Macrophages are part of the tumor microenvironment and have been associated with poor prognosis in uveal melanoma. We determined the presence of macrophages and their differentiation status in a murine intraocular melanoma model. Inoculation of B16F10 cells into the anterior chamber of the eye resulted in rapid tumor outgrowth. Strikingly, in aged mice, tumor progression depended on the presence of macrophages, as local depletion of these cells prevented tumor outgrowth, indicating that macrophages in old mice had a strong tumor-promoting role. Immunohistochemistry and gene expression analysis revealed that macrophages carried M2-type characteristics, as shown by CD163 and peroxisome proliferator-activated receptor γ expression, and that multiple angiogenic genes were heavily overrepresented in tumors of old mice. The M2-type macrophages were also shown to have immunosuppressive features. We conclude that tumor-associated macrophages are directly involved in tumor outgrowth of intraocular melanoma and that macrophages in aged mice have a predisposition for an M2-type profile.

Uveal melanoma is the most frequent intraocular tumor in adults, with an estimated incidence among whites of six to eight cases per million people per year (1). Several prognostic factors have been described for this type of cancer, and one of these is infiltration of macrophages in the tumor. A high macrophage density is not only associated with a poor prognosis in uveal melanoma, but also in many other types of cancer (24). Macrophages are part of the inflammatory phenotype of uveal melanoma and are associated with an increased microvascular density, leukocyte infiltration, and monosomy of chromosome 3 (5, 6).

That macrophages play a role in angiogenesis has been shown in models of intraocular choroidal neovascularization (79). Following laser treatment of the posterior pole of murine eyes, choroidal neovascularization develops, which is accompanied by a massive infiltrate of macrophages. Interestingly, age is an important determinant; whereas young mice show limited neoangiogenesis, old mice develop massive neovascularization (7). Macrophages are prominent mediators in this process; depletion of local macrophages or inhibition of their effector functions diminishes choroidal neovascularization in old mice.

Different types of macrophages have been identified: the classically activated macrophage can stimulate immune responses and has antibacterial and antiangiogenic functions. The alternatively activated macrophage, in contrast, displays a proangiogenic and anti-inflammatory phenotype. These two types of macrophages have been named M1- and M2-type macrophages, respectively (10, 11).

In the laser model, the balance between the macrophage subtypes differed between young and old mice; old mice carried more proangiogenic M2-type macrophages, whereas young mice showed a polarization toward the immunostimulatory M1-type macrophages, which can inhibit angiogenesis. These data indicate that age may influence blood vessel growth, which has considerable consequences for diseases, such as cancer, in which angiogenesis plays a key role. The so-called tumor-associated macrophages (TAMs) can stimulate angiogenesis, thus creating an ideal environment for cancer cells to grow (12). The formation of new blood vessels is essential for the survival of cancer cells as they supply nutrients to expanding tumors, and vessels can be used for tumor dissemination (13, 14). This might explain why the presence of high numbers of TAMs in uveal melanoma is associated with a decreased survival (2).

Based on this knowledge, we asked the question whether macrophages are involved in intraocular tumors, as they are in laser-induced neovascularization. We studied tumor growth postremoval of macrophages in an ocular tumor model (1517). Because Espinosa-Heidmann and Apte (7, 8) showed that age influences macrophage polarization, we also determined whether tumor growth was different in young versus old mice and what the effect of macrophage depletion would be on tumor progression at different ages. Interestingly, the polarization toward M1- or M2-type macrophages caused differences in tumor growth between young and old mice in our ocular tumor model and was related to the specific functions of the macrophages.

Male C57BL/6jico mice, 8 wk and 10–12 mo old, were obtained from Charles River Laboratories (Saint Germain sur L’Arbresle, France). All animals were housed under specific pathogen-free conditions and cared for in accordance with the guidelines of the University Committee for the Humane Care of Laboratory Animals, National Institutes of Health (Bethesda, MD) guidelines on laboratory animal welfare, and the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. Our research protocols were approved by the Committee for Animal Welfare, Leiden University Medical Center, Leiden, The Netherlands. Prior to inoculation of tumor cells, eyes were examined under a binocular microscope.

The B16F10 melanoma cell line was cultured in IMDM (Invitrogen, Carlsbad, CA) supplemented with 10% FCS, glutamine, and 2% penicillin/ streptomycin. Cells were incubated at 37°C in a humidified atmosphere containing 5% CO2. Cells were used for inoculation when cultures showed 70% confluency.

A previously described technique for deposition of tumor cells into the anterior chamber (AC) of the mouse was applied with slight modifications (15, 17). Mice were anesthetized with a mixture (ratio 1:1) of xylazine (Rompun 2%, Bayer, Leverkussen, Germany) and ketamine hydrochloride (Aescoket, Aesculaap, Boxtel, The Netherlands), given i.p. The eye was viewed at low magnification (×10) under a Carl Zeiss dissecting microscope (Zeiss, Oberkochen, Germany), and a sterile 30-gauge needle was used for making a paracentesis at the corneoscleral junction, parallel and anterior to the iris. A fused silica capillary (200 μm outer diameter, 100 μm inner diameter) was fitted into a union (Valco, Vici, Schenkon, Switzerland) used in chromatography. The capillary and the union were mounted onto a 0.1-ml Hamilton syringe. The capillary, loaded with B16F10 melanoma cells (2.5 × 104 cells/4 μl), was inserted through the paracentesis of the cornea, and the tumor cells were deposited into the AC.

B16F10 tumor cells were injected into eyes of young and old mice: both groups of mice were separated into two groups (i.e., with and without macrophage depletion). The eyes were examined three times a week with a dissecting microscope to observe and document tumor growth. Tumor volume was recorded as the percentage of anterior chamber occupied by tumor. Mice were sacrificed by cervical dislocation when the tumor occupied 80–100% of the AC.

For macrophage depletion, clodronate-containing liposomes were used. Preparation of multilamellar phosphatidyl-choline liposomes containing Cl2MDP took place as described previously (18).

For in vivo macrophage depletion, Cl2MDP liposomes were injected subconjunctivally 2 d before and 2, 6, 10, and 14 d after tumor cell inoculation. Mice were anesthetized as above. Under a dissecting microscope, the conjunctiva was lifted with a fine forceps, and a 30-gauge needle was used to puncture the conjunctiva at four different locations around the limbus. The fused silica capillary mounted onto a sterile 0.1 ml Hamilton syringe was introduced through four puncture sites of the conjunctiva, and at each puncture site, 4 μl liposome suspension (7 mg clodronate/ml) was delivered. In total, 16 μl Cl2MDP liposome suspension were injected into the bulbar conjunctiva, resulting in an equally distributed bleb surrounding the limbus.

Enucleated eyes were fixed in 4% buffered neutralized formalin. Postfixation for 24 h, we dehydrated eyes in 70% alcohol. After embedding in paraffin, 4-μm serial sections were made, mounted on a slide, and stained with H&E.

