Caveolin-1 (Cav1) plays a critical role in the invasion of pathogenic microbes into host cells, yet little is known about porcine Cav1. In this study, we provide the molecular characterization of Cav1 in pigs following stimulation with LPS/polyinosinic-polycytidylic acid as well as during infection with Haemophilus parasuis. The porcine Cav1 gene is 35 kb long and is located at SSC18q21; two isoforms (Cav1-α and Cav1-β) are produced by alternative splicing. Three point mutations were identified in the coding region of the gene, two of which were significantly associated with nine immunological parameters in Landrace pigs, including the Ab response against porcine reproductive and respiratory syndrome virus and lymphocyte counts. Promoter analysis indicated that NF-κB activates both Cav1 transcripts, but the forkhead gene family specifically regulates Cav1-β in the pig. Porcine Cav1 is expressed ubiquitously, with Cav1-α more abundantly expressed than Cav1-β in all tissues investigated. Basal expression levels of Cav1 in PBMCs are relatively similar across different pig breeds. LPS and polyinosinic-polycytidylic acid markedly induced the expression of Cav1 in porcine kidney-15 cells in vitro, likely through NF-κB activation. Pigs infected with H. parasuis exhibited decreased expression of Cav1, particularly in seriously impaired organs such as the brain. This study provides new evidence that supports the use of Cav1 as a potential diagnostic and genetic marker for disease resistance in animal breeding. In addition, our results suggest that Cav1 may be implicated in the pathogenesis of Glasser’s disease, which is caused by H. parasuis.

Caveolae are invaginations of the plasma membrane that are 50–100 nm in diameter. Originally identified by Palade (1) and Yamada (2) >50 y ago, caveolae are important organelles in mammalian cells. Caveolins are the major components and protein markers of caveolae (3). Caveolin-1 is the most important gene, both structurally and functionally, in the caveolin gene family, which includes three members in vertebrates: caveolin-1, caveolin-2, and caveolin-3 (4). Caveolin-3 is specific to the muscle and was first identified in the pig as a candidate gene of meat production traits (5). Caveolin-1 and caveolae have been shown to participate in various biological processes (6, 7), such as endocytosis, membrane trafficking, lipid recycling, cholesterol uptake, and various signaling pathways.

The role of caveolin-1 in vertebrate immunity has recently begun to be uncovered. Caveolin-1 has been reported to exist in many immune cell types, including macrophages and mast cells in the mouse and rat, bovine and murine lymphocytes, murine neutrophils, and human and bovine dendritic cells (8). In humans, caveolin-1 is thought to be a tumor suppressor gene (912). Caveolin-1 knockout mice exhibit defects in innate immunity, such as in the inflammatory response during infection with Salmonella enterica serovar Typhimurium (13) and macrophage phagocytosis (14). In particular, caveolin-1 plays a pivotal role in regulating the inflammatory responses of neutrophils during lung injury (15, 16). Furthermore, caveolin-1 has been implicated in pathogen–caveolae interactions, which lead to invasion of pathogenic microbes into host cells via caveolae-dependent endocytosis (17, 18). These findings indicate that caveolin-1 has a crucial role in innate immunity.

The pork industry suffers from outbreaks of serious diseases caused by many infectious pathogens, including Salmonella enterica (19), Haemophilus parasuis (20), porcine reproductive and respiratory syndrome virus (PRRSV) (21), porcine circovirus 2 (22), classical swine fever virus (CSFV) (23), and pseudorabies virus (PRV) (24). Thus, identification of key candidate genes that improve disease resistance in pigs is imperative. Although numerous studies on caveolin-1 have been reported in vertebrate animals, little is known about porcine caveolin-1. Thus far, only a partial cDNA sequence of porcine caveolin-1 has been reported in muscle tissue (25). Moreover, the role of caveolin-1 in immune responses against pathogens in pigs has not been investigated. H. parasuis is a Gram-negative bacterium, and virulent strains of H. parasuis can cause Glasser’s disease, which is characterized by fibrinous polyserositis, arthritis, and meningitis (26, 27). H. parasuis has caused huge economic losses each year in the pig industry worldwide (20). However, the pathogenesis of H. parasuis infection remains largely unknown. A recent study demonstrated that caveolin-1 knockout mice were markedly susceptible to Salmonella enterica serovar Typhimurium (13). Whether caveolin-1 is also involved in the pathogenesis of Glasser’s disease in pigs is of great interest.

In this study, we characterized several genomic, genetic, and transcriptional parameters of the porcine caveolin-1 gene. In this study, we also provide the molecular characterization of the caveolin-1 gene in pigs under stimulation with LPS/polyinosinic-polycytidylic acid [poly (I:C)] as well as during infection with H. parasuis.

The official gene name and symbol in this study were obtained from the Gene Ontology (http://www.geneontology.org/). A Basic Local Alignment Search Tool search in GenBank (http://www.ncbi.nlm.nih.gov/nuccore) using a predicted porcine caveolin-1 mRNA sequence (GenBank accession number NM_214438) (28) identified a number of porcine expressed sequence tags (ESTs) with >90% identity. These ESTs were assembled using SeqMan Pro 7.1 (DNASTAR) to obtain two contigs that differed at the 5′ end. The two cDNAs were obtained by assembling the two contigs until no further extension was observed (29). A primer set (Table I) that covered the coding region of the final cDNA contig was designed using Primer Premier 5.0 (PREMIER Biosoft). This primer pair was used to amplify a 667-bp fragment from the porcine cDNA. The PCR amplifications were performed in 10-μl volumes that contained 10 ng of mixed porcine cDNAs, 1× PCR Buffer (plus MgCl2), 0.25 mM each 2′-deoxynucleoside 5′-triphosphate, 100 pmol each primer, and 0.5 U TaqE DNA polymerase (TaKaRa, Japan). The thermal cycle was 94°C for 3 min followed by 35 cycles of 94°C for 30 s, the annealing temperature (Table I) for 30 s, 72°C for 30 s, and a final extension step at 72°C for 5 min. The PCR product was visualized after electrophoresis on 2% agarose gels with 0.5 μg/ml ethidium bromide, purified using the Biotech purification kit (Biotech), and sequenced by a commercial biotechnology company (Aoke). Two primer pairs were designed to amplify exons 2 and 3 (Table I). The amplification system and protocol were performed as described above. The PCR product of exon 2 was sequenced directly, whereas the product of exon 3 was cloned into the pMD-18T vector (TaKaRa) prior to sequencing (GenBank accession number FJ392024).

Table I.
Details of the primers used in this study
UsagePrimer NamePrimer Sequence (5′ →3′)GeneTa (°C)Size (bp)
CDS cloning CDS_F AATCTCCTCAGAGCCTTCATCC CAV1 55 667 
 CDS_R CGCTGTACTGGCAAATTGAAAC    
Mapping MAP_F TGGCAGAGGAAATGAACG  60 216 
 MAP_R GCAAAGACAGGGAAAGAT    
Q-PCR Both_F TGGCAGAGGAAATGAACGA  60–61 224 
 Both_R GAGGGCAGACAGCAAACG    
 Alpha_F TCCTCAGAGCCTTCATCCAG  60–65 162 
 Alpha_R GTCATACACTTGCTTCTCGTTC    
 Beta_F CTGCCAGGCTGACTTTTC  60–65 152 
 Beta_R GTTGGGCTTGTAGATGTTGC    
SNP screening SNP_F ACTGGTTTTACCGTTTGC  59 324 
 SNP_R GAAACTCGAAATTGGCAC    
Amplify exon2 E2_F CCTCTGAAGCGGTTAGTT  55 423 
 E2_R GCAAAGACAGGGAAAGAT    
Amplify exon3 E3_F GATGCTGCTGGATACCTTT  55 2473 
 E3_R CGAAAGACTACTACTCCCCA    
HK 18S_F TTTCGCTCTGGTCCGTCT 18S 60–65 101 
 18S_R TTCGGAACTGAGGCCATG    
 Ba_F CTCGATCATGAAGTGCGACGT ACTB 60–65 114 
 Ba_R GTGATCTCCTTCTGCATCCTGTC    
 RPl_F TGGAAGAGACGTTGTGAGCAA RPL32 60–65 94 
 RPl_R CGGAAGTTTCTGGTACACAATGTAA    
UsagePrimer NamePrimer Sequence (5′ →3′)GeneTa (°C)Size (bp)
CDS cloning CDS_F AATCTCCTCAGAGCCTTCATCC CAV1 55 667 
 CDS_R CGCTGTACTGGCAAATTGAAAC    
Mapping MAP_F TGGCAGAGGAAATGAACG  60 216 
 MAP_R GCAAAGACAGGGAAAGAT    
Q-PCR Both_F TGGCAGAGGAAATGAACGA  60–61 224 
 Both_R GAGGGCAGACAGCAAACG    
 Alpha_F TCCTCAGAGCCTTCATCCAG  60–65 162 
 Alpha_R GTCATACACTTGCTTCTCGTTC    
 Beta_F CTGCCAGGCTGACTTTTC  60–65 152 
 Beta_R GTTGGGCTTGTAGATGTTGC    
SNP screening SNP_F ACTGGTTTTACCGTTTGC  59 324 
 SNP_R GAAACTCGAAATTGGCAC    
Amplify exon2 E2_F CCTCTGAAGCGGTTAGTT  55 423 
 E2_R GCAAAGACAGGGAAAGAT    
Amplify exon3 E3_F GATGCTGCTGGATACCTTT  55 2473 
 E3_R CGAAAGACTACTACTCCCCA    
HK 18S_F TTTCGCTCTGGTCCGTCT 18S 60–65 101 
 18S_R TTCGGAACTGAGGCCATG    
 Ba_F CTCGATCATGAAGTGCGACGT ACTB 60–65 114 
 Ba_R GTGATCTCCTTCTGCATCCTGTC    
 RPl_F TGGAAGAGACGTTGTGAGCAA RPL32 60–65 94 
 RPl_R CGGAAGTTTCTGGTACACAATGTAA    

CDS, coding DNA sequence; HK, housekeeping gene; Size, size of amplicon; Ta, temperature of annealing.

Translation of the two cDNA sequences was predicted using ORF-Finder (http://www.ncbi.nlm.nih.gov/projects/gorf/). The deduced protein sequences were analyzed using tools from the ExPASy server (http://expasy.org/). Multiple alignments of amino acid sequences were carried out with DNAman 6.0 (Lynnon). The phylogenetic tree was inferred using the neighbor-joining method and replicated 1000 times in a bootstrap test using MEGA4 (30). Splice sites were identified by the Splign program (31). The conservative promoter and transcription factor binding sites were analyzed by ConSite (32) using ∼1 kb 5′ flanking sequence of the porcine, bovine, and human caveolin-1 genes, with the threshold score and energy set at 100 and −19 kcal/mol, respectively.

The Institut National de la Recherche Agronomique–University of Minnesota porcine radiation hybrid (IMpRH) panel, which consists of 118 hybrid clones (33), was employed to map the porcine caveolin-1 gene. A primer pair for chromosomal mapping that was specific to the pig was designed as shown in Table I. PCR reactions were performed and detected as described above, and the data were analyzed with the IMpRH mapping tool (34). Quantitative trait locus (QTL) analysis was performed by searching for QTLs and markers linked to the genetic position of porcine caveolin-1 in PigQTLdb (3537). Comparative maps of the caveolin-1 gene and nearby regions of the genomes of pig, cow, human, rat, mouse, chicken, and zebrafish were produced using the source data from the corresponding genes in the National Center for Biotechnology Information-Gene database.

