Expression of the cystic fibrosis transmembrane conductance regulator (CFTR) is altered in individuals with the ΔF508 CFTR mutation. We previously reported differential expression of microRNA (miRNA) in CF airway epithelium; however, the role of miRNA in regulation of CFTR expression here remains unexplored. In this study, we investigated the role of upregulated miRNAs in CFTR regulation in vivo in bronchial brushings from individuals homozygous or heterozygous for ΔF508 CFTR, validated our observations in vitro, and assessed the impact of defective chloride ion conductance, genotype, and colonization status on miRNA expression. miRNA target prediction was performed in silico, and expression of miRNA and target genes were measured by quantitative real-time PCR and/or Western blotting. Overexpression and inhibition studies were performed with pre-miRs or antimiRs, respectively, and a luciferase reporter gene was used to elucidate direct miRNA–target interactions. miR-145, miR-223, and miR-494 were upregulated in CF versus non-CF bronchial brushings and cell lines; in ΔF508 CFTR homozygotes versus heterozygotes; in subjects positive for P. aeruginosa; and in cells treated with a CFTR inhibitor or IL-1β. Reciprocal downregulation or upregulation of CFTR gene and/or protein expression was observed after miRNA manipulation and direct miRNA–target relationships demonstrated via a reporter system containing a wild type or mutated full-length CFTR 3′ untranslated region. Increased expression of miR-145, miR-223, and miR-494 in vivo in bronchial epithelium of individuals carrying the ΔF508 CFTR mutation correlates with decreased CFTR expression. Defective CFTR function, Pseudomonas colonization, and inflammation may affect miRNA expression and contribute to the regulation of ΔF508 CFTR.

Cystic fibrosis (CF) is a lethal genetic disease principally affecting white individuals. It has a high incidence in Europe and North America, and a carrier rate of ∼4% in the general population. The primary cause of CF is defective chloride ion transport due to mutations in the gene encoding the CF transmembrane conductance regulator (CFTR) protein (1). CFTR is an ATP-regulated chloride channel present within the apical surface of epithelial cells. More than 1800 CFTR mutations have been identified (CFTR mutation database: www.genet.sickkids.on.ca) and these can be subdivided into six classes (2). The most common CFTR mutants are those in class II, which occur because of defective protein processing; ΔF508 CFTR, which belongs to this class, is the most prevalent mutation worldwide (3).

Expression of CFTR is high in epithelial cells, where it is localized to the apical plasma membrane (4). Although CFTR expression is more abundant in intestinal, pancreatic, or kidney epithelial cells, it is expressed in nasal and bronchial biopsy tissue (5), and is expressed and functional in ciliated cells within the epithelium (6). Much is known about the spatial and developmental transcriptional regulation of CFTR (7). Other than alternative splicing (8, 9), there is little known regarding the posttranscriptional regulation of CFTR expression. However, a recent study has reported microRNA (miRNA) involvement in CFTR regulation in vitro (10).

miRNAs are short, noncoding RNAs that hybridize to miRNA recognition elements in the 3′-untranslated region (3′-UTR) of mRNA transcripts and predominantly block translation (1113). We have previously reported differential expression of miRNA in CF bronchial brushings (14). Of the 255 miRNA that are predicted to target CFTR (TargetScan 6.2), few have been examined and none in the context of CF in vivo. In this article, we describe the increased expression of specific miRNAs predicted to target CFTR in vivo and in vitro. We investigate the relationship between miRNAs and CFTR expression in individuals homozygous or heterozygous for the ΔF508 CFTR mutation and examine the effect of inhibition of the CFTR chloride ion channel on miRNA expression. We also determine the effects of miRNA manipulation on CFTR expression and function in vitro, and examine direct miRNA/CFTR 3′-UTR interactions. In addition, we explore how colonization with Pseudomonas aeruginosa, Staphylococcus aureus, or Aspergillus species relate to miRNA and CFTR expression, and examine the effects of Pseudomonas-conditioned media (PCM), LPS, and IL-1β on miRNA levels.

Following informed consent under a protocol approved by our Institutional Review Board, bronchial brushings were sampled from 23 individuals and RNA was isolated as previously described (14); CF (n = 14; 27.2 ± 2.7 y; male/female ratio, 8:6; confirmed by sweat testing and/or genotyping; Table I) and non-CF controls (n = 9; 50.8 ± 5.4 y; male/female ratio, 4:5). miRNA expression profiling was previously described for CF (n = 5; non-CF: n = 5) (14). Only CF samples from individuals with at least 1 ΔF508 CFTR allele were included in this study, which consisted of 4 samples from the original miRNA expression profiling screen and 10 additional brushings.

Table I.
Genotypes and colonization status of CF patients included in this study
Patient No.SexCFTR GenotypeP. aeruginosaS. aureusAspergillus Sp.
ΔF508/R506T > K Positive Positive Negative 
ΔF508/ΔF508 Positive Negative Negative 
ΔF508/R177H-5T Negative Positive Negative 
ΔF508/ΔF508 Positive Positive Positive 
ΔF508/unknown Positive Negative Negative 
ΔF508/ΔF508 Positive Negative Negative 
ΔF508/1717GA Positive Negative Positive 
ΔF508/621+1G > T Positive Negative Positive 
ΔF508/ΔF508 Positive Positive Negative 
10 ΔF508/G551D Positive Positive Positive 
11 ΔF508/621+1G > T Negative Negative Positive 
12 ΔF508/3007DELg Negative Negative Positive 
13 ΔF508/W361R Negative Positive Negative 
14 ΔF508/ΔF508 Negative Positive Negative 
Patient No.SexCFTR GenotypeP. aeruginosaS. aureusAspergillus Sp.
ΔF508/R506T > K Positive Positive Negative 
ΔF508/ΔF508 Positive Negative Negative 
ΔF508/R177H-5T Negative Positive Negative 
ΔF508/ΔF508 Positive Positive Positive 
ΔF508/unknown Positive Negative Negative 
ΔF508/ΔF508 Positive Negative Negative 
ΔF508/1717GA Positive Negative Positive 
ΔF508/621+1G > T Positive Negative Positive 
ΔF508/ΔF508 Positive Positive Negative 
10 ΔF508/G551D Positive Positive Positive 
11 ΔF508/621+1G > T Negative Negative Positive 
12 ΔF508/3007DELg Negative Negative Positive 
13 ΔF508/W361R Negative Positive Negative 
14 ΔF508/ΔF508 Negative Positive Negative 

All experiments were repeated in triplicate on at least three separate occasions. Human bronchial epithelial 16HBE14o (15) and ΔF508 homozygous CFBE41o cell lines were obtained as a gift from D. Gruenert (California Pacific Medical Center Research Institute, San Francisco, CA). HEK293 cells (human embryonic kidney cell line) were obtained from the European Collection of Cell Cultures (Salisbury, U.K.). Cell lines were routinely grown to 60–80% confluency in MEM (MEM+GlutaMax; Life Technologies) supplemented with 10% FCS (Life Technologies) and 1% penicillin-streptomycin (Life Technologies) in 75-cm2 flasks and maintained in a 37°C humidified incubator containing 5% CO2.

