
19
:
109
120
.
44
Gamble
J. R.
,
Khew-Goodall
Y.
,
Vadas
M. A.
.
1993
.
Transforming growth factor-β inhibits E-selectin expression on human endothelial cells.
J. Immunol.
150
:
4494
4503
.
45
Gamble
J. R.
,
Vadas
M. A.
.
1991
.
Endothelial cell adhesiveness for human T lymphocytes is inhibited by transforming growth factor-β1.
J. Immunol.
146
:
1149
1154
.
46
Chin
Y. H.
,
Cai
J. P.
,
Xu
X. M.
.
1992
.
Transforming growth factor-β1 and IL-4 regulate the adhesiveness of Peyer’s patch high endothelial venule cells for lymphocytes.
J. Immunol.
148
:
1106
1112
.
47
Tudor
K. S.
,
Hess
K. L.
,
Cook-Mills
J. M.
.
2001
.
Cytokines modulate endothelial cell intracellular signal transduction required for VCAM-1–dependent lymphocyte transendothelial migration.
Cytokine
15
:
196
211
.
48
Suzuki
Y.
,
Tanigaki
T.
,
Heimer
D.
,
Wang
W.
,
Ross
W. G.
,
Murphy
G. A.
,
Sakai
A.
,
Sussman
H. H.
,
Vu
T. H.
,
Raffin
T. A.
.
1994
.
TGF-β1 causes increased endothelial ICAM-1 expression and lung injury.
J. Appl. Physiol.
77
:
1281
1287
.
49
Letterio
J. J.
,
Roberts
A. B.
.
1998
.
Regulation of immune responses by TGF-β.
Annu. Rev. Immunol.
16
:
137
161
.
50
Wan
Y. Y.
,
Flavell
R. A.
.
2007
.
Regulatory T cells, transforming growth factor-β, and immune suppression.
Proc. Am. Thorac. Soc.
4
:
271
276
.
51
Le
N. T.
,
Chao
N.
.
2007
.
Regulating regulatory T cells.
Bone Marrow Transplant.
39
:
1
9
.
52
Bayer
A. L.
,
Jones
M.
,
Chirinos
J.
,
de Armas
L.
,
Schreiber
T. H.
,
Malek
T. R.
,
Levy
R. B.
.
2009
.
Host CD4+CD25+ T cells can expand and comprise a major component of the Treg compartment after experimental HCT.
Blood
113
:
733
743
.
53
Nguyen
V. H.
,
Shashidhar
S.
,
Chang
D. S.
,
Ho
L.
,
Kambham
N.
,
Bachmann
M.
,
Brown
J. M.
,
Negrin
R. S.
.
2008
.
The impact of regulatory T cells on T-cell immunity following hematopoietic cell transplantation.
Blood
111
:
945
953
.
54
Sheng
H.
,
Shao
J.
,
Hooton
E. B.
,
Tsujii
M.
,
DuBois
R. N.
,
Beauchamp
R. D.
.
1997
.
Cyclooxygenase-2 induction and transforming growth factor β growth inhibition in rat intestinal epithelial cells.
Cell Growth Differ.
8
:
463
470
.