Three electronic single nucleotide polymorphisms (SNPs) were identified from the alignment of the ESTs from UniGene (Ssc.12842). A primer set was designed for verification of the electronic SNPs by PCR sequencing (Table I). PCR reactions were performed to amplify the sequence from three pig breeds, Landrace, Yorkshire, and Meishan (Chinese native pig), and all products were sequenced. After sequencing confirmation (Fig. 8), SNPs were detected using cleaved amplification polymorphisms (38). The PCR products were treated in the reaction mixture directly after amplification with the corresponding restriction enzyme for at least 12 h at 37°C (Table IV), according to the manufacturers’ instructions. The variability in codon usage caused by synonymous and nonsynonymous nucleotide variations in the coding region was assessed by referring to the Codon Usage Database (39).

FIGURE 8.

Variations of codon usage frequency caused by variations of porcine caveolin-1. The variations in the codon usage frequency are underlined.

FIGURE 8.

Variations of codon usage frequency caused by variations of porcine caveolin-1. The variations in the codon usage frequency are underlined.

Close modal
Table IV.
Comparative analysis of transcription factor binding sites between caveolin-1 genes from pig, cow, and human
Transcription FactorBinding Sequence (5′–3′)FromToScoreStrandCowHuman
Caveolin-1-α transcript        
 TEF-1 ATGTGAAATGTA 327 338 8.844 −  
 Chop-cEBP TGATGCACTGCG 534 545 7.396  
 c-FOS TGATGCAC 534 541 6.301 −  
 Sox-5 AATGTTG 595 601 5.801 −  
 HAND1 CTGCCAGAAC 693 702 9.466 −  
 p50 GGGGATGTGCC 706 716 9.363 
 NF-κB GGGATGTGCC 707 716 8.018 − 
 NF-κB GGGATGTGCC 707 716 7.01 
 AML-1 AACCGCGAG 745 753 7.727 −  
 c-FOS TAAATCAC 872 879 6.769 −  
 NF-κB GGGAAATCTC 886 895 8.569 −  
 p50 GGGAAATCTCC 886 896 11.264 −  
 NF-κB GGAAATCTCC 887 896 10.258 −  
 c-REL GGAAATCTCC 887 896 9.981 − 
 p65 GGAAATCTCC 887 896 10.52 −  
 SOX17 CAGAATGTC 923 931 5.537 −  
 E2F GGGGCAAA 934 941 7.177 − 
 c-FOS AGACTCAG 947 954 6.49 −  
Caveolin-1-β transcript        
 Myf AGGCAGGAGCTC 507 518 7.819  
 E2F GCGCCAAG 576 583 8.832 −  
 Foxd1 GAGTTTAC 584 591 6.721 −  
 SOX17 TTTACTGTG 587 595 6.355  
 E2F TTTGCCCC 645 652 7.177  
 FoxI1 TGATTTTTCTTT 679 690 7.209  
 Foxd3 GATTTTTCTTTT 680 691 7.702  
 NF-κB GGGACATCTC 751 760 8.816  
 Spz1 AGGGCAACATC 783 793 9.288 
 Sox-5 CAACAAC 802 808 5.74 
 AML-1 AACAACAAG 803 811 6.991 − 
 Sox-5 CAACAAG 805 811 5.74 
 RORalfa-1 AACAAGGCCA 806 815 9.308  
 Thing1-E47 ATGGCAGAGG 815 824 6.295 − 
 ARNT CAAGTG 839 844 6.112 − 
 ARNT CAAGTG 839 844 6.112 
 USF CAAGTGT 839 845 5.797 
 n-MYC CAAGTG 839 844 6.133 − 
 n-MYC CAAGTG 839 844 6.038 
 AML-1 AACCGCGAT 878 886 8.68 −  
 Myc-Max ACGACGTTGTC 903 913 8.305 −  
Transcription FactorBinding Sequence (5′–3′)FromToScoreStrandCowHuman
Caveolin-1-α transcript        
 TEF-1 ATGTGAAATGTA 327 338 8.844 −  
 Chop-cEBP TGATGCACTGCG 534 545 7.396  
 c-FOS TGATGCAC 534 541 6.301 −  
 Sox-5 AATGTTG 595 601 5.801 −  
 HAND1 CTGCCAGAAC 693 702 9.466 −  
 p50 GGGGATGTGCC 706 716 9.363 
 NF-κB GGGATGTGCC 707 716 8.018 − 
 NF-κB GGGATGTGCC 707 716 7.01 
 AML-1 AACCGCGAG 745 753 7.727 −  
 c-FOS TAAATCAC 872 879 6.769 −  
 NF-κB GGGAAATCTC 886 895 8.569 −  
 p50 GGGAAATCTCC 886 896 11.264 −  
 NF-κB GGAAATCTCC 887 896 10.258 −  
 c-REL GGAAATCTCC 887 896 9.981 − 
 p65 GGAAATCTCC 887 896 10.52 −  
 SOX17 CAGAATGTC 923 931 5.537 −  
 E2F GGGGCAAA 934 941 7.177 − 
 c-FOS AGACTCAG 947 954 6.49 −  
Caveolin-1-β transcript        
 Myf AGGCAGGAGCTC 507 518 7.819  
 E2F GCGCCAAG 576 583 8.832 −  
 Foxd1 GAGTTTAC 584 591 6.721 −  
 SOX17 TTTACTGTG 587 595 6.355  
 E2F TTTGCCCC 645 652 7.177  
 FoxI1 TGATTTTTCTTT 679 690 7.209  
 Foxd3 GATTTTTCTTTT 680 691 7.702  
 NF-κB GGGACATCTC 751 760 8.816  
 Spz1 AGGGCAACATC 783 793 9.288 
 Sox-5 CAACAAC 802 808 5.74 
 AML-1 AACAACAAG 803 811 6.991 − 
 Sox-5 CAACAAG 805 811 5.74 
 RORalfa-1 AACAAGGCCA 806 815 9.308  
 Thing1-E47 ATGGCAGAGG 815 824 6.295 − 
 ARNT CAAGTG 839 844 6.112 − 
 ARNT CAAGTG 839 844 6.112 
 USF CAAGTGT 839 845 5.797 
 n-MYC CAAGTG 839 844 6.133 − 
 n-MYC CAAGTG 839 844 6.038 
 AML-1 AACCGCGAT 878 886 8.68 −  
 Myc-Max ACGACGTTGTC 903 913 8.305 −  

–, minus-strand DNA; +, plus-strand DNA; *, existence of transcription factor binding sites.

The HZAU Landrace Immunological Resource Family consists of 355 pure Landrace pigs with 302 F1 offspring and 53 parents (17 sire, 36 dam). The pigs were immunized against CSFV (Qilu Animal Health) at 0 to 1 d and 35 d, PRRSV (DaHuaNong) at 16 d, mycoplasma (RespiSure Mycoplasma; Pfizer), and PRRSV (Ingelvac PRRS MLV; Boehringer Ingelheim) at 7 d and 21 d, respectively. Blood samples were collected by jugular venipuncture on days 1, 17, and 32 after birth and submitted immediately for hematological analysis (Kx-21n; Sysmex). Serum was harvested within 2 h and stored at −70°C for analysis of Ab levels. Ab levels were determined by competitive ELISA using commercial ELISA kits on a Thermo MK3 Microplate Photometer. Abs were detected against PRRSV (PRRS 2XR; IDEXX), CSFV (CSFV-Ab; IDEXX), and PRV (PRV-gpi; IDEXX). Immunological parameters analyzed included RBC and WBC counts, frequencies, and absolute numbers of lymphocytes, monocytes, and neutrophils, hemoglobin concentration, mean cell volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, hematocrit, red cell distribution width, platelet count, platelet distribution width, mean platelet volume, platelet/large cell ratio, and Ab levels against PRRSV, PRV, and CSFV. All animal studies in this paper were approved by the Biological Studies Animal Care and Use Committee of the Hubei Province, People’s Republic of China.

ANOVA was performed to estimate the effects of the caveolin-1 genotypes on each immunological parameter using the Macro statements and Mixed procedure in SAS 8.01 (SAS Institute, Cary, NC) with restricted maximum likelihood estimation methods implemented with a Newton–Raphson algorithm. To improve homoscedasticity, arcsine transformation was performed on the proportional data. The following mixed models were used to estimate the effects of the genotypes on the immunological parameters: Yijklmn = μ + Genotypei + Sexj + Parityk + Environmentl + Sirem + Damn (Sirem) + εijklmn, in which Y is the response vector for the immunological parameters above, and μ is the overall mean of each parameter. Genotype (i = 3: caused by 1 allelic variation), sex (j = 2), parity (k = 2: first versus nonfirst), and environment (L = 2: pigpen 1&2) were considered fixed effects, whereas sire (m = 17) and dam (n = 36) were random effects. In addition, ε represents the residual errors; for each immunological parameter, the least-square means between genotype classes at each time of blood sampling were computed using the lsdmeans statement and compared with an extremely conservative Bonferroni adjustment using pdiff, sderr, and adjust = bon options in SAS (SAS Institute).

Tissue distribution of the alternative transcripts of caveolin-1 was analyzed by SYBR Green Q-PCR. Primer pair “Alpha” (Table I) was specific for caveolin-1-α, whereas primer pair “Beta” (Table I) was specific for caveolin-1-β. In addition, primer set “Both” (Table I) was specific for the consensus region of the two transcripts. The β-actin gene was used as an internal control. Total RNA was extracted from 18 different tissues of two mature Meishan pigs and from two cell types: heart, liver, spleen, lung, kidney, muscle, stomach, intestine, brain, fat, skin, bladder, bone marrow, lymph node, testis, epididymis, uterus, and ovary and PBMCs and porcine kidney (PK) cell lines. Total RNA was isolated using the RNAprep Pure Tissue Kit (Tiangen, Beijing, China), and RNase-free DNase and was reverse-transcribed into cDNA using the TransScript First-Strand cDNA Synthesis Kit (TransGen, Beijing, China), according to the manual. Each 20-μl quantitative PCR (Q-PCR) reaction contained 2× SYBR Green PCR Mixture (ToYoBo), 500 mM each 2′-deoxynucleoside 5′-triphosphate, 0.4 mM primers (Table I), and 0.5 μl normalized template cDNA. The thermal cycle was 94°C for 3 min followed by 35 cycles at 94°C for 30 s, the annealing temperature (Table I) for 30 s, 72°C for 30 s, and a final fluorescence acquisition from 55°C to 95°C for melting curve analysis. The specificity of the Q-PCR was confirmed by melting curve analysis. All PCRs were performed in triplicate, and the cycle threshold values were determined using Gene Expression IQ5 software (Bio-Rad, Richmond, CA). Gene expression was quantified relative to the expression of the housekeeping gene by employing the 2−ΔΔ cycle threshold method (40).

Blood from three clinically healthy 2-mo-old pigs from each breed was collected from the jugular vein into tubes containing sodium heparin. The breeds used were the Landrace, Yorkshire, Duroc, Meishan, and a three-way cross of Duroc × Landrace × Yorkshire (DLY). Porcine PBMCs were isolated using Lympholyte-H (HaoYang, TianJin, China) according to the manufacturer’s protocol. Total RNA was extracted from PBMCs and purified using the RNAprep Cell Kit and RNase-Free DNaseI (Tiangen). Purified RNA was reverse-transcribed with the TIAN Script Kit (Tiangen) according to the manufacturer’s instructions. The housekeeping gene β-actin was used as an internal control. The Q-PCR assays were performed and analyzed as described above, with primer pair “Both” (Table I). Overall comparison was made using ANOVA with OriginPro 8.07 (OriginLab Corporation). A p value <0.05 between control and treatment groups was considered statistically significant.

