The Down syndrome (DS) immune phenotype is characterized by thymus hypotrophy, higher propensity to organ-specific autoimmune disorders, and higher susceptibility to infections, among other features. Considering that AIRE (autoimmune regulator) is located on 21q22.3, we analyzed protein and gene expression in surgically removed thymuses from 14 DS patients with congenital heart defects, who were compared with 42 age-matched controls with heart anomaly as an isolated malformation. Immunohistochemistry revealed 70.48 ± 49.59 AIRE-positive cells/mm2 in DS versus 154.70 ± 61.16 AIRE-positive cells/mm2 in controls (p < 0.0001), and quantitative PCR as well as DNA microarray data confirmed those results. The number of FOXP3-positive cells/mm2 was equivalent in both groups. Thymus transcriptome analysis showed 407 genes significantly hypoexpressed in DS, most of which were related, according to network transcriptional analysis (FunNet), to cell division and to immunity. Immune response-related genes included those involved in 1) Ag processing and presentation (HLA-DQB1, HLA-DRB3, CD1A, CD1B, CD1C, ERAP) and 2) thymic T cell differentiation (IL2RG, RAG2, CD3D, CD3E, PRDX2, CDK6) and selection (SH2D1A, CD74). It is noteworthy that relevant AIRE-partner genes, such as TOP2A, LAMNB1, and NUP93, were found hypoexpressed in DNA microarrays and quantitative real-time PCR analyses. These findings on global thymic hypofunction in DS revealed molecular mechanisms underlying DS immune phenotype and strongly suggest that DS immune abnormalities are present since early development, rather than being a consequence of precocious aging, as widely hypothesized. Thus, DS should be considered as a non-monogenic primary immunodeficiency.

Down syndrome (DS) represents the most common chromosomal disorder (∼1 in 700 live births) and results from total or partial trisomy of chromosome 21 (13). DS is associated with several complex clinical features including immunological abnormalities (48), and it has long been noticed that patients present abnormal thymuses, characterized by lymphocyte depletion, cortical atrophy, and loss of corticomedullary demarcation (9, 10). In addition to higher susceptibility to infections—as evidenced during the H1N1 2009 pandemic where the likelihood of death was 300 times greater for DS patients (11)—DS is characterized by increased frequency of organ-specific autoimmune disorders and of lymphoid and myeloid leukemias, contrasting with a decreased risk for allergic diseases, particularly asthma (12, 13). Compared with the general population, the incidence of celiac disease, insulin-dependent diabetes mellitus, and hypothyroidism is, respectively 10–40, 6, and 4 times higher in DS patients, but Addison’s disease, pernicious anemia, alopecia areata, vitiligo, and chronic hepatitis have also been reported (12, 1416). This range of autoimmune disorders is reminiscent of autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy (APECED), as are autoantibody reactivity patterns (17), and there is increased susceptibility to oral candidiasis (18) in APECED and DS. APECED is a monogenic disorder caused by loss-of-function mutations in AIRE (autoimmune regulator) (19, 20), which is located on 21q22.3.

In the search for the molecular basis for clinical features in DS patients, we have studied AIRE expression in DS thymus compared with that in age-matched individuals with heart defects as an isolated congenital malformation. We also studied global gene expression and transcriptional networks in thymuses of DS patients and controls, and we now report the finding that AIRE expression in DS thymic medullary epithelial cells is significantly reduced, data that were confirmed by quantitative PCR (qPCR). Additionally, the current analysis showed hypoexpression of genes related to immune response and to cell proliferation in DS thymus.

Thymic tissues (corticomedullary sections) were collected between 2007 and 2010 from 14 DS (all with simple trisomy 21) infants and children (4 mo to 12 y old), all with congenital heart defects. These DS patients are being followed up: one died a few weeks after the surgery because of infectious complications; another developed Hashimoto thyroiditis at 3 y old. Control samples (42 thymuses) were from age-matched individuals with heart anomalies but no clinical signs of any other congenital malformation. All samples were collected during corrective cardiac surgery at the Hospital do Coração–Associação do Sanatório Sírio (São Paulo, Brazil). No tissue was removed for research purposes only. This study was approved by the hospital’s ethics committee, and informed consent from the parents of all participating individuals was obtained.

Small pieces of each thymus were fixed in 10% neutral buffered formalin and processed into paraffin blocks. Thymus sections (4 μm) were deparaffinized and rehydrated through graded alcohols to water. For antigenic retrieval, sections were microwave-treated at 800 W in 10 mM Tris–EDTA buffer at pH 8 for 15 min and allowed to cool for 15 min. After washed in running tap water for 5 min, tissue endogenous peroxidase was inhibited with a solution of 3% H2O2 for 10 min at room temperature. Unspecific binding sites were blocked by incubation with 5% BSA (Sigma) diluted in 10 mM PBS pH 7.4 for 10 min. Slides were incubated overnight at 4°C with a polyclonal rabbit anti-AIRE serum (sc-33188; Santa Cruz Biotechnology, Santa Cruz, CA) and with an affinity purified rat anti-human anti-FOXP3 14-4776-82 (eBioscience, San Diego, CA). Primary Ab was blown off, and the slides were then incubated with the Universal LSAB+ Kit/HRP (DakoCytomation, Carpinteria, CA). The reaction was developed with the substrate in 3,3′ diaminobenzidine chromogen. Tissue samples from DS patients and controls were processed simultaneously. Double immunohistochemistry staining was performed after completion of the single staining protocol. Sections were sequentially incubated with 5% BSA for 10 min, monoclonal mouse anti-cytokeratin (clone AE1/AE3; DakoCytomation) diluted in PBS containing 0.1% BSA overnight at 4°C, and then with the Universal LSAB+ Kit/AP (DakoCytomation). Revelation was performed using the alkaline phosphatase permanent red chromogen. After the single or double protocol, the tissues were counterstained with Mayer’s hematoxylin.

Epithelial cells expressing nuclear AIRE or thymocytes expressing FOXP3 were identified and quantified using a light microscope. For 15 random areas of the medullary region of each thymus, the number of positive cells per square millimeter was determined using an integration graticule (Carl Zeiss 4740680000000 Netzmikrometer 12.5×) under ×400 magnification. Counting of positive cells was performed in a blinded fashion independently by two pathologists. Statistical analysis was initially performed with the Shapiro–Wilk normality test to determine whether the data were consistent with a normal distribution. Groups were compared using the two-tailed Student t test for unpaired data. Correlation coefficients were calculated using the Pearson correlation (r) test. The p values <0.05 were considered statistically significant. All statistical tests were performed using GraphPad Prism software.

Obtention of thymic RNA.

Fresh ex vivo explants from the thymuses of four DS and four control patients, all of them <2 y old, were collected at the operating room and immediately immersed into RNAlater RNA Stabilization Reagent (cat. no. 76104; Qiagen, Valencia, CA). RNA was extracted from tissue fragments using the RNeasy Lipid Tissue Mini Kit according to the manufacturer’s instructions (cat. no. 74804; Qiagen).

Microarray hybridization and gene expression analysis.

To determine gene expression profiles, 44 K DNA microarrays (cat. no. G4845A; Agilent Technologies, Santa Clara, CA) were used. The procedures for hybridization followed the protocols provided by the manufacturer’s instructions (One-Color Microarray-Based Gene Quick Amp Labeling).

