Noncovalent Assembly of Anti-Dendritic Cell Antibodies and Antigens for Evoking Immune Responses In Vitro and In Vivo Free

Dendritic cells (DCs) are professional APCs that play a key role in inducing and regulating Ag-specific T and B cell immune responses. DCs capture Ags, then process and present them to T cells as peptides bound to both MHC class I and II (1–3). As the key players orchestrating immunity, DCs are a natural focus for immune therapy. A strategy to exploit DCs for vaccination is to deliver Ags directly to DCs using mAbs directed against specific endocytic DC cell-surface receptors, resulting in processing and presentation of antigenic peptides to T cells. Studies in mice have demonstrated that such DC-targeting vaccines can result in potent Ag-specific CD4⁺ and CD8⁺ T cell responses. For example, low doses of anti–LOX-1 or anti–DEC-205 mAbs fused to protein or peptide Ags mediated presentation via MHC class I (4) and II (5) and induced protective T cell immunity (5). In another study, effective humoral responses to DC-targeted Ag via CLEC-9A were elicited without adjuvant (6). The ability to deliver Ags to specific DC subtypes and via specific receptors (7, 8) is a powerful new approach to dissect their roles in immune responses, and this has exciting implications for vaccine development strategies. However, the full potential of this technology will only be realized when a wider range of both targeting Abs and linked Ags become available. Studies in vitro with DC-targeting vaccines have used Ag chemically cross-linked to Abs (9) or actual prototype vaccines: rAb directly fused to Ag, for example, melanoma Ag pmel17 fused to the H chain C terminus of a human mAb against mannose receptor (10) or HIV Gag p24 Ag similarly fused to a mouse Ab against human DEC-205 (11). In this work, we unfortunately find that many Ags, when fused to the mAb H chain C terminus, prevent efficient secretion of the rAb from mammalian cells. We have circumvented this problem by developing separate rAb fused to dockerin and protein Ag fused to cohesin. Dockerin and cohesin are bacterial protein domains that interact noncovalently with high affinity and specificity and serve to assemble a cellulose-degrading macromolecular structure called the cellulosome (12). This supermolecular structure is formed via dockerin modules appended to cellulose-degrading catalytic subunits interacting with a protein called scaffoldin, which has multiple cohesin modules interspersed with linker sequences and is, itself, anchored to cellulose via an integrated cellulose binding domain (13, 14). We show that stable and specific Ab–Ag complexes (we use a dash throughout to indicate this noncovalent interaction) based on this interaction can be conveniently assembled to deliver Ag in vitro to DCs, permitting DCs to expand Ag-specific CD4⁺ and CD8⁺ T cells. Also, such Ab–Ag complexes are effective prototype vaccines in vivo for elicitation of humoral and cellular responses in mice.