Before agonist treatment and after 24-h serum starvation, cells were washed with serum-free media and then placed in serum-free medium or IL-1β (10 ng/ml) or media containing 1% FCS for P. aeruginosa LPS (10 μg/ml; Sigma-Aldrich, St. Louis, MO) and Pseudomonas-conditioned media stimulation experiments. P. aeruginosa strain 01 was a gift from S. Smith (Trinity College Dublin, Ireland). PCM 1% (v/v) was prepared by filter sterilizing supernatants from 72-h P. aeruginosa strain 01 trypticase soy broth cultures. PCM contains multiple TLR agonists including lipopeptides, LPS, and uCpG DNA (16). For CFTR-inhibitor studies, 16HBE14o were treated with 10 μM CFTR inhibitor-172 (CFTRinh172; Sigma-Aldrich) in serum-free medium for 24 h. Total RNA was isolated for miRNA analysis by quantitative real-time PCR (qRT-PCR) analysis.

miRNA expression in brushings and cell lines was measured using TaqMan miRNA assays (Applied Biosystems, Foster City, CA) on the Roche LC480 LightCycler. Expression of miRNA relative to miR-218 was determined using the 2(−ΔΔCt) method (17). miR-218 was chosen for normalization because of a high degree of similarity in its expression levels between CF and non-CF brushings. All qRT-PCR experiments in cell lines were performed in triplicate, a minimum of three times, and included no-template controls. In silico target prediction analysis was performed using TargetScan 6.2 (release June 2012), MicroRNA.org, PITA, miRDB v4.0 (release Jan 2012), and Microcosm v5.0.

Total RNA was extracted using TriReagent, and equal quantities were reverse transcribed into cDNA using Quantitect Reverse Transcription Kit (Qiagen, Valencia, CA) following the manufacturer’s protocol. qRT-PCR was performed on the Roche LC480 LightCycler. CFTR gene expression was assessed in CF versus non-CF brushings and in cell lines. Primers for CFTR (forward 5′-CAAGGAGGAACGCTCTATCG-3′, reverse 5′-AGAACACGGCTTGACAGCTT-3′) and β-actin (forward 5′-GGACTTCGAGCAAGAGATGG-3′, reverse 5′-AGGAAGGAAGGCTGGAAGAG-3′) were obtained from MWG Eurofins Genetics (Ebersberg, Germany). Expression of CFTR relative to β-actin (data presented as fold differences) was determined using the 2(−ΔΔCt) method.

HEK293 cells (1 × 105 in triplicate) were transiently transfected with 250 ng of a luciferase reporter vector containing the full-length wild type (WT) 1.5-kb CFTR 3′-UTR (WT-CFTR-3′-UTR) or a negative control reporter containing full-length 1.5-kb CFTR 3′-UTR with mutations in the predicted binding sites (underlined) for miR-145 (WT: AATGATAACTGGAAACTTC, mutant: AATGATAACCGGTAACTTC), miR-223 (WT: ACTCCAAACTGACTCTTA, mutant: ACTCCAAATTAACTCTTA), and miR-494 (WT: TTAATAATGTTTCAAACATA, mutant: TTAATAATGCATCAAACATA) called Mut-CFTR-3′-UTR (Origene). Endogenous red fluorescent protein expressed within both the WT and MUT-CFTR 3′-UTR reporters was used to monitor transfection efficiency. Cells were cotransfected with a total of 30 nM synthetic pre-miR mimics (PMs) for miR-145, miR-221, miR-223, and miR-494 or a scrambled control (Applied Biosystems). PMs were transfected at 30 nM individually, all three combined at 10 nM each if three used, or 15 nM if just two used. Transfections were performed using Genejuice (Novagen, Madison, WI) for plasmid DNA and Ribojuice (Novagen) for miRNA in OptiMEM reduced serum media (Life Technologies) per the recommended conditions. Lysates were prepared 24 h after transfection, and measurement of firefly luciferase was performed using the Luciferase assay system (Promega, Madison, WI).

16HBE14o (1 × 105 for RNA or 3 × 105 for protein) or CFBE14o (8 × 104 for RNA) cells were transfected with a total of 30 nM of a scrambled control and either synthetic PMs or antimiRs (AMs) for miR-145, miR-223, and miR-494 (Applied Biosystems), respectively, using Ribojuice transfection reagent (Novagen). As an additional control, a PM and AM for miR-221, an miRNA also increased in CF in the expression profiling screen but not predicted to target CFTR was included. Cells were cotransfected with a fluorescently labeled nontargeting miRIDIAN miRNA mimic (Dharmacon) to monitor transfection efficiency. Total RNA was extracted from 16HBE14o and CFBE14o cells 48 h after transfection, and qRT-PCR was performed to measure CFTR mRNA and miRNA expression. Transfection efficiency was assessed by visualization of epifluorescence of the miRIDIAN negative control labeled with Thermo Scientific Pierce Dy547. For Western blotting, equal volumes of whole-cell lysates from 16HBE14o cells transfected for 48 h were separated on 4-12% Bis-Tris acrylamide gels (Invitrogen), transferred to polyvinylidene difluoride membranes (Roche), and probed with mouse anti-CFTR (R&D Systems catalog no. MAB25031) or rabbit anti-actin Abs (Millipore catalog no. MAB1501). Signals were detected using appropriate HRP-conjugated secondary Abs (Cell Signaling Technologies) and visualized by chemiluminescence (Millipore) on the Syngene G:Box chemi XL gel documentation system. Membranes were analyzed by densitometry using GeneTools software on the same system.

16HBE14o cells grown in a monolayer in 24-well plates were loaded with 1 mM fluorescent membrane permeable chloride indicator N-(ethoxycarbonylmethyl)-6-methoxyquinolinium bromide (MQAE) in phenol red–free DMEM at 37°C, 5% CO2 as previously described (1820). After 6 h, the cells were washed and maintained in MQAE-free, phenol red–free DMEM. MQAE fluorescence was measured using a Wallac Victor2 plate reader (Perkin Elmer) at excitation and emission wavelengths of 355 and 460 nm, respectively. A decrease in MQAE fluorescence reflects an increase in intracellular chloride concentration ([Cl]i). Fluorescence was measured in 0.1-s intervals for 1 min to determine the baseline of each experiment. Changes in [Cl]i upon cell stimulation were determined by expressing alterations in MQAE fluorescence in response to respective treatments relative to DMSO controls. After treatment with DMSO (vehicle control, 0.1%), CFTRinh172 (10 μM), or forskolin (FSK; 10 μM), fluorescence was measured for a further 10 min in 1-s intervals. Both CF and non-CF epithelial cell lines were transfected with a scrambled control and either a combination of AM145, -223, and -494 or PM145, -223, and -494 (100 nM in total), respectively. Cells were loaded with 1 mM MQAE 24 h posttransfection, and intracellular chloride levels were determined as described earlier. Transfection efficiency was estimated using a fluorescently labeled nontargeting miRIDIAN miRNA mimic to monitor transfection efficiency where uniform transfection was observed across all wells.

