Targeting Ags to dendritic cell (DC) surface receptors can induce a variety of responses depending on the DC type targeted, the receptor targeted, and the adjuvant used. Clec9A (DNGR-1), which is expressed by CD8+ DCs, has been shown to bind F-actin exposed on damaged cells. Targeting Ag to this receptor in mice and nonhuman primates induces strong humoral immunity even in the absence of adjuvant, a process seen for a few select DC receptors. In contrast with other receptors, however, targeting Clec9A induces long-lived, affinity-matured Ab responses that are associated with efficient CD4+ T cell responses shown to possess properties of follicular Th cells (TFH). In this article, we provide definitive evidence that Clec9A targeting promotes the development of TFH by showing that responding CD4 T cells express CXCR5, PD1, the TFH transcription factor Bcl6, and the cytokine IL-21, and that these cells localize to germinal centers. Furthermore, we extend studies from the model Ag OVA to the viral Ag glycoprotein D of HSV-1 and examine the capacity of primed TFH to form functional memory. We show that targeting glycoprotein D to Clec9A even in the absence of adjuvant induced long-lived memory CXCR5+ PD1hi CD4+ T cells that proliferated extensively upon secondary challenge and rapidly developed into effector TFH. This was associated with enhanced germinal center B cell responses and accelerated Ab production. Our study indicates that targeting Ags to Clec9A in the absence of adjuvant routinely generates TFH responses that form long-lived memory capable of robust secondary TFH responses.

This article is featured in In This Issue, p.753

Conventional dendritic cells (DCs), in mouse spleen, can be categorized into two functionally distinct subsets, CD8α+ DCs and CD8α DCs. CD8α+ DCs are the main subset responsible for priming CTL responses (14), most likely due to their dominant ability to cross-present Ags (16). In contrast, CD8α DCs preferentially process exogenous Ag via the MHC II pathway and, as such, activate CD4+ T cells (5). It is notable, however, that CD8α+ DCs can also process Ag in the MHC II pathway and induce CD4+ T cell responses, particularly of a Th1 phenotype (79).

Targeting Ag to DC receptors on specific DC subsets in vivo is a promising vaccination strategy for delivering Ag to obtain tailored immunity. mAbs specific for CD8α+ DCs receptors such as DEC205 (1013), Clec9A (1417), langerin/CD207 (18, 19), and Clec12A (16, 20) have been successfully used to deliver Ag. Targeting Ags to these receptors in vivo enhanced presentation of both MHC I– and MHC II–restricted Ags (1014, 16, 18, 19). However, simultaneous provision of adjuvants such as agonistic anti-CD40 Ab or TLR agonists is generally required for induction of optimal CTL (11, 16, 19, 21), IFN-γ–secreting Th1 (10, 19, 21, 22), and humoral immunity (15, 23).

Targeting the same DC subset via distinct receptors does not necessarily generate the same immune outcome because each receptor has different properties. For example, targeting Siglec-H on plasmacytoid DCs induces functional exhaustion of Ag-specific CD4+ T cells that results in inhibition of Ag-specific Ab responses even when adjuvant is coadministered, whereas targeting BST-2 also on plasmacytoid DCs facilitates cellular and humoral immunity (24). Analogous to this, targeting CD8α+ DCs via Clec9A induces a high, prolonged, and affinity-matured humoral response even in the absence of adjuvant, whereas targeting DEC205 or Clec12A on the same DCs induces only weak Ab responses (14, 16, 25). The potent humoral response induced by Clec9A targeting is seen in both mice and nonhuman primates (17) and in the former has been associated with induction of an Ag-specific CD4+ T cell response of a follicular Th cells (TFH) phenotype as assessed by upregulation of CXCR5 and PD1 on responding T cells (16). In contrast, targeting Ag to DEC205 in the absence of adjuvant induces deletion or anergy of Ag-specific T cells (1113) and generates Ag-specific regulatory T cells (13, 26).