Macrophages were visualized by immunohistochemistry using the rat anti-mouse macrophage mAb F4/80 (clone C1:A3-1, IgG2b; Serotec, Oxford, U.K.). For staining M2-type macrophages, rabbit anti-mouse mAb CD163 (clone M-96; Santa Cruz Biotechnology, Santa Cruz, CA) was used. Incubation with the mAb F4/80 was followed by biotinylated rabbit anti-rat IgG Ab (code number E0467; DakoCytomation, Glostrup, Denmark) diluted 1:300 in PBS containing 1% BSA. For CD163 staining, biotinylated swine anti-rabbit IgG Ab (code number E0431; DakoCytomation) was used postincubation with the primary Ab, diluted 1:400. After a final incubation with biotinylated alkaline phosphatase-streptavidin, diluted 1:100 (code number K0391; DakoCytomation), the alkaline phosphatase reaction was developed using Fast Red (Scytek, Logan, UT) in a naphthol-phosphate buffer (Scytek) with 50 mM levamisole (DakoCytomation). After 20 min, this reaction was blocked in distilled water. The slides were counterstained with Mayer’s hematoxylin and mounted in Kaiser’s glycerin. Control sections were incubated with secondary Abs alone. In addition, spleen sections were used as positive controls. Microscopic slides were evaluated without knowledge of prior treatment.

Fluorescent staining was performed on eyes, which had been enucleated and directly embedded in Tissuetek OCT (Sakura Fine-Tek, Zoeterwoude, The Netherlands). Four-micrometer cryosections were made and fixated in acetone for 10 min. For staining M2-type macrophages, rabbit anti-mouse mAb CD163 (clone M-96; Santa Cruz Biotechnology) was used in a 1:400 dilution, with a 1-h incubation. Because myeloid-derived suppressor cells (MDSCs) from the monocytic lineage have been characterized as being Gr-1low (19), staining with rat anti-mouse Gr-1 (clone RB6-8C5; eBioscience, San Diego, CA) took place at a 1:100 dilution, and a 1-h incubation. Goat anti-rabbit Alexa 488 and goat anti-rat Alexa 549 (Molecular Probes/Invitrogen, Carlsbad, CA) were used as secondary Abs with an incubation of 1 h to visualize the cells. Slides were evaluated with confocal microscopy.

Eyes were enucleated and directly embedded in Tissuetek OCT (Sakura Fine-Tek). Forty cryosections of 20 μm were made of the tumor-bearing AC, and by using an RNeasy Mini Kit (Qiagen, Valencia, CA), RNA was extracted from these sections. cDNA was synthesized using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Quantitative PCR (qPCR) was performed on several genes expressed by macrophages: F4/80 and CD11b are markers of common macrophages (20), MCP-1 has been reported as being expressed by M1 macrophages (21), whereas peroxisome proliferator-activated receptor γ (PPARG) (22), and CD163 (23) (scavenger receptor on M2 macrophages) are expressed by M2 macrophages; IL-10 (21) and arginase-1 (ARG-1) (24, 25) have been described to be specific for functionally active M2 macrophages. Stabilin 1 (STAB1) has been shown to be associated with M1 macrophages (26), but is also a scavenger receptor on M2 macrophages (27, 28). Ly-6G is a marker for MDSCs from granulocytic lineage, whereas Ly-6C characterizes these cells from the monocytic lineage (29). GAPDH, β-actin, RN18S, and β2-microglobulin (β2m) were initially included for selecting suitable reference genes. Furthermore, the expression of several genes that have been associated with angiogenesis was determined: vascular endothelial growth factor (VEGF) and tyrosine kinase with Ig and epidermal growth factor homology domains-2 (TIE-2) are associated with the proangiogenic capabilities of M2 macrophages, whereas CD31 is expressed on the endothelium of blood vessels (3032). Primers were designed with Beacon Designer (Biosoft, Palo Alto, CA). Primer sequences are shown in Table II. qPCR was performed according to our standard laboratory protocol, as described previously (33). By using the Lightcycler, it was possible to perform qPCR synchronically on several genes. The results were subsequently validated with the iQ5 Bio-Rad system (Bio-Rad).

Table II.
Primer sequences (5′–3′) designed with Beacon Designer software
F4/80 GCCTATTATCTATACCCTCCAGCACATC, F4/80mF 
TCCATCTCCCATCCTCCACATCAG, F4/80mR 
CD11b GAATGCTGCGAAGATCCTAGTTGTC, CD11BmF 
CGGGACTGTGGTTTGTTGAAGG, CD11BmR 
MCP-1 CGGAACCAAATGAGATCAGAACCTAC, MCP1mF 
GCTTCAGATTTACGGGTCAACTTCAC, MCP1mR 
STAB1 TGCTTCACTCCCTCAACTCTCTG, STAB1mF 
GGCTAACTACACCTACACGATTATTACC, STAB1mR 
CD163 CCTCCTCATTGTCTTCCTCCTGTG, CD163mF 
CATCCGCCTTTGAATCCATCTCTTG, CD163mR 
PPARG TGGAATTAGATGACAGTGACTTGGC, PPARGmF 
TGGAGCACCTTGGCGAACAG, PPARGmR 
IL-10 CAGGACTTTAAGGGTTACTTGGGTTG, Il10mF 
GCTCCACTGCCTTGCTCTTATTTTC, Il10mR 
ARG-1 TGAGAGACCACGGGGACCTG, ARGmF 
GCACCACACTGACTCTTCCATTC, ARGmR 
Ly-6G TCTGATGGATTTTGCGTTGCTCTG, Ly-6GmF 
GCATTACCAGTGATCTCAGTATTGTCC, Ly-6GmR 
Ly-6C CATTTAGTTGTGGATTTCTATTCTTGGC, Ly6C12mF 
CAGATACTTATGTGTGGATGGTGATAC, Ly6C12mR 
VEGF AGTCCCATGAAGTGATAAGTTCA, VEGFmF 
ATCCGCATGATCTGCATGG, VEGFmR 
CD31 CCAGGGAGCACACCGAGAG, CD31mF 
TGTCACCTTGGGCTTGGATACG, CD31mR 
TIE-2 CGAGGACAGGCTATAAGGATACGG, TIE2mF 
GTCATAGTTAAAGTAGCAGGTAGGAAGG, TIE2mR 
GAPDH GTGCTGAGTATGTCGTGGAGTCTAC, GAPDHmF 
GGCGGAGATGATGACCCTTTTGG, GAPDHmR 
β2CGGTCGCTTCAGTCGTCAG, B2mmF 
GCAGTTCAGTATGTTCGGCTTCC, B2mmR 
β-Actin CGGGACCTGACTGACTACCTC, ACTIN-BmF 
CTCCTTAATGTCACGCACGATTTC, ACTIN-BmR 
RN18S CGATGCGGCGGCGTTATTC, RN18SmF 
ATCTGTCAATCCTGTCCGTGTCC, RN18SmR 
F4/80 GCCTATTATCTATACCCTCCAGCACATC, F4/80mF 
TCCATCTCCCATCCTCCACATCAG, F4/80mR 
CD11b GAATGCTGCGAAGATCCTAGTTGTC, CD11BmF 
CGGGACTGTGGTTTGTTGAAGG, CD11BmR 
MCP-1 CGGAACCAAATGAGATCAGAACCTAC, MCP1mF 
GCTTCAGATTTACGGGTCAACTTCAC, MCP1mR 
STAB1 TGCTTCACTCCCTCAACTCTCTG, STAB1mF 
GGCTAACTACACCTACACGATTATTACC, STAB1mR 
CD163 CCTCCTCATTGTCTTCCTCCTGTG, CD163mF 
CATCCGCCTTTGAATCCATCTCTTG, CD163mR 
PPARG TGGAATTAGATGACAGTGACTTGGC, PPARGmF 
TGGAGCACCTTGGCGAACAG, PPARGmR 
IL-10 CAGGACTTTAAGGGTTACTTGGGTTG, Il10mF 
GCTCCACTGCCTTGCTCTTATTTTC, Il10mR 
ARG-1 TGAGAGACCACGGGGACCTG, ARGmF 
GCACCACACTGACTCTTCCATTC, ARGmR 
Ly-6G TCTGATGGATTTTGCGTTGCTCTG, Ly-6GmF 
GCATTACCAGTGATCTCAGTATTGTCC, Ly-6GmR 
Ly-6C CATTTAGTTGTGGATTTCTATTCTTGGC, Ly6C12mF 
CAGATACTTATGTGTGGATGGTGATAC, Ly6C12mR 
VEGF AGTCCCATGAAGTGATAAGTTCA, VEGFmF 
ATCCGCATGATCTGCATGG, VEGFmR 
CD31 CCAGGGAGCACACCGAGAG, CD31mF 
TGTCACCTTGGGCTTGGATACG, CD31mR 
TIE-2 CGAGGACAGGCTATAAGGATACGG, TIE2mF 
GTCATAGTTAAAGTAGCAGGTAGGAAGG, TIE2mR 
GAPDH GTGCTGAGTATGTCGTGGAGTCTAC, GAPDHmF 
GGCGGAGATGATGACCCTTTTGG, GAPDHmR 
β2CGGTCGCTTCAGTCGTCAG, B2mmF 
GCAGTTCAGTATGTTCGGCTTCC, B2mmR 
β-Actin CGGGACCTGACTGACTACCTC, ACTIN-BmF 
CTCCTTAATGTCACGCACGATTTC, ACTIN-BmR 
RN18S CGATGCGGCGGCGTTATTC, RN18SmF 
ATCTGTCAATCCTGTCCGTGTCC, RN18SmR 