All analyses were performed using GraphPad PRISM 4.0 (San Diego, CA). Results are expressed as the mean ± SEM and were compared by Student t test or ANOVA as appropriate. Differences were considered significant at p ≤ 0.05.

We have previously reported differential expression of miRNA in CF versus non-CF bronchial brushings (14). It is possible that miRNA that are increased in vivo in CF bronchial epithelium might regulate expression of CFTR. Of the 255 miRNA predicted to regulate CFTR (TargetScan 6.2), 7 were differentially expressed in CF versus non-CF airway epithelium, 4 were upregulated (miR-101, -145, -223, and -494), and 3 were downregulated (miR-31, miR-331-3p, and miR-362-5p). For miR-101, only two samples passed the relative expression cutoff; therefore, we did not analyze it further. miR-145, miR-223, and miR-494 were modestly increased 2.16 ± 0.85, 5.7 ± 1.8, and 3.22 ± 0.84-fold, respectively. Three miRNA target prediction databases (TargetScan 6.2, microRNA.org, and PITA) predict these three miRNA to regulate CFTR. Fig. 1A depicts the full-length human CFTR 3′-UTR with locations of predicted binding sites for miR-145, miR-223, and miR-494, and Fig. 1B shows the locations and base-pair matches of predicted binding sites adapted from TargetScan 6.2.

FIGURE 1.

miRNA targeting the CFTR 3′-UTR and CFTR mRNA expression. (A) Highly conserved (*) and poorly conserved () predicted binding sites for miR-145, miR-223, and miR-494 in full-length (1554 bp) human CFTR 3′-UTR and (B) predicted binding sites and base-pair matches for miR-145, miR-223, and miR-494 within the 3′-UTR of CFTR as predicted by TargetScan 6.2.

FIGURE 1.

miRNA targeting the CFTR 3′-UTR and CFTR mRNA expression. (A) Highly conserved (*) and poorly conserved () predicted binding sites for miR-145, miR-223, and miR-494 in full-length (1554 bp) human CFTR 3′-UTR and (B) predicted binding sites and base-pair matches for miR-145, miR-223, and miR-494 within the 3′-UTR of CFTR as predicted by TargetScan 6.2.

Close modal

Quantification of CFTR mRNA expression in the same bronchial brushings and also in CFBE41o versus 16HBE14o cell lines demonstrated that CFTR expression was significantly decreased in the CF versus non-CF samples both in vivo and in vitro (p = 0.0004 and 0.004, respectively; Supplemental Fig. 1A, 1B). Only individuals carrying at least one ΔF508 CFTR allele were included in this study; genotypes are listed in Table I.

Next, the expression of miR-145, miR-223, and miR-494 from the miRNA expression profiling study (14) were independently verified by qRT-PCR using TaqMan miRNA assays. This was performed using the original 4 ΔF508 CFTR samples and 10 additional CF brushings, and also in the original and additional controls (total CF = 14; non-CF = 9). miR-145, miR-223, and miR-494 were significantly increased in the CF samples by 8.4-, 32.8- and 3.6-fold, respectively (p = 0.0017, 0.0054, and 0.0236, respectively; Fig. 2A). These higher fold changes are likely to be a truer reflection of the in vivo situation having been determined using miR-specific assays in 14 rather than the original 4 samples used for profiling. Expression of miR-145, miR-223, and miR-494 were also found to be significantly increased in vitro in ΔF508/ΔF508 CF versus non-CF bronchial epithelial cell lines (CFBE41o versus 16HBE14o, p = 0.02, 0.0011, and 0.0014, respectively; Fig. 2B).

FIGURE 2.

Relative expression levels of miR-145, miR-223, and miR-494 in vivo and in vitro. (A) Relative expression of miR-145, miR-223, and miR-494 was determined by qRT-PCR using individual TaqMan miRNA assays and normalized to miR-218 in bronchial brushings (non-CF: n = 9; CF: n = 14), and (B) in CFBE41o versus 16HBE14o (three different cultures in triplicate). All qRT-PCR experiments for cell lines were performed in triplicate and included no-template controls. Data are represented as mean ± SEM and were compared by t test (*p < 0.05, **p < 0.01).

FIGURE 2.

Relative expression levels of miR-145, miR-223, and miR-494 in vivo and in vitro. (A) Relative expression of miR-145, miR-223, and miR-494 was determined by qRT-PCR using individual TaqMan miRNA assays and normalized to miR-218 in bronchial brushings (non-CF: n = 9; CF: n = 14), and (B) in CFBE41o versus 16HBE14o (three different cultures in triplicate). All qRT-PCR experiments for cell lines were performed in triplicate and included no-template controls. Data are represented as mean ± SEM and were compared by t test (*p < 0.05, **p < 0.01).

Close modal

HEK293 cells were transiently transfected with a luciferase reporter vector containing the full-length WT 1.5-kb CFTR 3′-UTR (WT-CFTR-3′-UTR) or a negative control reporter with mutations in the predicted binding sites for these miRNAs (Mut-CFTR-3′-UTR) to determine whether CFTR is a true molecular target of miR-145, miR-223, and miR-494. Cotransfection with PM145, PM223, and PM494, alone or in various combinations, resulted in significant decreases in luciferase gene expression from WT-CFTR-3′-UTR compared with Mut-CFTR-3′-UTR demonstrating direct miRNA–target interaction (p ≤ 0.05; Fig. 3). The magnitude of miRNA-mediated luciferase repression was in the order of PM145+PM494 > PM145 > PM145+PM223 > all 3 > PM223+PM494 > PM223. Additive effects were not evident; however, this may be due to the fact that PMs were used individually at 30 nM and for the combination, only 10 nM of each was used (or 15 nM each when two were combined), so that the total concentration did not exceed 30 nM. Differences in luciferase expression between WT and mutant reporters after transfection with PM221 (included as an additional control) were not significant. Delivery of reporter constructs, and hence transfection efficiency, was monitored by visualization of endogenous red fluorescent protein within luciferase reporter vectors (Supplemental Fig. 2) where representative uniform transfection (estimated to be ∼50%) was observed across all wells.

FIGURE 3.

miR-145, miR-223, and miR-494 directly target CFTR. Relative luciferase activity in HEK293 cells transiently transfected with either WT-CFTR-3′-UTR or Mut-CFTR-3′-UTR and cotransfected with synthetic pre-miRs (PM) for miR-145, miR-223, and miR-494 individually and in combinations indicated. Experiments were performed in three separate cultures in triplicate. Data are represented as mean ± SEM and were compared by t test (*p < 0.05). Scr, Scrambled control.

FIGURE 3.

miR-145, miR-223, and miR-494 directly target CFTR. Relative luciferase activity in HEK293 cells transiently transfected with either WT-CFTR-3′-UTR or Mut-CFTR-3′-UTR and cotransfected with synthetic pre-miRs (PM) for miR-145, miR-223, and miR-494 individually and in combinations indicated. Experiments were performed in three separate cultures in triplicate. Data are represented as mean ± SEM and were compared by t test (*p < 0.05). Scr, Scrambled control.

