Newborn infants, including those born at term without congenital disorders, are at high risk of severe disease from respiratory syncytial virus (RSV) infection. Indeed, our current local surveillance data demonstrate that approximately half of children hospitalized with RSV were ≤3 mo old, and 74% were born at term. Informed by this clinical epidemiology, we investigated antiviral innate immune responses in early life, with the goal of identifying immunological factors underlying the susceptibility of infants and young children to severe viral lower respiratory tract infections. We compared RSV-induced innate cytokine production in blood mononuclear cells from neonates, young children aged 12–59 mo, and healthy adults. RSV-induced IFN-α production was primarily mediated by plasmacytoid dendritic cells (pDCs), and was significantly lower in term infants and young children < 5 y of age than in adults (p < 0.01). RSV-induced IFN-α production in human pDCs proceeded independently of endosomal TLRs, and human pDCs from healthy adult donors produced IFN-α in a retinoic acid–inducible gene I protein (RIG-I)–dependent manner. Of interest, young age and premature birth were independently associated with attenuated RIG-I–dependent IFN-α responses (p < 0.01). In contrast to IFN-α production, proinflammatory IL-6 responses to RSV were mediated by monocytes, appeared less dependent on RIG-I, and were significantly impaired only among preterm infants, not in term infants and young children. Our results suggest that human pDCs are less functional in early life, which may contribute to the increased susceptibility of infants and young children to severe RSV disease.

Human respiratory syncytial virus (RSV) is one of the most important pathogens in early childhood, infecting 60–70% of all children during their first year of life, and virtually all at least once before their third birthday (1, 2). Worldwide, RSV is estimated to cause >30 million new episodes of lower respiratory tract infection (LRTI) in children under 5 y of age each year, with 10% or more of affected children requiring hospitalization (equivalent to 2–3% of all live births) and ∼200,000 fatal outcomes (3). Treatment of children with severe RSV LRTI is largely restricted to supportive care, including oxygen supplementation and mechanical ventilation (4). Severe RSV disease in infancy is preventable by passive immunization during the RSV season with a humanized mAb (palivizumab) directed against the viral fusion protein (generally referred to as RSV immunoprophylaxis). However, the lack of useful indicators to identify the majority of children at risk, and the high costs of this therapy, restrict its use to relatively few children, particularly infants born very early in gestation and those with congenital heart disease (5). Thus, there is a pressing need to understand the immunological mechanisms responsible for the high risk of severe RSV infection in neonates.

Infants, especially those born prematurely (i.e., at <37 wk of gestation), rely heavily on their innate immune system to control viral infections (6, 7). Severe outcomes following infection with RSV are likely a consequence of the failure to mount appropriate innate antiviral immune defenses upon primary RSV infection, or perhaps an imbalance between beneficial antiviral responses and potentially pathological proinflammatory responses (7). The virus then disseminates into the lower respiratory tract, causing harmful inflammation of the bronchioles and alveoli, resulting in the clinical manifestations of severe bronchiolitis.

The retinoic acid–inducible gene I protein (RIG-I) is an RNA helicase and cytosolic pattern recognition receptor (PRR) that plays a pivotal role in innate immune sensing of RSV at the cellular level to inhibit viral replication and spreading (810). Specifically, RIG-I recognizes short, blunt-ended, dsRNA moieties with a 5′ triphosphate (5′ppp-dsRNA), as contained in the panhandle structure of the RSV genome (11, 12). RIG-I activation in virus-infected cells leads to the production and release of cytokines, particularly type I IFNs, as the primary response to virus detection (1315). Type I IFNs engage the IFN-α/β receptor expressed on all cell types and induce the expression of IFN-stimulated genes, thereby initiating an antiviral state that extends to noninfected cells (1618).

In this study, we examined antiviral innate immune responses in human neonates and young children. Our goal was to identify immunological factors that may underlie the susceptibility of infants and young children to severe viral LRTI. Guided by RSV surveillance data, we compared antiviral cytokine responses in blood mononuclear cells from term and preterm infants, young children between 12 and 59 mo of age, and healthy adults. Our results suggest that human pDCs are less functional in early life, which may contribute to the increased susceptibility of infants and young children to severe RSV disease.

RSV strains A2, Long (American Type Culture Collection), HLI 1 (19), and rgRSV30 (20) were propagated in HEp2 cells and isolated as described previously (21). RSV Long and A2 were further purified by ultracentrifugation on a discontinuous sucrose gradient (22). Aliquots were quick frozen in HBSS with 25 mM HEPES and 35–45% sucrose, and stored in liquid nitrogen. Virus titers were determined on HEp2 cells by end point dilution and counting syncytia using a mouse anti-RSV F protein Ab (Chemicon/EMD Millipore).

Our study was approved by the Clinical Research Ethics Board of the University of British Columbia. Written informed consent was obtained from all subjects. Cord blood samples were collected from infants delivered at term (≥37 wk of gestation) or very prematurely (≤32 wk of gestation). Peripheral blood samples from children aged 12 mo to < 5 y were collected from pediatric patients undergoing surgery for noninfectious and noninflammatory reasons (e.g., repair of hypospadias, orchiopexy, hernia repair, hydrocelectomy, dental surgery). Children who had been born prematurely (<37 wk of gestation) were excluded from peripheral blood collection. Adult blood samples were collected from healthy volunteers. Samples were collected in sodium heparin tubes (BD Biosciences) and processed within 3 h. Cord mononuclear cells (MNCs) and PBMCs were isolated by Ficoll density gradient centrifugation (BD Biosciences). For some experiments, pDCs were isolated by negative selection using the Human Plasmacytoid DC Enrichment Kit (STEMCELL Technologies). Purity of all pDC preparations was determined by flow cytometry. All infections and stimulations were performed in RPMI 1640 medium containing 2 mM l-glutamine, 1 mM sodium pyruvate, and 10% FBS (Thermo Scientific HyClone), using 96- or 24-well plates with 1–2 × 105 MNCs per well, and 104 cells per well after pDC enrichment, for ELISA, and 106 MNCs per well for intracellular cytokine staining. Cells were either infected with RSV or stimulated with 1 μg/ml 5′ triphosphate dsRNA (5′ ppp-dsRNA) in complex with LyoVec (InvivoGen), at 37°C in a humidified chamber with 5% CO2. As controls, cells either were stimulated with sucrose in HBSS/HEPES buffer (stabilizing agent for virus), 1 μg/ml dsRNA lacking a 5′ triphosphate (ctl-dsRNA) in complex with LyoVec (InvivoGen), or 1 μg/ml R848 (InvivoGen), or were left unstimulated. For intracellular cytokine staining, a protein transport inhibitor mixture containing brefeldin A and monensin (eBioscience) was added for the final 3 h (isolated pDCs) or 6 h (MNCs) (23).

We used a polychromatic flow cytometric assay and gating strategy, as described elsewhere (23, 24) and Abs to HLA-DR (clone TU36; BD Biosciences), CD14 (clone M5E2; BD Biosciences), CD123 (clone 6H6; eBioscience), CD11c (clone 3.9; eBioscience), IFN-α (clone A11 from Antigenix America or 7N4-1 from BD Biosciences), and IL-6 (clone MQ2-13A5; eBioscience). The integrated mean fluorescence intensity (iMFI) (25) was used as readout for IFN-α and IL-6 production. To determine the frequency of pDCs among adult and term neonatal MNCs as well as the purity of every pDC preparation, cells were stained with Abs to CD303 (clone AC144; Miltenyi Biotec) and CD123 (clone 6H6; eBioscience). GFP expression was used as readout for infectivity of recombinant strain rgRSV30.

We used Human IL-6 and IL-8 ELISA kits (eBioscience), as well as a Human IFN-α (pan-specific) ELISA kit (Mabtech).