Calculation of the gene expression was as follows: the Ct value of each sample obtained from qPCR was normalized to the reference genes (genes that are stably expressed in the tissue). Because multiple genes were stably expressed [determined with the geNorm software (34, 35)], the gene of interest was corrected for the geometric mean of all reference genes, according to the method of Van den Sompele et al. (35). The calculated values were the normalized values of each eye sample. Subsequently, a ratio of the normalized values of the tumor eye and the fellow eye was taken, resulting in the expressed value of a gene of interest in a specific mouse. The contralateral eye thus served as control for basal expression of the macrophage markers.

Statistical analyses were performed using GraphPad software (GraphPad, San Diego, CA).

As macrophages are known to play an important role in tumors, and age influences polarization toward different subtypes of macrophages, we determined whether tumor growth differed in the eyes of young and old mice by using a syngeneic AC tumor model with the B16F10 melanoma cell line in a C57BL/6 mouse (Fig. 1A, 1B).

FIGURE 1.

Intraocular B16 tumor growth. A, Representative H&E-stained section of a B16 tumor growing in the AC of the eye of a young mouse (original magnification ×2.5). The structures in the eye are indicated. B, Representative images of different stages (initial, partial, and maximal) of a B16 tumor growing in the AC of the eye of a young mouse, as shown with H&E staining (original magnification ×2.5). C, Percentage of mice with maximal tumor growth in the AC in young and old mice without macrophage depletion, showing that the growth rate in both groups is comparable (p = 0.1). Mice were sacrificed when 100% of the AC was occupied by tumor cells. This experiment was repeated once, and in each experiment, each group consisted of seven mice.

FIGURE 1.

Intraocular B16 tumor growth. A, Representative H&E-stained section of a B16 tumor growing in the AC of the eye of a young mouse (original magnification ×2.5). The structures in the eye are indicated. B, Representative images of different stages (initial, partial, and maximal) of a B16 tumor growing in the AC of the eye of a young mouse, as shown with H&E staining (original magnification ×2.5). C, Percentage of mice with maximal tumor growth in the AC in young and old mice without macrophage depletion, showing that the growth rate in both groups is comparable (p = 0.1). Mice were sacrificed when 100% of the AC was occupied by tumor cells. This experiment was repeated once, and in each experiment, each group consisted of seven mice.

Close modal

Without macrophage depletion, no difference in tumor incidence (100% in young and 90% in old mice) and growth rate was observed between young and old mice (log-rank test, p = 0.1; Fig. 1C). In young as well as in old mice, mice had to be sacrificed starting from 10–12 d after tumor inoculation when the AC was fully occupied by tumor.

To verify the presence of macrophages, H&E staining was performed on sections of the enucleated eyes from the animals described above (Fig. 1A, 1B). Eyes were enucleated when the AC was fully occupied by the tumor. F4/80 was used as a marker to visualize macrophages, whereas CD163 was used to visualize M2-type macrophages. F4/80-positive cells were present in the tumors of both young and old mice, but more abundant in the tumors of old mice compared with young mice (Fig. 2A, Table I). It was remarkable that macrophages were mainly located in the periphery of the tumor. Similarly, many more CD163+ cells were found in the tumors of old mice than in young mice: in young mice, CD163+ cells were almost absent from the tumors (Fig. 2B). We compared F4/80 and CD163 staining and observed that in old mice, almost all F4/80 positive cells stained also for CD163 (~95% overlap), whereas that was not the case in young mice, in which only a few of the F4/80+ cells were CD163 positive.

FIGURE 2.

F4/80 and CD163 immunohistochemical staining of B16F10 tumors in young and old mice. Eyes of young and old mice were inoculated with 2.5 × 104 B16F10 cells at day 0. No macrophage depletion was applied. When the AC was completely occupied by tumor (100% tumor growth), mice were sacrificed and F4/80 (A) and CD163 (B) staining were performed. The presence of positively staining cells was identified with Fast Red, resulting in a red-colored infiltration of macrophages in the tumor. Eyes are shown at a magnification of ×2.5, with close-ups of ×10 and ×40 magnification (rectangle in the ×2.5 magnification designates the area of which the close-ups are taken). Macrophages are mainly located at the peripheral tumor margins. Furthermore, isotype controls in both young and old mice are shown for both mAbs at a magnification of ×10. F4/80+ macrophages were present in a low amount (± , as in Table I) in young mice, whereas they were classified as high (+++, as in Table I) in old mice. CD163-positive cells were only found in old mice in a high amount, whereas they were almost completely absent in young mice.

FIGURE 2.

F4/80 and CD163 immunohistochemical staining of B16F10 tumors in young and old mice. Eyes of young and old mice were inoculated with 2.5 × 104 B16F10 cells at day 0. No macrophage depletion was applied. When the AC was completely occupied by tumor (100% tumor growth), mice were sacrificed and F4/80 (A) and CD163 (B) staining were performed. The presence of positively staining cells was identified with Fast Red, resulting in a red-colored infiltration of macrophages in the tumor. Eyes are shown at a magnification of ×2.5, with close-ups of ×10 and ×40 magnification (rectangle in the ×2.5 magnification designates the area of which the close-ups are taken). Macrophages are mainly located at the peripheral tumor margins. Furthermore, isotype controls in both young and old mice are shown for both mAbs at a magnification of ×10. F4/80+ macrophages were present in a low amount (± , as in Table I) in young mice, whereas they were classified as high (+++, as in Table I) in old mice. CD163-positive cells were only found in old mice in a high amount, whereas they were almost completely absent in young mice.