Close modal

Next, the effect of miR-145, miR-223, and miR-494 overexpression on CFTR mRNA and protein was assessed. Non-CF 16HBE14o cells were transfected with synthetic pre-miRs for each of these miRNA individually and in combination (all three). A scrambled PM and PM221 were included as controls. Cells were cotransfected with a fluorescently labeled nontargeting miRIDIAN miRNA mimic to monitor transfection efficiency. Supplemental Fig. 3 shows the transfection efficiency of nontransfected (NT) and transfected cells, where >80–90% of cells are transfected as monitored by epifluorescence, and miRNA expression was increased after pre-miR transfection. Although levels appear greatly increased compared with controls, it has previously been determined that ectopic overexpression of miRNA at physiological levels using an expression plasmid has similar biological effects to the mature pre-miR introduced at supraphysiological levels (21).

Fig. 4A shows that pre-miR overexpression (PM145, PM223, PM494, and all three) significantly decreases CFTR mRNA expression by an average of 36.5% in 16HBE14o cells; PM221 has no effect. Overexpression of any single pre-miR induced as potent an effect on CFTR mRNA as a combination of all three. CFTR protein expression examined by Western blot was also decreased after transfection of PM145, PM223, or PM494, and to a greater extent with the combination of all three miRNAs (Fig. 4B). In SDS-PAGE, WT CFTR migrates with a characteristic banding pattern: band A (130 kDa), the core glycosylated band B (135 kDa), and the diffusely migrating mature glycosylated band C (150–170 kDa). The densitometry in Fig. 4C shows the fold change of bands A+B+C normalized to actin and confirms that CFTR protein is decreased by PM145, PM223, and PM494 by ∼33 and 52% (p = 0.0471) by all three combined.

FIGURE 4.

Effects of pre-miR overexpression. (A) CFTR mRNA expression in 16HBE14o cells after transfection of a scrambled control (Scr) and pre-miRs (PM) for miR-145, miR-223, and miR-494 alone or in combination (all three), and PM221 used as a control. qRT-PCR experiments were performed in triplicate and included no-template controls. Data are represented as mean ± SEM and were compared by t test (p = **0.0087, ***0.0043, *0.0238, *0.0238, and nonsignificant [n.s.], respectively). (B) Representative Western blots of CFTR and actin protein expression and (C) densitometry for three separate Western blots of CFTR relative to actin, Band A+B+C combined. All experiments were performed, n = 3. Data are represented as mean ± SEM (*p = 0.0471).

FIGURE 4.

Effects of pre-miR overexpression. (A) CFTR mRNA expression in 16HBE14o cells after transfection of a scrambled control (Scr) and pre-miRs (PM) for miR-145, miR-223, and miR-494 alone or in combination (all three), and PM221 used as a control. qRT-PCR experiments were performed in triplicate and included no-template controls. Data are represented as mean ± SEM and were compared by t test (p = **0.0087, ***0.0043, *0.0238, *0.0238, and nonsignificant [n.s.], respectively). (B) Representative Western blots of CFTR and actin protein expression and (C) densitometry for three separate Western blots of CFTR relative to actin, Band A+B+C combined. All experiments were performed, n = 3. Data are represented as mean ± SEM (*p = 0.0471).

Close modal

AMs are chemically modified siRNA-like molecules designed to knock down miRNA expression. CFBE41o cells were transfected with AM145, AM223, and AM494 alone and in combination, and ΔF508 CFTR mRNA expression was assessed. Both nontransfected (NT) and transfected cells are shown in Supplemental Fig. 4 where transfection efficiency is estimated qualitatively to be >80–90%, and miRNA expression after AM transfection is ∼35–40% decreased. Fig. 5 shows that knockdown of miR-145, miR-223, or miR-494 leads to a reciprocal increase in ΔF508 CFTR mRNA expression. When all three miRNAs are knocked down in combination, ΔF508 CFTR expression is increased, but not in a synergistic fashion. Control AM221 did not increase ΔF508 CFTR mRNA expression.

FIGURE 5.

ΔF508 CFTR expression after miRNA knockdown with AMs. ΔF508 CFTR mRNA expression in CFBE41o cells after transfection of a scrambled control (Scr) and AMs for miR-145, miR-223, and miR-494 alone or in combination (all three); AM221 was used as a control. qRT-PCR was performed in triplicate and included no-template controls. All experiments were performed, n = 3. Data are represented as mean ± SEM and were compared by t test (p = ***0.0043, ***0.0011, **0.019, *0.013, and nonsignificant [n.s.], respectively).

FIGURE 5.

ΔF508 CFTR expression after miRNA knockdown with AMs. ΔF508 CFTR mRNA expression in CFBE41o cells after transfection of a scrambled control (Scr) and AMs for miR-145, miR-223, and miR-494 alone or in combination (all three); AM221 was used as a control. qRT-PCR was performed in triplicate and included no-template controls. All experiments were performed, n = 3. Data are represented as mean ± SEM and were compared by t test (p = ***0.0043, ***0.0011, **0.019, *0.013, and nonsignificant [n.s.], respectively).

Close modal

To examine whether altered miR-145, miR-223, and miR-494 expression is a consequence of a lack of CFTR function, we treated 16HBE14o cells with CFTRinh172, a thiazolidine channel inhibitor highly selective for CFTR (22). After 24-h treatment with CFTRinh172, expression of all three miRNAs was significantly enhanced (p ≤ 0.05; Fig. 6A). Expression of miR-218 (the normalization control), not predicted to target CFTR, was not altered in response to CFTRinh172 (Fig. 6B). These results suggest that miR-145, miR-223, and miR-494 are constitutively upregulated in CF bronchial epithelium because of a lack of CFTR function. To assess the impact of ΔF508 CFTR on this finding, miRNA expression was quantified in bronchial brushings from ΔF508 CFTR homozygotes or heterozygotes versus non-CF controls (Fig. 6C–E). Expression of miR-145 and miR-223 was significantly higher in both groups compared with the non-CF controls (miR-145: p = 0.0035 and 0.0071; miR-223: p = 0.021 and 0.0122 for homozygotes and heterozygotes, respectively). miR-494 was significantly increased in the homozygote group compared with non-CF controls (p = 0.0415). There were no significant differences in miRNA expression between ΔF508 CFTR heterozygotes versus homozygotes.

FIGURE 6.

Inhibition of CFTR function and the ΔF508 genotype increases miR-145, miR-223, and miR-494 expression. (A) 16HBE14o cells were treated with 0.1% DMSO (control) or 10 μM CFTRinh172 for 24 h, and miR-145, miR-223, and miR-494 expression normalized to miR-218 was determined (n = 3). Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05). (B) miR-218 expression relative to β-actin in the same samples. (CE) MiR-145, miR-223, and miR-494 expression in bronchial brushings, subdivided into ΔF508 CFTR homozygotes versus heterozygotes (n = 5 and n = 9, respectively) compared with non-CF controls (n = 9). All qRT-PCR experiments were performed in triplicate and included no-template controls. Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05, **p ≤ 0.01).