Expression analysis.

The images were captured by the reader Agilent Bundle according to the parameters recommended for bioarrays and were extracted by Agilent Feature Extraction software version 9.5.3. Among the 45,015 spots present in each array, only those with none or only one flag (i.e., low intensity, saturation, controls, etc.) were selected for analysis using the R software version 2.9.2 (R Development Core Team). By means of the TMEV software version 4.4.1 (21), we selected as differentially expressed transcripts those presenting a p value ≤0.05 (Student t test and adjusted Bonferroni correction) and fold variation of ±2. Hierarchical clustering was based on Pearson correlation and complete linkage. The significance analysis of microarrays (SAM) procedure (22) was used with a false discovery ratio of zero.

Transcriptional interaction analyses (gene ontology and network analysis).

We used the FunNet software—based on the Gene Ontology Consortium (http://www.geneontology.org) and on the Kyoto Encyclopedia of Genes and Genomes (http://www.genome.jp/kegg) genomic annotations—for performing the functional profiling of gene expression data and identifying the biological themes in which the differentially expressed genes are involved. Themes with significant relationship in the transcriptional expression space were associated to build transcriptional modules in a proximity network. A transcriptional interaction network, corresponding with the theme proximity network, was then obtained (http://www.funnet.info).

qPCR.

Differential gene expression data were validated through qPCR. Specific primers for AIRE and five other selected genes (Table I) were designed using Primer-BLAST (Primer3 Input, version 0.4.0, and BLAST, available at http://www.ncbi.nlm.nih.gov/tools/primer-blast/). All thymus RNA samples were amplified in triplicate. Amplification reactions were performed in a 25-μl final volume containing 1× SYBR Green mix (Quantitec SYBR Green PCR kit; Qiagen, Hilden, DE), 10 pmol of each primer, and 2 μl cDNA (1:10 dilution, synthesized from 1 μg of total RNA). Real-time PCR amplifications were performed in an Applied Biosystems StepOne Plus Real Time PCR System with StepOne software (Applied Biosystems, Foster City, CA) with the following cycling parameters: an initial hot start of 95°C for 15 min followed by 50 cycles of 95°C for 15 s and 60°C for 30 s. To normalize qPCR reactions, GAPDH was included as reference gene after checking that amplification curves for RNA samples obtained from five DS thymuses (four from our patients and one additional DS thymus sample kindly provided by Instituto de Medicina Integral de Pernambuco, Recife, PE, Brazil) and six control thymuses (four from our controls and two additional samples provided by Instituto de Medicina Integral de Pernambuco) yielded essentially the same results. Relative expression was determined by the relative standard curve method and presented as fold-change comparing DS versus control mean values.

Table I.
Primers used in the qPCR assays with their sequences and respective product length
GeneForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)Product Length (bp)
AIRE ACCGGGTTTTCTTCCCAATA AGAGACGCCCATGCAGACT 224 
CDK6 TGGAGTGTTGGCTGCATATT ACAGGGCACTGTAGGCAGAT 260 
LMNB1 CTGGCGAAGATGTGAAGGTT TCTGAGAAGGCTCTGCACTG 268 
NUP93 TCAGGCACAACCTCTCAGAA CCACAAAGCATGGCACTTAAT 254 
PCNA GAATTCCAGAACAGGAGTACAGC TTCAGGTACCTCAGTGCAAAAG 258 
TOP2A GCTGCCCCAAAAGGAACTA TAGGTTTCTTTGCCCGTACA 251 
GeneForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)Product Length (bp)
AIRE ACCGGGTTTTCTTCCCAATA AGAGACGCCCATGCAGACT 224 
CDK6 TGGAGTGTTGGCTGCATATT ACAGGGCACTGTAGGCAGAT 260 
LMNB1 CTGGCGAAGATGTGAAGGTT TCTGAGAAGGCTCTGCACTG 268 
NUP93 TCAGGCACAACCTCTCAGAA CCACAAAGCATGGCACTTAAT 254 
PCNA GAATTCCAGAACAGGAGTACAGC TTCAGGTACCTCAGTGCAAAAG 258 
TOP2A GCTGCCCCAAAAGGAACTA TAGGTTTCTTTGCCCGTACA 251 

AIRE immunoreactivity was observed in nuclei of epithelial cells located in the medullary region, some of them around Hassall’s corpuscles (Fig. 1A–D). AIRE-positive cells were marked as epithelial by costaining with a cytokeratin-specific Ab (Fig. 1E, 1F). The number of AIRE protein-expressing epithelial cells in thymic medulla of DS patients (70.48 ± 49.6 cells/mm2; n = 14) was significantly lower (p < 0.0001) than that in the thymic medulla of the control group (154.70 ± 61.2 cells/mm2; n = 42), these differences being more marked in infants (Fig. 2, Supplemental Fig. 1).

FIGURE 1.

Representative illustrations of AIRE immunoreactivity (brown color) in thymic specimens from a control patient (A) and a DS patient (B). Nuclear AIRE is strongly stained in several cells of the thymic medullary region of control patients. C and D, Double-staining AIRE immunofluorescence (green color) in thymic specimens from a control patient (C) and a DS patient (D). AD, Original magnification ×200 (inset, original magnification ×400). E and F, Double-staining immunohistochemistry for AIRE (brown color) and cytokeratin (reddish) showing an AIRE-positive (E) and an AIRE-negative (F) epithelial cell (original magnification ×1,000).

FIGURE 1.

Representative illustrations of AIRE immunoreactivity (brown color) in thymic specimens from a control patient (A) and a DS patient (B). Nuclear AIRE is strongly stained in several cells of the thymic medullary region of control patients. C and D, Double-staining AIRE immunofluorescence (green color) in thymic specimens from a control patient (C) and a DS patient (D). AD, Original magnification ×200 (inset, original magnification ×400). E and F, Double-staining immunohistochemistry for AIRE (brown color) and cytokeratin (reddish) showing an AIRE-positive (E) and an AIRE-negative (F) epithelial cell (original magnification ×1,000).

Close modal
FIGURE 2.

Numbers of AIRE-positive cells/mm2 in the thymic medullary region of DS and control groups. A, Infants (<1 y old). B, Children. DS patients from both age groups present significantly lower numbers of AIRE-positive cells/mm2.

FIGURE 2.

Numbers of AIRE-positive cells/mm2 in the thymic medullary region of DS and control groups. A, Infants (<1 y old). B, Children. DS patients from both age groups present significantly lower numbers of AIRE-positive cells/mm2.

Close modal

There was no significant difference in the numbers of FOXP3-positive thymocytes in thymic medulla of both groups: 824.4 ± 483.5 cells/mm2 in DS (n = 14) and 617.0 ± 245.4 cells/mm2 in controls (n = 35). Whereas the numbers of AIRE- and FOXP3-positive cells were not correlated in the control group (r = 0.16, p = 0.35, Fig. 3A), a significant positive correlation was found in DS (r = 0.80, p = 0.0005, Fig. 3B). Finally, no significant correlation was found between age and the numbers of either AIRE- or FOXP3-positive cells in both DS and control groups (data not shown).

FIGURE 3.

A and B, Correlation between the number of AIRE-positive cells/mm2 and FOXP3-positive cells/mm2 in thymic medula of control patients (A) and DS patients (B).