Close modal
Table I.
Results of immunohistochemical staining of the intraocular tumors of young and old mice with and without macrophage depletion
Young MouseOld MouseMacrophage-Depleted Young MouseMacrophage-Depleted Old Mouse
F4/80 staining +++ ± ± 
CD163 staining ± +++ ± ± 
Young MouseOld MouseMacrophage-Depleted Young MouseMacrophage-Depleted Old Mouse
F4/80 staining +++ ± ± 
CD163 staining ± +++ ± ± 

Each group contained seven mice.

+, 5–20 macrophages in an examination field at ×10 magnification; +++, >100 macrophages in an examination field at ×10 magnification; ±, 0–5 macrophages in an examination field at ×10 magnification.

Because we hypothesized that the presence of macrophages might be involved in tumor growth, we studied the effect of macrophage depletion on the tumorigenicity of the B16F10 melanoma in our syngeneic AC model, also in young and old mice.

The tumor growth rate and incidence in young mice with and without macrophage depletion (100 versus 90%) were comparable (Fig. 3A; the log-rank test showed no significant difference, p = 0.053). In old mice, a strong difference was observed: removal of macrophages prevented outgrowth of the tumor in 86% of the mice, whereas in the control group that had not received any treatment, almost all mice developed a tumor (Fig. 3B; log-rank test, p = 0.005). Apparently, macrophages are essential for tumor growth in old mice.

FIGURE 3.

Effect of macrophage depletion on B16 tumor growth in young and old mice. Eyes of young and old mice were depleted of macrophages with subconjunctival injections of clodronate liposomes on day 2 prior to and days 2, 6, 10, and 14 after B16 tumor inoculation (2.5 × 104 cells). A, Macrophage depletion has no significant effect on tumor growth (p = 0.053) in young mice. B, However, depletion of macrophages in old mice leads to a significant (p = 0.005) inhibition of tumor growth in 86% of the mice, demonstrating the tumor-supportive effect of macrophages in aged mice. Mice were sacrificed when the AC was 100% occupied by tumor cells. This experiment was repeated once, and each group consisted of seven mice in each experiment (control naive mice are the same mice as shown in Fig. 1C).

FIGURE 3.

Effect of macrophage depletion on B16 tumor growth in young and old mice. Eyes of young and old mice were depleted of macrophages with subconjunctival injections of clodronate liposomes on day 2 prior to and days 2, 6, 10, and 14 after B16 tumor inoculation (2.5 × 104 cells). A, Macrophage depletion has no significant effect on tumor growth (p = 0.053) in young mice. B, However, depletion of macrophages in old mice leads to a significant (p = 0.005) inhibition of tumor growth in 86% of the mice, demonstrating the tumor-supportive effect of macrophages in aged mice. Mice were sacrificed when the AC was 100% occupied by tumor cells. This experiment was repeated once, and each group consisted of seven mice in each experiment (control naive mice are the same mice as shown in Fig. 1C).

Close modal

Macrophage depletion resulted in an almost complete absence of F4/80+ cells in the AC of the eye of both young and old mice (Fig. 4A). As CD163+ cells were especially present in the tumors in the AC of old mice (Fig. 4B, Table I), the effect of macrophage depletion on CD163+ cells could only be seen in old mice.

FIGURE 4.

Immunohistochemical staining of macrophage-depleted eyes in young and old mice. A, Immunohistochemical staining for F4/80 in macrophage-depleted eyes of young and old mice, shown at two magnifications (×2.5 and ×10, closeup of the periphery of the tumor; rectangle in the ×2.5 magnification designates the area where the closeups are taken). F4/80+ macrophages were absent in both young and old mice postadministration of clodronate liposomes. Note the absence of tumor growth in old mice. B. Staining for CD163 was performed on macrophage-depleted eyes of young and old mice, showing almost complete absence of positive cells after macrophage depletion in eyes of young as well as old mice; no tumor growth is observed in eyes of old mice after macrophage depletion. Staining for both markers was developed with Fast Red.

FIGURE 4.

Immunohistochemical staining of macrophage-depleted eyes in young and old mice. A, Immunohistochemical staining for F4/80 in macrophage-depleted eyes of young and old mice, shown at two magnifications (×2.5 and ×10, closeup of the periphery of the tumor; rectangle in the ×2.5 magnification designates the area where the closeups are taken). F4/80+ macrophages were absent in both young and old mice postadministration of clodronate liposomes. Note the absence of tumor growth in old mice. B. Staining for CD163 was performed on macrophage-depleted eyes of young and old mice, showing almost complete absence of positive cells after macrophage depletion in eyes of young as well as old mice; no tumor growth is observed in eyes of old mice after macrophage depletion. Staining for both markers was developed with Fast Red.

Close modal

In addition to immunohistochemical tests, we performed gene expression analysis with qPCR to determine whether the tumor-bearing anterior segment of the eyes of young and old mice contained different types of macrophages. Furthermore, we determined whether M2 macrophages were essential for B16F10 tumor engraftment in old mice. It is known that M2 macrophages exert both a proangiogenic and an immunosuppressive function.

First, we determined the expression of macrophage-associated genes (primer sequences are found in Table II) on cDNA from the B16F10 tumor cell line. Hardly any expression of these genes was present in the tumor cells (data not shown), making these genes specific for macrophage infiltration in the eye.

To select suitable reference genes for normalization of our samples, we analyzed four known reference genes (GAPDH, β-actin, RN18S, β2m) commonly used in qPCRs and three relatively stably expressed genes from our list of test genes (STAB1, MCP-1, and arginase). Using geNorm software, GAPDH and STAB-1 turned out to be the most stably expressed genes, and all values of the other genes of interest were normalized on these two genes.

Most macrophage-associated genes were expressed at a higher level in naive old mice compared with naive young mice, demonstrating that old mice intrinsically already carry more intraocular macrophages: when studying PCR data in naive mice, the common macrophage markers CD11b and F4/80 showed a 2.2 times and 4.2 times higher expression in the eyes of old naive mice compared with eyes of young mice, respectively (Table III). Especially the M2 subtype was increased (CD163 and PPARG were 3.5 times and 2.6 times higher in eyes of old naive mice compared with those of young naive mice, respectively).

Table III.
Ratio of normalized expression of macrophage genes between naive old and young mice
Ratio of Old to Young MiceMarker Specificity
CD11b 2.2 Common macrophage marker 
F4/80 4.2 Common macrophage marker 
MCP-1 1.0 M1 macrophage marker 
CD163 3.5 M2 macrophage marker 
PPARG 2.6 M2 macrophage marker 
ARG-1 0.8 M2 macrophage marker 
IL-10 – M2 macrophage marker 
Ly-6G – MDSC marker 
Ly-6C 1.2 MDSC marker 
CD31 2.3 Endothelial cell marker 
TIE-2 2.4 Proangiogenic marker 
VEGF 1.7 Proangiogenic marker 
GAPDH 1.0 Housekeeping gene 
STAB-1 1.0 Housekeeping gene 
Ratio of Old to Young MiceMarker Specificity
CD11b 2.2 Common macrophage marker 
F4/80 4.2 Common macrophage marker 
MCP-1 1.0 M1 macrophage marker 
CD163 3.5 M2 macrophage marker 
PPARG 2.6 M2 macrophage marker 
ARG-1 0.8 M2 macrophage marker 
IL-10 – M2 macrophage marker 
Ly-6G – MDSC marker 
Ly-6C 1.2 MDSC marker 
CD31 2.3 Endothelial cell marker 
TIE-2 2.4 Proangiogenic marker 
VEGF 1.7 Proangiogenic marker 
GAPDH 1.0 Housekeeping gene 
STAB-1 1.0 Housekeeping gene 

–, marker not expressed.