FIGURE 6.

Inhibition of CFTR function and the ΔF508 genotype increases miR-145, miR-223, and miR-494 expression. (A) 16HBE14o cells were treated with 0.1% DMSO (control) or 10 μM CFTRinh172 for 24 h, and miR-145, miR-223, and miR-494 expression normalized to miR-218 was determined (n = 3). Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05). (B) miR-218 expression relative to β-actin in the same samples. (CE) MiR-145, miR-223, and miR-494 expression in bronchial brushings, subdivided into ΔF508 CFTR homozygotes versus heterozygotes (n = 5 and n = 9, respectively) compared with non-CF controls (n = 9). All qRT-PCR experiments were performed in triplicate and included no-template controls. Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05, **p ≤ 0.01).

Close modal

The chloride-sensitive, quinoline-based dye MQAE, which can measure [Cl]i, was used to establish whether inhibition or overexpression of miR-145, miR-223, and miR-494 affects CFTR function (23). In control experiments, non-CF 16HBE14o cells treated with CFTRinh172 (10 μM, 10 min) had significantly reduced MQAE fluorescence when compared with DMSO controls corresponding to an increase in [Cl]i content (p = 0.0152; Fig. 7). FSK treatment (10 μM, 10 min) induced the opposite effect, leading to a decrease in [Cl]i content (p = 0.0243; Fig. 7). After transfection of 16HBE14o cells with a combination of PM145, PM223, and PM494, MQAE fluorescence was significantly reduced, similar to that observed with CFTRinh172 (p ≤ 0.0001; Fig 7). Transfection of CFBE41o cells with AM145, AM223, and AM494 in combination led to an increase in MQAE fluorescence (p ≤ 0.0001; Fig 7). Together, these data suggest that manipulation of these miRNAs can influence chloride ion conductance, possibly via altered CFTR levels.

FIGURE 7.

AM inhibition or pre-miR overexpression of miR-145, miR-223, and miR-494 can influence intracellular chloride levels in CF and non-CF cell lines. 16HBE14o cells were treated with 0.1% DMSO (vehicle control), CFTRinh172 (10 μM, 10 min), or FSK (10 μM, 10 min), and measurement of [Cl]i using the chloride-sensitive dye MQAE was determined. Twenty-four hours posttransfection, intracellular chloride was measured in 16HBE14o and CFBE41o cells transfected with PM145, PM223, and PM494 or AM145, AM223, and AM494 in combination, respectively. Alterations in baseline MQAE fluorescence after cell treatments/transfection were determined relative to DMSO controls. Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05, ***p ≤ 0.01; n = 4).

FIGURE 7.

AM inhibition or pre-miR overexpression of miR-145, miR-223, and miR-494 can influence intracellular chloride levels in CF and non-CF cell lines. 16HBE14o cells were treated with 0.1% DMSO (vehicle control), CFTRinh172 (10 μM, 10 min), or FSK (10 μM, 10 min), and measurement of [Cl]i using the chloride-sensitive dye MQAE was determined. Twenty-four hours posttransfection, intracellular chloride was measured in 16HBE14o and CFBE41o cells transfected with PM145, PM223, and PM494 or AM145, AM223, and AM494 in combination, respectively. Alterations in baseline MQAE fluorescence after cell treatments/transfection were determined relative to DMSO controls. Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05, ***p ≤ 0.01; n = 4).

Close modal

Next, the effect of colonization status on miRNA and CFTR mRNA expression was assessed (Fig. 8, Table I). Of the 14 CF samples, 9 tested positive for P. aeruginosa, 7 for S. aureus, and 6 for Aspergillus species at the time of sampling. miR-145 expression was increased in all CF subgroups compared with the non-CF group (Fig. 8A). All subgroups, with the exception of P. aeruginosa negative, were associated with increased miR-223 expression; levels of this miRNA were significantly increased in P. aeruginosa–positive versus P. aeruginosa–negative samples (Fig. 8B). miR-494 expression was most significantly elevated in P. aeruginosa–positive versus non-CF samples, compared with any other subgroup (Fig. 8C). The P. aeruginosa–positive subgroup was also associated with the most significant decrease in CFTR mRNA expression (Fig. 8D).

FIGURE 8.

P. aeruginosa colonization increases miR-145, miR-223, and miR-494 expression and correlates with CFTR expression levels in vivo. CF samples were subdivided into P. aeruginosa, S. aureus, and Aspergillus spp. positive and negative versus non-CF controls where asterisks (*) represent CF versus non-CF, and number signs (#) represent P. aeruginosa–positive versus P. aeruginosa–negative. (AC) miR-145, miR-223, and miR-494 expression in bronchial brushings; (D) relative CFTR expression. Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ##p ≤ 0.01, ###p ≤ 0.001).

FIGURE 8.

P. aeruginosa colonization increases miR-145, miR-223, and miR-494 expression and correlates with CFTR expression levels in vivo. CF samples were subdivided into P. aeruginosa, S. aureus, and Aspergillus spp. positive and negative versus non-CF controls where asterisks (*) represent CF versus non-CF, and number signs (#) represent P. aeruginosa–positive versus P. aeruginosa–negative. (AC) miR-145, miR-223, and miR-494 expression in bronchial brushings; (D) relative CFTR expression. Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ##p ≤ 0.01, ###p ≤ 0.001).

Close modal

Overall, P. aeruginosa colonization appeared to be associated with the most significant increases in expression of all three miRNAs and the most significant decrease in CFTR mRNA expression. Also, of the three organisms evaluated, only P. aeruginosa showed a significant difference in CFTR (and miR-223) expression in positive versus negative samples. The mean forced expiratory volume in 1 s percentage predicted was 49.67 ± 8.3 for P. aeruginosa–positive and 85.8 ± 4.3 for P. aeruginosa–negative individuals.

Finally, to assess whether P. aeruginosa affected miRNA expression in vitro, CFBE41o cells were stimulated for 6 h with Pseudomonas-conditioned media, and the effects were compared with cells treated with P. aeruginosa LPS or IL-1β (Fig. 9). To confirm that the agonists were inducing a proinflammatory effect, IL-8 qRT-PCR and ELISA were performed; all stimuli significantly increased IL-8 mRNA and protein expression (data not shown). miRNA expression was measured by qRT-PCR. Fig. 9A shows that PCM increases expression of miR-145, miR-223, and miR-494; however, only the miR-145 response is significant (p = 0.0206). Conversely, treatment with LPS decreased expression of all three miRNA (miR-223 and -494; p = 0.0206 and p = 0.0465, respectively; Fig. 9B), indicating that LPS is not the factor present in PCM responsible for increased miRNA expression. IL-1β, which was used as a proinflammatory control, enhanced expression of both miR-145 (p = 0.0130) and miR-223 (p = 0.0022; Fig. 9C).

FIGURE 9.