Ten groups (three replicates in each group, ∼1 × 105 cells of PK-15 cells with ATCC number CCL-33; American Type Culture Collection) from the same cell-culture flask were grown in culture medium (DMEM) supplemented with 10% heat-inactivated FBS at 37°C with 5% CO2. Adherent PK-15 cells were obtained by washing off the nonadherent cells with warm culture medium and PBS twice. Adherent cells were cultured further in DMEM (control samples) or treated with 1 μg/ml LPS (Escherichia coli 0127:B8; Sigma-Aldrich) or 10 μg/ml poly (I:C) (Sigma-Aldrich) for 0, 3, 6, 12, 24, or 48 h. The cells were harvested, and total RNA was extracted as described above. The housekeeping gene RPL32 was used as an internal control. The Q-PCR assays were performed with the primer “Both” (Table I) and analyzed as described above.

Eight 1-mo-old male piglets that were confirmed to be uninfected with H. parasuis were divided randomly into two equal groups. Four piglets were challenged intratracheally with 5 × 108 CFU of a virulent strain of H. parasuis, 0165 (serotype 5), whereas the remaining four piglets were maintained without challenge as controls. One week after challenge, all of the piglets were killed, and their tissues were removed and placed immediately in liquid nitrogen. The Q-PCR assays were performed with the primer pair “Both” and internal control 18S (Table I) and analyzed as described above.

Tissues from one H. parasuis-negative pig and two H. parasuis-infected pigs were cut into 5-μm sections and stained with H&E for routine histological examination. Three sections of each tissue were used for immunohistochemistry using polyclonal primary Abs against caveolin-1 (Cell Signaling Technology) and the immunohistochemistry protocol supplied with the commercial Ab. For each tissue, a negative control was done without caveolin-1 Ab. Three sections of each tissue were used for immunoassays. Immunohistochemical images were captured using a Nikon ECLIPSE 80i inverted microscope with a 40× objective lens and NIS-elements D3.00 image software (Nikon). The images were quantitatively analyzed using Image Pro-Plus v. 6.0 (Media Cybernetics). Density means are expressed as mean ± SE:

Optical density mean=Integrated optical densityArea sum.

The Student t test was used to compare data from two groups. The level of significance was set at p < 0.05.

Experimental and in silico cloning identified two isoforms of porcine caveolin-1, caveolin-1-α and caveolin-1-β. The caveolin-1-α transcript is 2494 bp and has an open reading frame of 537 nt flanked by a 60-nt 5′ untranslated region (UTR) and a 1897-nt 3′ UTR. The cDNA of caveolin-1-α encodes a 178-aa protein with a molecular mass of 20.6 kDa and a theoretical isoelectric point of 5.65. The sequence around the caveolin-1-α start codon (ATG) at position 61 shows a partial match with the Kozak consensus (RCCATGG) (41). The 3′ UTR contains two AATAAA polyadenylation signal consensus sequences (42), of which the last is 16–21 nt upstream of the poly(A) tail (Fig. 1A). The caveolin-1-β transcript is 2657 bp and has a 444-nt open reading frame flanked by a 325-nt 5′ UTR and a 1888-nt 3′ UTR. The caveolin-1-β isoform encodes a protein of 147 aa with a molecular mass of 17.2 kDa and a theoretical isoelectric point of 5.27. The 3′ UTR contains three polyadenylation signals, of which the last is 16–21 nt upstream of the poly(A) tail (Fig. 1B). The sequence around the caveolin-1-β start codon at position 326 shows a perfect match with the typical Kozak consensus.

FIGURE 1.

Nucleotide and deduced amino acid sequence for porcine caveolin-1. The start codons with the surrounding Kozak sequences are shown in dashed italics. The Kozak sequence in caveolin-1-β transcript (B) is more conserved than that of caveolin-1-α (A). The poly(A) signal (AATAAA) is underlined. The region in solid underlines indicates the unique nucleotide and amino acid sequences of caveolin-1-α (A).

FIGURE 1.

Nucleotide and deduced amino acid sequence for porcine caveolin-1. The start codons with the surrounding Kozak sequences are shown in dashed italics. The Kozak sequence in caveolin-1-β transcript (B) is more conserved than that of caveolin-1-α (A). The poly(A) signal (AATAAA) is underlined. The region in solid underlines indicates the unique nucleotide and amino acid sequences of caveolin-1-α (A).

Close modal

Fig. 2 shows multiple alignments of the predicted porcine caveolin-1 protein with 20 known vertebrate caveolin-1 proteins based on known structural and functional domains (4, 7). All identified domains (underlined), including the N-terminal membrane attachment domain (N-MAD), the caveolin signature, caveolin scaffolding domain (CSD), WW binding domain, C-terminal MAD, and three conserved palmitoyl group cysteine residues, are highly conserved among mammalian, avian, bony fish, and amphibian species. In particular, the N-MAD, caveolin signature, and CSD were almost completely conserved. Phosphorylation at Tyr14 and Ser80 is essential for the function of caveolin-1, and these residues are also conserved in the pig. Although the caveolin-1 proteins are highly conserved, the porcine caveolin-1 molecule has several unique features, including 10 nonconserved aa regions, which are unshaded in Fig. 2, and an N-terminal region containing Tyr14 that is absent from porcine caveolin-1-β and that of Xenopus laevis (Fig. 2).

FIGURE 2.

Multiple alignments of the putative porcine caveolin-1 protein with 20 known caveolin-1 proteins. Residues showing 100% homology are shaded in black; residues showing >75% homology are shaded in gray. The underlined features include the caveolin signature, N-MAD, CSD, WW binding domain, C-terminal MAD, and the four conserved palmitoyl group cysteine residues of porcine caveolin-1. The region absent in caveolin-1-β is also highlighted.

FIGURE 2.

Multiple alignments of the putative porcine caveolin-1 protein with 20 known caveolin-1 proteins. Residues showing 100% homology are shaded in black; residues showing >75% homology are shaded in gray. The underlined features include the caveolin signature, N-MAD, CSD, WW binding domain, C-terminal MAD, and the four conserved palmitoyl group cysteine residues of porcine caveolin-1. The region absent in caveolin-1-β is also highlighted.

Close modal

To define the molecular evolutionary history of porcine caveolin-1, protein sequences from 26 vertebrates were obtained to construct a phylogenetic tree (Fig. 3). Porcine caveolin-1 clusters with that of Chinese and Indian muntjac in the artiodactyl clade, with extremely high similarity and identity. The phylogeny of caveolin-1 shows a clear divergence among the vertebrates, including fish, amphibians, birds, and mammals. Although the bootstrap values in some nodes are not very high, the main structure of the tree is reasonable and supported by the known phylogeny of the species represented. In addition, the porcine caveolin-1 protein shows the most homology with that of the Indian deer and the lowest homology with that of the platypus (Fig. 3).

FIGURE 3.

Phylogenetic tree of caveolin-1. Phylogenetic and molecular evolutionary analyses were conducted using the neighbor-joining method based on multiple alignment of 26 known caveolin-1 amino acid sequences from GenBank using MEGA version 4 (30). The bootstrap confidence values marked at the nodes of the tree are based on 1000 bootstrap replicates. The horizontal branch lengths are proportional to the estimated divergence of the sequence from the branch point, whereas the vertical branch lengths are arbitrary.

FIGURE 3.

Phylogenetic tree of caveolin-1. Phylogenetic and molecular evolutionary analyses were conducted using the neighbor-joining method based on multiple alignment of 26 known caveolin-1 amino acid sequences from GenBank using MEGA version 4 (30). The bootstrap confidence values marked at the nodes of the tree are based on 1000 bootstrap replicates. The horizontal branch lengths are proportional to the estimated divergence of the sequence from the branch point, whereas the vertical branch lengths are arbitrary.

Close modal

A porcine BAC clone (GenBank accession number AC087423) that contains the complete porcine caveolin-1 gene was identified by a Basic Local Alignment Search Tool search in the GenBank database. The porcine caveolin-1 gene spans ∼34.7 kb, which is similar to the length of other mammalian caveolin-1 genes (36.3 kb in humans, 35.5 kb in cows). The transcripts were aligned with their genomic sequences to confirm the genomic structure of porcine caveolin-1 (Fig. 4). As shown in Fig. 4, there are at least two splice patterns of porcine caveolin-1. Three exons (ex1, ex2, and ex3) are transcribed into caveolin-1-α with two introns spliced, whereas two exons (ex1` and ex2`) are transcribed into caveolin-1-β, with one intron spliced. Ex1 is a unique exon, ex2 is partially identical to ex1`, and ex3 is identical to ex2`. All splice sites (Table II) conform to the consensus GT–AG rule (43). Comparison of seven vertebrate caveolin-1-α genes from pig, cattle, rat, mouse, human, chicken, and zebrafish revealed that the gene structure of caveolin-1 is highly conserved among the pig and other mammals, especially in the coding exons (Table III). However, the caveolin-1 gene structures of the pig, fish, and birds are not completely conserved. Furthermore, all of the exons of the vertebrate caveolin-1 genes described above have a coding region, and all of the introns are in phase 0 (44). Along with the results of the multiple alignment and phylogenetic tree analyses, the results described above demonstrate that the gene cloned in this study is that of the caveolin-1 homolog in the pig.

FIGURE 4.

Gene organization of porcine caveolin-1. Schematic of porcine caveolin-1-α and -β transcripts aligned to genomic sequences is shown. Open boxes and arrows indicate unique sequences of each transcript that match genomic sequences; dotted boxed regions and arrows indicate sequences identical between the two transcripts and genomic sequences. The single line indicates caveolin-1 intronic and intergenic sequences. The bold line indicates the coding region for two caveolin-1 isoforms. The coding region of caveolin-1-α consists of three exons, whereas caveolin-1-β is composed of two exons.

FIGURE 4.

Gene organization of porcine caveolin-1. Schematic of porcine caveolin-1-α and -β transcripts aligned to genomic sequences is shown. Open boxes and arrows indicate unique sequences of each transcript that match genomic sequences; dotted boxed regions and arrows indicate sequences identical between the two transcripts and genomic sequences. The single line indicates caveolin-1 intronic and intergenic sequences. The bold line indicates the coding region for two caveolin-1 isoforms. The coding region of caveolin-1-α consists of three exons, whereas caveolin-1-β is composed of two exons.

Close modal
Table II.
Size of exonic/intronic regions and consensus sequences of splicing sites of porcine caveolin-1-α and -β transcripts
Caveolin-1No.Exon5′ Splice DonorIntron3′ Splice Acceptor
α 90 CAGAGGTAGG 1420 TACAGGGACA 
 165 TCAAGGTAAG 30804 TTTAGATTGA 
 2214    
β 419 TCAAGGTAAG 30804 TTTAGATTGA 
 2215    
Caveolin-1No.Exon5′ Splice DonorIntron3′ Splice Acceptor
α 90 CAGAGGTAGG 1420 TACAGGGACA 
 165 TCAAGGTAAG 30804 TTTAGATTGA 
 2214    
β 419 TCAAGGTAAG 30804 TTTAGATTGA 
 2215    

Underlined letters indicate intron sequences, whereas no underlined letters indicate exon sequences. Size is given in bp.