Total RNA was prepared from hybridoma cells (RNeasy kit; Qiagen) and used for cDNA synthesis and PCR (SMART RACE kit; BD Biosciences) with supplied 5′ primers and gene-specific 3′ primers (mIgGκ, 5′-GGATGGTGGGAAGATGGATACAGTTGGTGCAGCATC-3′; mIgG1, 5′-GTCACTGGCTCAGGGAAATAGCCCTTGACCAGGCATC-3′; and mIgG2a, 5′-CCAGGCATCCTAGAGTCACCGAGGAGCCAGT-3′). PCR products were cloned (pCR2.1 TA kit; Invitrogen) and characterized by DNA sequencing (Molecular Cloning Laboratories). With the derived sequences for the mouse H and L chain V-region cDNAs, specific primers were designed and used in PCR to amplify the signal peptide and V-regions while incorporating flanking restriction sites for cloning into expression vectors encoding downstream human IgGκ or IgG4H regions. The vector for expression of chimeric mVκ-hIgGκ was built by amplification of residues 401–731 of gi|63101937| flanked by XhoI and NotI sites and inserting this into the XhoI–NotI interval of the vector pIRES2-DsRed2 (BD Biosciences). PCR was used to amplify the mAb Vκ region from the initiator codon, appending a proximal NheI or SpeI site then CACC to the region encoding, for example, residue 126 of gi|76779294|, while appending a distal in-frame XhoI site (the anti-DC receptor chimeric L and H chain sequences used in this study are GenBank entries HQ738667, HQ738666, HQ724328, HQ724329, HQ912690, HQ912691, HQ912692, HQ912693, JX002666, and JX002667; http://www.ncbi.nlm.nih.gov/nucleotide). The PCR fragment was then cloned into the NheI–NotI interval of the above vector. The control hIgGκ sequence corresponds to gi|49257887| residues 26–85 and gi|21669402| residues 67–709. The hIgG4H vector corresponds to residues 12–1473 of gi|19684072| [with S229P and L236E substitutions to stabilize a labile disulfide bond and abrogate residual Fc receptor interaction (15)] inserted between the BglII and NotI sites of pIRES2-DsRed2 while adding the sequence 5′-GCTAGCTGATTAATTAA-3′ instead of the stop codon. PCR was used to amplify the mAb VH region from the initiator codon, appending CACC then a BglII site, to the region encoding residue 473 of gi|19684072|. The PCR fragment was then cloned into the BglII–ApaI interval of the above vector. GenBank entries for the L and H chain sequences for the anti-Langerin mIgG2b Abs are JX002668 and JX002669 for the anti-human Langerin 4C7 mAb, which cross-reacts with mouse Langerin (S. Zurawski, unpublished observations), and JX002670 and JX002671 for the mAb 2G3 (7). The anti-DCIR rAb is described in Ref. 16. A dockerin coding sequence from Clostridium thermocellum CelD (gi|40671| residues 1923–2150) flanked by a proximal NheI site and a distal NotI site following the stop codon was inserted into the NheI–PacI–NotI interval of each H chain vector. The following Ag coding sequences were also inserted between the H chain vector NheI and NotI sites: Flu HA1-1 is CipA protein [C. thermocellum] gi|479126| residues 147–160 preceding gi|126599271| hemagglutinin HA [Influenza A virus (A/Puerto Rico/8/34(H1N1))] residues 18–331 with a P321L change and with 6 C-terminal His residues; Flu HA5-1 is CipA protein [C. thermocellum] gi|479126| residues 147–160 preceding gi|58618438| hemagglutinin HA [Influenza A virus (A/Viet Nam/1203/2004(H5N1))] residues 17–330 and with 6 C-terminal His residues; Flu HA5-0 is CipA protein [C. thermocellum] gi|479126| residues 147–160 preceding gi|58618438| hemagglutinin HA [Influenza A virus (A/Viet Nam/1203/2004(H5N1))] residues 17–519 with 6 C-terminal His residues; HIV Gag p24 is gi|119624034| MHC, class II, DR α residues 60–75 preceding gi|28872819| Gag p24 [HIV 1] residues 133–363; Flu M1 is gi|60458| matrix protein M1 [Influenza A virus (A/WSN/1933(H1N1))] residues 3–252 with V15I and N92S changes; Flex Flu M1 pep is CipA protein [C. thermocellum] gi|479126| residues 147–164 preceding gi|133754191| matrix protein M1 [Influenza A virus (A/Phila/1935(H1N1))] residues 50–72 and residues 58–67 joined by K and followed by C-terminal residues RKNGSGE; Flu M1 pep is gi|133754191| matrix protein M1 [Influenza A virus (A/Phila/1935(H1N1))] residues 50–72 and residues 58–67 joined by K; Flex V1 encoded ASQTPTNTISVTPTNNSTPTNNSNPKPNP; Gad B is NM_001134366.1 Homo sapiens glutamate decarboxylase 2 residues 513–2258; Cyclin B1 peptide 2 is NM_031966.2 residues 797–903; Cyclin B1-v1 is NM_031966.2 residues 475–1476 with 6 His codons appended; PE38KDL is gb|K01397.1| Pseudomonas aeruginosa exotoxin type A residues 856–1195 then 1244–1926 followed by 5′-AAGGACGAGCTGTAA-3′; Cyclin D1 is NM_053056.2 Homo sapiens Cyclin D1 residues 210–1009; a Coh coding sequence, the 7th cohesin domain in CipA protein [C. thermocellum] gi|479126| residues 148–165 preceding gi|479126| residues 1–147 with R21N, E54K, E96K, and S109E changes and a C-terminal T residue. The DocVar1 derivative of the dockerin domain (gi|40671| 2085–2085, AAT to GAC) was made by site-specific mutagenesis (Quickchange kit; Stratagene). A mammalian expression vector for hIgG Fc fusion proteins was engineered as described (17). PCR was used to amplify human alkaline phosphatase (AP) gb|BC009647| residues 133–1581 while adding a proximal in-frame XhoI site and distal 6 C-terminal His residues followed by a TGA codon and a NotI site. This XhoI–NotI fragment replaced the hIgG Fc coding sequence in the above vector. A mammalian expression vector for G.AP fusion protein was constructed by inserting protein G precursor B2 domain gi|124267| residues 295–352 preceded by a SalI site and followed by distal linker residues encoding GGSGGSGGS and a XhoI site into the XhoI site of the AP vector. A similar mammalian expression vector for the fusion of cohesin with AP (Coh.AP) was made by inserting a fragment (bound by a proximal SalI site and distal XhoI site) encoding gi|479126| type I cohesin residues 165–312 then 148–169 into the XhoI site. The following Ag-coding sequences replaced AP in the above XhoI–NotI interval: Flu HA1-1 is gb|EF467821.1| residues 85–1025 (with an A290T change) with a proximal XhoI site and distal 5′-CACCATCACCATCACCATTGAGCGGCCGC-3′ sequence (encoding 6 C-terminal His residues, a stop codon, and a NotI site); Flu HA5-1 is gi|58618438| residues 17–330 with 6 C-terminal His residues; Gag p24 is HIV 1 gb|ABO61536.1| residues 45–256 with 6 C-terminal His residues. For expression of cohesin–Ag fusion (Coh.antigen) proteins in E. coli, PCR was used to amplify the open reading frame (ORF) of gi|60458| Flu M1 protein [Influenza A virus (A/WSN/1933(H1N1))] with a V15I change while incorporating a NheI site distal to the initiator codon and a NotI site distal to the stop codon. The fragment was inserted into pET-28b (+) (Novagen), placing the Flu M1 ORF in-frame with 6 C-terminal His residues. A pET-28b (+) derivative encoding the N-terminal 169 residue cohesin domain from gi|479126| with R21N, E54K, E96K, and S109E changes was inserted between the NcoI and NheI sites, and this encoded Coh fusion protein. For expression of Coh.Flu M1 protein, PCR was used to amplify the above Flu M1 residues while incorporating a NheI site proximal to the initiator codon and a XhoI site instead of the terminator codon. This fragment was inserted between the NheI and XhoI sites of the Coh.His vector. Similar strategies were used to generate expression vectors for His-tagged Coh.Gad B, Coh.Cyclin D1, Coh.Cyclin B1-v1, and Coh.PE38KDL, except with the latter the His-tag was N-terminal to the cohesin domain.