Following tumor inoculation, the macrophage markers CD11b and F4/80 were more highly expressed, confirming the strongly increased infiltration of macrophages as had already been observed using immunohistochemistry; tumor inoculation led to an increase of CD11b and F4/80 expression of (19.2/4.6 =) 4.2 times and (5.3/1.7 =) 3.2 times, respectively, in young mice compared with naive young mice, whereas the markers in old mice increased 33.3 times and 15.6 times, respectively, after tumor inoculation (Table IV). When comparing the effect of age, PCR values for CD11b and F4/80 expression were much higher in tumor-bearing eyes of old mice compared with tumor-bearing eyes of young mice (5.9 and 7.9 times higher, respectively; Table IV), again confirming the results obtained with immunohistochemistry. The expression of both genes decreased after macrophage depletion in young as well as old mice, confirming that macrophage depletion had indeed been performed effectively.

Table IV.
Average normalized expression of macrophage and angiogenesis genes in different groups of mice
Naive YoungTumor-Inoculated YoungMacrophage-Depleted Tumor-Inoculated YoungNaive OldTumor-Inoculated OldMacrophage-Depleted Tumor-Inoculated OldRemarks
CD11b 4.6 19.2 7.0 3.4 113.3 10.2 Common macrophage marker 
F4/80 1.7 5.3 2.5 2.7 41.5 4.2 Common macrophage marker 
MCP-1 1.0 1.2 1.3 1.0 2.2 1.1 M1 macrophage marker 
CD163 1.0 2.3 2.4 5.2 74.5 4.2 M2 macrophage marker 
PPARG 1.4 1.9 3.1 3.2 25.6 0.5 M2 macrophage marker 
ARG-1 2.1 0.8 1.1 1.5 1.3 2.4 M2 macrophage marker 
IL-10 – – – – – – M2 macrophage marker 
Ly-6G – – – – – – MDSC marker 
Ly-6C 1.3 0.9 1.5 2.2 6.5 1.3 MDSC marker 
CD31 1.3 7.6 1.1 3.5 104.4 1.3 Endothelial cell marker 
TIE-2 1.2 1.2 0.6 5.3 45.7 4.9 Proangiogenic marker 
VEGF 1.6 2.0 1.4 3.7 105.1 4.6 Proangiogenic marker 
GAPDH 1.0 1.1 1.1 1.1 1.0 1.0 Housekeeping gene 
STAB-1 1.0 1.0 0.9 0.9 1.1 1.1 Housekeeping gene 
Naive YoungTumor-Inoculated YoungMacrophage-Depleted Tumor-Inoculated YoungNaive OldTumor-Inoculated OldMacrophage-Depleted Tumor-Inoculated OldRemarks
CD11b 4.6 19.2 7.0 3.4 113.3 10.2 Common macrophage marker 
F4/80 1.7 5.3 2.5 2.7 41.5 4.2 Common macrophage marker 
MCP-1 1.0 1.2 1.3 1.0 2.2 1.1 M1 macrophage marker 
CD163 1.0 2.3 2.4 5.2 74.5 4.2 M2 macrophage marker 
PPARG 1.4 1.9 3.1 3.2 25.6 0.5 M2 macrophage marker 
ARG-1 2.1 0.8 1.1 1.5 1.3 2.4 M2 macrophage marker 
IL-10 – – – – – – M2 macrophage marker 
Ly-6G – – – – – – MDSC marker 
Ly-6C 1.3 0.9 1.5 2.2 6.5 1.3 MDSC marker 
CD31 1.3 7.6 1.1 3.5 104.4 1.3 Endothelial cell marker 
TIE-2 1.2 1.2 0.6 5.3 45.7 4.9 Proangiogenic marker 
VEGF 1.6 2.0 1.4 3.7 105.1 4.6 Proangiogenic marker 
GAPDH 1.0 1.1 1.1 1.1 1.0 1.0 Housekeeping gene 
STAB-1 1.0 1.0 0.9 0.9 1.1 1.1 Housekeeping gene 

In separate experiments, six groups of mice (each group consisted of five mice) were used for studying gene expression of typical macrophage markers; young as well as old mice were divided into three groups: one naive group, which did not have a tumor and did not receive any treatment, and two groups that received a tumor in one of their eyes; one group received subconjunctival injections of clodronate-containing liposomes around the tumor eye, whereas the other group did not.

–, marker not expressed.

PPARG and CD163 are both associated with M2 macrophages, whereas a high expression of IL-10 and arginase should functionally characterize this subtype. PPARG and CD163 were expressed at a low level in eyes of naive young and old mice. After tumor inoculation in one eye, ocular expression of these genes was mainly increased in old mice (PPARG was ~13.6 times and CD163 was 33 times higher than in tumor-bearing young mice; Table IV), indicating that M2 macrophages were especially attracted to the tumor eyes of old mice.

ARG-1 was relatively stably expressed in all groups, and its expression was neither correlated with age nor with presence of macrophages. Surprisingly, IL-10 was only expressed in a few eyes and could therefore not be used to characterize macrophages.

MDSCs are phenotypically characterized as CD11b+ and Gr-1+ cells. Because the Gr-1 Ab recognizes both Ly-6G and Ly-6C, Ly-6G is a marker for MDSCs from the granulocytic lineage, whereas Ly-6C is found on MDSCs from the monocytic lineage. We performed qPCR on these two genes to study whether the infiltrating macrophages were MDSCs. Ly-6G was not present in the eyes from naive mice. After tumor inoculation, Ly-6G was only expressed by one young mouse and not in any old mice. Ly-6C was expressed at a low level in young as well as old naive mice. After tumor inoculation, we saw a high expression of this marker in the eyes of old mice, whereas it remained low in young mice (7.0 times higher in old mice; Table IV), indicating that the tumor-bearing eyes of old mice contained MDSCs from the monocytic lineage. These cells were also depleted after subconjunctival injection of clodronate-containing liposomes.

The proangiogenic genes VEGF and TIE-2, which are associated with the angiogenic effector function of M2-type macrophages, were expressed at a low level in naive young mice, whereas naive old mice displayed a relatively higher level of these proangiogenic genes in the eye. After tumor inoculation, both genes increased in expression to strikingly high levels in old mice only (Table IV). After macrophage depletion, the genes were again expressed in the eyes of young and old mice at comparable levels as seen in the naive state. We observed that CD31, which is a marker for endothelium and the quantity of blood vessels, had a low expression in naive mice. When a tumor was present in the eye, this expression increased 6 times in young mice and 30 times in old mice compared with their naive littermates.