FIGURE 3.

A and B, Correlation between the number of AIRE-positive cells/mm2 and FOXP3-positive cells/mm2 in thymic medula of control patients (A) and DS patients (B).

Close modal

We identified 21,940 valid thymic transcripts using the R program. Microarray data were deposited in the Gene Expression Omnibus public database (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE23910. In the comparison of DS versus controls, a total of 1,238 differentially expressed transcripts were selected using permuted t test, adjusted p value ≤0.05 (Bonferroni), and a fold of ±2. The SAM procedure (22) revealed 407 significantly hypoexpressed genes in the DS group (false discovery ratio = 0), whereas no hyperexpressed gene was observed. Hierarchical clustering showed complete separation between DS and controls (Supplemental Fig. 2). Overlap analysis (SAM and t test data), performed by means of the TMEV 4.4.1 program, yielded 156 hypoexpressed genes. The AIRE gene was not found significantly hypoexpressed in this analysis (fold of −1.87).

This analysis was accomplished using SAM-selected differentially expressed genes and the FunNet software. The strength of the links between each pair of genes is given by Pearson’s correlation coefficient of expression profiles. From a total of 13,041 links, we selected the 654 links with a value above the third quartile (0.949).

A graphical representation of the functional gene profile according to gene ontology (GO) biological processes is shown in Fig. 4. The transcriptional domain coverage (GO categories) shows that the majority of the hypoexpressed genes belong to categories linked to cell cycle/cell proliferation or to immune response. Theme proximity network analysis (Fig. 5) confirms the picture revealed by GO categorization, as essentially two modules appear in this analysis, the first linked to cell division/proliferation and the second encompassing themes relevant to the immune response, such as Ag processing and presentation via MHC class II, T cell differentiation, selection, and activation, among others. The themes “male sex differentiation” and “male somatic sex determination” only encompass the X-linked androgen receptor gene (AR).

FIGURE 4.

Graphical representation of GO biological processes functional profile based on the differentially expressed genes data set.

FIGURE 4.

Graphical representation of GO biological processes functional profile based on the differentially expressed genes data set.

Close modal
FIGURE 5.

Theme proximity network built for GO biological process. Module 1 is represented by triangles and module 2 by squares.

FIGURE 5.

Theme proximity network built for GO biological process. Module 1 is represented by triangles and module 2 by squares.

Close modal

The picture showed in the theme proximity network was confirmed by the transcriptional interaction network analysis (Fig. 6), which depicts genes involved in immune function and in cell division/proliferation as the most frequent gene interactions. Table II shows selected relevant genes per category/function.

FIGURE 6.

Transcriptional interaction network corresponding with the theme proximity network related to GO biological process. Colored circles indicate predominant gene function.

FIGURE 6.

Transcriptional interaction network corresponding with the theme proximity network related to GO biological process. Colored circles indicate predominant gene function.