Expression of miR-145, miR-223, and miR-494 is increased in CFBE41o cells stimulated with proinflammatory agonists PCM and IL-1β but not with LPS. (AC) Relative expression of miR-145, miR-223, and miR-494 in CFBE41o cells stimulated with PCM (1% v/v), LPS (10 μg/ml), or IL-1β (10 ng/ml) for 6 h (n = 3). All qRT-PCR experiments were performed in triplicate and included no-template controls (n = 3). Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05).

FIGURE 9.

Expression of miR-145, miR-223, and miR-494 is increased in CFBE41o cells stimulated with proinflammatory agonists PCM and IL-1β but not with LPS. (AC) Relative expression of miR-145, miR-223, and miR-494 in CFBE41o cells stimulated with PCM (1% v/v), LPS (10 μg/ml), or IL-1β (10 ng/ml) for 6 h (n = 3). All qRT-PCR experiments were performed in triplicate and included no-template controls (n = 3). Data are represented as mean ± SEM and were compared by t test (*p ≤ 0.05).

Close modal

In this article, we present the first report, to our knowledge, on a direct correlation between miRNA and CFTR expression in vivo in the bronchial epithelium of individuals with CF carrying a ΔF508 CFTR mutation. The data show that miR-145, miR-223, and miR-494 directly regulate CFTR expression via inhibition of luciferase expression from a WT-CFTR-3′-UTR reporter, and that modulation of these miRNAs can reciprocally regulate CFTR gene expression. Alterations in miRNA based on genotype and colonization status were observed, with the highest increases in miR-145, miR-223, and miR-494 expression occurring in ΔF508 CFTR homozygotes, and those positive for P. aeruginosa. Levels of CFTR expression in vivo based on P. aeruginosa status were also assessed where those positive for P. aeruginosa were found to have marked reduction in CFTR expression compared with P. aeruginosa–negative subjects. In vitro PCM and IL-1β amplified miRNA expression in a CF bronchial epithelial cell line, whereas LPS had the opposite effect, suggesting the involvement of other P. aeruginosa components. Chemical inhibition of CFTR increased expression of all three miRNAs, and overexpression or inhibition of the three miRNAs together led to alterations in intracellular chloride levels, implying functional effects on CFTR. The data suggest that regulation of CFTR by miRNAs represents a previously unidentified mechanism controlling CFTR levels, at least in those carrying a ΔF508 mutation. Many of the in vivo observations could be replicated in cell culture in the absence of patient-specific stimuli, indicating an intrinsic effect.

This study validates CFTR as a target of miR-223, and complements and extends the findings of recent reports documenting miRNA influences over CFTR expression (10, 24, 25). Gillen et al. (10) reported varying degrees of miRNA/CFTR interaction in pancreatic and colonic cell lines, and of 13 miRNAs examined found 4 that are predicted to target CFTR and are expressed in primary bronchial and tracheal cells (miR-101, -145, -331-3p, and -494). Consistent with this, our expression profiling screen detected the same four miRNAs in CF and non-CF bronchial epithelial cells in vivo. miR-101, -145, and -494 were upregulated in CF (together with miR-223), whereas miR-331-3p was downregulated. For miR-101, only two of five samples passed the relative expression cutoff; therefore, it was not analyzed further here. Although several of the 255 miRNAs predicted to regulate CFTR by TargetScan 6.2 may be important regulators of CFTR in different cells types, we found only 7 to be differentially expressed in CF versus non-CF airway epithelium. However, this does not account for those not tested in our arrays, which may also be of significance in the CF lung or miRNAs targeting CFTR by indirect means. For example, Ramachandran et al. (25) reported indirect regulation of CFTR by miR-138, an miRNA also increased in CF in our profiling study but not predicted to target CFTR, and therefore not pursued in this study.

There have been several reports on miR-145, miR-223, and miR-494. miR-145 is decreased in a variety of malignancies including lung cancer and is now considered a tumor suppressor (26). miR-223 and miR-494 have been described as oncomirs targeting the tumor suppressors F-box and WD-40 domain protein 7 (27), and phosphatase and tensin homolog (28), respectively. A role in allergic airway disease has also been proposed for miR-145 (29). Decreased expression of miR-145 and miR-223 was reported in cigarette smoke–exposed rat lungs and similarly, miR-223 was downregulated in primary human bronchial epithelial cells exposed to cigarette smoke (30, 31). Conversely, miR-223 was one of the most highly expressed miRNAs in chronic obstructive pulmonary disease smokers versus normal smokers in a study by Ezzie et al. (32). miR-223 expression can be increased in response to LPS in murine bronchial epithelial cells and alveolar macrophages of mild asthmatics (33, 34). In CF airway epithelial cells, we found LPS decreased miR-223 expression. In this article, we show that CFTR is a target of miR-145, miR-223, and miR-494, and that their expression is increased in vivo in the bronchial epithelium of ΔF508 CFTR carriers.

The ΔF508 CFTR mutation encodes a misfolded protein that is rapidly degraded (35). More than 95% of ΔF508 CFTR is retained in the endoplasmic reticulum and subsequently degraded by the proteosome; consequently, less protein reaches the apical membrane and chloride ion transport is impaired. ΔF508 CFTR accounts for up to 70% of CFTR mutations worldwide, and its frequency is even higher in the Irish population, with 90% of CF individuals carrying one or two alleles (36). Whether the altered miRNA pattern evident here is unique to ΔF508 individuals or is more broadly representative of other CFTR mutations remains to be determined.

A number of possibilities exist regarding the relationship between increased miR-145, miR-223, and miR-494 expression and decreased CFTR. It may be an intrinsic event directly linked to ΔF508 CFTR, although this is unlikely given that miRNA modulation in 16HBE14o cells expressing WT CFTR and in ΔF508-expressing CFBE41o cells generated comparable data. Alternatively, the observation that CFTR dysfunction impacts on the expression of these specific miRNAs may point toward an autoregulatory loop and the fact that the miRNAs are regulated by defective chloride ion transport. In support of this, we found that miR-218 was not regulated in response to CFTRinh172, indicating a specific effect on these miRNAs. In addition, we demonstrated that manipulation of these miRNAs can influence CFTR function based on alterations in intracellular chloride levels in CF and non-CF cell lines after inhibition and overexpression studies. Thus, regulation by miRNAs may be a previously unidentified mechanism regulating CFTR. Interestingly, miR-494 also targets SLC12A2, an Na-K-Cl transporter (10). Therefore, the decrease in MQAE fluorescence caused by overexpression of the combined miRNAs may be due, in part, to altered function of SLC12A2 or other ion channels, not only CFTR; conversely, the upregulation of chloride conductance after inhibition of miRNAs may be caused by stimulation of alternative channels to CFTR.