To determine whether M2 macrophages present in old mice have phenotypical characteristics of MDSC, a CD163 (M2-specific) and Gr-1 (Ly-6C and Ly-6G specific) immunofluorescence staining was performed. We observed in the tumor-bearing old mice that many CD163+ cells double-stained positively with Gr-1+ especially accumulated in the periphery of the tumor (Fig. 5A, 5B). After macrophage depletion in old mice, we no longer observed CD163+ cells and only some single Gr-1+ cells, indicating that MDSCs from the monocytic lineage had been removed completely (Fig. 5B). The tumor-supportive effect of macrophages in old mice can be explained by their characteristics as MDSCs from the monocytic lineage (Gr-1+/CD163+). As control of the immunofluorescence results of old mice, we stained the eyes of young mice for these two markers. In young mice with 100% tumor in the AC, no double-positive cells for these markers were found (Fig. 5C), which corresponds to our immunohistochemical observation that the tumor-bearing anterior segment of eyes of young mice contain hardly any CD163+ cells and indicates that no MDSCs from the monocytic lineage are present. Only some Gr-1+ cells could be observed in the tumor-bearing anterior segment of the eye of a young mouse, which remains almost unchanged after macrophage depletion.

FIGURE 5.

Double immunofluorescence staining for CD163 (green) and Gr-1 (red) for identifying M2 macrophages with immunosuppressive functions. Eyes were enucleated when the tumor was completely occupied with tumor. Pictures were taken of the peripheral AC (designated by a rectangle), where most of the macrophages had accumulated (A). Pictures were taken at ~×25 magnification. B, In the sections of old mice, abundant numbers of double-positive cells were observed in the tumor, showing the presence of M2 macrophages expressing immunosuppressive markers. Postadministration of clodronate liposomes, the tumor was depleted of the double-positive cells; no M2 cells expressing immunosuppressive markers were present anymore, and, at the same time, tumor growth was inhibited. C, In young mice, no double-positive cells were found, indicating that no M2 macrophages are present with immunosuppressive function. Macrophage depletion led to the depletion of some Gr-1 cells in young mice.

FIGURE 5.

Double immunofluorescence staining for CD163 (green) and Gr-1 (red) for identifying M2 macrophages with immunosuppressive functions. Eyes were enucleated when the tumor was completely occupied with tumor. Pictures were taken of the peripheral AC (designated by a rectangle), where most of the macrophages had accumulated (A). Pictures were taken at ~×25 magnification. B, In the sections of old mice, abundant numbers of double-positive cells were observed in the tumor, showing the presence of M2 macrophages expressing immunosuppressive markers. Postadministration of clodronate liposomes, the tumor was depleted of the double-positive cells; no M2 cells expressing immunosuppressive markers were present anymore, and, at the same time, tumor growth was inhibited. C, In young mice, no double-positive cells were found, indicating that no M2 macrophages are present with immunosuppressive function. Macrophage depletion led to the depletion of some Gr-1 cells in young mice.

Close modal

The B16F10 melanoma cell line is a poorly immunogenic cell line when placed in a C57BL/6 mouse (36, 37). It can subsequently be used to create an intraocular tumor model. We were able to inhibit tumor growth using macrophage depletion, but only in old mice. In agreement with findings by Espinosa-Heidmann and Apte (7, 8) in laser-induced choroidal neovascularization, we observed that naive as well as tumor-containing eyes of old mice have more proangiogenic and tumor-promoting M2-type macrophages than similar eyes of young mice, which carry macrophages that are probably polarized toward an immunostimulatory, tumor-suppressing M1-macrophage type. Our finding that eyes of naive old mice contain more macrophages than young mice concurs with a report on similar finding in the retina, in which an effect of age on increased numbers of macrophages has also been observed (38).

In general, cancer is considered to be a disease of elderly people, caused by a slow accumulation of genetic mutations. Interestingly, in this study, we observe a new phenomenon: tumor progression is subject to physiological changes of the immune system caused by senescence. We suggest that aging is causing a switch in polarization of macrophage subtypes, supporting the development of malignancies. Interestingly, the highest incidence of uveal melanoma is observed in the fifth and sixth decades of life in patients (1); changes in macrophage function may be related to this phenomenon. A major implication of these findings is that aged animals should be considered for use in cancer studies.

One important observation in this B16F10 model is that intraocular tumor growth in young mice is probably subject to alternative mechanisms and not related to the contribution of M2 macrophages, because the immunohistochemistry and PCR data show that these cells are only present in low amounts. A remarkable observation is that tumor growth in macrophage-depleted eyes of young mice was comparable to tumor growth in macrophage-containing eyes of old mice, according to the survival plot. This strengthens the observation that a tumor-bearing young mouse does not need macrophages to have intraocular growth, whereas tumors in eyes of old mice need these cells.

However, some important questions remain regarding the role of TAMs in old mice: are M2 macrophages specifically homing into the tumor, or does the presence of a tumor modulate the microenvironment and convert tumor-infiltrating macrophages into an M2 phenotype? Both options are plausible, but this has to be explored further. Furthermore, how do TAMs in old mice contribute to tumor growth? We showed that these TAMs are mainly from the M2 type, as they express the genes PPARG and CD163. CD163 is a specific scavenger receptor expressed on M2-type macrophages, and it is known that expression of PPARG is related to the differentiation of monocytes into tumor-suppressing M2-type macrophages (22). PPARG inhibits the immune system by blocking the activation of M1-type macrophages via interference of classical inflammatory pathways such as NF-κB, AP-1, and STAT3. It is plausible that due to the high expression of PPARG in mice with intraocular tumors, M2 tumor-promoting macrophages are attracted to the eye and, perhaps to a lesser extent, tumor-suppressing M1 macrophages are inhibited from attacking the tumor (37). We observed that the inhibition of tumor growth after macrophage depletion in old mice was associated with a decrease in PPARG expression, also indicating that M2 macrophages are involved in the tumor growth process in old mice.

An intriguing fact is that PPARG is located on chromosome 3, and, as we know from uveal melanoma, monosomy of chromosome 3 is associated with a bad prognosis (5, 39).

M2 macrophages are found to be associated with the tumor growth process in old mice; is the proangiogenic effector function of these macrophages the key factor in tumor development or could other functions explain this tumor growth? We indeed observed that proangiogenic signals for M2 macrophages, such as VEGF, TIE-2, and CD31, were especially abundant in the tumor-containing eyes of old mice, and periocular macrophage depletion in these mice led to a decrease of these markers in the eye, implicating M2 macrophage-mediated angiogenesis as an important determinant in the tumor growth process in old mice.

However, other studies describe that M2 macrophage are also immunosuppressive, leading to inhibition of tumoricidal immune responses. Some studies state that M2 macrophages are the same as MDSCs derived from the monocytic lineage (5, 19), although other researchers consider these cells to be two different entities, sharing some phenotypical characteristics (marker Ly-6C) (40). Therefore, we determined whether the genes that are typical for MDSCs are elevated in the eye and the tumor tissue. Ly-6G was expressed in only one young mouse. However, Ly-6C, a marker for MDSCs from the monocytic lineage, was specifically expressed in the tumor-containing eyes of old mice, indicating that these cells are present and may suppress tumor rejection. After macrophage depletion, Ly-6C is downregulated in the eyes of old mice. The absence of MDSCs would allow T cells to kill the tumor cells, thus inhibiting tumor growth. Immunofluorescence confirmed the observation that tumor-bearing old mice have CD163+ M2 macrophages expressing surface marker Gr-1, whereas after macrophage depletion, these cells were no longer present in the anterior segment of the eye.

Our results are comparable to a recent study in human eyes. McKenna et al. (41) described that in uveal melanoma, T cell function is reduced by CD68+ tumor-infiltrating macrophages in the eye, whereas in the peripheral blood, this suppression is caused by CD11b+CD15+ granulocytes. This supports our observation that only MDSCs from the monocytic lineage play an important role in tumor evasion from the immune system in the eye and not those from the granulocytic lineage.