Close modal
Table II.
Selected relevant genes hypoexpressed in DS thymus displayed by category and function
Gene SymbolGene ProductChromosomal LocationBiological Process (Module 1)Biological Process (Module 2)
KIF23 Kinesin-like protein family 15q23 DNA metabolic process; mitosis; cell division; cell cycle, DNA repair Microtubule-based process 
ZWINT A protein involved in kinetochore function 10q21-q22 Chromosome organization; spindle organization, mitosis; cell division; cell cycle; chromosome segregation; etc. Microtubule-based process 
GRAP2 This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adapter-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. 22q13.2 Cell division, mitosis, Ras protein signal transduction, intracellular signaling cascade — 
PRDX2 Peroxiredoxin family of antioxidant enzymes 19p13.2 Lymphocyte activation; cell proliferation; cell division; regulation of hydrogen peroxide metabolic process; thymus development; T cell differentiation; regulation of lymphocyte activation; homeostasis of number of cells Regulation of T cell activation; immune response; negative regulation of T cell differentiation 
PRSS16 Serine protease expressed exclusively in the thymus 6p21 Nucleotide binding — 
IL2RG IL-2R, γ Xq13.1 Lymphocyte activation; cell division; mitosis; interspecies interaction between organism; T cell activation Regulation of T cell activation; positive regulation of immune system process; immune response 
RAG2 This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development 11p3 DNA metabolic process, cell proliferation, cell division, mitosis, T cell differentiation, DNA recombination B cell homeostatic proliferation, immune response 
SH2D1A Role in the bidirectional stimulation of T and B cells Xq25-q26 Mitosis Positive regulation of immune system process 
CD3D Part of the TCR–CD3 complex 11q23 Lymphocyte activation, cell division, mitosis, T cell differentiation Positive thymic T cell selection, T cell selection 
CD3E CD3-ε polypeptide 11q23 Cell proliferation; protein amino acid phosphorylation; lymphocyte activation; T cell differentiation Negative thymic T cell selection; T cell selection 
HLA-DRB3 HLA-DRB3 belongs to the HLA class II β-chain paralogs. This class II molecule is a heterodimer consisting of an α (DRA) and a β (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. 6p21.3 Mitosis Immune response, Ag processing and presentation 
HLA-DQB1 HLA-DQB1 belongs to the HLA class II β-chain paralogs 6p21.3 Cell division, mitosis Ag processing and presentation of peptide or polysaccharide Ag via MHC class II, Ag processing and presentation 
CD1A CD1 family of transmembrane glycoproteins 1q22-q23 Cell division, mitosis Ag processing and presentation 
CD1B CD1 family of transmembrane glycoproteins 1q22-q23 Cell division Immune response; Ag processing and presentation 
CD1C CD1 family of transmembrane glycoproteins 1q22-q23 Mitosis; cell division Immune response; Ag processing and presentation 
CD1D CD1 family of transmembrane glycoproteins 1q22-q23 Lymphocyte activation; mitosis; interspecies interaction between organisms; T cell differentiation Ag processing and presentation of endogenous Ag; immune response; T cell selection; Ag processing and presentation 
CD74 CD74 molecule, MHC class II invariant chain 5q32 Mitosis, intracellular signaling cascade, protein amino acid phosphorylation, lymphocyte activation, cell proliferation, cell division Ag processing and presentation of endogenous Ag, positive regulation of immune system process, positive regulation of immune system process, regulation of T cell activation, negative thymic T cell selection, immune response, positive thymic T cell selection, T cell selection 
TOP2A Topoisomerase (DNA) II α. This gene is an AIRE partner and encodes a DNA topoisomerase that controls and alters the topologic states of DNA during transcription. 17q21-q22 DNA replication, intracellular signaling cascade Positive regulation of retroviral genome replication 
LCK Protein tyrosine kinases 1p34.3 Protein amino acid phosphorylation; cell division; mitosis; positive regulation of TCR signaling pathway; interspecies interaction between organisms; TCR signaling pathway Positive regulation of immune system process; regulation of T cell activation; immune response 
LAT Linker for activation of T cells 16p11.2 Lymphocyte activation; cell division; mitosis; RAS protein signal transduction; regulation of lymphocyte activation; intracellular signaling cascade Regulation of T cell activation; immune response 
ERAP2 ERAP1 (MIM 606832) and LRAP to trim precursors to antigenic peptides in the endoplasmic reticulum 5q15 Cell division, mitosis Ag processing and presentation of endogenous Ag, immune response 
IKZF1 Family zinc finger 1 7p13-p11.1 T cell differentiation, regulation of lymphocyte activation, lymphocyte activation Positive regulation of immune system process, regulation of T cell activation 
SLAMF1 Signaling lymphocytic activation molecule family member 1 1q22-q23 Interspecies interaction between organisms, lymphocyte activation, cell proliferation, cell division, mitosis — 
CXCR4 CXCR specific for stromal cell-derived factor-1 2q21 Mitosis, interspecies interaction between organisms, intracellular signaling cascade, cell division Immune response 
CHEK1 CHK1 checkpoint homolog (S. pombe11q24-q24 Cell proliferation, cell division, mitosis, meiosis, cell cycle Meiosis 
FEN1 DNA repair and processes the 5′ ends of Okazaki fragments in lagging strand DNA synthesis 11q12 Cell division, mitosis — 
CCNB2 Cyclin family 15q22.2 Cell division, mitosis, cell cycle, thymus development — 
MLF1IP Specialized chromatin domain 4q35.1 Mitosis, interspecies interaction between organisms, cell division — 
E2F7 Plays an essential role in the regulation of cell cycle progression 12q21.2 Cell proliferation — 
Gene SymbolGene ProductChromosomal LocationBiological Process (Module 1)Biological Process (Module 2)
KIF23 Kinesin-like protein family 15q23 DNA metabolic process; mitosis; cell division; cell cycle, DNA repair Microtubule-based process 
ZWINT A protein involved in kinetochore function 10q21-q22 Chromosome organization; spindle organization, mitosis; cell division; cell cycle; chromosome segregation; etc. Microtubule-based process 
GRAP2 This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adapter-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. 22q13.2 Cell division, mitosis, Ras protein signal transduction, intracellular signaling cascade — 
PRDX2 Peroxiredoxin family of antioxidant enzymes 19p13.2 Lymphocyte activation; cell proliferation; cell division; regulation of hydrogen peroxide metabolic process; thymus development; T cell differentiation; regulation of lymphocyte activation; homeostasis of number of cells Regulation of T cell activation; immune response; negative regulation of T cell differentiation 
PRSS16 Serine protease expressed exclusively in the thymus 6p21 Nucleotide binding — 
IL2RG IL-2R, γ Xq13.1 Lymphocyte activation; cell division; mitosis; interspecies interaction between organism; T cell activation Regulation of T cell activation; positive regulation of immune system process; immune response 
RAG2 This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development 11p3 DNA metabolic process, cell proliferation, cell division, mitosis, T cell differentiation, DNA recombination B cell homeostatic proliferation, immune response 
SH2D1A Role in the bidirectional stimulation of T and B cells Xq25-q26 Mitosis Positive regulation of immune system process 
CD3D Part of the TCR–CD3 complex 11q23 Lymphocyte activation, cell division, mitosis, T cell differentiation Positive thymic T cell selection, T cell selection 
CD3E CD3-ε polypeptide 11q23 Cell proliferation; protein amino acid phosphorylation; lymphocyte activation; T cell differentiation Negative thymic T cell selection; T cell selection 
HLA-DRB3 HLA-DRB3 belongs to the HLA class II β-chain paralogs. This class II molecule is a heterodimer consisting of an α (DRA) and a β (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. 6p21.3 Mitosis Immune response, Ag processing and presentation 
HLA-DQB1 HLA-DQB1 belongs to the HLA class II β-chain paralogs 6p21.3 Cell division, mitosis Ag processing and presentation of peptide or polysaccharide Ag via MHC class II, Ag processing and presentation 
CD1A CD1 family of transmembrane glycoproteins 1q22-q23 Cell division, mitosis Ag processing and presentation 
CD1B CD1 family of transmembrane glycoproteins 1q22-q23 Cell division Immune response; Ag processing and presentation 
CD1C CD1 family of transmembrane glycoproteins 1q22-q23 Mitosis; cell division Immune response; Ag processing and presentation 
CD1D CD1 family of transmembrane glycoproteins 1q22-q23 Lymphocyte activation; mitosis; interspecies interaction between organisms; T cell differentiation Ag processing and presentation of endogenous Ag; immune response; T cell selection; Ag processing and presentation 
CD74 CD74 molecule, MHC class II invariant chain 5q32 Mitosis, intracellular signaling cascade, protein amino acid phosphorylation, lymphocyte activation, cell proliferation, cell division Ag processing and presentation of endogenous Ag, positive regulation of immune system process, positive regulation of immune system process, regulation of T cell activation, negative thymic T cell selection, immune response, positive thymic T cell selection, T cell selection 
TOP2A Topoisomerase (DNA) II α. This gene is an AIRE partner and encodes a DNA topoisomerase that controls and alters the topologic states of DNA during transcription. 17q21-q22 DNA replication, intracellular signaling cascade Positive regulation of retroviral genome replication 
LCK Protein tyrosine kinases 1p34.3 Protein amino acid phosphorylation; cell division; mitosis; positive regulation of TCR signaling pathway; interspecies interaction between organisms; TCR signaling pathway Positive regulation of immune system process; regulation of T cell activation; immune response 
LAT Linker for activation of T cells 16p11.2 Lymphocyte activation; cell division; mitosis; RAS protein signal transduction; regulation of lymphocyte activation; intracellular signaling cascade Regulation of T cell activation; immune response 
ERAP2 ERAP1 (MIM 606832) and LRAP to trim precursors to antigenic peptides in the endoplasmic reticulum 5q15 Cell division, mitosis Ag processing and presentation of endogenous Ag, immune response 
IKZF1 Family zinc finger 1 7p13-p11.1 T cell differentiation, regulation of lymphocyte activation, lymphocyte activation Positive regulation of immune system process, regulation of T cell activation 
SLAMF1 Signaling lymphocytic activation molecule family member 1 1q22-q23 Interspecies interaction between organisms, lymphocyte activation, cell proliferation, cell division, mitosis — 
CXCR4 CXCR specific for stromal cell-derived factor-1 2q21 Mitosis, interspecies interaction between organisms, intracellular signaling cascade, cell division Immune response 
CHEK1 CHK1 checkpoint homolog (S. pombe11q24-q24 Cell proliferation, cell division, mitosis, meiosis, cell cycle Meiosis 
FEN1 DNA repair and processes the 5′ ends of Okazaki fragments in lagging strand DNA synthesis 11q12 Cell division, mitosis — 
CCNB2 Cyclin family 15q22.2 Cell division, mitosis, cell cycle, thymus development — 
MLF1IP Specialized chromatin domain 4q35.1 Mitosis, interspecies interaction between organisms, cell division — 
E2F7 Plays an essential role in the regulation of cell cycle progression 12q21.2 Cell proliferation — 

—, Not present in Module 2.

Fig. 7 shows qPCR expression fold-changes comparing DS versus control samples for the genes (Table 1) AIRE, 2) TOP2A, LMNB1, and NUP93 (AIRE-target genes), and 3) CDK6 and PCNA (not modulated by AIRE). The results demonstrate downregulation of all these genes in DS thymus and corroborate DNA microarray expression values.