Table III.
Size of the exons and introns of caveolin-1-α in pig, cattle, rat, mouse, human, chicken, and zebrafish
Exon Size
Coding Exon Size
Intron Size
SpeciesTotal123CDS12312
Pig 2,469 90 165 2,214 537 30 165 342 1,420 30,804 
Cattle 2,453 92 165 2,196 537 30 165 342 1,447 31,682 
Rat 2,468 30 165 2,273 537 30 165 342 1,426 29,086 
Mouse 2,487 110 165 2,212 537 30 165 342 1,401 31,067 
Human 2,704 308 165 2,231 537 30 165 342 1,432 32,256 
Chicken 989 18 165 806 525 18 165 342 7,320 13,165 
Zebrafish 1,749 244 168 1337 546 36 168 342 623 9,658 
Exon Size
Coding Exon Size
Intron Size
SpeciesTotal123CDS12312
Pig 2,469 90 165 2,214 537 30 165 342 1,420 30,804 
Cattle 2,453 92 165 2,196 537 30 165 342 1,447 31,682 
Rat 2,468 30 165 2,273 537 30 165 342 1,426 29,086 
Mouse 2,487 110 165 2,212 537 30 165 342 1,401 31,067 
Human 2,704 308 165 2,231 537 30 165 342 1,432 32,256 
Chicken 989 18 165 806 525 18 165 342 7,320 13,165 
Zebrafish 1,749 244 168 1337 546 36 168 342 623 9,658 

Sizes are given in bp.

CDS, coding DNA sequence.

The transcription factor binding sites of porcine caveolin-1 are largely unknown. Promoter analyses of the porcine caveolin-1 gene revealed some potential transcription factor binding sites (Table IV), including sites for NF-κB, c-REL, Sox5, Sox17, c-FOS, TEF-1, and E2F for porcine caveolin-1-α (Table IV) and sites for NF-κB, E2F, the Foxo family (Foxd1, FoxI1, and Foxd3), Sox5, Sox17, Myc-Max, and USF for porcine caveolin-1-β (Table IV). Comparison of porcine, bovine, and human caveolin-1 genes revealed that NF-κB, p50, c-REL, and E2F transcription factor binding sites are present in the caveolin-1-α genes of the three species (Table IV) and that Spz1, Sox-5, AML-1, HAND1, ARNT, USF, and n-MYC transcription factor binding sites are present and identical in the caveolin-1-β gene of the three species (Table IV). Some of the transcription factor binding sites are conserved in the two promoter regions of the alternative transcripts of caveolin-1. No conventional TATA-binding protein binding sites (TATA boxes) were found in the two promoter regions of the porcine, bovine, and human genes, suggesting that transcription of the caveolin-1 gene in these species does not require TATA boxes.

The porcine caveolin-1 gene is located on chromosome 18 and is closely linked to microsatellite marker SW1984 at 37 cR, with a logarithm of odds score of 10.52, and marker SW787 at 36 cR, with a logarithm of odds score of 9.33, respectively (Fig. 5). Marker SW1984 (UniSTS: 252678) has been mapped to SSC18 (45) and updated to SSC18q21 at 29.4 cM, according to MARC Map. Thus, the most probable chromosomal location for the porcine caveolin-1 gene is SSC18q21. This agrees with the comparative map because human caveolin-1 has been mapped to 7q31.1-q31.2 (46), which is a syntenic region of porcine chromosome 18 (47). Further comparative mapping of this genomic region in mammals, birds, and fish revealed a conserved genetic region containing TES, caveolin-2, caveolin-1, MET, and CAPZA2 genes (Fig. 6). Despite differences in intergenic distance, the linkage between these genes and the transcriptional direction are well conserved. Interestingly, the genes in avian species are transcribed in the reverse direction compared with those of mammals and fish. Using microsatellite marker SW1984, QTLs matching with pig caveolin-1 were found in PigQTLdb (37); these QTLs affect mostly traits relating to carcass and meat quality (48).

FIGURE 5.

Mapping of porcine caveolin-1 to SSC18q21 and QTL analysis. Porcine caveolin-1 was newly mapped to SSC18q21, shown in pig karyotypic maps using hybrid panel (IMpRH). Its detailed position is also shown in the MARC linkage map. At the right, human caveolin-1, mapped to Hsa7q31, also agrees with the comparative maps of human chromosome 7 (Hsa7) and pig chromosome 18 (SSC18). At the far left, the QTLs in corresponding region include 16LRIBF (Backfat At Last Rib Measured At 16 Weeks Of Age), 1010THRIBBF (Backfat At Tenth Rib Measured At 10 Weeks Of Age), PH (Loin PH 24 Hours Post Mortem), LRIBF (Backfat At Last Rib), 10THRIBBF (Backfat At Tenth Rib), SPARERIB (Spareribs Weight), NUMRIB (Number Of Ribs), 10THRIBBFL (Backfat Linear At Tenth Rib), and LEAL (Loin Eye Area Linear).

FIGURE 5.

Mapping of porcine caveolin-1 to SSC18q21 and QTL analysis. Porcine caveolin-1 was newly mapped to SSC18q21, shown in pig karyotypic maps using hybrid panel (IMpRH). Its detailed position is also shown in the MARC linkage map. At the right, human caveolin-1, mapped to Hsa7q31, also agrees with the comparative maps of human chromosome 7 (Hsa7) and pig chromosome 18 (SSC18). At the far left, the QTLs in corresponding region include 16LRIBF (Backfat At Last Rib Measured At 16 Weeks Of Age), 1010THRIBBF (Backfat At Tenth Rib Measured At 10 Weeks Of Age), PH (Loin PH 24 Hours Post Mortem), LRIBF (Backfat At Last Rib), 10THRIBBF (Backfat At Tenth Rib), SPARERIB (Spareribs Weight), NUMRIB (Number Of Ribs), 10THRIBBFL (Backfat Linear At Tenth Rib), and LEAL (Loin Eye Area Linear).

Close modal
FIGURE 6.

Comparative mapping of caveolin-1 genomic region in mammals, birds, and fish. The map indicates that the genomic region containing caveolin-1, caveolin-2, TES, MET, and CAPZA2 is syntenic and conserved. The gene size and intergenic distances are shown approximately in kilobases. The transcriptional direction of the genes in avian is opposite that of mammals and fish.

FIGURE 6.

Comparative mapping of caveolin-1 genomic region in mammals, birds, and fish. The map indicates that the genomic region containing caveolin-1, caveolin-2, TES, MET, and CAPZA2 is syntenic and conserved. The gene size and intergenic distances are shown approximately in kilobases. The transcriptional direction of the genes in avian is opposite that of mammals and fish.

Close modal

To identify genetic variation in porcine caveolin-1, the coding regions from three pig breeds were sequenced by a combination of in silico and experimental cloning (Fig. 7). Three SNPs—G387C, A474G, and G512A—were identified (Table V). Among these SNPs, G387C and A474G are synonymous mutations, whereas G512A is a nonsynonymous substitution that changes Arg171 (CGC) into His171 (CAC). This arginine (Arg171) is conserved in all mammalian caveolin-1 genes, suggesting that G512A is a candidate functional mutation in porcine caveolin-1. To further investigate the effects of the mutations on the porcine caveolin-1 protein, the variability of codon usage caused by these mutations was assessed (Fig. 8). The synonymous G387C is present in the codon of Ala129 of the porcine caveolin-1-α protein. The codon usage frequencies of Ala (GCG) and Ala (GCC) are 0.89 and 3.17%, respectively (mutations underlined). Unlike GCC, GCG of Ala129 is a low-usage codon. Furthermore, the A474G synonymous mutation is present in the codon of Pro158 of the porcine caveolin-1-α protein. The codon usage frequencies of Pro (CCA) and Pro (CCG) are 1.43 and 0.84%, respectively. Unlike CCA, CCG of Ala129 is a low-usage codon. These findings indicate that the two synonymous mutations, G387C and A474G, can lead to low-usage codons in new translations of porcine caveolin-1 and also suggest that these mutations may influence the function of the porcine caveolin-1 proteins via changes in codon usage. In addition, the distribution of the variant A474G differs between local Chinese breeds and European breeds (Table VI).

FIGURE 7.

Genetic variations of porcine caveolin-1 gene and cleaved amplification polymorphisms (CAPs) analysis. Three SNPs, including G387C, A474G, and G512A, were identified. G387C and A474G are synonymous mutations, whereas G512 is a nonsynonymous substitution changing amino acid Arg171 (CGC) into His171 (CAC). The detection of SNPs by PCR-CAPs is also established.

FIGURE 7.

Genetic variations of porcine caveolin-1 gene and cleaved amplification polymorphisms (CAPs) analysis. Three SNPs, including G387C, A474G, and G512A, were identified. G387C and A474G are synonymous mutations, whereas G512 is a nonsynonymous substitution changing amino acid Arg171 (CGC) into His171 (CAC). The detection of SNPs by PCR-CAPs is also established.

Close modal
Table V.
Allelic variations and amino acid substitution in the coding region of porcine caveolin-1
PositionaVariationAmino Acid Position and Deduced Amino Acid SubstitutionCAPs EnzymebCAPs Fragments
387 G387Cc 129Ala (GCG)◇ Ala (GCC), Silent HaeIII (GG^CC) 228+96 
474 A474Gd 158Pro(CCA)◇Pro(CCG), Silent MbiI(GAG^CGG) 185+139 
512 G512Ad 171Arg(CGC)◇ His(CAC)e AciI(C^CGC) Complicated 
PositionaVariationAmino Acid Position and Deduced Amino Acid SubstitutionCAPs EnzymebCAPs Fragments
387 G387Cc 129Ala (GCG)◇ Ala (GCC), Silent HaeIII (GG^CC) 228+96 
474 A474Gd 158Pro(CCA)◇Pro(CCG), Silent MbiI(GAG^CGG) 185+139 
512 G512Ad 171Arg(CGC)◇ His(CAC)e AciI(C^CGC) Complicated 

Underlined text indicates the site of variation.

a

Number refers to the position in coding region sequence of porcine caveolin-1-α (gi|112181313:113-649).

b

CAPs (PCR-RFLP). Enzymes were brought from Fergment.

c

Transversion (G/C).

d

Transition (A/G).

e

Nonsynonymous variation; both Arg and His are polar basic amino acid.

Table VI.
Genotype frequencies of the variation A474G in different breeds
Genotype and AlleleYorkshireDurocLandraceErhualianQinping
AA 18 
AG 
GG 11 14 
Total 20 10 11 14 
0.95 0.75 0.56 0.00 0.00 
0.05 0.25 0.44 1.00 1.00 
Genotype and AlleleYorkshireDurocLandraceErhualianQinping
AA 18 
AG 
GG 11 14 
Total 20 10 11 14 
0.95 0.75 0.56 0.00 0.00 
0.05 0.25 0.44 1.00 1.00 

A, variation of adenosine; G, variation of guanosine.

To investigate the relationship between porcine caveolin-1 and immunity, we evaluated the effects of two SNPs on immunological parameters in a Landrace population by ANOVA. The G387C polymorphism segregated in the resource family and was consistent with Hardy–Weinberg equilibrium. The Shannon’s Information index of this site is 0.69, which suggests high diversity. Significant associations of G387C with five immunological parameters were found in the resource family (Tables VII, VIII). The A474G polymorphism segregated in the same resource family and was also consistent with Hardy–Weinberg equilibrium; the Shannon’s Information index of this site was 0.61, again suggesting high diversity. Three immunological parameters were found to be significantly associated with the porcine caveolin-1 A474G in the resource family (Tables VII, VIII).