Remarkably, macrophages are not distributed diffusely, but accumulate mainly in the periphery of the tumors. A similar observation was made by Pina et al. (42) in a murine model of retinoblastoma.

In this study, we determined whether age has a similar influence on macrophage function with regard to intraocular tumor development as it does in choroidal angiogenesis. We show that this was the case and that different subtypes of macrophages play a key role. M2 macrophages are essential for the tumorigenicity of B16F10 melanoma cells in the eyes of old mice and their proangiogenic function contributes to tumor growth. In addition, the immunosuppressive features of these M2 macrophages may also be important.

Although we have to be careful with macrophage modulation, because in the absence of macrophages eyes become prone to infections (43), this could be a possible therapeutic option for cancer.

We thank the Dermatology Department, Leiden University Medical Center for providing PCR facilities for this study.

Disclosures N.vR. delivers clodronate liposomes on a non-profit base via www.clodronateliposomes.org. The other authors have no financial conflicts of interest.

This work was supported by The Netherlands Organization for Scientific Research Mozaiek Grant 017.003.059, Landelijke Stichting voor Blinden en Slechtzienden, Stichting Blinden-Penning, Leiden University Fund, Gratama Stichting, and Stichting Nederlands Oogheelkundig Onderzoek.

Abbreviations used in this paper:

AC

anterior chamber

ARG-1

arginase-1

β2m

β2-microglobulin

MDSC

myeloid-derived suppressor cell

PPARG

peroxisome proliferator-activated receptor γ

qPCR

quantitative PCR

STAB1

stabilin 1

TAM

tumor-associated macrophage

TIE-2

tyrosine kinase with Ig and epidermal growth factor homology domains-2

VEGF

vascular endothelial growth factor.