Total RNA was isolated using the E.Z.N.A. HP Total RNA Isolation Kit (OMEGA bio-tek) and reverse transcribed using the iScript Reverse Transcription Supermix (Bio-Rad) according to the manufacturer’s instructions. Gene expression was assessed by quantitative PCR, using SYBR GreenER dye (Life Technologies) and a 7300 Real-Time PCR System (Applied Biosystems), with ACTB as internal reference. Primers used in this study are listed in Table I. Relative gene expression was calculated by the 2−∆∆Ct Livak method (26). All quantitative PCR experiments were performed in triplicate.

Table I.
Primers used in this study
GenePrimerSequence (5′–3′)
DDX58 Forward ACCAGAGCACTTGTGGACGC 
Reverse GCCGGGAGGGTCATTCCTGTG 
IFIH1 Forward CTGCAGTGTGCTAGCCTGTTCTGG 
Reverse TGTTCCCCAAGCCTGGCCACAT 
DHX58 Forward TGGGCAAGGCGCAGTTTCAGT 
Reverse CACCCGTGGGCAGCCAGATG 
MAVS Forward TACCCACACAGCAGGTGCGAC 
Reverse CCTGTGGGTCCAGGCAAGCG 
ACTB Forward GTTGCGTTACACCCTTTCTT 
Reverse ACCTTCACCGTTCCAGTTT 
GenePrimerSequence (5′–3′)
DDX58 Forward ACCAGAGCACTTGTGGACGC 
Reverse GCCGGGAGGGTCATTCCTGTG 
IFIH1 Forward CTGCAGTGTGCTAGCCTGTTCTGG 
Reverse TGTTCCCCAAGCCTGGCCACAT 
DHX58 Forward TGGGCAAGGCGCAGTTTCAGT 
Reverse CACCCGTGGGCAGCCAGATG 
MAVS Forward TACCCACACAGCAGGTGCGAC 
Reverse CCTGTGGGTCCAGGCAAGCG 
ACTB Forward GTTGCGTTACACCCTTTCTT 
Reverse ACCTTCACCGTTCCAGTTT 

To define the RSV season in British Columbia, we reviewed the number of children with confirmed RSV infection visiting the emergency room at the British Columbia Children's Hospital from 1994 to 2011. Primary diagnosis of RSV infection was made on nasopharyngeal washes by direct immunofluorescence assays (Chemicon/EMD Millipore; Meridian Bioscience) or enzyme immunoassays (BD Biosciences; Abbott).

To analyze the age and risk criteria profile of children with RSV infection who required admission to British Columbia Children’s Hospital during the 2009–2010 RSV season, all admissions between December 1st, 2009, and April 30th, 2010, were reviewed. We also reviewed all RSV admissions to the pediatric intensive care unit from January 1, 2005, to December 2009.

Statistical comparison of cytokine response between different subject groups was done using the nonparametric Mann–Whitney test (two groups) or the Kruskal–Wallis test (three groups) with Dunn's multiple comparison posttests and GraphPad Prism software. A p value ≤ 0.05 was considered statistically significant.

In the current era of RSV immunoprophylaxis, our first goal was to better define those individuals in the pediatric population who currently require hospitalization for RSV infection. Based on 15 y (1994–2011) of cumulative data on the number of children with confirmed RSV infection who visited the emergency room at the British Columbia Children's Hospital, we defined the RSV season to run from the end of November to the end of April (Fig. 1A). We then reviewed all RSV-related admissions that had occurred during the 2009–2010 RSV season at the British Columbia Children’s Hospital, the only pediatric referral center in the province of British Columbia, Canada. Among a total of 167 children < 5 y of age who were admitted, admissions peaked in infants of only 1 mo old, and 51% of all admissions were of infants ≤ 3 mo of age (Fig. 1B). Similar observations were made in a review of RSV-related admissions to the pediatric intensive care unit (PICU) from 2005 to 2009 (Fig. 1D). Importantly, of all admissions during the 2009–2010 RSV season, ≥ 93% of children did not fall into a risk group that would qualify them for palivizumab immunoprophylaxis—either they were born at term (74%) or late preterm (35–36 wk gestational age) (11%), and had no signs of congenital heart disease or other known clinical risk factors, or they were > 6 mo at the start of the RSV season (8%) (Fig. 1C).

FIGURE 1.

Surveillance data of children with RSV infection at British Columbia Children's Hospital. (A) Average number of RSV diagnoses per month of children who visited the emergency room from 1994 to 2011. Basing our findings on 15 y of cumulative data, we defined the RSV season in British Columbia, Canada to run from the end of November to the end of April. (B) Total number of children with RSV infection (n = 167) who required admission to British Columbia Children’s Hospital during the 2009–2010 RSV season, stratified by age. (C) Risk criteria profile of children with RSV infection who required admission to British Columbia Children’s Hospital during the 2009–2010 RSV season. (D) Total number of children with RSV infection (n = 136) who were admitted to the pediatric intensive care unit (PICU) at British Columbia Children’s Hospital from 2005 to 2009, stratified by age.

FIGURE 1.

Surveillance data of children with RSV infection at British Columbia Children's Hospital. (A) Average number of RSV diagnoses per month of children who visited the emergency room from 1994 to 2011. Basing our findings on 15 y of cumulative data, we defined the RSV season in British Columbia, Canada to run from the end of November to the end of April. (B) Total number of children with RSV infection (n = 167) who required admission to British Columbia Children’s Hospital during the 2009–2010 RSV season, stratified by age. (C) Risk criteria profile of children with RSV infection who required admission to British Columbia Children’s Hospital during the 2009–2010 RSV season. (D) Total number of children with RSV infection (n = 136) who were admitted to the pediatric intensive care unit (PICU) at British Columbia Children’s Hospital from 2005 to 2009, stratified by age.

Close modal

Given that most RSV-related admissions occurred in term infants in the first few months of life, we investigated whether infants and young children are less able than healthy adults to mount innate antiviral immune responses. For this purpose, we isolated MNCs from cord blood of term infants (GA ≥ 37 wk), from peripheral blood of healthy adult volunteers, and, as a third subject group, from young children (born at term) between 12 and 59 mo old who were undergoing surgery for noninfectious and noninflammatory indications. Of note, we chose this alternative recruitment strategy because it is ethically and logistically challenging to obtain blood samples from otherwise healthy young children. Cells from all three subject groups were exposed ex vivo to RSV strain Long. MNCs from cord blood of term infants and peripheral blood of healthy adults were also exposed to RSV strain A2 and community isolate HLI 1 (19) (the latter experimental conditions were not feasible for children aged 12 mo to < 5 y owing to the small peripheral blood volumes available for our study). We chose to focus on RSV strain Long because, unlike the other commonly used strain RSV A2, this strain is able to induce robust IFN-α responses in human PBMCs (27, 28). As controls, cells were exposed to a vehicle control (sucrose buffer) or were left unstimulated. We measured total levels of IFN-α and IL-6 at 24 h post infection. In comparison with healthy adults, we found RSV-induced IFN-α production to be greatly attenuated at birth (p < 0.001) (Fig. 2A). Consistent with individual differences in the trajectory of immune development, this response was much more variable in children aged 12 mo to 59 mo, but the response of these young children was significantly reduced compared with that of adults (p < 0.05). As expected, the difference in IFN-α production was most pronounced in response to RSV Long (Fig. 2A). IL-6 induction by RSV was not significantly different between adults, term infants, and young children (Fig. 2B). Because the difference in IFN-α production between adults and term infants appeared to be greatest in response to RSV Long and smallest in response to RSV A2, we decided to use both of these strains for further studies.

FIGURE 2.