rAbs and some fusion proteins were produced using the FreeStyle 293 Expression System (Invitrogen) according to the manufacturer’s protocol based on 1 mg total plasmid DNA with 1.3 ml 293 Fectin reagent/l of transfection. Production levels of rAb–Ag fusion (rAb.antigen) protein expression constructs were tested in 5 ml transiently transfected mammalian 293F cell cultures using ∼2.5 μg each of the L chain and H chain constructs and the protocol described above. Culture supernatants were harvested after 3 d and analyzed by anti-hIgG Fc ELISA with AffiniPure goat anti-human IgG (H+L) as the capture agent and peroxidase-conjugated AffiniPure goat anti-human IgG, Fcγ fragment-specific Ab as the detection reagent (Jackson ImmunoResearch). Some measurements also used the anti-human κ ELISA kit (Bethyl Laboratories). In tests of this protocol, production of secreted rAb was independent of H chain and L chain vector concentrations over an ∼2-fold range of each vector DNA concentration (i.e., the system was DNA saturated for each vector over this range). For rAb production, equal amounts of vector encoding the H and L chain were cotransfected. Transfected cells were cultured for 3 d, the culture supernatant was harvested, and fresh 293 Freestyle media (Invitrogen) with 0.5% penicillin/streptomycin (Sigma) added with continued incubation for 2 d. The pooled supernatants were clarified by filtration, loaded onto a 1-ml HiTrap MabSelect column (GE Healthcare), eluted with 0.1 M glycine pH 2.7, neutralized with Tris base, and then dialyzed versus Dulbecco's PBS (DPBS; Life Technologies). Endotoxin levels ranged from 0.01 to 0.20 ng/mg for rAbs. Coh.antigens (Coh.Flu HA1-1, Coh.Flu HA5-1, and Coh.Gag p24) were also expressed using the system described above. The culture supernatant (1 l) was loaded onto a 20-ml Q Sepharose column (GE Healthcare) washed with PBS and then eluted with PBS plus 1 M NaCl pH 7.4. The eluted fraction was purified by Ni²⁺ chelating chromatography, as described below, and then dialyzed versus DPBS, yielding 16.6 mg, 1.0 mg, and 1.3 mg, respectively. Endotoxin level was 0.43 ng/mg for Coh.Flu HA1-1. All proteins were analyzed by SDS-PAGE gel, and concentrations were based on theoretical extinction coefficient at 280 nm. Coh.Flu M1 was expressed in E. coli strain T7 Express (NEB) grown in Luria broth (Difco) at 37°C with selection for kanamycin resistance (40 μg/ml) and shaking at 200 rounds/min to midlog growth phase. Then, 120 mg/l isopropyl β-d-1-thiogalactopyranoside (Bioline) was added, and after 3 h, the cells were harvested by centrifugation and stored at −80°C. E. coli cells from each 1-l fermentation were resuspended in 50 ml ice-cold 50 mM Tris, 1 mM EDTA pH 8 with 0.2 ml protease inhibitor Cocktail II (Calbiochem). The cells were sonicated twice on ice for 4 min at setting 18 (Fisher Sonic Dismembrator 60) with a 5-min rest period and then spun at 17,000 rpm (Sorvall SA-600) for 20 min at 4°C. For Coh.Flu M1 purification, the 50-ml cell lysate supernatant was passed through 10 ml of Q Sepharose beads (GE Healthcare), then through a 1-ml S Sepharose column (GE Healthcare) and washed with 50 mM Tris pH 7.4. The flow-through was adjusted to binding buffer with 7.5 ml 160 mM Tris, 40 mM imidazole, 4 M NaCl pH 7.9 and loaded onto a 5-ml HiTrap chelating HP column (GE Healthcare) charged with Ni²⁺. The bound protein was washed with 20 mM NaPO₄, 300 mM NaCl, 10 mM imidazole pH 7.6 (buffer A) and eluted with a 10–500 mM imidazole gradient in buffer A. The peak fractions were analyzed by SDS-PAGE gel, pooled, and dialyzed versus DPBS, yielding 6.4 mg. Endotoxin level was 2 ng/mg for Coh.Flu M1. Control cohesin protein was purified by breaking 2-l cells in 50 mM MES pH 5.5, then binding the soluble fraction onto a 20-ml QXL column (GE Healthcare) and eluting with a gradient to 1 M NaCl in pH 6.5, and the positive fractions were adjusted to binding buffer and run on a 10-ml Ni²⁺ column, washed with 100 ml 0.5% ASB-14 (Calbiochem) in binding buffer, and then eluted as above. Positive fractions (second peak) were pooled and dialyzed versus DPBS, yielding 33 mg. Coh.Gad B was isolated from the sonic extract pellet washed with 0.5% Triton X-100 then dissolved in binding buffer with 6 M urea and reacted with 30 mg MPEG-MAL-20K (Nektar) at room temperature overnight and run on a 1-ml Ni²⁺ column as above. The eluted refolded PEG-derivatized protein was dialyzed into DPBS, yielding 9.6 mg/l cells. Coh.Cyclin D1 was isolated from the supernatant after passing it through a 5-ml ANX column (GE Healthcare) after two extractions with Triton X-114 (Pierce) then loaded onto a 5-ml Ni²⁺ column and eluted as described above. Fractions containing the protein (∼16 mg total) were treated overnight with 10 mg MPEG-MAL-20K reagent at room temperature and dialyzed versus DPBS yielding 16 mg. Coh.Cyclin B1-v1 was isolated from the sonic extract pellet washed in Triton X-100 (Sigma) and dissolved in binding buffer with 6 M urea, reacted with 25 mg MPEG-MAL-20K at room temperature overnight, then diluted 10× in binding buffer and purified via a 5-ml Ni²⁺ column, yielding 2.5 mg of refolded PEG-derivatized protein. Coh.PE38KDL was isolated from the supernatant fraction, loaded onto a 20-ml QXL column, and eluted with a 5-vol gradient to 1 M NaCl. Pooled fractions at ∼0.4 M NaCl were adjusted to binding buffer and further purified over a 5-ml Ni²⁺ column yielding 7.5 mg. In each case, cohesin fusion proteins were confirmed to bind to rAb–dockerin fusion (rAb.Doc). Flu HA1-Cal04 protein was prepared from 1 l E. coli containing pET28 with gb|GQ117044.1| Influenza A virus [A/California/04/2009(H1N1)] residues 52–996 and appended CATCACCATCACCATCACTGA inserted between the NheI and NotI sites. The protein from the insoluble fraction was dissolved in 40 ml 7 M urea in 25 mM NaPO₄ pH 6.3 with 5 mM DTT, and then 140 mg MPEG-BTC-20K (Nektar) was added at room temperature overnight. This was purified via Ni²⁺ affinity chromatography as described above, and pooled fractions were dialyzed into PBS yielding 4.7 mg.

Apheresis procedures were performed on healthy donors after informed consent was collected. This protocol was approved by the Baylor Research Institute Institutional Review Board. Monocyte-derived IFN-α-DCs and monocyte-derived IL-4-DCs were prepared from frozen human monocytes from normal donors (HLA-A*0201⁺) cultured in CellGenix media (CellGenix) with GM-CSF and IFN-α or GM-CSF and IL-4, respectively, and 1% penicillin/streptomycin as described previously (18). Autologous CD8⁺ T cells were negatively or positively selected from PBMCs using anti-CD8 magnetic beads (Miltenyi Biotec) or EasySep enrichment mixture (StemCell). Complexes between rAb.Doc and Coh.antigen were formed by mixing rAb.Doc fusion proteins with 2 molar equivalents of Coh.antigen fusion proteins in DPBS with Ca²⁺/Mg²⁺. IFN-α-DCs (5 × 10³) were loaded with various concentrations of preassembled complexes between rAb.Doc and Coh.Flu M1. After 16 h, 2 × 10⁵ purified autologous CD8⁺ T cells in complete RPMI 1640 (Invitrogen) medium supplemented with 25 mM HEPES (Life Technologies), 2 mM l-glutamine, 1 mM sodium pyruvate, 1% nonessential amino acids, 1% penicillin/streptomycin (all from Sigma) containing 10% heat-inactivated AB serum (Gemini Bioproducts) were added to the culture. IL-2 and IL-7 (20 and 10 U/ml, respectively; R&D Systems) were added on day 2. The frequency of Flu M1-specific CD8⁺ T cells was measured by staining cells with anti-CD8, anti-CD3 mAbs (BD Biosciences), live/dead fixable aqua dye (Invitrogen), and with MHC class I Flu M1 tetramers (HLA-A*0201-GILGFVFTL)–PE (Beckman Coulter) on day 7 of the culture and then analyzed by flow cytometry. Autologous CD4⁺ T cells were negatively selected using the EasySep enrichment kit. IFN-α-DCs (5 × 10³) were loaded with various concentrations of preassembled rAb.Doc–Coh.Flu HA1-1 complexes. After 16 h, 2 × 10⁵ purified autologous CD4⁺ T cells labeled with 50 nM CFSE (Molecular Probes) were added to the culture. On day 10, cells were washed and restimulated with 5 μM 17-mer peptides 43 (LEPDGTIIFEANGNLIA) and 65 (DQKSTQNAINGITNKVN) or 2 μM pools of overlapping (staggered by 4 aa) 15-mer peptides (Mimotopes) in 50% acetonitrile solution (Fluka) within the Flu HA1-1 protein and incubated for 48 h, and then the secreted IFN-γ was measured in the culture supernatant using BioPlex200 Luminex (BioRad). In parallel, intracellular IFN-γ production was assessed after 6 h of restimulation with 5 μM peptides 43 or 65 or 2 μM pools of overlapping 15-mer peptides within the Flu HA1-1 protein in the presence of brefeldin A (BD Biosciences). Cells were then fixed, permeabilized, and stained with anti-CD4, anti-CD3, anti-CD8, and anti–IFN-γ mAbs (all from BD Biosciences) and live/dead fixable aqua dye. The IFN-γ production of the CFSE^low CD4⁺ T viable cells was assessed by flow cytometry on a FACSCalibur instrument (BD Biosciences).