Although the data presented in this study support the concept that P. aeruginosa–positive CF bronchial brush samples express higher levels of miR-145, miR-223, and miR-494, the levels of these miRNAs in P. aeruginosa–negative samples were also increased, most likely as a result of altered chloride ion conductance. Low numbers of samples in the P. aeruginosa–negative population is, in part, responsible for this variation in the data. Another factor potentially confounding these data is the possibility that the change in miRNA levels related to P. aeruginosa–positive sputum also may be caused by contributions from neutrophils harvested with the epithelial cells from the bronchial brushings of these patients. Nonetheless, P. aeruginosa can contribute to increased miRNA expression given that the expression of these miRNAs is increased in bronchial epithelial cell lines in vitro in response to stimulation with PCM, where there are no neutrophils present.

With respect to other organisms in the CF lung that could contribute to altered miRNA expression, although Aspergillus and S. aureus colonization were somewhat associated with increases in miR-145, miR-223, and/or miR-494, the patterns were less clear than for P. aeruginosa. Further in-depth studies examining the contribution of these organisms and their components to altered miRNA expression in CF bronchial epithelium are warranted given their importance as CF lung pathogens.

In conclusion, the observations that miR-145, miR-223, and miR-494 regulate CFTR expression and that their increased expression in vivo correlates with decreased ΔF508 CFTR expression are novel. We show that defective CFTR, IL-1β, and Pseudomonas colonization not due to LPS upregulate miR-145, miR-223, and miR-494 expression in CF bronchial epithelium in vitro and/or in vivo. These data implicate intrinsic, inflammatory, and infective factors as influences on miRNA regulation of CFTR. This knowledge may influence future therapies for CF and other diseases where modulation of CFTR expression might be important.

16HBE14o and CFBE41o cell lines were obtained as a gift from D. Gruenert (Pacific Medical Center Research Institute, San Francisco, CA). We thank Drs. S. Keely and M. Mroz (Molecular Medicine, Royal College of Surgeons in Ireland) for advice on MQAE experiments.

This work was supported by the Science Foundation Ireland (12/TIDA/B2265) and the Medical Research Charities Group and Health Research Board.

The online version of this article contains supplemental material.

Abbreviations used in this article:

AM

antimiR

CF

cystic fibrosis

CFTR

cystic fibrosis transmembrane conductance regulator

CFTRinh172

cystic fibrosis transmembrane conductance regulator inhibitor-172

[Cl]i

intracellular chloride concentration

FSK

forskolin

HEK

human embryonic kidney

MQAE

N-(ethoxycarbonylmethyl)-6-methoxyquinolinium bromide

miRNA

microRNA

NT

nontransfected

PCM

Pseudomonas-conditioned medium

PM

pre-miR mimic

qRT-PCR

quantitative real-time PCR

3′-UTR

3′-untranslated region

WT

wild type.