RSV-induced (total) cytokine production in human peripheral and cord blood mononuclear cells from healthy adults, from term infants at birth, or from term-born children between 12 and 59 mo of age. Scatter plots showing IFN-α (A) and IL-6 (B) responses induced by RSV strains Long, A2, or HLI 1 (multiplicity of infection of 2), after subtracting the responses to the vehicle control (sucrose buffer). Note that responses in unstimulated cells (not shown) were similar to responses to the vehicle control. Horizontal lines depict the median responses within a given subject group. Numbers of individuals tested for each group are indicated in parentheses. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 2.

RSV-induced (total) cytokine production in human peripheral and cord blood mononuclear cells from healthy adults, from term infants at birth, or from term-born children between 12 and 59 mo of age. Scatter plots showing IFN-α (A) and IL-6 (B) responses induced by RSV strains Long, A2, or HLI 1 (multiplicity of infection of 2), after subtracting the responses to the vehicle control (sucrose buffer). Note that responses in unstimulated cells (not shown) were similar to responses to the vehicle control. Horizontal lines depict the median responses within a given subject group. Numbers of individuals tested for each group are indicated in parentheses. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

Next, we wanted to identify the blood mononuclear cell type that is responsible for RSV-induced IFN-α production among healthy adults and that is less responsive to RSV in infants at birth. We stimulated MNCs from cord blood of term infants and peripheral blood of healthy adults with RSV strains Long and A2 for 24 h. MNCs of children between 12 and 59 mo old were not analyzed owing to the small peripheral blood volumes obtained from these children. We quantified IFN-α and IL-6 production at the single-cell level by intracellular cytokine staining and polychromatic flow cytometry, allowing us to differentiate between monocytes, myeloid (conventional) dendritic cells, and plasmacytoid dendritic cells (pDCs) (Fig. 3A). iMFI (25) was used as a readout, which incorporates both the magnitude (frequency of cytokine-producing cells) and the potency or quality of the response (MFI of the cytokine-positive population). As shown in Fig. 3B, pDCs of healthy adult individuals were the primary source of IFN-α after ex vivo stimulation with RSV. More importantly, the ability of both RSV Long and A2 to induce IFN-α production was highly attenuated in pDCs from term infants at birth when compared with adult pDCs (p < 0.01) (Fig. 3B). Another way to analyze these data is by comparing the percent of positive (cytokine-producing) cells, which revealed significantly lower frequencies of IFN-α–producing neonatal pDCs in response to in vitro infection with RSV A2 or Long, in comparison with pDCs from adult donors treated under the same experimental conditions (p < 0.05). Specifically, there were 6.3% and 4.5% of IFN-α–positive pDCs from neonates post infection with RSV A2 and Long, respectively, whereas in the adult sample group, there were 14.5% and 11.5% of IFN-α–positive pDCs post infection with RSV A2 and Long, respectively. In contrast, IL-6 production was primarily mediated by monocytes, detectable only in response to RSV A2, and not different between neonatal and adult subject groups (Fig. 3C). We also assessed the frequency of pDCs in MNCs from peripheral blood of healthy adults and cord blood from term neonatal subjects. For this purpose, we isolated primary MNCs from peripheral blood samples of 23 healthy adults and cord blood samples of 24 term neonatal subjects, and stained the cells for surface markers CD303 and CD123. The median frequency of CD303 and CD123 double-positive pDCs in MNCs from the 23 adult donors was 0.34% (range: 0.19–0.83%), which was only slightly higher than the median frequency of 0.23% (range: 0.10–0.97%) pDCs in MNCs isolated from cord blood of 24 term neonatal subjects.

FIGURE 3.

Intracellular cytokine staining and polychromatic flow cytometry of cord and PBMCs from healthy adults and term infants. (A) Representative sample from a healthy adult donor whose cells were infected ex vivo with RSV Long. Contour plots (with outliers) showing gating strategy used to identify various innate immune cell subsets as follows. pDCs: MHCIIpos, CD14neg/low, CD11cneg, CD123pos/high; myeloid (conventional) dendritic cells: MHCIIpos, CD14neg/low, CD123neg/low, CD11cpos; and monocytes: MHCIIpos, CD14pos/high. (B and C) Stacked bars showing mean iMFI + SEM of IFN-α–positive (B) and IL-6–positive (C) pDC, mCD, and monocyte populations upon infection with RSV Long or RSV A2 (multiplicity of infection of 2). **p < 0.01, iMFI IFN-α–positive pDCs from adults versus term infants.

FIGURE 3.

Intracellular cytokine staining and polychromatic flow cytometry of cord and PBMCs from healthy adults and term infants. (A) Representative sample from a healthy adult donor whose cells were infected ex vivo with RSV Long. Contour plots (with outliers) showing gating strategy used to identify various innate immune cell subsets as follows. pDCs: MHCIIpos, CD14neg/low, CD11cneg, CD123pos/high; myeloid (conventional) dendritic cells: MHCIIpos, CD14neg/low, CD123neg/low, CD11cpos; and monocytes: MHCIIpos, CD14pos/high. (B and C) Stacked bars showing mean iMFI + SEM of IFN-α–positive (B) and IL-6–positive (C) pDC, mCD, and monocyte populations upon infection with RSV Long or RSV A2 (multiplicity of infection of 2). **p < 0.01, iMFI IFN-α–positive pDCs from adults versus term infants.

Close modal

Hornung et al. (27) demonstrated that RSV-mediated IFN-α production in human pDCs from healthy adult donors depends upon viral replication in the cytosol but remained unaffected by chloroquine, which inhibits endosome maturation and endosomal TLR function. To confirm that RSV-mediated IFN-α production in human pDCs is indeed independent of endosomal TLRs, we isolated human pDCs from healthy adult donors by negative selection (Fig. 4A), and infected the cells with a recombinant, GFP-expressing RSV strain (rgRSV30), in either the absence or presence of 0.25 μM bafilomycin. Similar to chloroquine, bafilomycin is an inhibitor of endosomal acidification and autophagy. At 24 h post infection, we determined the percent of rgRSV30-infected (GFP-stained) cells and IFN-α production by intracellular cytokine staining (Fig. 4B). We observed no significant differences in RSV infectivity or RSV-induced IFN-α production between the bafilomycin-treated and untreated pDCs (Fig. 4D), confirming that viral entry and IFN-α production in these cells are independent of endosome acidification, which is a necessary step for the function of endosomal TLRs. In contrast, treatment of isolated pDCs with bafilomycin abolished IFN-α induction with the TLR7/8 agonist R848 as early as 3 h after stimulation, as well as R848-induced MHC II upregulation at a later time point (24 h), providing evidence that TLR7/8 function was inhibited under our experimental conditions (Fig. 4C).

FIGURE 4.

RSV entry and RSV-mediated IFN-α responses in human pDCs are independent of endosomal TLRs. (A) FACS dot plots showing percentage of CD123 and CD303 double-positive cells (pDCs) before (left) and after (right) enrichment by negative selection from PBMCs of a healthy adult donor. (BD) IFN-α production in highly enriched pDCs that were mock infected/unstimulated; infected with GFP-expressing, recombinant RSV strain rgRSV30 at a multiplicity of infection of 10 (B, D); or stimulated with 1 μg/ml R848 (C) in the absence of, or after 30 min pretreatment with, 0.25 μM bafilomycin. FACS dot plots depict intracellular IFN-α staining and either GFP staining (B) or MHC II expression (C) from one representative experiment. Bar diagrams (D) depict mean values ± SEM of percent infectivity (% GFP-positive cells) and iMFI of IFN-α of data from three independent experiments and different donors. Statistical comparisons were made using the Student t test. *p < 0.05, **p < 0.01.

FIGURE 4.