IFN-α-DCs (1 × 10⁵–2 × 10⁵) in complete RPMI 1640 containing 10% human AB serum were cultured in 96-well plates with premixed complexes or proteins (1.8 nM) or 100 ng/ml LPS from E. coli for 16 h. DCs were then stained with the indicated Abs (BD Biosciences), and the expression levels of CD83 and CD86 were measured by flow cytometry on a FACSCantoII instrument (BD Biosciences).

Serial dilutions of anti-CD40.antigen fusion proteins and preassembled anti-CD40.Doc–Coh.antigen complexes starting at 138 nM were incubated with 5 × 10⁵ cells from a stable CHO cell line expressing CD40 receptor in DPBS, 2% BSA, on ice for 30 min. The cells were then washed and incubated with 4 μg/ml PhycoLink goat anti-human IgG (Fc-specific)-R–PE (Prozyme). The cells were washed again and resuspended in DPBS, 1% PFA, and then analyzed by flow cytometry on a FACSArray flow cytometer (BD Biosciences). Coh.Flu M1 was treated with EZ-Link NHS-SS-PEO₄-Biotin (Pierce) at a compound to protein ratio of 25 in a 100 μg/100 μl reaction in PBS for 1 h at room temperature with rotation. The derivatized proteins were dialyzed versus several changes of DPBS to remove unbound labeling reagent. For flow cytometry analysis, various concentrations of rAb.Doc and biotinylated Coh.Flu M1 were incubated in DPBS with Ca²⁺/Mg²⁺ for 1 h at room temperature. Human IFN-α-DCs (4.5 × 10⁵/ml), IL-4-DCs (2 × 10⁵/ml), or PBMCs (10⁷/ml) were resuspended in DPBS and 2% FCS (HyClone), and then rAb.Doc–Coh.Flu M1 complexes were added to the cells and kept on ice for 30 min. Cells were then washed with DPBS and incubated for 30 min at room temperature with streptavidin–PE (SA–PE, 1:200 in 100 μl; BD Biosciences), anti-CD3, anti-CD14, CD19 mAbs (all from BD Biosciences), and live/dead fixable aqua dye, and then washed twice with DPBS and 2% FCS and analyzed by flow cytometry on FACSCalibur and FACSCantoII instruments (BD Biosciences).

Analysis of rAb.Doc and Coh.antigen protein interaction by size exclusion chromatography was done on a Superdex 200 30/300 column (GE Healthcare) in DPBS with Ca²⁺/Mg²⁺ at room temperature and an 0.35 ml/min flow rate. The column was calibrated with gel filtration standards from Pierce. For determination of affinity and rate constants by surface plasmon resonance (SPR), analyses were performed using a SensiQ instrument (ICx Nomadics) at 25°C. A carboxyl sensor surface was modified to covalently couple protein G to both channels. Channel 1 was used to capture dockerin molecules, and channel 2 was left as a reference protein G surface to subtract nonspecific binding. A concentration of 2 nM anti–DC-ASGPR.Doc was used for capture, and at 1 min of contact time the average capture was ∼233 resonance units (RU). A serial doubling dilution was prepared of Coh.Gag p24 at a top concentration of 20 nM down to 0.625 nM. The top concentration of 20 nM of Coh.Gag was near saturation of this interaction after 3 min of association. This concentration was allowed to dissociate for 30 min whereas the other concentrations were regenerated after 4 min. The data were fit in Qdat software (ICx Nomadics).

Human Langerin transgenic mice (huLangerin-DTR) have been previously described (7, 19). All experiments were performed on age- (7–12 wk) and sex-matched mice (7). Littermate control, huLangerin-DTR, and BALB/c mice were housed in microisolator cages and fed irradiated food. The University of Minnesota and Baylor Research Institute Institutional Animal Care and Use Committees approved all mouse protocols. The anti-hLang.Doc Ab was mixed for conjugation with Coh.Flu HA1-1 in sterile Hanks’ buffer (Life Technologies) to a final concentration of 1 μg or 10 μg of conjugate or anti-CD40.Flu HA1-1 in 100 μl. For the control group in some experiments, anti-hLang Ab lacking the dockerin domain was mixed with Coh.Flu HA1-1. The mice were injected i.p. in 250 μl with a 26-gauge needle at day 0 and day 14 and in some experiments at day 21 and at day 30. Blood samples were taken at days −2, 14, 21, and in some experiments at day 28. The blood was coagulated 1 h at room temperature and then centrifuged at 8000 rpm for 8 min. The serum was stored at −80°C. To determine Ag-specific Ab titers, ELISA plates were coated with 1 μl/ml purified Influenza A PR8 virus (Charles River), or 0.25 μg hIgG4.Doc protein, or 2 μg/ml Flu HA1-Cal04 protein. Serial dilutions of serum in blocking buffer (TBS; Pierce) were incubated in the wells overnight at 4°C. After washing, plates were incubated with HRP-conjugated goat anti-mouse IgG (Jackson ImmunoResearch) in blocking solution for 2 h at 37°C, then washed and developed with HRP substrate and read at 405 nm. Ab titer data are plotted on log scales. Assays for isotyping Ag-specific Abs in the serum used biotinylated goat anti-mouse IgG1, IgG2a, IgG2b, and IgG3 polyclonal reagents and biotinylated anti-mouse IgE monoclonal 23G3 (SouthernBiotech) as detecting reagents, followed by development with NeutrAvidin HRP (Pierce). The capacity of Coh.Flu HA1-1 to present epitopes relevant to protective Abs was verified by demonstrating that overnight incubation at 4°C with plate-bound Coh.Flu HA1-1, but not Coh.Gag p24, completely depleted hemagglutination inhibition (HAI) activity from sera with titers of 1:1280 and 1:2560. Also, addition of as little as 0.6 μg/ml Coh.Flu HA1-1, but not Coh.Gag p24 at levels as great as 20 μg/ml, completely inhibited HAI activity in sera with titer of 1:1280 against Influenza A PR8 virus. HAI assay was as described (20), except sera were treated with trypsin at 56°C for 30 min, then 0.01 M IKO₄ at room temperature for 15 min, followed by addition of 1% glycerol for 15 min at room temperature, then dilution into 85% saline with virus at 4°C for 30 min before addition of the RBCs at 4°C for 45 min before scoring the assay. For the IFN-γ ELISPOT assay, mouse splenocytes taken 4 d after the last boost and purified via Lympholyte-M (Cedarlane) gradients were plated at 2.5 × 10⁵ cells per assay point in precoated mouse IFN-γ ELISPOT plates (PLUS kit; MabTech) with 1 μM peptides in 150 μl RPMI 1640 with 5% FCS, 10 mM HEPES, 2 mM GlutaMAX (Invitrogen), 50 μM 2-mercaptoethanol, and 1% penicillin/streptomycin. Controls were cells without peptide or protein with matching acetonitrile concentrations, as well as cells with 1 μg/ml PHA. Plates were incubated for 36 h, developed with the supplied HRP reagent (MabTech), and read by ELISPOT reader (ZellNet Consulting).