FIGURE 7.

qPCR validation of DNA microarray data. A, Boxplots comparing the DNA microarray expression values of six selected genes in DS (gray) and control (white) samples. B, qPCR expression fold-changes comparing DS with control samples for the same genes showing downregulation in DS. qPCR was performed using RNA samples from five DS patients and six control patients.

FIGURE 7.

qPCR validation of DNA microarray data. A, Boxplots comparing the DNA microarray expression values of six selected genes in DS (gray) and control (white) samples. B, qPCR expression fold-changes comparing DS with control samples for the same genes showing downregulation in DS. qPCR was performed using RNA samples from five DS patients and six control patients.

Close modal

This study revealed for the first time, to our knowledge, reduced thymic expression of a large set of genes that may constitute the basis for the molecular mechanisms underlying the immune disturbances characteristically seen in DS patients: thymus hypotrophy, higher propensity to develop organ-specific autoimmune disorders, and higher susceptibility to infection. Furthermore, DS thymus presents a pattern of widespread gene hypoexpression, which may well result in a hypofunctional thymic environment that characterizes the disease. Our data are in agreement with those of Aït Yahya-Graison et al. (23), who studied gene-expression variation of 136 genes located on chromosome 21 in DS lymphoblastoid cell lines and found that only 29% are expressed proportionally to the genomic-dosage imbalance, the other 71% having their expression “compensated” to normal or below-normal levels. Similar results were found by Prandini et al. (24) studying the gene-expression variation of DS lymphoblastoid and fibroblast cells. Notably, Sommer et al. (25) used serial analysis of gene expression methodology to study dysregulated genes in blood lymphocytes of DS children and found that none of the 30 mostly expressed tags was located on chromosome 21.

Prompted by some similarities between clinical and laboratory immunological features of DS and APECED (17, 2631), we demonstrated reduced expression levels (RNA and protein) of AIRE—a chromosome 21 gene—in DS thymus. This finding corroborates those reported by Aït Yahya-Graison et al. (23), showing that AIRE is one of the chromosome 21 genes with reduced expression due to the trisomic imbalance. AIRE is a transcriptional regulator that commands the ectopic expression of tissue-specific Ags in thymic medullary epithelial cells (3235), a critical mechanism for the selection of T cell repertoire emerging from thymus. AIRE function was largely revealed by APECED, a monogenic condition due to null or hypomorphic AIRE mutations (19, 20, 2629, 31). It is surprising that a rather modest reduction in AIRE expression levels (a third or so) may result in the severe clinical autoimmune disorder manifestations that characterize DS. It had previously been noted, however, that the presence of a functional AIRE allele in heterozygotic individuals does not prevent autoimmune disorder manifestations. An Italian APECED family was described in which all homozygous and heterozygous carriers of an AIRE mutation developed thyroiditis (36). More recently, this particular mutation (G228W) was cloned in a mouse model, and the resulting heterozygous mice developed autoimmunity (37). In short, together with these previous observations, our data indicate that “fine tuning” of thymic tissue-specific Ags expression is crucial in preventing autoimmune diseases. This may be particularly critical at early developmental times, as suggested by our observation of a greater AIRE expression deficit in the first year of life in DS (Fig. 2). It would appear that an “autoimmune condition” is set at these early periods, the “compensation” that occurs later having little effect in correcting it (38). Clearly, not all DS patients present autoimmune disorders, although most show reduced AIRE expression (Figs. 2, 3), suggesting that a pathogenic threshold may be influenced by other factors. Notably, TOP2A, an essential AIRE partner involved in chromatin remodeling and ectopic Ag expression, was also found hypoexpressed in DS thymus, as were three other AIRE partners (39), LMNB1, NUP93, and PCNA, as confirmed by qPCR (Fig. 7). Notably, LMBB1 is positively stimulated in AIRE knockout mice (39), allowing the hypothesis that in DS, AIRE is just one among many hyporegulated genes.

Although some similarities between DS and APECED prompted us to investigate AIRE in DS (and, in fact, we now know that AIRE expression is altered in both conditions), they result from different pathophysiological mechanisms. In APECED, we have an AIRE mutation causing a severe impairment of gene function, whereas in DS, there is a moderate decrease in AIRE expression interplaying with a global thymic gene hypofunction caused by trisomy 21. Nonetheless, it is striking that both conditions show important commonalities regarding organ-specific autoimmune disorders, mainly endocrinopathies, as well as unique autoimmune Ab pattern (12, 17).

The molecular mechanisms regulating AIRE expression to lower-than-control levels in cases of trisomy 21 remain unclear, although a recent study demonstrated that a number of genes are subject to such “trisomic imbalance” (23). Notably, none of the significantly hypoexpressed genes (at the 2-fold level) that we found in this study is located on chromosome 21 (Table II). In contrast, chromosome 21 harbors five micro-RNA genes—miR-99a, let-7c, miR-125b-2, miR-155, and miR-802—that were already found to be overexpressed in the brain and heart of DS individuals (40) and may well exert regulatory effects on many of the genes described in this study. This is the case of miR-155, which regulates the development of regulatory T cells and the innate immune response through downregulation of SOCS1 (41), and of miR-125-b and let-7c, which regulate macrophage responses to various stimuli (42, 43).

Yet, our global gene expression and transcriptional network analyses demonstrated deficient expression of many other genes in DS thymus. Notably, a number of these genes are known to regulate biological processes related to the development/activation of T cells and to the establishment of central tolerance (Figs. 46 and Table II): 1) Ag processing and presentation of Ag via MHC class II (ERAP2, CD1D, HLA-DQB1, HLA-DRB3, CD1A, CD1B, CD1C); 2) thymic T cell selection (CD3D, CD74, CD1D, CD3E), 3) T cell activation (LAT). It follows that susceptibility to organ-specific autoimmune disorder in DS may not be the consequence of deficient AIRE expression only, but owe as well to the reduced expression of other genes involved in critical thymic functions. Altogether, our data reinforce the pivotal role of defective central tolerance in the pathogenesis of DS autoimmune disorders. Thus, the thymus in DS individuals had been reported to be smaller and hypocellular, even in infants, containing a decreased proportion of phenotypically mature TCR-αβ+ thymocytes (6). The number of TRECs and the size of T cell subpopulations (CD4+, CD8+, CD4+CD45+RA cells) in the peripheral blood of DS individuals have been described as reduced at various age groups (4, 6, 7). It was also demonstrated that DS patients present low naive T cell numbers (44). Additionally, DS individuals fail to show the normal, notorious expansion of circulating lymphocyte numbers in the first months of life (45). Our finding that several genes related to cell proliferation (Figs. 46 and Table II) are hypofunctional in DS (1) cell cycle regulation [E2F7]; 2) cell proliferation [ZWINT, KIF23, CHEK1]; 3) DNA replication [FEN1]; 4) homeostasis of number of cells [PRDX2], and 5) thymus development [PRDX2, IKZF1, CCNB2, CDK6]) may be causally related to DS immune phenotype (i.e., thymus hypotrophy and hypocellularity). It is interesting to note that CDK6 was recently found to be essential for thymocyte development (46).

In contrast with the scenario described above, augmented numbers of FOXP3+CD25+ natural regulatory T cells were observed in DS peripheral blood (7), which is in accordance with our data showing normal numbers of FOXP3-positive cells in DS thymus (Fig. 3).