RSV entry and RSV-mediated IFN-α responses in human pDCs are independent of endosomal TLRs. (A) FACS dot plots showing percentage of CD123 and CD303 double-positive cells (pDCs) before (left) and after (right) enrichment by negative selection from PBMCs of a healthy adult donor. (BD) IFN-α production in highly enriched pDCs that were mock infected/unstimulated; infected with GFP-expressing, recombinant RSV strain rgRSV30 at a multiplicity of infection of 10 (B, D); or stimulated with 1 μg/ml R848 (C) in the absence of, or after 30 min pretreatment with, 0.25 μM bafilomycin. FACS dot plots depict intracellular IFN-α staining and either GFP staining (B) or MHC II expression (C) from one representative experiment. Bar diagrams (D) depict mean values ± SEM of percent infectivity (% GFP-positive cells) and iMFI of IFN-α of data from three independent experiments and different donors. Statistical comparisons were made using the Student t test. *p < 0.05, **p < 0.01.

Close modal

Endosomal TLR-independent IFN-α production in human pDCs suggested a role for the cytosolic RIG-I receptor as seen in other cell types (810). To test whether RIG-I is functional in primary human pDCs from adults and term neonates at birth, we isolated pDCs from cord blood MNCs of term infants and from PBMNCs of healthy adult volunteers by negative selection (Fig. 4A). Again, children between 12 and 59 mo of age were omitted from this analysis owing to the small peripheral blood volumes obtained from these children. The highly enriched pDC preparations were transfected with a synthetic RIG-I agonist, namely, a dsRNA-19mer containing a 5′ triphosphate (5′ppp-dsRNA). To control for RIG-I–independent responses, we transfected the cells with a similar dsRNA-19mer, which lacked the 5′ triphosphate group (ctl-dsRNA) required for RIG-I activation (11, 12). As shown in Fig. 5A, pDCs isolated from healthy adults were capable of producing IFN-α in a RIG-I–dependent manner, but this response was highly attenuated in term infants at birth (p < 0.01). We also assessed the relative expression of the DDX58 gene encoding RIG-I, as well as IFIH1 (MDA5), DHX58 (LGP2), and MAVS in pDCs isolated from healthy adults and term infants at birth using primers listed in Table I. This assessment was done either at baseline or upon infection with RSV strains Long and A2. Despite differential RIG-I–dependent IFN-α production, median DDX58 gene expression profiles between adults and term infants appeared to be similar. In both adult and neonatal pDCs, DDX58 gene expression was upregulated upon RSV infection (Fig. 5B). Similarly, we found IFIH1 to be upregulated upon RSV infection (Fig. 5C), whereas DHX58 remained undetectable under all conditions. MAVS expression appeared to be downregulated upon RSV infection (Fig. 5D), although this finding was statistically significant only upon infection of adult pDCs with RSV A2. Importantly, no gene expression defect was found in neonatal pDCs that could explain the differences in their responsiveness to RSV or synthetic RIG-I ligands. Of note, owing to the limited availability of blood samples and the low abundance of pDCs in peripheral and cord blood, we were not able to assess RIG-I expression at the protein level.

FIGURE 5.

RIG-I–dependent IFN-α production, but not RIG-I–like receptor gene expression, is attenuated in human pDCs in term infants at birth. (A) Scatter plots showing IFN-α secretion in enriched pDCs from healthy adults and term infants upon transfection with synthetic 5′PPP-dsRNA (RIG-I agonist), normalized per 10,000 CD123 and CD303 double-positive cells. To control for RIG-I–independent responses to intracellular dsRNA, cells were transfected with a nontriphosphate control ligand (ctl-dsRNA). (BD) Fold expression of DDX58 encoding RIG-I (B), IFIH1 encoding MDA5 (C), and MAVS (D) in enriched pDCs from healthy adults and term infants, relative to the median gene expression levels in unstimulated pDCs from adult donors. Cells were either infected for 24 h with RSV strains A2 and Long (MOI 20) or left uninfected. Log2-transformed values are reported, to display up- and downregulated gene expression levels. Relative gene expression between groups was analyzed by the 2−ΔΔCt Livak method using the ACTB gene as a reference, and normalized based on the percentage of CD123 and CD303 double-positive cells in each preparation. Note that in some cases, gene expression was undetectable and therefore not included in the analysis. Horizontal lines depict the median responses within a given subject group. Numbers of individuals tested for each group are indicated in parentheses. **p < 0.01, ***p < 0.001.

FIGURE 5.

RIG-I–dependent IFN-α production, but not RIG-I–like receptor gene expression, is attenuated in human pDCs in term infants at birth. (A) Scatter plots showing IFN-α secretion in enriched pDCs from healthy adults and term infants upon transfection with synthetic 5′PPP-dsRNA (RIG-I agonist), normalized per 10,000 CD123 and CD303 double-positive cells. To control for RIG-I–independent responses to intracellular dsRNA, cells were transfected with a nontriphosphate control ligand (ctl-dsRNA). (BD) Fold expression of DDX58 encoding RIG-I (B), IFIH1 encoding MDA5 (C), and MAVS (D) in enriched pDCs from healthy adults and term infants, relative to the median gene expression levels in unstimulated pDCs from adult donors. Cells were either infected for 24 h with RSV strains A2 and Long (MOI 20) or left uninfected. Log2-transformed values are reported, to display up- and downregulated gene expression levels. Relative gene expression between groups was analyzed by the 2−ΔΔCt Livak method using the ACTB gene as a reference, and normalized based on the percentage of CD123 and CD303 double-positive cells in each preparation. Note that in some cases, gene expression was undetectable and therefore not included in the analysis. Horizontal lines depict the median responses within a given subject group. Numbers of individuals tested for each group are indicated in parentheses. **p < 0.01, ***p < 0.001.

Close modal

Infants born early in gestation are at highest risk of severe RSV infection (29, 30). Therefore, we hypothesized that, in these high-risk premature infants, attenuation of RIG-I function may be even more pronounced than in infants born at term. To test this hypothesis, we obtained cord blood from term infants [gestational age (GA) ≥ 37 wk] and from infants born at very low gestational age [(VLGA), ≤32 wk]. We did not recruit mid- and late-preterm infants (GA ≥ 33 and ≤ 36) for our study, to allow the comparison of clearly distinct groups. Because pDCs are present in comparable numbers in cord blood from VLGA infants compared with term infants (31), we transfected MNCs of these two subject groups with the synthetic RIG-I agonist (5′ppp-dsRNA). As controls, cells were transfected with the RIG-I–independent control ligand (ctl-dsRNA), were exposed to a vehicle control (transfection reagent), or were left unstimulated. IFN-α and IL-6 production was measured 24 h after stimulation. As shown in Fig. 6, IFN-α production in response to the synthetic 5′ppp-dsRNA ligand was highly dependent on RIG-I (i.e., median IFN-α responses to the RIG-I–independent control ligand were reduced by ∼75% in comparison with the RIG-I agonist). Importantly, we found IFN-α production among the term infant group to be significantly higher than in the VLGA infant group (p < 0.01) (Fig. 6A). We also observed that in term infants, proinflammatory IL-6 responses to the synthetic RIG-I agonist were significantly higher in comparison with those in the VLGA infant group, but this trend was also seen in response to the RIG-I–independent control ligand, albeit with slightly lower IL-6 levels in the term infants group (Fig. 6B).

FIGURE 6.

Cytokine production in human cord blood mononuclear cells from term infants (GA ≥ 37 wk) and preterm infants born at VLGA (GA ≤ 32 wk) in response to cytosolic, nonself RNA. Shown are scatter plots depicting IFN-α (A) and IL-6 (B) responses upon transfection with 5′ppp-dsRNA (RIG-I agonist) or ctl-dsRNA lacking a 5′ triphosphate (RIG-I–independent control ligand), after subtracting the responses to the vehicle control (transfection reagent). Horizontal lines depict the median responses within a given subject group. Numbers of individuals tested for each group are indicated in parentheses. **p < 0.01, ***p < 0.001.