A limited number of DC-targeting vaccines based on recombinant anti-DC receptor Abs with Ag fused to the H chain C terminus have been described. These include a model hen egg lysozyme peptide (21), melanoma Ag peptide pmel17 (10), HIV Gag p24 (5), and Leishmania LACK (8), and they all used mammalian cell secretion systems, which typically yield correctly folded and glycosylated functional Ab products.

Our purpose was the production of prototype Ag-targeting vaccines composed of recombinant anti-DC receptor mAbs fused to several other desired Ags. Thus, variable regions from L and H chains of anti-DC receptor mAbs with different specificities (DC-ASGPR, DC-SIGN/L, Langerin, and CD40) were cDNA cloned, characterized by DNA sequence analysis, and engineered into mammalian expression vectors bearing either human Igκ or human IgG4H constant regions. Coding sequences for HIV Gag p24, used as a positive control, or Influenza A Ags were then placed in-frame with each H chain C terminus. rAbs fused to the 249 residue HIV Gag p24 domain or to the 336 residue HA1 subunit of Influenza A PR8 subtype H1N1 hemagglutinin (Flu HA1-1) were secreted at levels between 25 and 75% compared with cells transfected with expression vectors encoding the same Abs without the C-terminal Ag fusion (rAb) (Fig. 1A). Surprisingly, expression constructs encoding the 336-residue HA1 domain from the H5N1 strain (Flu HA5-1) were very poorly secreted at levels >10-fold reduced compared with cells transfected with matching control Flu HA1-1 constructs (Fig. 1A). This is despite their structural homology and 57% amino acid identity. Prototype DC-targeting vaccines bearing the full HA ectodomain from either the H5N1 (Flu HA5-0) or the H1N1 strain (Flu HA1-0, data not shown) or the entire 336 residue Influenza A matrix protein 1 (Flu M1) were also very poorly secreted (Fig. 1A). Vectors encoding two copies of a region of Flu M1 containing a known immunodominant epitope either directly fused to the H chain C terminus (Flu M1 pep) or via a flexible linker sequence (Flex Flu M1 pep) also failed to direct secretion of significant amounts of the fusion proteins (Fig. 1A). There was no significant difference in the secretion properties between such rAb.antigen fusion proteins based on the three different mouse variable regions. Similar data showing extremely poor or no secretion from 293F cells were obtained for constructs linking Gad B, Cyclin B1, Cyclin D1, and PE38 directly to the C terminus of anti-DCIR rAb or control hIgG4 H chain (see 2Materials and Methods; data not shown). Thus, many Ags are recalcitrant to production as DC-targeting prototype vaccines when linked to the rAb H chain C terminus, and this seems independent of differences in the vaccine V-region sequences and the size of Ags tested in this study.

For experimental studies, the Ag component can also be made independently and chemically cross-linked to the Ab (4), but manufacture of such a product for human use has significant quality control issues unless linking of the Ag to the Ab is controlled (22). The specific protein A or G interaction with the Ig C region (23) provides a conceptual framework for an alternate strategy of formulating such prototype vaccines by the controlled assembly of the Ab and Ag via noncovalent protein–protein interactions; however, this method is not suited to applications where other Abs are present. As an alternative, we explored the use of the well-characterized dockerin and cohesin interaction (12–14) for this purpose.

Fusion proteins composed of C. thermocellum dockerin and cohesin domains linked to Ab H chain C termini (respectively, rAb.Doc and rAb.Coh) were efficiently secreted by mammalian cells (Fig. 1A, 1B). Some Ags of interest that were not well secreted as rAb.antigen (e.g., Flu M1 and Flu HA5-1) (Fig. 1A) were readily purified from E. coli bearing expression vectors encoding cohesin fused to Ag (e.g., Coh.Flu M1, Fig. 1B) or were efficiently secreted by 293F cells transfected with Coh.antigen expression vectors (e.g., Flu HA5-1, data not shown).

We used cohesin fused to alkaline phosphatase (Coh.AP) as a model Ag. Coh.AP interacted specifically with rAb.Doc (Fig. 2A, 2B) but not control rAb (Fig. 2B) in ELISA, and the binding was efficient, as ∼2 mol equivalents of Coh.AP (0.5 μg, 72 kDa) saturated the rAb.Doc (0.25 μg, 160 kDa) surface (Fig. 2A). Preformed dockerin–cohesin complexes appeared to be very stable. In a competition study, only ∼20% of the rAb.Doc–Coh.AP complex dissociated within 300 min in the presence of a 20-fold excess of free rAb.Doc compared with Ab–protein G.AP complexes, where ∼90% dissociated within 300 min when 20-fold excess free rAb was added (Fig. 2C). The interaction between dockerin and cohesin was also very stable in pure human serum, where virtually no dissociation was observed in 4 h (total Ig in serum is ∼15 mg/ml), in contrast to rAb interaction with protein G, where ∼1 mg/ml total Ig displaced all the bound protein G in 4 h (Fig. 2D). Thus, the rAb.Doc–Coh.antigen interaction is specific and stable, and this is a key attribute for potential use in in vitro and in vivo biological situations, which typically contain serum.