Global gene profiles and transcriptional network analyses presented in this study may also help to understand the higher susceptibility to infections systematically described in DS (5, 6, 12). Thus, mutations of genes that were found hypoexpressed in DS thymus have been associated with severe primary immunodeficiencies (47): IL2RG (X-linked SCID), RAG2, CD3D, CD3E (SCID), and SH2D1A (X-linked lymphoproliferative syndrome). Notably, milder immunodeficiency forms, in which autoimmune manifestations are frequently part of the clinical picture, were also associated with mutations in some of these genes, including IL2RG and RAG (48). Furthermore, other hypoexpressed genes in DS thymus are involved in other biological processes that are also relevant for resistance to infections: 1) positive regulation of neutrophil differentiation (IKZF1), 2) NK cell differentiation (IKZF1), 3) respiratory burst during acute inflammatory response (PRDX2), 4) negative regulation of oxygen and reactive oxygen species metabolic process (PRDX2), among others. Although many such processes are unlikely to occur inside the thymus, hypoexpression due to trisomic imbalance may well result in deficient immune functions in the periphery. This may be the case of the genes categorized as “interspecies interaction between organisms” (i.e., IL2RG, KRT19, LCK, RAN, SGTA, SLAMF1, CXCR4, MLF1IP, CD1D).

It should also be noted that the genes with more interactions (hubs) in the transcriptional network analysis (Fig. 6) were 1) PRDX2, which codes for a member of the peroxiredoxin family of antioxidant enzymes involved in T cell antiviral activity (49) and in thymus development, and was described as hypoexpressed in fetal DS brain (50); 2) GRAP2, which codes for an adapter-like protein involved in leukocyte-specific protein-tyrosine kinase signaling (51); 3) ZWINT, involved in kinetochore function (52); and 4) KIF23, which codes for a kinesin-like protein family involved in chromosome movement during cell division (53).

The current study 1) contributes to the understanding of thymic hypotrophy in DS patients, 2) demonstrates its association with reduced expression of critical genes, probably derived from trisomic imbalance, and 3) strongly suggests that DS typical immune malfunction is owed to impaired central tolerance, possibly due to both decreased AIRE expression and global thymic hypofunction. Thus, our results are in general agreement with the recent proposal by Kusters et al. (6) that “the immune system in DS is intrinsically deficient from the very beginning, and not simply another victim of a generalized process of precocious aging,” as hypothesized by others (7, 8, 54, 55). Altogether, our data indicate that DS is indeed a primary, rather than a secondary, immunodeficiency, contrary to what is largely accepted (47). It would seem, therefore, that DS should well be considered as a non-monogenic primary immunodeficiency (PID). It has largely been recognized that most PIDs are monogenic disorders (47); however, there exist good examples of polygenic PIDs (such as DiGeorge syndrome) that are caused by a deletion encompassing several loci on chromosome 22q11.2 (56).

We are grateful to Prof. Alberto Duarte (Hospital do Coração, Associação Sanatório Sírio de São Paulo) and to Dr. Letícia Watanabe (Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo) for valuable help in selection of patients and to Drs. João Guilherme Bezerra Alves, Fernando Moraes, and Pollyanna Burégio Frota (Instituto de Medicina Integral de Pernambuco) for kindly providing additional thymus samples used for qPCR validation. We thank Dr. Silvia Yumi Bando for valuable technical assistance.

This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo through grants 2008/58238-4 (to M.C.-S.) and 2005/56446-0 (to C.A.M.-F.). F.A.L. was a Fundação de Amparo à Pesquisa do Estado de São Paulo doctoral fellow (2005/60069-8).

The online version of this article contains supplemental material.

Abbreviations used in this article:

     
  • APECED

    autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy

  •  
  • DS

    Down syndrome

  •  
  • GO

    gene ontology

  •  
  • PID

    primary immunodeficiency

  •  
  • qPCR

    quantitative PCR

  •  
  • SAM

    significance analysis of microarrays.