FIGURE 6.

Cytokine production in human cord blood mononuclear cells from term infants (GA ≥ 37 wk) and preterm infants born at VLGA (GA ≤ 32 wk) in response to cytosolic, nonself RNA. Shown are scatter plots depicting IFN-α (A) and IL-6 (B) responses upon transfection with 5′ppp-dsRNA (RIG-I agonist) or ctl-dsRNA lacking a 5′ triphosphate (RIG-I–independent control ligand), after subtracting the responses to the vehicle control (transfection reagent). Horizontal lines depict the median responses within a given subject group. Numbers of individuals tested for each group are indicated in parentheses. **p < 0.01, ***p < 0.001.

Close modal

Finally, we asked the question whether RIG-I–dependent innate immune responses remain attenuated during early childhood, similar to what we have observed with regard to RSV-induced type I IFN production (Figs. 2, 3). For this purpose, we obtained peripheral blood samples from young children aged 12 to 59 mo who were born after a full pregnancy, as described above. As control groups, we recruited healthy adult volunteers or obtained cord blood samples from term infants at birth. Isolated MNCs of the three subject groups were stimulated either with the synthetic RIG-I agonist (5′ppp-dsRNA) or with the RIG-I–independent control ligand (ctl-dsRNA). As additional controls, cells were exposed to a vehicle control (transfection reagent) or were left unstimulated. Similar to the RSV-mediated responses, RIG-I stimulation of MNCs from cord blood of newborn term infants as well as peripheral blood of young children aged 12 mo to < 5 y demonstrated significantly reduced IFN-α responses in comparison with those in adults, whereas IL-6 responses were not significantly different between the three subject groups (Fig. 7). Of note, although we did observe age-dependent differences in IFN-α production, overall levels also appeared to be reduced in comparison with the previous experiment, which was likely due to a difference in the batch of dsRNA ligands used for the two experiments.

FIGURE 7.

RIG-I–dependent cytokine production in human peripheral and cord blood MNCs from healthy adults, term infants at birth, or young children between 12 and 59 mo of age. Shown are scatter plots depicting IFN-α (A) and IL-6 (B) responses upon transfection with 5′ppp-dsRNA (RIG-I agonist) or ctl-dsRNA lacking a 5′ triphosphate (RIG-I–independent control ligand), after subtracting the responses to the vehicle control (transfection reagent). Horizontal lines depict the median responses within a given subject group. Numbers of individuals tested for each group are indicated in parentheses. *p < 0.05,**p < 0.01.

FIGURE 7.

RIG-I–dependent cytokine production in human peripheral and cord blood MNCs from healthy adults, term infants at birth, or young children between 12 and 59 mo of age. Shown are scatter plots depicting IFN-α (A) and IL-6 (B) responses upon transfection with 5′ppp-dsRNA (RIG-I agonist) or ctl-dsRNA lacking a 5′ triphosphate (RIG-I–independent control ligand), after subtracting the responses to the vehicle control (transfection reagent). Horizontal lines depict the median responses within a given subject group. Numbers of individuals tested for each group are indicated in parentheses. *p < 0.05,**p < 0.01.

Close modal

In the current era of RSV immunoprophylaxis, RSV-related illness remains a significant health problem in the pediatric population, particularly among late preterm and term infants (5). Our findings are consistent with recent population-based studies that have also demonstrated that most children hospitalized with RSV infection were previously healthy (32, 33). This observation suggests that control strategies targeting only newborns with pre-existing clinical problems will have a limited effect on the total disease burden of RSV infection. Novel indicators to identify otherwise healthy term and late preterm infants who are at risk for severe RSV disease are needed (32, 33).

We examined the ability of innate immune cells from term neonates to respond to viral infection. It has been postulated that severe outcomes following RSV infection are due, at least in part, to a failure to mount appropriate innate antiviral immune defenses or to an imbalance between antiviral and proinflammatory cytokine responsiveness (7). Our focus on innate immune responses in blood mononuclear cells was deliberate. Hematopoietic cells are permissive to RSV and may serve as a reservoir for this virus in vivo (34). Dendritic cells play a central role in shaping the immune response to, and outcome of, RSV infection (35, 36). In agreement with previous studies (27), we demonstrate that in human hematopoietic cells, type I IFN responses to RSV are primarily mediated by pDCs and are independent of endosomal TLRs. Intriguingly, we found pDCs of term neonates to be profoundly impaired in their capacity to produce IFN-α when compared with those of adults, both in response to RSV and in response to a synthetic RIG-I agonist. pDCs are specialized immune cells that infiltrate the lung to produce large amounts of type I IFN in response to viral infection, and they play a pivotal role in the outcome of RSV infection in a mouse model (35, 36). In addition, we found the IFN-α production in MNCs in response to RSV Long and a synthetic RIG-I agonist to be lower among children aged 12 mo to < 5 y when compared with the responses among healthy adults. However, this analysis was limited in that we were not able to assess cell type–specific cytokine responses, owing to the small blood volumes available from these children.

An important finding in our study is that we observed a functional role for RIG-I in human pDCs. We demonstrate that primary human pDCs from healthy adult donors respond to cytosolic delivery of synthetic (non-self) dsRNA in a RIG-I–dependent manner, consistent with the response in human airway epithelial cells (9, 10) and murine fibroblasts (8), thereby explaining the ability of RSV to induce type I IFN production independent of endosomal TLRs and PKR (27). However, this is in contrast to the generally stated model in which pDCs sense other ssRNA viruses, such as influenza virus, vesicular stomatitis virus, and Newcastle disease virus, primarily via endosomal TLRs 7 and 8 (3740). The differences may be explained by the distinct viral entry mechanisms. Unlike influenza virus, vesicular stomatitis virus, or Newcastle disease virus, RSV fusion does not require endosomal maturation and acidification (41, 42), which in turn is a necessary step for endosomal TLR function. Therefore, the ssRNA genome may not be accessible to TLR7 upon RSV entry of human pDCs. Further studies are needed to clarify ligand accessibility during the RSV life cycle, particularly in the context of innate immune recognition of RSV by DCs and alveolar macrophages (for a more comprehensive discussion, see our recent review article, Ref. 43). Moreover, diverging results may also be due to species-specific differences. Most studies were done using murine (CD11c+B220+) pDCs, which express a surface marker profile distinct from that of human pDCs (CD11c, CD123+, CD303+, CD304+), and may therefore also differ in other aspects, such as their PRR expression profile. Our findings are consistent with a recent study by Stone et al. (44). Using the human GEN2.2 pDC cell line, the authors demonstrated that these cells require RIG-I to respond to RNA from the 3′ nontranslated region of the hepatitis C virus genome containing polyuridine motif (HCV pU/UC). Although different from the 5′ppp-dsRNA ligand used in the current study, the HCV pU/UC region had been established earlier to act as a potent, RIG-I–specific agonist in other human and murine cells (45). Stone et al. (44) also showed that primary human pDCs from adult donors respond to the same HCV-derived RIG-I agonist. In addition, human pDCs were recently shown to respond to DNA viruses via two newly described cytosolic DExD/H-box helicases (46). Taken together, these different findings indicate that the repertoire of functional PRRs in human pDCs is broader than initially thought, and that the commonly stated dogma that innate immune recognition of RNA viruses in pDCs is primarily TLR7 dependent requires revision, as it does not hold true for all RNA viruses. Better characterization of human pDCs (which is highly challenging because of the extremely low frequency with which they cicrculate in human blood) will help clarify their role in protection from RSV-associated disease.