1
Rowe
S. M.
,
Miller
S.
,
Sorscher
E. J.
.
2005
.
Cystic fibrosis.
N. Engl. J. Med.
352
:
1992
2001
.
2
Lommatzsch
S. T.
,
Aris
R.
.
2009
.
Genetics of cystic fibrosis.
Semin. Respir. Crit. Care Med.
30
:
531
538
.
3
Bobadilla
J. L.
,
Macek
M.
 Jr.
,
Fine
J. P.
,
Farrell
P. M.
.
2002
.
Cystic fibrosis: a worldwide analysis of CFTR mutations–correlation with incidence data and application to screening.
Hum. Mutat.
19
:
575
606
.
4
Crawford
I.
,
Maloney
P. C.
,
Zeitlin
P. L.
,
Guggino
W. B.
,
Hyde
S. C.
,
Turley
H.
,
Gatter
K. C.
,
Harris
A.
,
Higgins
C. F.
.
1991
.
Immunocytochemical localization of the cystic fibrosis gene product CFTR.
Proc. Natl. Acad. Sci. USA
88
:
9262
9266
.
5
Zeitlin
P. L.
,
Crawford
I.
,
Lu
L.
,
Woel
S.
,
Cohen
M. E.
,
Donowitz
M.
,
Montrose
M. H.
,
Hamosh
A.
,
Cutting
G. R.
,
Gruenert
D.
, et al
.
1992
.
CFTR protein expression in primary and cultured epithelia.
Proc. Natl. Acad. Sci. USA
89
:
344
347
.
6
Kreda
S. M.
,
Mall
M.
,
Mengos
A.
,
Rochelle
L.
,
Yankaskas
J.
,
Riordan
J. R.
,
Boucher
R. C.
.
2005
.
Characterization of wild-type and deltaF508 cystic fibrosis transmembrane regulator in human respiratory epithelia.
Mol. Biol. Cell
16
:
2154
2167
.
7
Lewandowska
M. A.
,
Costa
F. F.
,
Bischof
J. M.
,
Williams
S. H.
,
Soares
M. B.
,
Harris
A.
.
2010
.
Multiple mechanisms influence regulation of the cystic fibrosis transmembrane conductance regulator gene promoter.
Am. J. Respir. Cell Mol. Biol.
43
:
334
341
.
8
Hull
J.
,
Shackleton
S.
,
Harris
A.
.
1994
.
Analysis of mutations and alternative splicing patterns in the CFTR gene using mRNA derived from nasal epithelial cells.
Hum. Mol. Genet.
3
:
1141
1146
.
9
Zuccato
E.
,
Buratti
E.
,
Stuani
C.
,
Baralle
F. E.
,
Pagani
F.
.
2004
.
An intronic polypyrimidine-rich element downstream of the donor site modulates cystic fibrosis transmembrane conductance regulator exon 9 alternative splicing.
J. Biol. Chem.
279
:
16980
16988
.
10
Gillen
A. E.
,
Gosalia
N.
,
Leir
S. H.
,
Harris
A.
.
2011
.
MicroRNA regulation of expression of the cystic fibrosis transmembrane conductance regulator gene.
Biochem. J.
438
:
25
32
.
11
Lau
N. C.
,
Lim
L. P.
,
Weinstein
E. G.
,
Bartel
D. P.
.
2001
.
An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans.
Science
294
:
858
862
.
12
Lagos-Quintana
M.
,
Rauhut
R.
,
Lendeckel
W.
,
Tuschl
T.
.
2001
.
Identification of novel genes coding for small expressed RNAs.
Science
294
:
853
858
.
13
Ambros
V.
2001
.
microRNAs: tiny regulators with great potential.
Cell
107
:
823
826
.
14
Oglesby
I. K.
,
Bray
I. M.
,
Chotirmall
S. H.
,
Stallings
R. L.
,
O’Neill
S. J.
,
McElvaney
N. G.
,
Greene
C. M.
.
2010
.
miR-126 is downregulated in cystic fibrosis airway epithelial cells and regulates TOM1 expression.
J. Immunol.
184
:
1702
1709
.
15
Cozens
A. L.
,
Yezzi
M. J.
,
Kunzelmann
K.
,
Ohrui
T.
,
Chin
L.
,
Eng
K.
,
Finkbeiner
W. E.
,
Widdicombe
J. H.
,
Gruenert
D. C.
.
1994
.
CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells.
Am. J. Respir. Cell Mol. Biol.
10
:
38
47
.
16
Greene
C. M.
,
Carroll
T. P.
,
Smith
S. G.
,
Taggart
C. C.
,
Devaney
J.
,
Griffin
S.
,
O’neill
S. J.
,
McElvaney
N. G.
.
2005
.
TLR-induced inflammation in cystic fibrosis and non-cystic fibrosis airway epithelial cells.
J. Immunol.
174
:
1638
1646
.
17
Livak
K. J.
,
Schmittgen
T. D.
.
2001
.
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method.
Methods
25
:
402
408
.
18
Keitel
V.
,
Cupisti
K.
,
Ullmer
C.
,
Knoefel
W. T.
,
Kubitz
R.
,
Häussinger
D.
.
2009
.
The membrane-bound bile acid receptor TGR5 is localized in the epithelium of human gallbladders.
Hepatology
50
:
861
870
.
19
Marandi
N.
,
Konnerth
A.
,
Garaschuk
O.
.
2002
.
Two-photon chloride imaging in neurons of brain slices.
Pflugers Arch.
445
:
357
365
.
20
Reinehr
R.
,
Sommerfeld
A.
,
Keitel
V.
,
Grether-Beck
S.
,
Haüssinger
D.
.
2008
.
Amplification of CD95 activation by caspase 8-induced endosomal acidification in rat hepatocytes.
J. Biol. Chem.
283
:
2211
2222
.
21
Foley
N. H.
,
Bray
I. M.
,
Tivnan
A.
,
Bryan
K.
,
Murphy
D. M.
,
Buckley
P. G.
,
Ryan
J.
,
O’Meara
A.
,
O’Sullivan
M.
,
Stallings
R. L.
.
2010
.
MicroRNA-184 inhibits neuroblastoma cell survival through targeting the serine/threonine kinase AKT2.
Mol. Cancer
9
:
83
.
22
Ma
T.
,
Thiagarajah
J. R.
,
Yang
H.
,
Sonawane
N. D.
,
Folli
C.
,
Galietta
L. J.
,
Verkman
A. S.
.
2002
.
Thiazolidinone CFTR inhibitor identified by high-throughput screening blocks cholera toxin-induced intestinal fluid secretion.
J. Clin. Invest.
110
:
1651
1658
.
23
Verkman
A. S.
,
Sellers
M. C.
,
Chao
A. C.
,
Leung
T.
,
Ketcham
R.
.
1989
.
Synthesis and characterization of improved chloride-sensitive fluorescent indicators for biological applications.
Anal. Biochem.
178
:
355
361
.
24
Megiorni
F.
,
Cialfi
S.
,
Dominici
C.
,
Quattrucci
S.
,
Pizzuti
A.
.
2011
.
Synergistic post-transcriptional regulation of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) by miR-101 and miR-494 specific binding.
PLoS ONE
6
:
e26601
.
25
Ramachandran
S.
,
Karp
P. H.
,
Jiang
P.
,
Ostedgaard
L. S.
,
Walz
A. E.
,
Fisher
J. T.
,
Keshavjee
S.
,
Lennox
K. A.
,
Jacobi
A. M.
,
Rose
S. D.
, et al
.
2012
.
A microRNA network regulates expression and biosynthesis of wild-type and DeltaF508 mutant cystic fibrosis transmembrane conductance regulator.
Proc. Natl. Acad. Sci. USA
109
:
13362
13367
.
26
Sachdeva
M.
,
Zhu
S.
,
Wu
F.
,
Wu
H.
,
Walia
V.
,
Kumar
S.
,
Elble
R.
,
Watabe
K.
,
Mo
Y. Y.
.
2009
.
p53 represses c-Myc through induction of the tumor suppressor miR-145.
Proc. Natl. Acad. Sci. USA
106
:
3207
3212
.
27
Xu
Y.
,
Sengupta
T.
,
Kukreja
L.
,
Minella
A. C.
.
2010
.
MicroRNA-223 regulates cyclin E activity by modulating expression of F-box and WD-40 domain protein 7.
J. Biol. Chem.
285
:
34439
34446
.
28
Liu
L.
,
Jiang
Y.
,
Zhang
H.
,
Greenlee
A. R.
,
Han
Z.
.
2010
.
Overexpressed miR-494 down-regulates PTEN gene expression in cells transformed by anti-benzo(a)pyrene-trans-7,8-dihydrodiol-9,10-epoxide.
Life Sci.
86
:
192
198
.
29
Collison, A., J. Mattes, M. Plank, and P. S. Foster. 2011. Inhibition of house dust mite-induced allergic airways disease by antagonism of microRNA-145 is comparable to glucocorticoid treatment. J. Allergy Clin. Immunol. 128: 160–167.e4.
30
Izzotti
A.
,
Calin
G. A.
,
Arrigo
P.
,
Steele
V. E.
,
Croce
C. M.
,
De Flora
S.
.
2009
.
Downregulation of microRNA expression in the lungs of rats exposed to cigarette smoke.
FASEB J.
23
:
806
812
.
31
Schembri
F.
,
Sridhar
S.
,
Perdomo
C.
,
Gustafson
A. M.
,
Zhang
X.
,
Ergun
A.
,
Lu
J.
,
Liu
G.
,
Zhang
X.
,
Bowers
J.
, et al
.
2009
.
MicroRNAs as modulators of smoking-induced gene expression changes in human airway epithelium.
Proc. Natl. Acad. Sci. USA
106
:
2319
2324
.
32
Ezzie
M. E.
,
Crawford
M.
,
Cho
J. H.
,
Orellana
R.
,
Zhang
S.
,
Gelinas
R.
,
Batte
K.
,
Yu
L.
,
Nuovo
G.
,
Galas
D.
, et al
.
2012
.
Gene expression networks in COPD: microRNA and mRNA regulation.
Thorax
67
:
122
131
.
33
Moschos
S. A.
,
Williams
A. E.
,
Perry
M. M.
,
Birrell
M. A.
,
Belvisi
M. G.
,
Lindsay
M. A.
.
2007
.
Expression profiling in vivo demonstrates rapid changes in lung microRNA levels following lipopolysaccharide-induced inflammation but not in the anti-inflammatory action of glucocorticoids.
BMC Genomics
8
:
240
.
34
Williams
A. E.
,
Larner-Svensson
H.
,
Perry
M. M.
,
Campbell
G. A.
,
Herrick
S. E.
,
Adcock
I. M.
,
Erjefalt
J. S.
,
Chung
K. F.
,
Lindsay
M. A.
.
2009
.
MicroRNA expression profiling in mild asthmatic human airways and effect of corticosteroid therapy.
PLoS ONE
4
:
e5889
.
35
Cheng
S. H.
,
Gregory
R. J.
,
Marshall
J.
,
Paul
S.
,
Souza
D. W.
,
White
G. A.
,
O’Riordan
C. R.
,
Smith
A. E.
.
1990
.
Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis.
Cell
63
:
827
834
.
36
The Cystic Fibrosis Registry of Ireland. 2011 Annual Report. p. 23. Available at: http://www.cfri.ie/docs/annual_reports/CFRI2011.pdf. Accessed: February 8, 2013.

The authors have no financial conflicts of interest.