The dockerin domain contains two predicted N-linked glycosylation sites (using NetNGlyc 1.0 Server). We found that rAb.Doc preparations were variably glycosylated within the dockerin domain, and glycosylated forms of rAb.Doc did not interact with cohesin fusion proteins (Supplemental Fig. 1A). Therefore, one of these sites was altered by mutagenesis, yielding rAb.Doc products that consistently retained full activity for binding cohesin fusion proteins while reducing product heterogeneity (Supplemental Fig. 1B, 1C) and possibly extraneous interactions with cell surface lectins. All subsequent experiments used this dockerin variant.

Mixtures of purified rAb.Doc and Coh.antigen fusion proteins were analyzed via gel filtration. Individually, anti-CD40.Doc and an E. coli-expressed cohesin migrated as single peaks (Fig. 3A, Supplemental Fig. 2A). When anti-CD40.Doc was mixed with an excess of cohesin, the anti-CD40 rAb.Doc peak was quantitatively displaced into a faster migrating peak (Fig. 3A). When anti-CD40.Doc was mixed in an equimolar amount with cohesin, the cohesin was quantitatively displaced into a similar faster migrating peak (Supplemental Fig. 2A). In each case, the shifted peaks were relatively homogeneous and migrated consistently with the expected apparent molecular weights of complexes of 1 dimeric rAb.Doc to 2 Coh.antigens. Also, complexes between rAb.Doc and Coh.antigen could be purified directly from the supernatant of 293F cells cotransfected with expression vectors directing the synthesis of 1) rAb.Doc H chain, 2) rAb L chain, and 3) Coh.antigen (Fig. 3B).

In addition, the interaction of Coh.antigen with rAb.Doc immobilized to a surface coated with protein G was investigated with an SPR system. The association rate constant was high (k_a = 2.3 × 10⁶ M⁻¹ s⁻¹, Fig. 3C), and the dissociation rate constant was very low (k_d = 6.3 × 10⁻⁵ s⁻¹, Fig. 3C). A K_D of 27 pM was determined from the kinetic analysis assuming a 1:1 interaction model, and this is in the range of high-affinity Ab–Ag interaction (24). In Fig. 3C, 233 RU of protein A-immobilized anti–DC-ASGPR rAb.Doc (162 kDa) bound 111 RU of the Coh.Gag p24 (42 kDa) at ligand saturation (20 nM), indicating that ∼1.85 mol of Coh.antigen bound to 1 mol of rAb.Doc, consistent with a dimeric rAb.Doc structure and a 1:1 interaction between the dockerin and cohesin domains. Similar data were found with other Coh.antigen and rAb.Doc interactions, and we did not detect any significant difference in rAb.Doc binding to Coh.antigen secreted from mammalian cells versus that expressed as soluble E. coli protein (data not shown).

To assess the capacity of anti-DC receptor rAb.Doc–Coh.antigen complexes to deliver Ags to DCs, we labeled Coh.Flu M1 with biotin and used SA–PE and flow cytometry to detect cell surface-bound complexes. Specific staining was detected on monocyte-derived IFN-α-DCs with >0.1 μg/ml anti-CD40.Doc but not with isotype control hIgG4.Doc, and a maximal signal was observed with ∼1.6 μg/ml (Fig. 4A, 4B). The anti-CD40.Doc–Coh.Flu M1 complex was detected on CD19⁺ B cells but not on CD3⁺ T cells (Fig. 4C). On monocyte-derived IL-4-DCs, specific staining was also observed using anti–DC-SIGN/L rAb.Doc (Fig. 4D). Because the SA–PE detecting reagent binds only the biotinylated Coh.Flu M1, these data show that the anti-DC receptor rAb.Doc reagents effectively target the Flu M1 Ag to the cell surface of cells bearing the DC receptor.

In dose-ranging studies of the relative affinities for either plate-bound or cell surface CD40, anti-CD40 rAbs with H chain C-terminal dockerin (anti-CD40.Doc) or HA1 domain fusions (anti-CD40.Flu HA1-1) had only slightly reduced affinities for CD40 compared with recombinant anti-CD40 rAb alone (Supplemental Fig. 3A, 3B). Similarly, studies with anti-CD40 rAb.Doc–Coh.antigens versus rAb.Doc alone showed that the complexes had no significant impact on interaction with cell surface CD40 (Supplemental Fig. 3C, 3D).

Our pretext for development of prototype vaccines based on rAb.Doc–Coh.antigen complexes was to broaden the study of DC targeting to include Ags that could not be expressed as direct rAb.antigen fusion proteins. For example, to demonstrate that Flu M1 delivered to DCs via anti-CD40.Doc is presented to T cells, we incubated IFN-α-DCs with preformed anti-CD40.Doc–Coh.Flu M1 complexes and then cocultured them with autologous CD8⁺ T cells for 7 d. Then, HLA-A2 tetramers bearing Flu M1 peptide (58–66) were used to detect Flu M1-specific CD8⁺ T cell expansion. Ag doses as low as 10 pM delivered via anti-CD40.Doc–Coh.Flu M1 complexes elicited robust Flu M1-specific CD8⁺ T cell responses (Fig. 5A). At least 1000-fold higher doses of Coh.Flu M1 alone or isotype control hIgG4.Doc–Coh.Flu M1 complexes were required to elicit detectable Ag-specific CD8⁺ T cell responses (Fig. 5A). In a second donor, anti-CD40.Doc–Coh.Flu M1 at 1 nM was more potent at inducing expansion of Flu M1-specific CD8⁺ T cells than the isotype control hIgG4.Doc–Coh.Flu M1 or Coh.FluM1 alone (27% tetramer-positive cells versus 0.35%), and addition of free anti-CD40 rAb did not increase the low potency of hIgG4.Doc–Coh.Flu M1 or Coh.Flu M1 alone (Fig. 5B, upper panel). The potency of targeting via anti-CD40.Doc–Coh.Flu M1 complex was confirmed at 0.1 nM where the hIgG4.Doc–Coh.Flu M1 complex and Coh.Flu M1 were not cross-presented (14.3% of tetramer-positive cells versus 0.36% and 0. 38%; Fig. 5B, lower panel). Thus, this anti-DC rAb.Doc–Coh.antigen DC-targeting reagent can effectively expand in vitro Ag-specific CD8⁺ T cells against an Ag that could not be configured as a direct rAb.antigen fusion.