Table VII.
Association between porcine caveolin-1 and immunological parameters: the effect and least-square means of porcine caveolin-1 HaeIII-CAP genotypes on immunological parameters
TraitAge (y)PGenotypeCC–Least-Square MeansaCG–Least-Square MeansaGG–Least-Square Meansa
RDW (%) 0.035 14.72 ± 0.31(76) 14.27 ± 0.27(138) 14.57 ± 0.32(62) 
PRRSV 17 0.037 0.95 ± 0.17(76) 1.01 ± 0.17(123) 0.80 ± 0.18(53) 
WBC (109/l) 17 0.013 10.07 ± 0.48(76) 9.93 ± 0.37(125) 11.51 ± 0.56(52) 
LYM# (109/l) 17 0.018 7.28 ± 0.53(67) 6.78 ± 0.43(108) 8.34 ± 0.60(46) 
P-LCR (%) 17 0.035 30.38 ± 1.28(70) 28.71 ± 1.11(122) 31.04 ± 1.39(47) 
TraitAge (y)PGenotypeCC–Least-Square MeansaCG–Least-Square MeansaGG–Least-Square Meansa
RDW (%) 0.035 14.72 ± 0.31(76) 14.27 ± 0.27(138) 14.57 ± 0.32(62) 
PRRSV 17 0.037 0.95 ± 0.17(76) 1.01 ± 0.17(123) 0.80 ± 0.18(53) 
WBC (109/l) 17 0.013 10.07 ± 0.48(76) 9.93 ± 0.37(125) 11.51 ± 0.56(52) 
LYM# (109/l) 17 0.018 7.28 ± 0.53(67) 6.78 ± 0.43(108) 8.34 ± 0.60(46) 
P-LCR (%) 17 0.035 30.38 ± 1.28(70) 28.71 ± 1.11(122) 31.04 ± 1.39(47) 

The correlated numbers of the animals used for each trait are given in parentheses.

a

Least square means with different letters are significantly different (p < 0.05) per row.

LYM#, lymphocyte count; P-LCR, platelet-large cell ratio; PRRSV, PRRSV Ab; RDW, red cell distribution width.

Table VIII.
Association between porcine caveolin-1 and immunological parameters: the effect and least square means of porcine caveolin-1 MbiI-CAP genotypes on immunological parameters
TraitAge (y)PGenotypeAA–Least-Square MeansaAG–Least-Square MeansaGG–Least-Square Meansa
MCHC (g/l) 0.023 267.47 ± 4.98(30) 277.94 ± 3.84(112) 276.15 ± 3.82(133) 
LYN (%) 0.012 81.78 ± 7.11(11) 75.3248 ± 4.78(53) 86.0835 ± 4.70(71) 
PLT (109/l) 17 0.023 422.08 ± 33.94(27) 417.78 ± 23.15(99) 470.2 ± 23.08(124) 
HGB (g/l) 32 0.016 113.69 ± 4.09(26) 123.35 ± 2.95(107) 122.67 ± 2.98(124) 
TraitAge (y)PGenotypeAA–Least-Square MeansaAG–Least-Square MeansaGG–Least-Square Meansa
MCHC (g/l) 0.023 267.47 ± 4.98(30) 277.94 ± 3.84(112) 276.15 ± 3.82(133) 
LYN (%) 0.012 81.78 ± 7.11(11) 75.3248 ± 4.78(53) 86.0835 ± 4.70(71) 
PLT (109/l) 17 0.023 422.08 ± 33.94(27) 417.78 ± 23.15(99) 470.2 ± 23.08(124) 
HGB (g/l) 32 0.016 113.69 ± 4.09(26) 123.35 ± 2.95(107) 122.67 ± 2.98(124) 

The correlated numbers of the animals used for each trait are given in parentheses.

a

Least-square means with different letters are significantly different (p < 0.05) per row.

HGB, hemoglobin concentration; LYN, lymphocyte; MCHC, mean corpuscular hemoglobin concentration; PLT, platelet count.

Using transcript-specific and consensus region-specific primers (Table I), the expression of porcine caveolin-1 was detected by Q-PCR in 18 tissues and two cell types and was normalized to the expression of β-actin (Fig. 9). The total mRNA levels of both forms of caveolin-1 were higher than that of the alternative transcripts (α and β) in the 18 tissues and two cell types. This is compatible with the hypothesis (mRNATotal ≥ mRNAα + mRNAβ).

FIGURE 9.

Basal expression of porcine caveolin-1 splice variants in adult pig tissues. The expression of caveolin-1 transcripts was first normalized to the expression of β-actin and then compared relative to expression of caveolin-1-β in PK cells, which was set as 1.

FIGURE 9.

Basal expression of porcine caveolin-1 splice variants in adult pig tissues. The expression of caveolin-1 transcripts was first normalized to the expression of β-actin and then compared relative to expression of caveolin-1-β in PK cells, which was set as 1.

Close modal

Interestingly, the abundance of the α transcript of mature porcine caveolin-1 was notably higher than that of the β transcript in all tissues and cell types examined. Furthermore, caveolin-1 was most highly expressed in the skin, muscle, heart, fat, lung, epididymis, uterus, and ovary, moderately expressed in the spleen, bone marrow, lymph node, liver, intestine, and testis, and lowly expressed in PBMCs, kidney, and brain.

To investigate differences in basal expression of porcine caveolin-1 in different pig breeds, we measured porcine caveolin-1 expression in PBMCs from Landrace, Yorkshire, Duroc, Meishan, and the three-way cross DLY (Fig. 10). Our results indicated that caveolin-1 was highly expressed in PBMCs of Yorkshire pigs, whereas PBMCs of Landrace and DLY pigs expressed relatively low levels of caveolin-1. However, there was no significant difference in the basal expression of caveolin-1 in PBMCs among all pig breeds examined.

FIGURE 10.

Basal expression of porcine caveolin-1 in PBMCs from five pig breeds. The expression of porcine caveolin-1 in PBMCs was detected in different pig breeds, including Landrace (L), Yorkshire (Y), Duroc (D), Meishan (M), and three-way cross DLY. The expression of caveolin-1 transcripts was first normalized to the expression of β-actin and then compared relative to the expression of caveolin-1 in Yorkshire, which was set as 1.

FIGURE 10.

Basal expression of porcine caveolin-1 in PBMCs from five pig breeds. The expression of porcine caveolin-1 in PBMCs was detected in different pig breeds, including Landrace (L), Yorkshire (Y), Duroc (D), Meishan (M), and three-way cross DLY. The expression of caveolin-1 transcripts was first normalized to the expression of β-actin and then compared relative to the expression of caveolin-1 in Yorkshire, which was set as 1.

Close modal

The presence of consensus NF-κB binding sites in the promoters of the two transcripts suggests that NF-κB may activate caveolin-1 in pigs. To investigate this possibility, poly (I:C) and LPS were used to activate NF-κB in PK-15 cells. Overnight cultures of PK-15 cells were treated with 1 μg/ml LPS or 10 μg/ml poly (I:C) for 0, 3, 6, 12, 24, and 48 h. LPS stimulation induced expression of porcine caveolin-1 at 3 h and more significantly at 6 h, after which caveolin-1 expression dropped and plateaued for 12–24 h (Fig. 11). In contrast, poly (I:C) stimulation did not induce expression of porcine caveolin-1 until after 24 h, with expression peaking at 48 h (Fig. 12). These findings indicate that both LPS and poly (I:C) can induce the expression of porcine caveolin-1 in vitro.

FIGURE 11.

LPS-induced expression of porcine caveolin-1 in PK-15 cells. PK-15 cells were cultured with 1 μg/ml LPS for 24 h. Relative expression of caveolin-1 was detected by Q-PCR and normalized to the expression of RPL32. The fold increase is expressed as the mean of three replicates with SEM by comparison with the control (0 h). The difference between the treatment and the control (0 h) is significant (*p < 0.05).

FIGURE 11.

LPS-induced expression of porcine caveolin-1 in PK-15 cells. PK-15 cells were cultured with 1 μg/ml LPS for 24 h. Relative expression of caveolin-1 was detected by Q-PCR and normalized to the expression of RPL32. The fold increase is expressed as the mean of three replicates with SEM by comparison with the control (0 h). The difference between the treatment and the control (0 h) is significant (*p < 0.05).

Close modal
FIGURE 12.

Poly (I:C)-induced expression of porcine caveolin-1 in PK-15 cells. PK-15 cells were cultured with 10 μg/ml poly (I:C) for 48 h. Relative expression of caveolin-1 was detected by Q-PCR and normalized to the expression of RPL32. The fold increase is expressed as the mean of three replicates with SEM compared with the control (0 h). The difference between the treatment and the control (0 h) is significant (*p < 0.05).

FIGURE 12.

Poly (I:C)-induced expression of porcine caveolin-1 in PK-15 cells. PK-15 cells were cultured with 10 μg/ml poly (I:C) for 48 h. Relative expression of caveolin-1 was detected by Q-PCR and normalized to the expression of RPL32. The fold increase is expressed as the mean of three replicates with SEM compared with the control (0 h). The difference between the treatment and the control (0 h) is significant (*p < 0.05).

Close modal

Decreased expression of caveolin-1 was observed in the brains and lungs of pigs infected with H. parasuis for 1 wk (Fig. 13). To confirm these findings, immunohistochemical staining was performed on paraffin-embedded sections of porcine tissues. Quantitative analyses showed significantly decreased expression of caveolin-1 in the brain, spleen, heart, and kidney (Fig. 14). Positive staining was observed as brown reaction products, mostly in the cytoplasm and on cell membranes of control lung and brain, respectively (Fig. 15A, 15C). Porcine caveolin-1 was widely expressed, particularly in the bronchial epithelial cells surrounding air spaces (Fig. 15A) and brain capillary networks (Fig. 15C). However, caveolin-1 staining in infected porcine lung (Fig. 15B) and brain (Fig. 15D) tissues was much lower than in the control. These results indicate that caveolin-1 protein is downregulated in the brain and lung 1 wk postinfection with H. parasuis. Reduced expression of porcine caveolin-1 postinfection with H. parasuis was also observed in the heart; positive staining for caveolin-1 was detected along the vessels and in the epithelial cells of control heart specimens (Fig. 15E), but the intensity of the positive staining was reduced significantly in similar areas of infected hearts (Fig. 15F). In addition, reduced expression of porcine caveolin-1 postinfection with H. parasuis was observed in the spleen (Fig. 16A, 16B) and kidney (Fig. 16C, 16D) but not in the liver (Fig. 16E, 16F). In summary, the expression of caveolin-1 was reduced 1 wk after H. parasuis infection in the pig brain, heart, kidney, spleen, and lung.

FIGURE 13.

Depressed in vivo gene expression of caveolin-1 in lung and brain of pigs with Glasser’s disease. The gene expression of caveolin-1 was detected by Q-PCR and normalized to the expression of 18S. The fold increase is expressed as the mean of three replicates with SEM compared with the control. The difference between the treatment and the control is significant (*p < 0.05).

FIGURE 13.

Depressed in vivo gene expression of caveolin-1 in lung and brain of pigs with Glasser’s disease. The gene expression of caveolin-1 was detected by Q-PCR and normalized to the expression of 18S. The fold increase is expressed as the mean of three replicates with SEM compared with the control. The difference between the treatment and the control is significant (*p < 0.05).

Close modal
FIGURE 14.

Quantitative immunohistochemical expression of caveolin-1 in six tissues from pigs with Glasser’s disease. The immunohistochemical images were analyzed quantitatively using Image Pro-Plus. Density means are expressed as mean ± SE. Quantitative analysis showed significantly decreased expression of caveolin-1 in brain, spleen, heart, and kidney. The level of significance was set at *p < 0.05, **p < 0.01.

FIGURE 14.

Quantitative immunohistochemical expression of caveolin-1 in six tissues from pigs with Glasser’s disease. The immunohistochemical images were analyzed quantitatively using Image Pro-Plus. Density means are expressed as mean ± SE. Quantitative analysis showed significantly decreased expression of caveolin-1 in brain, spleen, heart, and kidney. The level of significance was set at *p < 0.05, **p < 0.01.