A second key finding of this research is that RIG-I–dependent IFN-α responses in human pDCs are highly attenuated in early life. A traditional view has been that anatomical issues, such as structure and proportions of the infant’s airways and lungs (which differ from those of adults) (47), predispose babies to severe RSV disease. Our data suggest that, in addition to structural respiratory factors, developmental innate immune mechanisms may affect the ability of newborn infants to mount appropriate innate antiviral responses upon primary RSV infection. Despite the dramatically decreased responsiveness of neonatal pDCs to RSV and synthetic RIG-I ligands, expression levels of DDX58, the gene encoding RIG-I, appeared to be similar between adults and term infants at birth and were further increased upon RSV infection. The decreased responsiveness of neonatal pDCs was also not explained by differential gene expression of other RIG-I–like receptors (MDA5 and LGP2), or the downstream adapter protein MAVS. This observation suggests that the underlying differences between adult and neonatal pDCs is due to a discrepancy affecting either RIG-I or MAVS at the posttranslational level or signaling events downstream of MAVS.

Using MNCs from cord blood of term and preterm neonates, we have shown that attenuation of RIG-I–dependent type I IFN responses is even more profound in infants born very early in gestation (VLGA ≤ 32 wk) compared with term infants (GA ≥ 37 wk). In addition, preterm infants exhibited impaired proinflammatory (IL-6) responses in comparison with term infants. However, these defective responses appeared to be less dependent upon RIG-I because we found similar gestational age–dependent differences in IL-6 production in response to the RIG-I–independent control ligand, albeit with slightly lower total cytokine levels among the term infant group. RIG-I–independent innate immune responses may also explain why RSV is able to induce robust IL-6 responses in term infants at birth that were primarily mediated by monocytes. Indeed, it has been shown in a mouse model that the dsRNA-dependent protein kinase PKR is necessary for maximal expression of inflammatory cytokines and chemokines in response to RSV infection, and that in the absence of PKR, RSV-induced lung injury was reduced (48).

It is important to point out some limitations of our study. Our study was designed to examine antiviral innate immune responses to RSV in early life—when children are most vulnerable to develop severe illness from RSV infection—but not to directly test a relationship between innate immune responses and outcome of pediatric RSV infection. To answer the question whether a causal relationship exists between responsiveness of RIG-I–dependent antiviral immune signaling prior to RSV infection and outcomes of RSV infection, a population-based longitudinal (birth cohort) study is required, including a much larger cohort of children. Interestingly, a recent case-control study by Tabarani et al. (49) had found that nasopharyngeal wash samples of children with moderate and severe RSV infection (i.e., requiring hospitalization, and intensive care unit stay, respectively) contained elevated levels of several cytokines (e.g., IL-6, IL-8, TNF-α, and IFN-α) when compared with NP samples from RSV-infected children with mild RSV infection (i.e., that did not require hospitalization). This finding suggests an association between increased, rather than decreased, innate immune responses and severity of illness. The diverging results from this and our study may be explained by the different study design. The study by Tabarani et al. (49) was designed to examine cytokine levels in the upper airways of patients presenting with natural infection, which is inevitably delayed until symptoms occur and disease is well advanced. Therefore, the findings may be a consequence of higher viral loads in patients with severe illness, as it had been suggested in previous studies (50, 51).

Another potentially confounding factor of our study may be the use of cord blood as a source of MNCs from human neonatal subjects, as the relative abundance of particular cell types may be different in comparison with MNCs isolated from peripheral blood. Indeed, we found the frequency of pDCs in MNCs from term neonatal cord blood to be slightly lower in comparison with the percentage of pDCs in MNCs from adult peripheral blood samples. However, this difference is unlikely to have a significant impact on our overall results and conclusions because we also used single-cell–based polychromatic flow cytometry for the comparison of antiviral innate immune responses in MNCs between adults and term neonates. Moreover, we found antiviral innate immune responses to be reduced in MNCs isolated from peripheral blood of children between 12 mo and < 5 y of age, thereby ruling out possible artifacts from the use of cord blood as the sole cause of reduced antiviral innate immune responsiveness.

On the basis of our data, we propose a mechanism that may contribute to the remarkable vulnerability of infants to severe outcomes following RSV infection—including infants born at term without congenital disorders. According to our model, insufficient RIG-I–dependent IFN responses in pDCs of high-risk children may allow the dissemination of RSV into the lower respiratory tract, thereby causing harmful inflammation of bronchioles and alveoli, which is largely mediated by pDC-independent responses via viral sensors other than RIG-I.

Our findings may have important implications for innate immune responses to other viruses that depend upon RIG-I (14). In the current study, we focused primarily on RSV because infections with this virus are very common even very early in life, with 60–70% of all newborns experiencing their primary RSV infection during their first year of life (1, 2). Future studies are needed to determine the genetic, epigenetic, and developmental factors responsible for the differences in antiviral innate immune defenses between neonates and adults. Of note, although we and others (27) have demonstrated that RSV-dependent type I IFN responses are independent of endosomal TLRs, it is important to highlight that neonatal TLR-dependent innate immune responses are also different from those in adults (24). It will be vital to further investigate innate immune function and the underlying developmental factors in infants and young children who are highly vulnerable to a variety of infectious diseases, to empower the development of novel therapeutic approaches and vaccines targeted at this age group.

We thank David Marchant for generously providing RSV strain HLI1, as well as Mark Peeples and Peter Collins for generously providing recombinant RSV strain rgRSV30, Peter Tilley and Scott McRae for retrieving surveillance data from the British Columbia Children’s Hospital, and Tobias Kollmann and Edgardo S. Fortuno, III for providing protocols, reagents, and helpful feedback for the polychromatic flow cytometry analysis.

This work was supported by funding from the British Columbia Children’s Hospital Foundation, the Canadian Lung Association, and the Canadian Institutes of Health Research Team in Mutagenesis and Infectious Diseases. N.M. was a recipient of the 2010 Canadian Allergy and Immune Diseases Advanced Training Initiative award funded by AllerGen Networks of Centres of Excellence (NCE), Canada, and a fellowship in respiratory health cofunded by the Canadian Institutes of Health Research, the Canadian Lung Association, and GlaxoSmithKline. S.E.T. holds the Aubrey J. Tingle Professorship in Pediatric Immunology. S.E.T. and P.M.L. are scholars of the Michael Smith Foundation for Health Research. T.-I.W., A.L., and Y.S.H. were recipients of undergraduate summer studentships from AllerGen NCE, Canada, the Child and Family Research Institute, Vancouver, British Columbia, Canada, and the Faculty of Medicine, University of British Columbia, respectively. A.A.S. was supported by a Child and Family Research Institute graduate studentship and by the Canadian Institutes of Health Research Transplantation Scholarship Training Program.

Abbreviations used in this article:

GA

gestational age

iMFI

integrated mean fluorescence intensity

LRTI

lower respiratory tract infection

MNC

mononuclear cell

pDC

plasmacytoid dendritic cell

PRR

pattern recognition receptor

RIG-I

retinoic acid–inducible gene I protein

RSV

respiratory syncytial virus

VLGA

very low gestational age.