To study further the capacity of Ab.Doc–Coh.antigen complexes to direct Ag presentation to CD4⁺ T cells, we configured Influenza hemagglutinin Flu HA1-1 fused to cohesin (Coh.Flu HA1-1). Stimulation with anti-CD40.Doc–Coh.Flu HA1-1 complexes activated IFN-α-DCs in vitro as measured by CD83 or CD86 upregulation compared with hIgG4.Doc–Coh.Flu HA1-1 or Coh.Flu HA1-1 alone (Fig. 6A). In IFN-α-DC/CD4⁺ T cell cocultures, anti-CD40.Doc–Coh.Flu HA1-1 complexes expanded memory Ag-specific CD4⁺ T cells recognizing different epitopes of the Flu HA1-1 protein as measured by IFN-γ secretion after peptide stimulation (Fig. 6B). The control hIgG4.Doc–Coh.Flu HA1-1 or Coh.Flu HA1-1 alone resulted in weaker Flu HA1-1–specific responses (Fig. 6B). The responses were dependent on delivery via CD40, as addition of free anti-CD40 rAb did not potentiate the efficacy of control hIgG4.Doc–Coh.Flu HA1-1 complex (Fig. 6B). Flu HA1-1 delivery to surface CD40 via anti-CD40.Doc–Coh.Flu HA1-1 was receptor dependent, as the incubation of IFN-α-DCs with such complexes at 4°C prior to incubation with autologous CD4⁺ T cells resulted in expansion of Flu HA1-1 peptide-specific CD4⁺ T cells, whereas incubation with control hIgG4.Doc-Coh.Flu HA1-1 did not (data not shown). To verify that the presence of Doc and Coh sequences in the prototype targeting vaccine was not affecting the breadth of the response, we configured Influenza A hemagglutinin Flu HA1-1 as a direct fusion to the anti-CD40 rAb (anti-CD40.Flu HA1-1), thus permitting direct comparison between the direct fusion and complex. In IFN-α-DC/CD4⁺ T cell cocultures from a second donor, both reagents were equally effective at expanding autologous CD4⁺ T cells specific to Flu HA1-1 as determined by the frequency of CFSE^low CD4⁺ T cells producing intracellular IFN-γ in response to the same specific Flu HA1-1 peptides (Fig. 6C). These data show that this anti-DC rAb.Doc–Coh.antigen reagent is able to elicit DC-directed Ag-specific MHC class II-restricted CD4⁺ T cell responses. In addition, the presence of cohesin and dockerin sequences in the prototype targeting vaccine did not appear to affect the magnitude and the breadth of the Ag-specific CD4⁺ T cells responses in vitro.

We further tested the efficacy of anti-DC receptor rAb.Doc–Coh.antigen complexes in vivo. We used transgenic mice expressing human Langerin (huLangerin-DTR mice) specifically on Langerhans cells (LCs) and an anti-human Langerin rAb (anti-hLang rAb) previously characterized to bind to LCs and to induce Ag-specific immune responses via LC targeting (7). In this study, anti-hLang mAb was administered i.p., and LCs isolated from the epidermis efficiently acquired the Ab, whereas keratinocytes, dendritic epidermal T cells, and LCs from littermate control mice (i.e., without human Langerin) did not acquire the mAb (7). huLangerin-DTR mice were injected i.p. with 1 μg anti-hLang.Doc–Coh.Flu HA1-1 complex (Fig. 7A), and a control group was injected with a 1-μg mixture of anti-hLang rAb (i.e., without dockerin) and Coh.Flu HA1-1 (Fig. 7A). In the huLangerin-DTR group injected with anti-hLang.Doc–Coh.Flu HA1-1 complexes, Flu HA1-1–specific Abs were detected in serum sampled 2 wk after vaccination, and this response was strongly boosted with a second injection (Supplemental Fig. 4A). In the noncomplexed control group, only a very weak anti-Flu HA1-1 response could be detected (Fig. 7A, Supplemental Fig. 4A) and then in only one of three mice after the boost (Fig. 7A, Supplemental Fig. 4B), indicating that the targeting rAb is required to be complexed to the Ag through the dockerin–cohesin domains interaction for efficacy. The mice from both groups also raised Abs against the rAb vehicle itself, which had human IgG4 constant regions (Supplemental Fig. 4C, 4D). In the huLangerin-DTR mice, the anti-hIgG titers were generally higher and developed with a more rapid kinetic when immunized with the dockerin–cohesin assembled complex rather than the rAb alone mixed with Coh.antigen (Supplemental Fig. 4C, 4D), and these complex-elicited Abs were predominantly of the IgG1 isotype (data not shown). Additional controls were non-transgenic littermate mice injected with the identical mixtures. Littermate control groups immunized with the same reagents gave no significant anti-Flu HA1-1 or anti-hIgG Ab responses (Fig. 7A, Supplemental Fig. 4E, 4F), indicating that the prototype vaccine was acting specifically through hLangerin expressed on LCs.

To address possible differences in immunity against Flu HA1-1 delivered via cohesin–dockerin interaction versus direct fusion and their potential for development of neutralizing anti-Flu HA1-1 Abs, two additional groups of huLangerin-DTR mice were vaccinated as above, but with 10 μg of complex versus 10 μg of direct fusion. The sera were tested 1 wk after a third injection. We did not observe any differences in anti-Flu HA1-1 responses between delivering Flu HA1-1 with anti-hLangerin.Doc–Coh.Flu HA1-1 versus anti-hLangerin.Flu HA1-1 (Fig. 7B). The resulting Flu HA1-specific Abs had only a minimal cross-reactivity against a different Influenza A hemagglutin in strain (H1N1, Flu HA1-Cal04). Using the same protocol, we also vaccinated two groups of BALB/c mice with an anti-mouse Langerin rAb.Doc (anti-mLangerin rAb.Doc) complexed to Coh.Flu HA1-1 complex or with an anti-mLang.Flu HA1-1 direct fusion protein. Both the cohesin–dockerin complex-vaccinated and the direct fusion protein-vaccinated groups mounted anti-Flu HA1-1–specific Ab responses (Fig. 7C). The anti-Flu HA1-1 positive sera shown in Fig. 7A did not neutralize the homologous Influenza A PR8 virus (HAI < 1:1). However, the increased anti-Flu HA1-1 titers obtained in the two high-dose studies (Fig. 7B, 7C) did yield potentially neutralizing Abs (HAI range, 1:1–1:2) (data not shown), and there were no observed significant differences between the efficacy of the cohesin–dockerin interaction versus the direct fusion nor between the huLangerin-DTR mice and normal mice (Fig. 7B, 7C).

To compare the efficacy of anti-mLang.Doc–Coh.Flu HA1-1 versus anti-mLang.Flu HA1-1 for elicitation of T cell responses, we again boosted the BALB/c mice and analyzed splenic Flu HA1-1–specific T cell responses 4 d after the final boost. IFN-γ–secreting Flu HA1-1–specific T cells detected by ELISPOT assay were induced without adjuvant, and the levels of responses were similar for the complex versus the direct fusion protein (Fig. 7D). However, no such responses that cross-reacted to Flu HA1-Cal04 peptides were observed (data not shown).