Close modal
FIGURE 15.

Immunohistochemical expression of caveolin-1 in lung, brain, and heart of pigs with Glasser’s disease. Caveolin-1 (brown color) was mainly expressed in the airway epithelium and alveolar macrophages of control pigs but was notably lacking in infected pigs. The intensity of positive staining in infected brain and heart was lower than in the control tissues as well. A, Control lung. B, Infected lung; C, Control brain. D, Infected brain. E, Control heart. F, Infected heart. AF, H. parasuis, original magnification ×400.

FIGURE 15.

Immunohistochemical expression of caveolin-1 in lung, brain, and heart of pigs with Glasser’s disease. Caveolin-1 (brown color) was mainly expressed in the airway epithelium and alveolar macrophages of control pigs but was notably lacking in infected pigs. The intensity of positive staining in infected brain and heart was lower than in the control tissues as well. A, Control lung. B, Infected lung; C, Control brain. D, Infected brain. E, Control heart. F, Infected heart. AF, H. parasuis, original magnification ×400.

Close modal
FIGURE 16.

Immunohistochemical expression of caveolin-1 in spleen, kidney, and liver of pigs with Glasser’s disease. Strong expression of caveolin-1 was detected in the spleen of control pigs but was notably lacking from pigs infected with H. parasuis. The intensity of positive staining in infected kidney was lower than that in the control. The difference in the level of caveolin-1 expression after H. parasuis infection was not apparent in the liver. A, Control spleen. B, Infected spleen. C, Control kidney. D, Infected kidney. E, Control liver. F, Infected liver. AF, H. parasuis, original magnification ×400.

FIGURE 16.

Immunohistochemical expression of caveolin-1 in spleen, kidney, and liver of pigs with Glasser’s disease. Strong expression of caveolin-1 was detected in the spleen of control pigs but was notably lacking from pigs infected with H. parasuis. The intensity of positive staining in infected kidney was lower than that in the control. The difference in the level of caveolin-1 expression after H. parasuis infection was not apparent in the liver. A, Control spleen. B, Infected spleen. C, Control kidney. D, Infected kidney. E, Control liver. F, Infected liver. AF, H. parasuis, original magnification ×400.

Close modal

In this study, we identified two alternative transcript variants that encode two isoforms of the porcine caveolin-1 protein, caveolin-1-α and -β. The cloned cDNA sequence of caveolin-1 matched perfectly with the genomic sequence. The porcine caveolin-1 gene exhibits at least two splicing patterns: a three exon/two intron organization for caveolin-1-α and a two exon/one intron organization for caveolin-1-β. The caveolin-1 gene has been cloned in humans (3, 4952), mice (53), African clawed frog (54), zebrafish (55), and even in the invertebrate Caenorhabditis elegans (56). Studies of the human (57), mouse (53), and zebrafish proteins indicate that caveolin-1 has two isoforms that differ in their N-terminal protein sequences (an additional 31 aa is added to the α-isoform at its N terminus). Our findings show that the two isoforms are also present in the pig.

Two explanations have been proposed for the generation of the two isoforms of caveolin-1, but the molecular mechanisms are still unclear. Mutation analyses in humans suggest that these two isoforms are derived from two alternative start sites of a single transcript (57). However, studies in mice suggest that the two isoforms of caveolin-1 are generated by translation of distinct mRNAs, as a TATA box was found in the first intron, where the promoter of caveolin-1-β lies (53). In contrast, we did not find a TATA box in either of the promoter regions of the porcine caveolin-1 gene. In mammalian genes, the TATA box is located 25–30 bp upstream of the transcription start site and is important for directing accurate transcription initiation via specific interaction with TATA binding protein (58). Some TATA-less promoters appear to direct the initiation of transcription from multiple start sites (59). Therefore, the TATA-less promoters in the porcine caveolin-1 gene are likely responsible for the multiple transcription initiation sites. In addition, porcine caveolin-1-α has two start codons, Met1 and an internal Met32. However, the nucleotide sequence around Met1 (AGAATGT) shows only a partial match with the typical Kozak consensus, whereas Met32 (GCCATGG) shows a perfect match with the typical Kozak consensus. The Kozak consensus is a sequence (RCCATGG) that occurs in eukaryotic mRNA (41) that plays a major role in the process of translation initiation (60). Point mutations close to the AUG initiator codon affect the efficiency of translation (61). Given that the internal Kozak sequence is more typical than the first Kozak sequence in porcine caveolin-1-α, we inferred that the internal Met32 was highly efficient at starting translation; this is also supported by mutation analyses in humans (57). In summary, we hypothesize that the distinct transcript variants generated by the TATA-less promoter and the alternative start sites in caveolin-1-α translation are responsible for generating the two isoforms of porcine caveolin-1. The former may regulate the level of transcription, whereas the latter may regulate the level of translation.

The porcine caveolin-1 gene was initially mapped to SSC18q21, which is syntenic to human Hsc7q31, where the human caveolin-1 gene is located. The porcine caveolin-1 gene is closely linked to the genes TES, caveolin-2, MET, and CAPZA2. Interestingly, all of the genes in this region have been implicated in immunity and disease, such as tumorigenesis, in humans (46). As previously reported in humans (46), porcine caveolin-1 is closely linked to caveolin-2, which suggests that the two genes in the pig are parallel homologs and were likely generated by duplication (52). Therefore, we hypothesize that the genes in this region may be evolutionarily linked and may also be functionally related to immunity in the pig.

The porcine caveolin-1 gene is polymorphic and has three SNPs in its coding region. Rich polymorphisms in the coding region suggest that functional mutations may be present in the caveolin-1 gene in pigs and other higher mammals. Mice deficient in caveolin-1 have reduced serum levels of Abs (62), lower levels of leukocytes, and decreased platelet rolling (63). Our results also showed an association between caveolin-1 and blood Ab levels, lymphocytes, and platelet bioactivity. Synonymous mutations can influence the translation rate, protein folding, and thus biological function of proteins via changes in codon usage (64). We found that the two synonymous mutations of caveolin-1, G387C and A474G, resulted in low-usage codons in new translations of porcine caveolin-1, which suggests that these mutations may influence the function of porcine caveolin-1 proteins. Collectively, our findings indicate that the caveolin-1 gene is polymorphic and that its genetic variants are potentially functional. Given that the caveolin-1 gene is a potential diagnostic and prognostic marker in humans (65), these findings suggest that the caveolin-1 gene can be used to introduce disease resistance in pig breeding programs.

Porcine caveolin-1 was found to be expressed in almost all body systems, including the circulatory (heart, PBMCs), respiratory (lungs), immune (spleen, bone marrow, lymph node, PBMCs, muscles), musculoskeletal (muscles), urinary (bladder, kidneys), digestive (stomach, intestines), nervous (brain), and reproductive (epididymis, testis, uterus, ovary) systems. The human and murine caveolin-1 molecules also show a broad distribution of expression in tissues and cell types (52, 53). Caveolin-1 was moderately expressed in the porcine immune system. Interestingly, the caveolin-1-α transcript was more abundantly expressed than that of caveolin-1-β in a wide range of tissues, consistent with previous findings of caveolin-1 protein expression in different developmental stages of zebrafish (55). These findings indicate that porcine caveolin-1 is a key gene involved in various biological processes, including immunity, and as the main form of caveolin-1, the caveolin-1-α gene may play a predominant role. In addition, the basal expression levels of caveolin-1 in PBMCs from different pig breeds are relatively similar, suggesting that genetic variation has limited effects on basal expression of caveolin-1.

The putative transcription factors that regulate the porcine caveolin-1 gene are involved in a range of signaling pathways, especially the MAPK/ERK pathway. Most of the transcription factor binding sites are also present in the human and bovine genes, suggesting that the regulation of caveolin-1 expression is conserved among mammals. These observations are supported by previous reports showing that activation of protein kinase A downregulates caveolin-1 protein expression (66) and that cytokine production by caveolin-1 also involves the MAPK kinase 3/p38 MAPK pathway (67).

The transcriptional regulatory mechanisms governing the generation of the two alternative transcripts of porcine caveolin-1 may overlap, as some transcription factor binding sites, such as the NF-κB elements, are common in the two promoters. LPS and poly (I:C) can activate NF-κB, and we found that both LPS and poly (I:C) induced the expression of porcine caveolin-1 in PK-15 cells. These findings are consistent with a study showing that LPS treatment upregulated caveolin-1 expression in murine macrophages (68). In addition, LPS has been shown to induce the binding of NF-κB to intronic NF-κB consensus sites of caveolin-1 in microvascular endothelial cells of human lung tissue (69). LPS is a characteristic cell wall component of Gram-negative bacteria, whereas poly (I:C) is a double-stranded viral RNA mimic. Our results show that porcine caveolin-1 can be induced by both Gram-negative bacteria and double-stranded viral RNA, likely through activation of NF-κB. The two alternative transcripts of porcine caveolin-1 also have transcript-specific regulatory factors, which include TEF-1 and c-REL for porcine caveolin-1-α and the Foxo family (Foxd1, FoxI1, and Foxd3), Spz1, USF, and Myc for porcine caveolin-1-β. The FOXO (forkhead box O) protein can bind to the promoter of caveolin-1 and activate its transcription (70). In this article, we found that Foxd1 (forkhead box D1), FoxI1 (forkhead box I1), and Foxd3 (forkhead box D3) could bind to the promoter of caveolin-1-β but not that of caveolin-1-α. Therefore, the forkhead gene family may specifically regulate caveolin-1-β expression.

Glasser’s disease is characterized mainly by meningitis, fibrinous polyserositis, and arthritis (26, 27), all of which are associated with uncontrolled inflammation. Caveolin-1 is a key immunomodulatory molecule in the inflammatory response (13, 16, 67, 71), and decreased expression of caveolin-1 in murine alveolar and peritoneal macrophages has a proinflammatory outcome (67). Fibrinous polyserositis is inflammation of the serous tissues with fibrosis. Caveolin-1 has been reported to be a critical regulator of fibrosis, as knockout studies have shown that caveolin-1 participates in the pathogenesis of systemic sclerosis and idiopathic pulmonary fibrosis (72). Decreased expression of caveolin-1 plays a crucial role in the pathogenesis of tissue fibrosis (73). Therefore, we deduce that decreases in caveolin-1 expression may underlie fibrosis and inflammation in serous tissues during H. parasuis infection in pigs. Meningitis is inflammation of the meninges, and H. parasuis must cross the blood–brain barrier (BBB) to cause meningitis and neurologic disorders. Recent reports show that deficiency in caveolin-1 alters the normal function of the brain and the BBB. Knockdown of caveolin-1 significantly perturbs the normal function of the BBB in humans via regulation of chemokine MCP-1 in astrocytes (74). Caveolin-1 deficiency also increases cerebral ischemic injury and the volume of cerebral infarction, impairs angiogenesis, and increases apoptotic cell death (75). Caveolin-1 knockout mice display several neurologic disorders, such as muscle weakness, reduced activity, and gait abnormalities (76). These neurologic disorders are similar to some of the central nervous clinical signs of pigs infected with H. parasuis. These observations implicate the decrease in caveolin-1 expression during H. parasuis infection in the development of meningitis and other inflammatory processes.