1
Glezen
W. P.
,
Taber
L. H.
,
Frank
A. L.
,
Kasel
J. A.
.
1986
.
Risk of primary infection and reinfection with respiratory syncytial virus.
Am. J. Dis. Child.
140
:
543
546
.
2
Simoes, E. A., and X. Carbonell-Estrany. 2003. Impact of severe disease caused by respiratory syncytial virus in children living in developed countries. Pediatr. Infect. Dis. J. 22: S13–S18; discussion S18–S20
.
3
Nair
H.
,
Nokes
D. J.
,
Gessner
B. D.
,
Dherani
M.
,
Madhi
S. A.
,
Singleton
R. J.
,
O’Brien
K. L.
,
Roca
A.
,
Wright
P. F.
,
Bruce
N.
, et al
.
2010
.
Global burden of acute lower respiratory infections due to respiratory syncytial virus in young children: a systematic review and meta-analysis.
Lancet
375
:
1545
1555
.
4
Collins
P. L.
,
Melero
J. A.
.
2011
.
Progress in understanding and controlling respiratory syncytial virus: still crazy after all these years.
Virus Res.
162
:
80
99
.
5
2009
.
American Academy of Pediatrics
.
Respiratory syncytial virus
. In
Red Book: 2009 Report of the Committee on Infectious Diseases
, 28th Ed.
Pickering
L. K.
,
Baker
C. J.
,
Kimberlin
D. W.
,
Long
S. S.
, eds.
American Academy of Pediatrics
,
Elk Grove Village, IL,
p.
560
569
.
6
Sharma
A. A.
,
Jen
R.
,
Butler
A.
,
Lavoie
P. M.
.
2012
.
The developing human preterm neonatal immune system: a case for more research in this area.
Clin. Immunol.
145
:
61
68
.
7
Welliver
R. C.
 Sr.
2008
.
The immune response to respiratory syncytial virus infection: friend or foe?
Clin. Rev. Allergy Immunol.
34
:
163
173
.
8
Loo
Y. M.
,
Fornek
J.
,
Crochet
N.
,
Bajwa
G.
,
Perwitasari
O.
,
Martinez-Sobrido
L.
,
Akira
S.
,
Gill
M. A.
,
García-Sastre
A.
,
Katze
M. G.
,
Gale
M.
 Jr.
2008
.
Distinct RIG-I and MDA5 signaling by RNA viruses in innate immunity.
J. Virol.
82
:
335
345
.
9
Yoboua
F.
,
Martel
A.
,
Duval
A.
,
Mukawera
E.
,
Grandvaux
N.
.
2010
.
Respiratory syncytial virus-mediated NF-kappa B p65 phosphorylation at serine 536 is dependent on RIG-I, TRAF6, and IKK beta.
J. Virol.
84
:
7267
7277
.
10
Liu
P.
,
Jamaluddin
M.
,
Li
K.
,
Garofalo
R. P.
,
Casola
A.
,
Brasier
A. R.
.
2007
.
Retinoic acid-inducible gene I mediates early antiviral response and Toll-like receptor 3 expression in respiratory syncytial virus-infected airway epithelial cells.
J. Virol.
81
:
1401
1411
.
11
Hornung
V.
,
Ellegast
J.
,
Kim
S.
,
Brzózka
K.
,
Jung
A.
,
Kato
H.
,
Poeck
H.
,
Akira
S.
,
Conzelmann
K. K.
,
Schlee
M.
, et al
.
2006
.
5′-Triphosphate RNA is the ligand for RIG-I.
Science
314
:
994
997
.
12
Schlee
M.
,
Roth
A.
,
Hornung
V.
,
Hagmann
C. A.
,
Wimmenauer
V.
,
Barchet
W.
,
Coch
C.
,
Janke
M.
,
Mihailovic
A.
,
Wardle
G.
, et al
.
2009
.
Recognition of 5′ triphosphate by RIG-I helicase requires short blunt double-stranded RNA as contained in panhandle of negative-strand virus.
Immunity
31
:
25
34
.
13
Kawai
T.
,
Akira
S.
.
2008
.
Toll-like receptor and RIG-I-like receptor signaling.
Ann. N. Y. Acad. Sci.
1143
:
1
20
.
14
Loo
Y. M.
,
Gale
M.
 Jr.
2011
.
Immune signaling by RIG-I-like receptors.
Immunity
34
:
680
692
.
15
Wang
Y.
,
Swiecki
M.
,
McCartney
S. A.
,
Colonna
M.
.
2011
.
dsRNA sensors and plasmacytoid dendritic cells in host defense and autoimmunity.
Immunol. Rev.
243
:
74
90
.
16
Panne
D.
2008
.
The enhanceosome.
Curr. Opin. Struct. Biol.
18
:
236
242
.
17
Samuel
C. E.
2001
.
Antiviral actions of interferons.
Clin. Microbiol. Rev.
14
:
778
809
.
18
Hovanessian
A. G.
2007
.
On the discovery of interferon-inducible, double-stranded RNA activated enzymes: the 2′-5′oligoadenylate synthetases and the protein kinase PKR.
Cytokine Growth Factor Rev.
18
:
351
361
.
19
Tayyari
F.
,
Marchant
D.
,
Moraes
T. J.
,
Duan
W.
,
Mastrangelo
P.
,
Hegele
R. G.
.
2011
.
Identification of nucleolin as a cellular receptor for human respiratory syncytial virus.
Nat. Med.
17
:
1132
1135
.
20
Kwilas
A. R.
,
Yednak
M. A.
,
Zhang
L.
,
Liesman
R.
,
Collins
P. L.
,
Pickles
R. J.
,
Peeples
M. E.
.
2010
.
Respiratory syncytial virus engineered to express the cystic fibrosis transmembrane conductance regulator corrects the bioelectric phenotype of human cystic fibrosis airway epithelium in vitro.
J. Virol.
84
:
7770
7781
.
21
Marr
N.
,
Turvey
S. E.
.
2012
.
Role of human TLR4 in respiratory syncytial virus-induced NF-κB activation, viral entry and replication.
Innate Immun
18
:
856
865
.
22
Ueba
O.
1978
.
Respiratory syncytial virus. I. Concentration and purification of the infectious virus.
Acta Med. Okayama
32
:
265
272
.
23
Jansen
K.
,
Blimkie
D.
,
Furlong
J.
,
Hajjar
A.
,
Rein-Weston
A.
,
Crabtree
J.
,
Reikie
B.
,
Wilson
C.
,
Kollmann
T.
.
2008
.
Polychromatic flow cytometric high-throughput assay to analyze the innate immune response to Toll-like receptor stimulation.
J. Immunol. Methods
336
:
183
192
.
24
Kollmann
T. R.
,
Crabtree
J.
,
Rein-Weston
A.
,
Blimkie
D.
,
Thommai
F.
,
Wang
X. Y.
,
Lavoie
P. M.
,
Furlong
J.
,
Fortuno
E. S.
 III
,
Hajjar
A. M.
, et al
.
2009
.
Neonatal innate TLR-mediated responses are distinct from those of adults.
J. Immunol.
183
:
7150
7160
.
25
Darrah
P. A.
,
Patel
D. T.
,
De Luca
P. M.
,
Lindsay
R. W.
,
Davey
D. F.
,
Flynn
B. J.
,
Hoff
S. T.
,
Andersen
P.
,
Reed
S. G.
,
Morris
S. L.
, et al
.
2007
.
Multifunctional TH1 cells define a correlate of vaccine-mediated protection against Leishmania major.
Nat. Med.
13
:
843
850
.
26
Livak
K. J.
,
Schmittgen
T. D.
.
2001
.
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods
25
:
402
408
.
27
Hornung
V.
,
Schlender
J.
,
Guenthner-Biller
M.
,
Rothenfusser
S.
,
Endres
S.
,
Conzelmann
K. K.
,
Hartmann
G.
.
2004
.
Replication-dependent potent IFN-alpha induction in human plasmacytoid dendritic cells by a single-stranded RNA virus.
J. Immunol.
173
:
5935
5943
.
28
Schlender
J.
,
Hornung
V.
,
Finke
S.
,
Günthner-Biller
M.
,
Marozin
S.
,
Brzózka
K.
,
Moghim
S.
,