Collectively, these data in mice show that anti-Lang.Doc–Coh.Flu HA1-1 complex can effectively target the Ag to Langerin in vivo, resulting in specific Ab and T cell responses.

DC-targeting vaccines, typically recombinant anti-DC receptor rAbs fused directly to Ags via the H chain C terminus, offer a very promising new tool for enhancing and controlling humoral and cellular immune responses. In this study, we demonstrate that many desirable Ags cannot be produced in this direct rAb fusion configuration. To circumvent this problem, rAbs directly linked to a dockerin domain can be assembled into fully functional DC-targeting agents via noncovalent interaction with separately produced Coh.antigen fusion proteins. We considered assembling such Ab–Ag complexes based on modifications of existing technologies for making heterodimeric Abs or proteins (e.g., amphiphilic Fos-Jun leucine zippers) (25, 26), CH3 domain “knob-in-hole” pairs (27), or E-coil-K-coil peptides (28, 29). However, we were intrigued with the possibilities offered by the well-characterized dockerin–cohesin interaction that is a hallmark of the cellulosome. These very-high-affinity interacting dockerin and cohesin modules were designed by nature to function when fused to other domains. The cellulosome proteins are secreted and glycosylated bacterial products, but their dockerin and cohesin domains are also functional when expressed as intracellular E. coli products (30).

The results presented in this study establish the utility of dockerin and cohesin modules for making very specific and stable anti-DC receptor Ab–Ag complexes, which retain full DC-targeting function in vitro and in vivo. These bacterial domains were well expressed and functional, either as rAb.Doc secreted by mammalian cells or as Coh.antigen fusion proteins produced in E. coli or mammalian cells. Recombinant anti-DC receptor Ab–Ag complexes assembled through the dockerin–cohesin interaction are remarkably stable, especially in the presence of human serum, and retain native Ab binding properties to the DC receptor. Quantitative analysis of the interaction between rAb.Doc and Coh.antigen confirmed a high-affinity interaction between the two domains, within the range of high-affinity Ab–Ag interaction (24).

Anti-DC receptor rAb.Doc–Coh.antigen complexes are potentially very useful tools for in vitro and in vivo Ag-targeting studies. They effectively deliver Ag to the DC surface, permitting expansion in vitro of both CD4⁺ and CD8⁺ Ag-specific T cells in a DC receptor-dependent fashion. This was exemplified via targeting of two key Influenza Ags, M1 and HA1-1, to DCs through CD40. Infection with Influenza virus generates a broad range of CD4⁺ and CD8⁺ T cells that are reactive against most of the viral proteins (31), and many of these T cell epitopes are conserved across the various Influenza virus strains, making them attractive as potential Ags for invoking cellular immunity. Targeting the whole Flu M1 Ag to human DCs with anti-CD40.Doc–Coh.Flu M1 complex could efficiently expand Flu M1-specific memory CD8⁺ T cells. Also, targeting of Flu HA1-1 to human DCs via either a direct anti-CD40.Flu HA1-1 fusion protein or via a dockerin–cohesin mediated complex expanded anti-Flu HA1-1–specific memory CD4⁺ T cells in vitro with equal efficiency. The Influenza HA1 domain is one of the relevant Ags for raising protective humoral responses (32), and augmentation of anti-Flu HA1 Ab responses via DC targeting is an attractive option for novel Influenza vaccine development. Targeting of HA1-1 in vivo to mouse LCs via an anti-Lang.Doc–Coh.Flu HA1-1 complex evoked strong anti-Flu HA1-1 Ab responses at very low doses, and those Ag-specific Ab responses were dependent on both the dockerin–cohesin interaction and the targeted receptor.

Targeting of Flu HA1-1 in vivo to mouse Langerin via an anti-Lang.Doc–Coh.Flu HA1-1 complex versus a direct fusion protein yielded identical neutralizing serum anti-Flu HA1-1 Ab responses, as well as Flu HA1-1–specific T cell responses. These data indicate that this form of delivery does not affect the presentation of crucial epitopes for neutralization. These responses had minimal cross-reactivity to a different Influenza A strain hemagglutinin (H1N1, Flu HA1-Cal04), but these studies were without adjuvant, which should increase the magnitude of responses and thus the potential for cross-reactivity. An obvious difference between injection with direct fusion rAb versus a complex is the development of responses against the dockerin and cohesin components, which are neo-antigens with no major cross-reactivity to human proteins. In this respect, the similar efficacy of anti-Lang.Doc–Coh.Flu HA1-1 versus anti-Lang.Flu HA1-1 for both humoral and cellular responses suggests that anti-Doc and anti-Coh Abs are not a hindrance in such a “prime-boost” setting. However, much like viral vector-based vaccines, such anti-vector immunity could impede subsequent vaccinations. However, a wide selection of very distantly related Doc–Coh pairs are available that could be adapted to circumvent this possibility or dominant epitopes could be dulled by protein engineering (33).

In summary, our work demonstrates that noncovalent assembly of prototype DC-targeting vaccines is practical and greatly expands options for development of such vaccines delivering a multitude of Ags that cannot be efficiently expressed as direct fusions of rAb to Ag. Importantly, a single rAb–dockerin vaccine preparation can be efficiently linked to different Coh.antigen fusion proteins (e.g., different seasonal Influenza HA Ags) or a single Coh.antigen preparation can be linked to different anti-DC receptor rAbs, bringing the flexibility of combinatorial approaches to DC-targeting vaccine design and optimization. Prototype vaccines based on this technology enabled in vitro studies of targeting of Flu M1 to different DC subsets, including human blood DCs and skin DCs for expanding Ag-specific CD8⁺ T cell responses (16), and cross-priming of the neo-antigen MART-1 via targeting of human DCs (16, 18). Our new data provide the rationale, characterization, and validation of this technology for further use in both in vitro and in vivo studies.

We thank Drs. Michael Ramsay and William Duncan for support, Keiko Akagawa, Julien Blond, Brandon Hahm, and Guocheng He for some vector constructs and protein purifications, Aaron Martin for help with SPR, and Yaming Xue for HAI assays. We thank Drs. Ralph Steinman and Christine Trumpfheller for kindly providing vectors for anti-human DEC-205. mIgG2b rAb, and isotype control mIgG2b and the HIV Gag p24 component of our rAb.Gag p24 construct. We also thank the Adolfo Garcia-Sastre Laboratory for providing influenza cDNAs.

A.-L.F., E.K., and G.Z. are inventors on an issued patent concerning the dockerin–cohesin technologies described in this study. The application is held by the Baylor Research Institute, a nonprofit research arm of the Baylor Heath Care System. J.Q. is employed by ICx Nomadics, which develops and markets SPR instrumentation. The other authors have no financial conflicts of interest.