Breeding for disease resistance is one of the most useful methods to improve animal health, welfare, and productivity (77). Although identification of mechanisms of disease resistance is challenging, an essential first step is to investigate the key genes involved in the host response to infectious pathogens (78, 79). In this study, we investigated caveolin-1 as a candidate gene for disease resistance in pigs. We characterized the gene structure and transcriptional regulation of the porcine caveolin-1 gene and provided the in vivo characterization of caveolin-1 in the pathogenesis of systemic H. parasuis infection in pigs. These findings not only provide new support for the use of the caveolin-1 gene as a potential diagnostic and genetic marker for disease resistance in animal breeding programs, but also implicate caveolin-1 in the pathogenesis of Glasser’s disease.

We thank Dr. Martine Yerle (Institut National de la Recherche Agronomique, France) for providing the RH panel. We also thank Prof. Shu-Jun Zhang, Dr. Xue-Ying Hu, Xiang-An Jing, Xi Su, Nu-Nu Sun, and Jian-Bo Cao for technical assistance.

This work was supported by the Natural Science Foundation of China-Guangdong Key Project (U 0631005) and the Creative Team Project of Education Ministry (IRT-0831).

Abbreviations used in this article:

BBB

blood–brain barrier

CAP

cleaved amplification polymorphism

Cav1

caveolin-1

CSD

caveolin scaffolding domain

CSFV

classical swine fever virus

DLY

Duroc × Landrace × Yorkshire

EST

expressed sequence tag

IMpRH

Institut National de la Recherche Agronomique–University of Minnesota porcine radiation hybrid

N-MAD

N-terminal membrane attachment domain

PK

porcine kidney

poly (I:C)

polyinosinic-polycytidylic acid

PRRSV

porcine reproductive and respiratory syndrome virus

PRV

pseudorabies virus

Q-PCR

quantitative PCR

QTL

quantitative trait loci

SNP

single nucleotide polymorphism

UTR

untranslated region.