1
Bergman
L.
,
Seregard
S.
,
Nilsson
B.
,
Ringborg
U.
,
Lundell
G.
,
Ragnarsson-Olding
B.
.
2002
.
Incidence of uveal melanoma in Sweden from 1960 to 1998.
Invest. Ophthalmol. Vis. Sci.
43
:
2579
2583
.
2
Mäkitie
T.
,
Summanen
P.
,
Tarkkanen
A.
,
Kivelä
T.
.
2001
.
Tumor-infiltrating macrophages (CD68(+) cells) and prognosis in malignant uveal melanoma.
Invest. Ophthalmol. Vis. Sci.
42
:
1414
1421
.
3
Mantovani
A.
,
Schioppa
T.
,
Porta
C.
,
Allavena
P.
,
Sica
A.
.
2006
.
Role of tumor-associated macrophages in tumor progression and invasion.
Cancer Metastasis Rev.
25
:
315
322
.
4
Shabo
I.
,
Stål
O.
,
Olsson
H.
,
Doré
S.
,
Svanvik
J.
.
2008
.
Breast cancer expression of CD163, a macrophage scavenger receptor, is related to early distant recurrence and reduced patient survival.
Int. J. Cancer
123
:
780
786
.
5
Maat
W.
,
Ly
L. V.
,
Jordanova
E. S.
,
de Wolff-Rouendaal
D.
,
Schalij-Delfos
N. E.
,
Jager
M. J.
.
2008
.
Monosomy of chromosome 3 and an inflammatory phenotype occur together in uveal melanoma.
Invest. Ophthalmol. Vis. Sci.
49
:
505
510
.
6
Mäkitie
T.
,
Summanen
P.
,
Tarkkanen
A.
,
Kivelä
T.
.
1999
.
Microvascular density in predicting survival of patients with choroidal and ciliary body melanoma.
Invest. Ophthalmol. Vis. Sci.
40
:
2471
2480
.
7
Apte
R. S.
,
Richter
J.
,
Herndon
J.
,
Ferguson
T. A.
.
2006
.
Macrophages inhibit neovascularization in a murine model of age-related macular degeneration.
PLoS Med.
3
:
e310
.
8
Espinosa-Heidmann
D. G.
,
Suner
I. J.
,
Hernandez
E. P.
,
Monroy
D.
,
Csaky
K. G.
,
Cousins
S. W.
.
2003
.
Macrophage depletion diminishes lesion size and severity in experimental choroidal neovascularization.
Invest. Ophthalmol. Vis. Sci.
44
:
3586
3592
.
9
Kelly
J.
,
Ali Khan
A.
,
Yin
J.
,
Ferguson
T. A.
,
Apte
R. S.
.
2007
.
Senescence regulates macrophage activation and angiogenic fate at sites of tissue injury in mice.
J. Clin. Invest.
117
:
3421
3426
.
10
Mantovani
A.
,
Sozzani
S.
,
Locati
M.
,
Allavena
P.
,
Sica
A.
.
2002
.
Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes.
Trends Immunol.
23
:
549
555
.
11
Mills
C. D.
,
Kincaid
K.
,
Alt
J. M.
,
Heilman
M. J.
,
Hill
A. M.
.
2000
.
M-1/M-2 macrophages and the Th1/Th2 paradigm.
J. Immunol.
164
:
6166
6173
.
12
Moldovan
N. I.
2002
.
Role of monocytes and macrophages in adult angiogenesis: a light at the tunnel’s end.
J. Hematother. Stem Cell Res.
11
:
179
194
.
13
Folkman
J.
1971
.
Tumor angiogenesis: therapeutic implications.
N. Engl. J. Med.
285
:
1182
1186
.
14
Folkman
J.
1986
.
How is blood-vessel growth regulated in normal and neoplastic tissue. G. H. A. Clowes memorial Award lecture.
Cancer Res.
46
:
467
473
.
15
Boonman
Z. F.
,
Schurmans
L. R.
,
van Rooijen
N.
,
Melief
C. J.
,
Toes
R. E.
,
Jager
M. J.
.
2006
.
Macrophages are vital in spontaneous intraocular tumor eradication.
Invest. Ophthalmol. Vis. Sci.
47
:
2959
2965
.
16
Dace
D. S.
,
Chen
P. W.
,
Niederkorn
J. Y.
.
2008
.
CD4+ T-cell-dependent tumour rejection in an immune-privileged environment requires macrophages.
Immunology
123
:
367
377
.
17
Schurmans
L. R.
,
den Boer
A. T.
,
Diehl
L.
,
van der Voort
E. I.
,
Kast
W. M.
,
Melief
C. J.
,
Toes
R. E.
,
Jager
M. J.
.
1999
.
Successful immunotherapy of an intraocular tumor in mice.
Cancer Res.
59
:
5250
5254
.
18
van Rooijen
N.
,
van Nieuwmegen
R.
.
1984
.
Elimination of phagocytic cells in the spleen after intravenous injection of liposome-encapsulated dichloromethylene diphosphonate. An enzyme-histochemical study.
Cell Tissue Res.
238
:
355
358
.
19
Umemura
N.
,
Saio
M.
,
Suwa
T.
,
Kitoh
Y.
,
Bai
J.
,
Nonaka
K.
,
Ouyang
G. F.
,
Okada
M.
,
Balazs
M.
,
Adany
R.
, et al
.
2008
.
Tumor-infiltrating myeloid-derived suppressor cells are pleiotropic-inflamed monocytes/macrophages that bear M1- and M2-type characteristics.
J. Leukoc. Biol.
83
:
1136
1144
.
20
Hirsch
S.
,
Austyn
J. M.
,
Gordon
S.
.
1981
.
Expression of the macrophage-specific antigen F4/80 during differentiation of mouse bone marrow cells in culture.
J. Exp. Med.
154
:
713
725
.
21
Sica
A.
,
Schioppa
T.
,
Mantovani
A.
,
Allavena
P.
.
2006
.
Tumour-associated macrophages are a distinct M2 polarised population promoting tumour progression: potential targets of anti-cancer therapy.
Eur. J. Cancer
42
:
717
727
.
22
Bouhlel
M. A.
,
Derudas
B.
,
Rigamonti
E.
,
Dièvart
R.
,
Brozek
J.
,
Haulon
S.
,
Zawadzki
C.
,
Jude
B.
,
Torpier
G.
,
Marx
N.
, et al
.
2007
.
PPARgamma activation primes human monocytes into alternative M2 macrophages with anti-inflammatory properties.
Cell Metab.
6
:
137
143
.
23
Polfliet
M. M.
,
Fabriek
B. O.
,
Daniëls
W. P.
,
Dijkstra
C. D.
,
van den Berg
T. K.
.
2006
.
The rat macrophage scavenger receptor CD163: expression, regulation and role in inflammatory mediator production.
Immunobiology
211
:
419
425
.
24
Ho
V. W.
,
Sly
L. M.
.
2009
.
Derivation and characterization of murine alternatively activated (M2) macrophages.
Methods Mol. Biol.
531
:
173
185
.
25
Misson
P.
,
van den Brûle
S.
,
Barbarin
V.
,
Lison
D.
,
Huaux
F.
.
2004
.
Markers of macrophage differentiation in experimental silicosis.
J. Leukoc. Biol.
76
:
926
932
.
26
Chan
G.
,
Bivins-Smith
E. R.
,
Smith
M. S.
,
Smith
P. M.
,
Yurochko
A. D.
.
2008
.
Transcriptome analysis reveals human cytomegalovirus reprograms monocyte differentiation toward an M1 macrophage.
J. Immunol.
181
:
698
711
.
27
Kzhyshkowska
J.
,
Workman
G.
,
Cardó-Vila
M.
,
Arap
W.
,
Pasqualini
R.
,
Gratchev
A.
,
Krusell
L.
,
Goerdt
S.
,
Sage
E. H.
.
2006
.
Novel function of alternatively activated macrophages: stabilin-1-mediated clearance of SPARC.
J. Immunol.
176
:
5825
5832
.
28
Mantovani
A.
,
Sica
A.
,
Locati
M.
.
2007
.
New vistas on macrophage differentiation and activation.
Eur. J. Immunol.
37
:
14
16
.
29
Sunderkötter
C.
,
Nikolic
T.
,
Dillon
M. J.
,
Van Rooijen
N.
,
Stehling
M.
,
Drevets
D. A.
,
Leenen
P. J.
.
2004
.
Subpopulations of mouse blood monocytes differ in maturation stage and inflammatory response.
J. Immunol.
172
:
4410
4417
.
30
Fang
H. Y.
,
Hughes
R.
,
Murdoch
C.
,
Coffelt
S. B.
,
Biswas
S. K.
,
Harris
A. L.
,
Johnson
R. S.
,
Imityaz
H. Z.
,
Simon
M. C.
,
Fredlund
E.
, et al
.
2009
.
Hypoxia-inducible factors 1 and 2 are important transcriptional effectors in primary macrophages experiencing hypoxia.
Blood
114
:
844
859
.
31
Lewis
C. E.
,
De Palma
M.
,
Naldini
L.
.
2007
.
Tie2-expressing monocytes and tumor angiogenesis: regulation by hypoxia and angiopoietin-2.
Cancer Res.
67
:
8429
8432
.
32
Murdoch
C.
,
Tazzyman
S.
,
Webster
S.
,
Lewis
C. E.
.
2007
.
Expression of Tie-2 by human monocytes and their responses to angiopoietin-2.
J. Immunol.
178
:
7405
7411
.
33
El Filali
M.
,
Homminga
I.
,
Maat
W.
,
van der Velden
P. A.
,
Jager
M. J.
.
2008
.
Triamcinolone acetonide and anecortave acetate do not stimulate uveal melanoma cell growth.
Mol. Vis.
14
:
1752
1759
.
34
Goossens
K.
,
Van Poucke
M.
,
Van Soom
A.
,
Vandesompele
J.
,
Van Zeveren
A.
,
Peelman
L. J.
.
2005
.
Selection of reference genes for quantitative real-time PCR in bovine preimplantation embryos.
BMC Dev. Biol.
5
:
27
.
35
Vandesompele
J.
,
De Preter
K.
,
Pattyn
F.
,
Poppe
B.
,
Van Roy
N.
,
De Paepe
A.
,
Speleman
F.
.
2002
.
Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes
.
Genome Biol
.
3
:
RESEARCH0034
.
36
Harning
R.
,
Szalay
J.
.
1987
.
Ocular metastasis of in vivo and in vitro derived syngeneic murine melanoma.
Invest. Ophthalmol. Vis. Sci.
28
:
1599
1604
.
37
Knisely
T. L.
,
Niederkorn
J. Y.
.
1990
.
Immunologic evaluation of spontaneous regression of an intraocular murine melanoma.
Invest. Ophthalmol. Vis. Sci.
31
:
247
257
.
38
Xu
H.
,
Chen
M.
,
Forrester
J. V.
.
2009
.
Para-inflammation in the aging retina.
Prog. Retin. Eye Res.
28
:
348
368
.
39
Scholes
A. G.
,
Damato
B. E.
,
Nunn
J.
,
Hiscott
P.
,
Grierson
I.
,
Field
J. K.
.
2003
.
Monosomy 3 in uveal melanoma: correlation with clinical and histologic predictors of survival.
Invest. Ophthalmol. Vis. Sci.
44
:
1008
1011
.
40
Sinha
P.
,
Clements
V. K.
,
Ostrand-Rosenberg
S.
.
2005
.
Interleukin-13-regulated M2 macrophages in combination with myeloid suppressor cells block immune surveillance against metastasis.
Cancer Res.
65
:
11743
11751
.
41
McKenna
K. C.
,
Beatty
K. M.
,
Bilonick
R. A.
,
Schoenfield
L.
,
Lathrop
K. L.
,
Singh
A. D.
.
2009
.
Activated CD11b+ CD15+ granulocytes increase in the blood of patients with uveal melanoma.
Invest. Ophthalmol. Vis. Sci.
50
:
4295
4303
.
42
Piña
Y.
,
Boutrid
H.
,
Murray
T. G.
,
Jager
M. J.
,
Cebulla
C. M.
,
Schefler
A.
,
Ly
L. V.
,
Alegret
A.
,
Celdran
M.
,
Feuer
W.
,
Jockovich
M. E.
.
2010
.
Impact of tumor-associated macrophages in LH(BETA)T(AG) mice on retinal tumor progression: relation to macrophage subtype.
Invest. Ophthalmol. Vis. Sci.
51
:
2671
2677
.
43
van Klink
F.
,
Taylor
W. M.
,
Alizadeh
H.
,
Jager
M. J.
,
van Rooijen
N.
,
Niederkorn
J. Y.
.
1996
.
The role of macrophages in Acanthamoeba keratitis.
Invest. Ophthalmol. Vis. Sci.
37
:
1271
1281
.