1
Gorlin
R. J.
,
Cohen
M. M.
 Jr.
,
Hennekam
R. C. M.
.
2001
.
Chromosomal syndromes: common and/or well-known syndromes
. In
Syndromes of the Head and Neck
, 4th Ed
Oxford University Press
,
Oxford
, p.
35
44
.
2
Mégarbané
A.
,
Ravel
A.
,
Mircher
C.
,
Sturtz
F.
,
Grattau
Y.
,
Rethoré
M. O.
,
Delabar
J. M.
,
Mobley
W. C.
.
2009
.
The 50th anniversary of the discovery of trisomy 21: the past, present, and future of research and treatment of Down syndrome.
Genet. Med.
11
:
611
616
.
3
Korbel
J. O.
,
Tirosh-Wagner
T.
,
Urban
A. E.
,
Chen
X. N.
,
Kasowski
M.
,
Dai
L.
,
Grubert
F.
,
Erdman
C.
,
Gao
M. C.
,
Lange
K.
, et al
.
2009
.
The genetic architecture of Down syndrome phenotypes revealed by high-resolution analysis of human segmental trisomies.
Proc. Natl. Acad. Sci. USA
106
:
12031
12036
.
4
de Hingh
Y. C.
,
van der Vossen
P. W.
,
Gemen
E. F.
,
Mulder
A. B.
,
Hop
W. C.
,
Brus
F.
,
de Vries
E.
.
2005
.
Intrinsic abnormalities of lymphocyte counts in children with down syndrome.
J. Pediatr.
147
:
744
747
.
5
Garrison
M. M.
,
Jeffries
H.
,
Christakis
D. A.
.
2005
.
Risk of death for children with down syndrome and sepsis.
J. Pediatr.
147
:
748
752
.
6
Kusters
M. A.
,
Verstegen
R. H.
,
Gemen
E. F.
,
de Vries
E.
.
2009
.
Intrinsic defect of the immune system in children with Down syndrome: a review.
Clin. Exp. Immunol.
156
:
189
193
.
7
Roat
E.
,
Prada
N.
,
Lugli
E.
,
Nasi
M.
,
Ferraresi
R.
,
Troiano
L.
,
Giovenzana
C.
,
Pinti
M.
,
Biagioni
O.
,
Mariotti
M.
, et al
.
2008
.
Homeostatic cytokines and expansion of regulatory T cells accompany thymic impairment in children with Down syndrome.
Rejuvenation Res.
11
:
573
583
.
8
da Rosa Utiyama
S. R.
,
Nisihara
R. M.
,
Nass
F. R.
,
Oliveira
N. P.
,
Fiedler
P. T.
,
de Messias-Reason
I. T.
.
2008
.
Autoantibodies in patients with Down syndrome: early senescence of the immune system or precocious markers for immunological diseases?
J. Paediatr. Child Health
44
:
182
186
.
9
Levin
S.
,
Schlesinger
M.
,
Handzel
Z.
,
Hahn
T.
,
Altman
Y.
,
Czernobilsky
B.
,
Boss
J.
.
1979
.
Thymic deficiency in Down’s syndrome.
Pediatrics
63
:
80
87
.
10
Larocca
L. M.
,
Lauriola
L.
,
Ranelletti
F. O.
,
Piantelli
M.
,
Maggiano
N.
,
Ricci
R.
,
Capelli
A.
.
1990
.
Morphological and immunohistochemical study of Down syndrome thymus.
Am. J. Med. Genet. Suppl.
7
(
Suppl.
):
225
230
.
11
Pérez-Padilla
R.
,
Fernández
R.
,
García-Sancho
C.
,
Franco-Marina
F.
,
Aburto
O.
,
López-Gatell
H.
,
Bojórquez
I.
.
2010
.
Pandemic (H1N1) 2009 virus and Down syndrome patients.
Emerg. Infect. Dis.
16
:
1312
1314
.
12
Goldacre
M. J.
,
Wotton
C. J.
,
Seagroatt
V.
,
Yeates
D.
.
2004
.
Cancers and immune related diseases associated with Down’s syndrome: a record linkage study.
Arch. Dis. Child.
89
:
1014
1017
.
13
Hitzler
J. K.
,
Zipursky
A.
.
2005
.
Origins of leukaemia in children with Down syndrome.
Nat. Rev. Cancer
5
:
11
20
.
14
Burch
P. R.
,
Milunsky
A.
.
1969
.
Early-onset diabetes mellitus in the general and Down’s syndrome populations. Genetics, aetiology, and pathogenesis.
Lancet
1
:
554
558
.
15
Shield
J. P.
,
Wadsworth
E. J.
,
Hassold
T. J.
,
Judis
L. A.
,
Jacobs
P. A.
.
1999
.
Is disomic homozygosity at the APECED locus the cause of increased autoimmunity in Down’s syndrome?
Arch. Dis. Child.
81
:
147
150
.
16
Gillespie
K. M.
,
Dix
R. J.
,
Williams
A. J.
,
Newton
R.
,
Robinson
Z. F.
,
Bingley
P. J.
,
Gale
E. A.
,
Shield
J. P.
.
2006
.
Islet autoimmunity in children with Down’s syndrome.
Diabetes
55
:
3185
3188
.
17
Söderbergh
A.
,
Gustafsson
J.
,
Ekwall
O.
,
Hallgren
A.
,
Nilsson
T.
,
Kämpe
O.
,
Rorsman
F.
,
Annerén
G.
.
2006
.
Autoantibodies linked to autoimmune polyendocrine syndrome type I are prevalent in Down syndrome.
Acta Paediatr.
95
:
1657
1660
.
18
Carlstedt
K.
,
Krekmanova
L.
,
Dahllöf
G.
,
Ericsson
B.
,
Braathen
G.
,
Modéer
T.
.
1996
.
Oral carriage of Candida species in children and adolescents with Down’s syndrome.
Int. J. Paediatr. Dent.
6
:
95
100
.
19
Betterle
C.
,
Greggio
N. A.
,
Volpato
M.
.
1998
.
Clinical review 93: autoimmune polyglandular syndrome type 1.
J. Clin. Endocrinol. Metab.
83
:
1049
1055
.
20
Perheentupa
J.
2006
.
Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy.
J. Clin. Endocrinol. Metab.
91
:
2843
2850
.
21
Saeed
A. I.
,
Sharov
V.
,
White
J.
,
Li
J.
,
Liang
W.
,
Bhagabati
N.
,
Braisted
J.
,
Klapa
M.
,
Currier
T.
,
Thiagarajan
M.
, et al
.
2003
.
TM4: a free, open-source system for microarray data management and analysis.
Biotechniques
34
:
374
378
.
22
Tusher
V. G.
,
Tibshirani
R.
,
Chu
G.
.
2001
.
Significance analysis of microarrays applied to the ionizing radiation response.
Proc. Natl. Acad. Sci. USA
98
:
5116
5121
.
23
Aït Yahya-Graison
E. A.
,
Aubert
J.
,
Dauphinot
L.
,
Rivals
I.
,
Prieur
M.
,
Golfier
G.
,
Rossier
J.
,
Personnaz
L.
,
Creau
N.
,
Bléhaut
H.
, et al
.
2007
.
Classification of human chromosome 21 gene-expression variations in Down syndrome: impact on disease phenotypes.
Am. J. Hum. Genet.
81
:
475
491
.
24
Prandini
P.
,
Deutsch
S.
,
Lyle
R.
,
Gagnebin
M.
,
Delucinge Vivier
C.
,
Delorenzi
M.
,
Gehrig
C.
,
Descombes
P.
,
Sherman
S.
,
Dagna Bricarelli
F.
, et al
.
2007
.
Natural gene-expression variation in Down syndrome modulates the outcome of gene-dosage imbalance.
Am. J. Hum. Genet.
81
:
252
263
.
25
Sommer
C. A.
,
Pavarino-Bertelli
E. C.
,
Goloni-Bertollo
E. M.
,
Henrique-Silva
F.
.
2008
.
Identification of dysregulated genes in lymphocytes from children with Down syndrome.
Genome
51
:
19
29
.
26
Finnish-German APECED Consortium
.
1997
.
An autoimmune disease, APECED, caused by mutations in a novel gene featuring two PHD-type zinc-finger domains.
Nat. Genet.
17
:
399
403
.
27
Nagamine
K.
,
Peterson
P.
,
Scott
H. S.
,
Kudoh
J.
,
Minoshima
S.
,
Heino
M.
,
Krohn
K. J.
,
Lalioti
M. D.
,
Mullis
P. E.
,
Antonarakis
S. E.
, et al
.
1997
.
Positional cloning of the APECED gene.
Nat. Genet.
17
:
393
398
.
28
Anderson
M. S.
,
Venanzi
E. S.
,
Klein
L.
,
Chen
Z.
,
Berzins
S. P.
,
Turley
S. J.
,
von Boehmer
H.
,
Bronson
R.
,
Dierich
A.
,
Benoist
C.
,
Mathis
D.
.
2002
.
Projection of an immunological self shadow within the thymus by the aire protein.