1
Palade
G. E.
1953
.
The fine structure of blood capillaries.
J. Appl. Phys.
24
:
1424
.
2
Yamada
E.
1955
.
The fine structure of the gall bladder epithelium of the mouse.
J. Biophys. Biochem. Cytol.
1
:
445
458
.
3
Rothberg
K. G.
,
Heuser
J. E.
,
Donzell
W. C.
,
Ying
Y. S.
,
Glenney
J. R.
,
Anderson
R. G.
.
1992
.
Caveolin, a protein component of caveolae membrane coats.
Cell
68
:
673
682
.
4
Williams
T. M.
,
Lisanti
M. P.
.
2004
.
The caveolin proteins.
Genome Biol.
5
:
214
.
5
Zhu
Z.
,
Li
Y.
,
Mo
D.
,
Li
K.
,
Zhao
S.
.
2006
.
Molecular characterization and expression analysis of the porcine caveolin-3 gene.
Biochem. Biophys. Res. Commun.
346
:
7
13
.
6
Razani
B.
,
Woodman
S. E.
,
Lisanti
M. P.
.
2002
.
Caveolae: from cell biology to animal physiology.
Pharmacol. Rev.
54
:
431
467
.
7
Parton
R. G.
,
Simons
K.
.
2007
.
The multiple faces of caveolae.
Nat. Rev. Mol. Cell Biol.
8
:
185
194
.
8
Harris
J.
,
Werling
D.
,
Hope
J. C.
,
Taylor
G.
,
Howard
C. J.
.
2002
.
Caveolae and caveolin in immune cells: distribution and functions.
Trends Immunol.
23
:
158
164
.
9
Juhász
M.
,
Vértesaljai
M.
,
Herszényi
L.
,
Malfertheiner
P.
,
Ebert
M. P.
,
Tulassay
Z.
.
2004
.
[The role of caveolin-1 gene in carcinogenesis].
Orv. Hetil.
145
:
1985
1989
.
10
Williams
T. M.
,
Lisanti
M. P.
.
2005
.
Caveolin-1 in oncogenic transformation, cancer, and metastasis.
Am. J. Physiol. Cell Physiol.
288
:
C494
C506
.
11
Shatz
M.
,
Liscovitch
M.
.
2004
.
Caveolin-1 and cancer multidrug resistance: coordinate regulation of pro-survival proteins?
Leuk. Res.
28
:
907
908
.
12
Bouras
T.
,
Lisanti
M. P.
,
Pestell
R. G.
.
2004
.
Caveolin-1 in breast cancer.
Cancer Biol. Ther.
3
:
931
941
.
13
Medina
F. A.
,
de Almeida
C. J.
,
Dew
E.
,
Li
J.
,
Bonuccelli
G.
,
Williams
T. M.
,
Cohen
A. W.
,
Pestell
R. G.
,
Frank
P. G.
,
Tanowitz
H. B.
,
Lisanti
M. P.
.
2006
.
Caveolin-1-deficient mice show defects in innate immunity and inflammatory immune response during Salmonella enterica serovar Typhimurium infection.
Infect. Immun.
74
:
6665
6674
.
14
Li
J.
,
Scherl
A.
,
Medina
F.
,
Frank
P. G.
,
Kitsis
R. N.
,
Tanowitz
H. B.
,
Sotgia
F.
,
Lisanti
M. P.
.
2005
.
Impaired phagocytosis in caveolin-1 deficient macrophages.
Cell Cycle
4
:
1599
1607
.
15
Hu
G.
,
Ye
R. D.
,
Dinauer
M. C.
,
Malik
A. B.
,
Minshall
R. D.
.
2008
.
Neutrophil caveolin-1 expression contributes to mechanism of lung inflammation and injury.
Am. J. Physiol. Lung Cell. Mol. Physiol.
294
:
L178
L186
.
16
Zemans
R.
,
Downey
G. P.
.
2008
.
Role of caveolin-1 in regulation of inflammation: different strokes for different folks.
Am. J. Physiol. Lung Cell. Mol. Physiol.
294
:
L175
L177
.
17
Shin
J. S.
,
Abraham
S. N.
.
2001
.
Cell biology. Caveolae–not just craters in the cellular landscape.
Science
293
:
1447
1448
.
18
Shin
J.-S.
,
Abraham
S. N.
.
2001
.
Caveolae as portals of entry for microbes.
Microbes Infect.
3
:
755
761
.
19
Baumler
A. J.
,
Hargis
B. M.
,
Tsolis
R. M.
.
2000
.
Tracing the origins of Salmonella outbreaks.
Science
287
:
50
52
.
20
Yue
M.
,
Yang
F.
,
Yang
J.
,
Bei
W.
,
Cai
X.
,
Chen
L.
,
Dong
J.
,
Zhou
R.
,
Jin
M.
,
Jin
Q.
,
Chen
H.
.
2009
.
Complete genome sequence of Haemophilus parasuis SH0165.
J. Bacteriol.
191
:
1359
1360
.
21
Lewis
C. R.
,
Torremorell
M.
,
Galina-Pantoja
L.
,
Bishop
S. C.
.
2009
.
Genetic parameters for performance traits in commercial sows estimated before and after an outbreak of porcine reproductive and respiratory syndrome.
J. Anim. Sci.
87
:
876
884
.
22
Segalés
J.
,
Allan
G. M.
,
Domingo
M.
.
2005
.
Porcine circovirus diseases.
Anim. Health Res. Rev.
6
:
119
142
.
23
Greiser-Wilke
I.
,
Moennig
V.
.
2004
.
Vaccination against classical swine fever virus: limitations and new strategies.
Anim. Health Res. Rev.
5
:
223
226
.
24
Pomeranz
L. E.
,
Reynolds
A. E.
,
Hengartner
C. J.
.
2005
.
Molecular biology of pseudorabies virus: impact on neurovirology and veterinary medicine.
Microbiol. Mol. Biol. Rev.
69
:
462
500
.
25
Wang
C.
,
Mei
Y.
,
Li
L.
,
Mo
D.
,
Li
J.
,
Zhang
H.
,
Tian
X.
,
Chen
Y.
.
2008
.
Molecular characterization and expression analysis of caveolin-1 in pig tissues.
Sci. China C Life Sci.
51
:
655
661
.
26
Blanco
I.
,
Canals
A.
,
Evans
G.
,
Mellencamp
M. A.
,
Cia
C.
,
Deeb
N.
,
Wang
L.
,
Galina-Pantoja
L.
.
2008
.
Differences in susceptibility to Haemophilus parasuis infection in pigs.
Can J Veterinary Res
72
:
228
235
.
27
Oliveira
S.
,
Pijoan
C.
.
2004
.
Haemophilus parasuis: new trends on diagnosis, epidemiology and control.
Vet. Microbiol.
99
:
1
12
.
28
Thomas
J. W.
,
Touchman
J. W.
,
Blakesley
R. W.
,
Bouffard
G. G.
,
Beckstrom-Sternberg
S. M.
,
Margulies
E. H.
,
Blanchette
M.
,
Siepel
A. C.
,
Thomas
P. J.
,
McDowell
J. C.
, et al
.
2003
.
Comparative analyses of multi-species sequences from targeted genomic regions.
Nature
424
:
788
793
.
29
Feng
Z.
,
Tang
Z. L.
,
Li
K.
,
Liu
B.
,
Yu
M.
,
Zhao
S. H.
.
2007
.
Molecular characterization of the BTG2 and BTG3 genes in fetal muscle development of pigs.
Gene
403
:
170
177
.
30
Tamura
K.
,
Dudley
J.
,
Nei
M.
,
Kumar
S.
.
2007
.
MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.
Mol. Biol. Evol.
24
:
1596
1599
.
31
Kapustin
Y.
,
Souvorov
A.
,
Tatusova
T.
,
Lipman
D.
.
2008
.
Splign: algorithms for computing spliced alignments with identification of paralogs.
Biol. Direct
3
:
20
.
32
Sandelin
A.
,
Wasserman
W. W.
,
Lenhard
B.
.
2004
.
ConSite: web-based prediction of regulatory elements using cross-species comparison.
Nucleic Acids Res.
32
(
Web Server issue
):
W249
W252
.
33
Yerle
M.
,
Pinton
P.
,
Robic
A.
,
Alfonso
A.
,
Palvadeau
Y.
,
Delcros
C.
,
Hawken
R.
,
Alexander
L.
,
Beattie
C.
,
Schook
L.
, et al
.
1998
.
Construction of a whole-genome radiation hybrid panel for high-resolution gene mapping in pigs.
Cytogenet. Cell Genet.
82
:
182
188
.
34
Milan
D.
,
Hawken
R.
,
Cabau
C.
,
Leroux
S.
,
Genet
C.
,
Lahbib
Y.
,
Tosser
G.
,
Robic
A.
,
Hatey
F.
,
Alexander
L.
, et al
.
2000
.
IMpRH server: an RH mapping server available on the Web.
Bioinformatics
16
:
558
559
.
35
Rothschild
M. F.
,
Hu
Z. L.
,
Jiang
Z.
.
2007
.
Advances in QTL mapping in pigs.
Int. J. Biol. Sci.
3
:
192
197
.
36
Hu
Z. L.
,
Reecy
J. M.
.
2007
.
Animal QTLdb: beyond a repository. A public platform for QTL comparisons and integration with diverse types of structural genomic information.
Mamm. Genome
18
:
1
4
.
37
Hu
Z. L.
,
Dracheva
S.
,
Jang
W.
,
Maglott
D.
,
Bastiaansen
J.
,
Rothschild
M. F.
,
Reecy
J. M.
.
2005
.
A QTL resource and comparison tool for pigs: PigQTLDB.
Mamm. Genome
16
:
792
800
.
38
Zhang
W. S.
,
Li
X.
,
Liu
J. B.
.
2007
.
Genetic variation of Bmy1 alleles in barley (Hordeum vulgare L.) investigated by CAPS analysis.
Theor. Appl. Genet.
114
:
1039
1050
.
39
Nakamura
Y.
,
Gojobori
T.
,
Ikemura
T.
.
2000
.
Codon usage tabulated from international DNA sequence databases: status for the year 2000.
Nucleic Acids Res.
28
:
292
.
40
Livak
K. J.
,
Schmittgen
T. D.
.
2001
.
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods
25
:
402
408
.
41
Kozak
M.
1986
.
Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.
Cell
44
:
283
292
.
42
Swimmer
C.
,
Shenk
T.
.
1985
.
Selection of sequence elements that substitute for the standard AATAAA motif which signals 3′ processing and polyadenylation of late simian virus 40 mRNAs.
Nucleic Acids Res.
13
:
8053
8063
.
43
Wu
Q.
,
Krainer
A. R.
.
1996
.
U1-mediated exon definition interactions between AT-AC and GT-AG introns.
Science
274
:
1005
1008
.
44
Long
M.
,
Rosenberg
C.
,
Gilbert
W.
.
1995
.
Intron phase correlations and the evolution of the intron/exon structure of genes.
Proc. Natl. Acad. Sci. USA
92
:
12495
12499
.
45
Hawken
R. J.
,
Murtaugh
J.
,
Flickinger
G. H.
,
Yerle
M.
,
Robic
A.
,
Milan
D.
,
Gellin
J.
,
Beattie
C. W.
,
Schook
L. B.
,
Alexander
L. J.
.
1999
.
A first-generation porcine whole-genome radiation hybrid map.
Mamm. Genome
10
:
824
830
.
46
Engelman
J. A.
,
Zhang
X. L.
,
Lisanti
M. P.
.
1998
.
Genes encoding human caveolin-1 and -2 are co-localized to the D7S522 locus (7q31.1), a known fragile site (FRA7G) that is frequently deleted in human cancers.
FEBS Lett.
436
:
403
410
.
47
Goureau
A.
,
Yerle
M.
,
Schmitz
A.
,
Riquet
J.
,
Milan
D.
,
Pinton
P.
,
Frelat
G.
,
Gellin
J.
.
1996
.
Human and porcine correspondence of chromosome segments using bidirectional chromosome painting.
Genomics
36
:
252
262
.
48
Edwards
D. B.
,
Ernst
C. W.
,
Raney
N. E.
,
Doumit
M. E.
,
Hoge
M. D.
,
Bates
R. O.
.
2008
.
Quantitative trait locus mapping in an F2 Duroc x Pietrain resource population: II. Carcass and meat quality traits.
J. Anim. Sci.
86
:
254
266
.
49
Glenney
J. R.
 Jr
1992
.
The sequence of human caveolin reveals identity with VIP21, a component of transport vesicles.
FEBS Lett.
314
:
45
48
.
50
Glenney
J. R.
 Jr.
,
Soppet
D.
.
1992
.
Sequence and expression of caveolin, a protein component of caveolae plasma membrane domains phosphorylated on tyrosine in Rous sarcoma virus-transformed fibroblasts.
Proc. Natl. Acad. Sci. USA
89
:
10517
10521
.
51
Engelman
J. A.
,
Zhang
X. L.
,
Lisanti
M. P.
.
1999
.
Sequence and detailed organization of the human caveolin-1 and -2 genes located near the D7S522 locus (7q31.1). Methylation of a CpG island in the 5′ promoter region of the caveolin-1 gene in human breast cancer cell lines.
FEBS Lett.
448
:
221
230
.
52
Fra
A. M.
,
Pasqualetto
E.
,
Mancini
M.
,
Sitia
R.
.
2000
.
Genomic organization and transcriptional analysis of the human genes coding for caveolin-1 and caveolin-2.
Gene
243
:
75
83
.
53
Kogo
H.
,
Fujimoto
T.
.
2000
.
Caveolin-1 isoforms are encoded by distinct mRNAs. Identification Of mouse caveolin-1 mRNA variants caused by alternative transcription initiation and splicing.
FEBS Lett.
465
:
119
123
.
54
Razani
B.
,
Park
D. S.
,
Miyanaga
Y.
,
Ghatpande
A.
,
Cohen
J.
,
Wang
X. B.
,
Scherer
P. E.
,
Evans
T.
,
Lisanti
M. P.
.
2002
.
Molecular cloning and developmental expression of the caveolin gene family in the amphibian Xenopus laevis.
Biochemistry
41
:
7914
7924
.
55
Fang
P. K.
,
Solomon
K. R.
,
Zhuang
L.
,
Qi
M.
,
McKee
M.
,
Freeman
M. R.
,
Yelick
P. C.
.
2006
.
Caveolin-1alpha and -1beta perform nonredundant roles in early vertebrate development.
Am. J. Pathol.
169
:
2209
2222
.
56
Tang
Z.
,
Okamoto
T.
,
Boontrakulpoontawee
P.
,
Katada
T.
,
Otsuka
A. J.
,
Lisanti
M. P.
.
1997
.
Identification, sequence, and expression of an invertebrate caveolin gene family from the nematode Caenorhabditis elegans. Implications for the molecular evolution of mammalian caveolin genes.
J. Biol. Chem.
272
:
2437
2445
.
57
Scherer
P. E.
,
Tang
Z.
,
Chun
M.
,
Sargiacomo
M.
,
Lodish
H. F.
,
Lisanti
M. P.
.
1995
.
Caveolin isoforms differ in their N-terminal protein sequence and subcellular distribution. Identification and epitope mapping of an isoform-specific monoclonal antibody probe.
J. Biol. Chem.
270
:
16395
16401
.
58
Hernandez
N.
1993
.
TBP, a universal eukaryotic transcription factor?
Genes Dev.
7
(
7B
):
1291
1308
.
59
Smale
S. T.
1997
.
Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes.
Biochim. Biophys. Acta
1351
:
73
88
.
60
Kozak
M.
1987
.
An analysis of 5′-noncoding sequences from 699 vertebrate messenger RNAs.
Nucleic Acids Res.
15
:
8125
8148
.
61
Kozak
M.
1984
.
Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo.
Nature
308
:
241
246
.
62
Medina
F. A.
,
Williams
T. M.
,
Sotgia
F.
,
Tanowitz
H. B.
,
Lisanti
M. P.
.
2006
.
A novel role for caveolin-1 in B lymphocyte function and the development of thymus-independent immune responses.
Cell Cycle
5
:
1865
1871
.
63
Chidlow
J. H.
 Jr.
,
Greer
J. J.
,
Anthoni
C.
,
Bernatchez
P.
,
Fernadez-Hernando
C.
,
Bruce
M.
,
Abdelbaqi
M.
,
Shukla
D.
,
Granger
D. N.
,
Sessa
W. C.
,
Kevil
C. G.
.
2009
.
Endothelial caveolin-1 regulates pathologic angiogenesis in a mouse model of colitis.
Gastroenterology
136
:
575
584
.
e572
.
64
Kimchi-Sarfaty
C.
,
Oh
J. M.
,
Kim
I. W.
,
Sauna
Z. E.
,
Calcagno
A. M.
,
Ambudkar
S. V.
,
Gottesman
M. M.
.
2007
.
A “silent” polymorphism in the MDR1 gene changes substrate specificity.
Science
315
:
525
528
.
65
van Golen
K. L.
2006
.
Is caveolin-1 a viable therapeutic target to reduce cancer metastasis?
Expert Opin. Ther. Targets
10
:
709
721
.
66
Engelman
J. A.
,
Zhang
X. L.
,
Razani
B.
,
Pestell
R. G.
,
Lisanti
M. P.
.
1999
.
p42/44 MAP kinase-dependent and -independent signaling pathways regulate caveolin-1 gene expression. Activation of Ras-MAP kinase and protein kinase a signaling cascades transcriptionally down-regulates caveolin-1 promoter activity.
J. Biol. Chem.
274
:
32333
32341
.
67
Wang
X. M.
,
Kim
H. P.
,
Song
R.
,
Choi
A. M.
.
2006
.
Caveolin-1 confers antiinflammatory effects in murine macrophages via the MKK3/p38 MAPK pathway.
Am. J. Respir. Cell Mol. Biol.
34
:
434
442
.
68
Lei
M. G.
,
Morrison
D. C.
.
2000
.
Differential expression of caveolin-1 in lipopolysaccharide-activated murine macrophages.
Infect. Immun.
68
:
5084
5089
.
69
Tiruppathi
C.
,
Shimizu
J.
,
Miyawaki-Shimizu
K.
,
Vogel
S. M.
,
Bair
A. M.
,
Minshall
R. D.
,
Predescu
D.
,
Malik
A. B.
.
2008
.
Role of NF-kappaB-dependent caveolin-1 expression in the mechanism of increased endothelial permeability induced by lipopolysaccharide.
J. Biol. Chem.
283
:
4210
4218
.
70
van den Heuvel
A. P.
,
Schulze
A.
,
Burgering
B. M.
.
2005
.
Direct control of caveolin-1 expression by FOXO transcription factors.
Biochem. J.
385
:
795
802
.
71
Garrean
S.
,
Gao
X. P.
,
Brovkovych
V.
,
Shimizu
J.
,
Zhao
Y. Y.
,
Vogel
S. M.
,
Malik
A. B.
.
2006
.
Caveolin-1 regulates NF-kappaB activation and lung inflammatory response to sepsis induced by lipopolysaccharide.
J. Immunol.
177
:
4853
4860
.
72
Del Galdo
F.
,
Lisanti
M. P.
,
Jimenez
S. A.
.
2008
.
Caveolin-1, transforming growth factor-beta receptor internalization, and the pathogenesis of systemic sclerosis.
Curr. Opin. Rheumatol.
20
:
713
719
.
73
Del Galdo
F.
,
Sotgia
F.
,
de Almeida
C. J.
,
Jasmin
J. F.
,
Musick
M.
,
Lisanti
M. P.
,
Jiménez
S. A.
.
2008
.
Decreased expression of caveolin 1 in patients with systemic sclerosis: crucial role in the pathogenesis of tissue fibrosis.
Arthritis Rheum.
58
:
2854
2865
.
74
Ge
S.
,
Pachter
J. S.
.
2004
.
Caveolin-1 knockdown by small interfering RNA suppresses responses to the chemokine monocyte chemoattractant protein-1 by human astrocytes.
J. Biol. Chem.
279
:
6688
6695
.
75
Jasmin
J. F.
,
Malhotra
S.
,
Singh Dhallu
M.
,
Mercier
I.
,
Rosenbaum
D. M.
,
Lisanti
M. P.
.
2007
.
Caveolin-1 deficiency increases cerebral ischemic injury.
Circ. Res.
100
:
721
729
.
76
Trushina
E.
,
Du Charme
J.
,
Parisi
J.
,
McMurray
C. T.
.
2006
.
Neurological abnormalities in caveolin-1 knock out mice.
Behav. Brain Res.
172
:
24
32
.
77
Stear
M. J.
,
Bishop
S. C.
,
Mallard
B. A.
,
Raadsma
H.
.
2001
.
The sustainability, feasibility and desirability of breeding livestock for disease resistance.
Res. Vet. Sci.
71
:
1
7
.
78
Clapperton
M.
,
Bishop
S. C.
,
Glass
E. J.
.
2005
.
Innate immune traits differ between Meishan and Large White pigs.
Vet. Immunol. Immunopathol.
104
:
131
144
.
79
Gogolin-Ewens
K. J.
,
Meeusen
E. N.
,
Scott
P. C.
,
Adams
T. E.
,
Brandon
M. R.
.
1990
.
Genetic selection for disease resistance and traits of economic importance in animal production.
Rev. - Off. Int. Epizoot.
9
:
865
896
.

The authors have no financial conflicts of interest.