Endres
S.
,
Hartmann
G.
,
Conzelmann
K. K.
.
2005
.
Inhibition of toll-like receptor 7- and 9-mediated alpha/beta interferon production in human plasmacytoid dendritic cells by respiratory syncytial virus and measles virus.
J. Virol.
79
:
5507
5515
.
29
Boyce
T. G.
,
Mellen
B. G.
,
Mitchel
E. F.
 Jr.
,
Wright
P. F.
,
Griffin
M. R.
.
2000
.
Rates of hospitalization for respiratory syncytial virus infection among children in Medicaid.
J. Pediatr.
137
:
865
870
.
30
Welliver
R. C.
2003
.
Review of epidemiology and clinical risk factors for severe respiratory syncytial virus (RSV) infection.
J. Pediatr.
143
(
5
,
Suppl
)
S112
S117
.
31
Lavoie
P. M.
,
Huang
Q.
,
Jolette
E.
,
Whalen
M.
,
Nuyt
A. M.
,
Audibert
F.
,
Speert
D. P.
,
Lacaze-Masmonteil
T.
,
Soudeyns
H.
,
Kollmann
T. R.
.
2010
.
Profound lack of interleukin (IL)-12/IL-23p40 in neonates born early in gestation is associated with an increased risk of sepsis.
J. Infect. Dis.
202
:
1754
1763
.
32
García
C. G.
,
Bhore
R.
,
Soriano-Fallas
A.
,
Trost
M.
,
Chason
R.
,
Ramilo
O.
,
Mejias
A.
.
2010
.
Risk factors in children hospitalized with RSV bronchiolitis versus non-RSV bronchiolitis.
Pediatrics
126
:
e1453
e1460
.
33
Hall
C. B.
,
Weinberg
G. A.
,
Iwane
M. K.
,
Blumkin
A. K.
,
Edwards
K. M.
,
Staat
M. A.
,
Auinger
P.
,
Griffin
M. R.
,
Poehling
K. A.
,
Erdman
D.
, et al
.
2009
.
The burden of respiratory syncytial virus infection in young children.
N. Engl. J. Med.
360
:
588
598
.
34
Dakhama
A.
,
Kaan
P. M.
,
Hegele
R. G.
.
1998
.
Permissiveness of guinea pig alveolar macrophage subpopulations to acute respiratory syncytial virus infection in vitro.
Chest
114
:
1681
1688
.
35
Wang
H.
,
Peters
N.
,
Schwarze
J.
.
2006
.
Plasmacytoid dendritic cells limit viral replication, pulmonary inflammation, and airway hyperresponsiveness in respiratory syncytial virus infection.
J. Immunol.
177
:
6263
6270
.
36
McDermott
D. S.
,
Weiss
K. A.
,
Knudson
C. J.
,
Varga
S. M.
.
2011
.
Central role of dendritic cells in shaping the adaptive immune response during respiratory syncytial virus infection.
Future Virol
6
:
963
973
.
37
Kato
H.
,
Sato
S.
,
Yoneyama
M.
,
Yamamoto
M.
,
Uematsu
S.
,
Matsui
K.
,
Tsujimura
T.
,
Takeda
K.
,
Fujita
T.
,
Takeuchi
O.
,
Akira
S.
.
2005
.
Cell type-specific involvement of RIG-I in antiviral response.
Immunity
23
:
19
28
.
38
Diebold
S. S.
,
Kaisho
T.
,
Hemmi
H.
,
Akira
S.
,
Reis e Sousa
C.
.
2004
.
Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA.
Science
303
:
1529
1531
.
39
Lee
H. K.
,
Lund
J. M.
,
Ramanathan
B.
,
Mizushima
N.
,
Iwasaki
A.
.
2007
.
Autophagy-dependent viral recognition by plasmacytoid dendritic cells.
Science
315
:
1398
1401
.
40
Lund
J. M.
,
Alexopoulou
L.
,
Sato
A.
,
Karow
M.
,
Adams
N. C.
,
Gale
N. W.
,
Iwasaki
A.
,
Flavell
R. A.
.
2004
.
Recognition of single-stranded RNA viruses by Toll-like receptor 7.
Proc. Natl. Acad. Sci. USA
101
:
5598
5603
.
41
Krzyzaniak
M. A.
,
Zumstein
M. T.
,
Gerez
J. A.
,
Picotti
P.
,
Helenius
A.
.
2013
.
Host cell entry of respiratory syncytial virus involves macropinocytosis followed by proteolytic activation of the F protein.
PLoS Pathog.
9
:
e1003309
.
42
Chaiwatpongsakorn
S.
,
Epand
R. F.
,
Collins
P. L.
,
Epand
R. M.
,
Peeples
M. E.
.
2011
.
Soluble respiratory syncytial virus fusion protein in the fully cleaved, pretriggered state is triggered by exposure to low-molarity buffer.
J. Virol.
85
:
3968
3977
.
43
Marr
N.
,
Turvey
S. E.
,
Grandvaux
N.
.
2013
.
Pathogen recognition receptor crosstalk in respiratory syncytial virus sensing: a host and cell type perspective.
Trends Microbiol.
21
:
568
574
.
44
Stone
A. E.
,
Giugliano
S.
,
Schnell
G.
,
Cheng
L.
,
Leahy
K. F.
,
Golden-Mason
L.
,
Gale
M.
 Jr.
,
Rosen
H. R.
.
2013
.
Hepatitis C virus pathogen associated molecular pattern (PAMP) triggers production of lambda-interferons by human plasmacytoid dendritic cells.
PLoS Pathog.
9
:
e1003316
.
45
Saito
T.
,
Owen
D. M.
,
Jiang
F.
,
Marcotrigiano
J.
,
Gale
M.
 Jr.
2008
.
Innate immunity induced by composition-dependent RIG-I recognition of hepatitis C virus RNA.
Nature
454
:
523
527
.
46
Kim
T.
,
Pazhoor
S.
,
Bao
M.
,
Zhang
Z.
,
Hanabuchi
S.
,
Facchinetti
V.
,
Bover
L.
,
Plumas
J.
,
Chaperot
L.
,
Qin
J.
,
Liu
Y. J.
.
2010
.
Aspartate-glutamate-alanine-histidine box motif (DEAH)/RNA helicase A helicases sense microbial DNA in human plasmacytoid dendritic cells.
Proc. Natl. Acad. Sci. USA
107
:
15181
15186
.
47
Jeffrey
P. K.
1998
.
The development of large and small airways.
Am. J. Respir. Crit. Care Med.
157
:
S174
S180
.
48
Minor
R. A.
,
Limmon
G. V.
,
Miller-DeGraff
L.
,
Dixon
D.
,
Andrews
D. M.
,
Kaufman
R. J.
,
Imani
F.
.
2010
.
Double-stranded RNA-activated protein kinase regulates early innate immune responses during respiratory syncytial virus infection.
J. Interferon Cytokine Res.
30
:
263
272
.
49
Tabarani
C. M.
,
Bonville
C. A.
,
Suryadevara
M.
,
Branigan
P.
,
Wang
D.
,
Huang
D.
,
Rosenberg
H. F.
,
Domachowske
J. B.
.
2013
.
Novel inflammatory markers, clinical risk factors, and virus type associated with severe respiratory syncytial virus infection.
Pediatr. Infect. Dis. J.
10.1097/INF.0b013e3182a14407.
50
DeVincenzo
J. P.
,
Wilkinson
T.
,
Vaishnaw
A.
,
Cehelsky
J.
,
Meyers
R.
,
Nochur
S.
,
Harrison
L.
,
Meeking
P.
,
Mann
A.
,
Moane
E.
, et al
.
2010
.
Viral load drives disease in humans experimentally infected with respiratory syncytial virus.
Am. J. Respir. Crit. Care Med.
182
:
1305
1314
.
51
Utokaparch
S.
,
Marchant
D.
,
Gosselink
J. V.
,
McDonough
J. E.
,
Thomas
E. E.
,
Hogg
J. C.
,
Hegele
R. G.
.
2011
.
The relationship between respiratory viral loads and diagnosis in children presenting to a pediatric hospital emergency department.
Pediatr. Infect. Dis. J.
30
:
e18
e23
.

The authors have no financial conflicts of interest.