Science
298
:
1395
1401
.
29
Villaseñor
J.
,
Benoist
C.
,
Mathis
D.
.
2005
.
AIRE and APECED: molecular insights into an autoimmune disease.
Immunol. Rev.
204
:
156
164
.
30
Carneiro-Sampaio
M.
,
Coutinho
A.
.
2007
.
Tolerance and autoimmunity: lessons at the bedside of primary immunodeficiencies.
Adv. Immunol.
95
:
51
82
.
31
DeVoss
J. J.
,
Anderson
M. S.
.
2007
.
Lessons on immune tolerance from the monogenic disease APS1.
Curr. Opin. Genet. Dev.
17
:
193
200
.
32
Taubert
R.
,
Schwendemann
J.
,
Kyewski
B.
.
2007
.
Highly variable expression of tissue-restricted self-antigens in human thymus: implications for self-tolerance and autoimmunity.
Eur. J. Immunol.
37
:
838
848
.
33
Peterson
P.
,
Org
T.
,
Rebane
A.
.
2008
.
Transcriptional regulation by AIRE: molecular mechanisms of central tolerance.
Nat. Rev. Immunol.
8
:
948
957
.
34
Mathis
D.
,
Benoist
C.
.
2009
.
Aire.
Annu. Rev. Immunol.
27
:
287
312
.
35
Org
T.
,
Rebane
A.
,
Kisand
K.
,
Laan
M.
,
Haljasorg
U.
,
Andreson
R.
,
Peterson
P.
.
2009
.
AIRE activated tissue specific genes have histone modifications associated with inactive chromatin.
Hum. Mol. Genet.
18
:
4699
4710
.
36
Cetani
F.
,
Barbesino
G.
,
Borsari
S.
,
Pardi
E.
,
Cianferotti
L.
,
Pinchera
A.
,
Marcocci
C.
.
2001
.
A novel mutation of the autoimmune regulator gene in an Italian kindred with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy, acting in a dominant fashion and strongly cosegregating with hypothyroid autoimmune thyroiditis.
J. Clin. Endocrinol. Metab.
86
:
4747
4752
.
37
Su
M. A.
,
Giang
K.
,
Zumer
K.
,
Jiang
H.
,
Oven
I.
,
Rinn
J. L.
,
Devoss
J. J.
,
Johannes
K. P.
,
Lu
W.
,
Gardner
J.
, et al
.
2008
.
Mechanisms of an autoimmunity syndrome in mice caused by a dominant mutation in Aire.
J. Clin. Invest.
118
:
1712
1726
.
38
Guerau-de-Arellano
M.
,
Martinic
M.
,
Benoist
C.
,
Mathis
D.
.
2009
.
Neonatal tolerance revisited: a perinatal window for Aire control of autoimmunity.
J. Exp. Med.
206
:
1245
1252
.
39
Abramson
J.
,
Giraud
M.
,
Benoist
C.
,
Mathis
D.
.
2010
.
Aire’s partners in the molecular control of immunological tolerance.
Cell
140
:
123
135
.
40
Kuhn
D. E.
,
Nuovo
G. J.
,
Martin
M. M.
,
Malana
G. E.
,
Pleister
A. P.
,
Jiang
J.
,
Schmittgen
T. D.
,
Terry
A. V.
 Jr.
,
Gardiner
K.
,
Head
E.
, et al
.
2008
.
Human chromosome 21-derived miRNAs are overexpressed in Down syndrome brains and hearts.
Biochem. Biophys. Res. Commun.
370
:
473
477
.
41
Tsitsiou
E.
,
Lindsay
M. A.
.
2009
.
microRNAs and the immune response.
Curr. Opin. Pharmacol.
9
:
514
520
.
42
Okada
H.
,
Kohanbash
G.
,
Lotze
M. T.
.
2010
.
MicroRNAs in immune regulation—opportunities for cancer immunotherapy.
Int. J. Biochem. Cell Biol.
42
:
1256
1261
.
43
Murphy
A. J.
,
Guyre
P. M.
,
Pioli
P. A.
.
2010
.
Estradiol suppresses NF-kappa B activation through coordinated regulation of let-7a and miR-125b in primary human macrophages.
J. Immunol.
184
:
5029
5037
.
44
Bloemers
B. L.
,
Bont
L.
,
de Weger
R. A.
,
Otto
S. A.
,
Borghans
J. A.
,
Tesselaar
K.
.
2011
.
Decreased thymic output accounts for decreased naive T cell numbers in children with Down syndrome.
J. Immunol.
186
:
4500
4507
.
45
Kusters
M. A. A.
,
Gemen
E. F. A.
,
Verstegen
R. H. J.
,
Wever
P. C.
,
DE Vries
E.
.
2010
.
Both normal memory counts and decreased naive cells favor intrinsic defect over early senescence of Down syndrome T lymphocytes.
Pediatr. Res.
67
:
557
562
.
46
Hu
M. G.
,
Deshpande
A.
,
Schlichting
N.
,
Hinds
E. A.
,
Mao
C.
,
Dose
M.
,
Hu
G. F.
,
Van Etten
R. A.
,
Gounari
F.
,
Hinds
P. W.
.
2011
.
CDK6 kinase activity is required for thymocyte development.
Blood
117
:
6120
6131
.
47
Notarangelo
L. D.
,
Fischer
A.
,
Geha
R. S.
,
Casanova
J. L.
,
Chapel
H.
,
Conley
M. E.
,
Cunningham-Rundles
C.
,
Etzioni
A.
,
Hammartröm
L.
,
Nonoyama
S.
, et al
International Union of Immunological Societies Expert Committee on Primary Immunodeficiencies
.
2009
.
Primary immunodeficiencies: 2009 update.
J. Allergy Clin. Immunol.
124
:
1161
1178
.
48
Liston
A.
,
Enders
A.
,
Siggs
O. M.
.
2008
.
Unravelling the association of partial T-cell immunodeficiency and immune dysregulation.
Nat. Rev. Immunol.
8
:
545
558
.
49
Geiben-Lynn
R.
,
Kursar
M.
,
Brown
N. V.
,
Addo
M. M.
,
Shau
H.
,
Lieberman
J.
,
Luster
A. D.
,
Walker
B. D.
.
2003
.
HIV-1 antiviral activity of recombinant natural killer cell enhancing factors, NKEF-A and NKEF-B, members of the peroxiredoxin family.
J. Biol. Chem.
278
:
1569
1574
.
50
Sánchez-Font
M. F.
,
Sebastià
J.
,
Sanfeliu
C.
,
Cristòfol
R.
,
Marfany
G.
,
Gonzàlez-Duarte
R.
.
2003
.
Peroxiredoxin 2 (PRDX2), an antioxidant enzyme, is under-expressed in Down syndrome fetal brains.
Cell. Mol. Life Sci.
60
:
1513
1523
.
51
Shen
R.
,
Ouyang
Y. B.
,
Qu
C. K.
,
Alonso
A.
,
Sperzel
L.
,
Mustelin
T.
,
Kaplan
M. H.
,
Feng
G. S.
.
2002
.
Grap negatively regulates T-cell receptor-elicited lymphocyte proliferation and interleukin-2 induction.
Mol. Cell. Biol.
22
:
3230
3236
.
52
Famulski
J. K.
,
Vos
L.
,
Sun
X.
,
Chan
G.
.
2008
.
Stable hZW10 kinetochore residency, mediated by hZwint-1 interaction, is essential for the mitotic checkpoint.
J. Cell Biol.
180
:
507
520
.
53
Seguin
L.
,
Liot
C.
,
Mzali
R.
,
Harada
R.
,
Siret
A.
,
Nepveu
A.
,
Bertoglio
J.
.
2009
.
CUX1 and E2F1 regulate coordinated expression of the mitotic complex genes Ect2, MgcRacGAP, and MKLP1 in S phase.
Mol. Cell. Biol.
29
:
570
581
.
54
Cossarizza
A.
,
Monti
D.
,
Montagnani
G.
,
Ortolani
C.
,
Masi
M.
,
Zannotti
M.
,
Franceschi
C.
.
1990
.
Precocious aging of the immune system in Down syndrome: alteration of B lymphocytes, T-lymphocyte subsets, and cells with natural killer markers.
Am. J. Med. Genet. Suppl.
7
(
Suppl.
):
213
218
.
55
Cuadrado
E.
,
Barrena
M. J.
.
1996
.
Immune dysfunction in Down’s syndrome: primary immune deficiency or early senescence of the immune system?
Clin. Immunol. Immunopathol.
78
:
209
214
.
56
Kobrynski
L. J.
,
Sullivan
K. E.
.
2007
.
Velocardiofacial syndrome, DiGeorge syndrome: the chromosome 22q11.2 deletion syndromes.
Lancet
370
:
1443
1452
.

The authors have no financial conflicts of interest.