TFH are a CD4+ effector T cell subset that specializes in B cell help. Upon encountering Ag, specific B cells migrate from B cell follicles toward the T cell zone of secondary lymphoid organs to receive help from cognate CD4+ T cells (pre-TFH). The helped B cells then upregulate EBI2 and migrate to outer follicles (27, 28), and may form extrafollicular foci of short-lived plasma cells that produce low-affinity early Abs. Alternatively, they may migrate back into the B cell follicles and undergo affinity maturation within germinal centers (GCs), within which high-affinity B cell clones are selected by preferential acquisition of help from GC TFH, thereby driving the process of affinity maturation (29). Induction of GC is a desired feature for vaccines because this generates long-lived plasma cells and memory B cells required to maintain high levels of serum Abs. Ags targeted to CD8α DCs through DCIR-2 (30), Sirpβ-1 (31), CIRE, and FIRE (32) have been shown to induce strong humoral responses without adjuvant. However, in the case of DCIR-2 targeting, the only molecule assessed in detail, CD4+ T cells primed by CD8α DCs did not support GC B cell responses, suggesting a lack of TFH induction. Instead, Ab was generated through extrafollicular activation of Ag-specific B cells (30). At this stage, therefore, Clec9A targeting is the unique strategy for generating GC B cell responses in the absence of adjuvant, a property that may relate to its capacity to induce TFH. However, given that GC TFH and pre-TFH appear to differ only in the extent of polarization (33) and a limited number of markers were used previously to identify TFH induced by this approach, it was unclear whether full TFH development was achieved by Clec9A targeting. In this study, we sought to thoroughly examine the nature of the putative TFH response induced by targeting Ags to Clec9A without adjuvant and to extend our studies to several Ags. Furthermore, we explored whether this targeting strategy could generate CD4+ T cell memory and, if so, how these cells related to TFH.

Kinetic analysis of the Ag-specific CD4+ T cell response to Clec9A-targeted Ag revealed an early burst of proliferation in the T cell zone, followed by preferential retention within the B cell follicles and GCs of the spleen. These Ag-specific CD4+ T cells produced IL-21, supporting GC responses. TFH induction was observed using multiple CD4+ TCR transgenic cells specific to distinct epitopes, confirming that the induction of TFH was a general feature of Clec9A targeting. We further showed that Ag-specific CD4+ T cells induced by Clec9A targeting persisted as memory cells expressing markers of TFH. These memory cells mounted robust TFH responses upon secondary challenge, providing efficient help to B cells. Thus, Clec9A targeting is a promising vaccination strategy to induce TFH that form effective TFH memory.

C57BL/6, B6.SJL-PtprcaPep3b/BoyJ (B6.Ly5.1), OT-II (34) ×B6.Ly5.1 (OT-IILy5.1), OT-II×uGFP (OT-IIEGFP), and gDT-II (35) ×B6.Ly5.1 (gDT-IILy5.1) mice were bred and housed under specific pathogen-free conditions in the Biological Resources Facility at the Department of Microbiology and Immunology, The University of Melbourne. OT-II.IL21GFP/+ mice (36) and IL21R−/− mice (37) were maintained at The Walter and Eliza Hall Institute, Parkville, Australia. Mice were used at 6–20 wk of age and handled according to the guidelines of the National Health and Medical Research Council of Australia. Experimental procedures were approved by the Animal Ethics Committee, The University of Melbourne.

The entire cDNA encoding either chicken OVA, the polytope (see later), or the HSV-1 glycoprotein D (gD) protein was cloned in-frame with the C-terminal region of the H chain of rat anti-mouse Clec9A (clone 24/04-10B4) or rat IgG2a isotype control (GL117) via alanine linkers as previously described (16). The cDNA sequence of polytope is as follows: 5′-GCGGCCGCTGACTACAAGGACGACGACGACAAGCTGGAAAGCATCATCAACTTCGAGAAGCTGACCGAGACAACCAGCAGCATCGAGTTCGCCCGGCTGCAGGAAAGCCTGAAGATCAGCCAGGCCGTGCACGCCGCCCACGCCGAGATCAATGAGGCCGGACGGGAGGTGGTGGGCTGGCCCAACAACCACAACACCAACGGCGTGACCGCCGCCTGTAGCCACGAGGGCAAGAGCCTGGCCATCTACAGCACCGTGGCCAGCAGCCTGGAATCCCTGATCCCCCCCAACTGGCACATCCCCAGCATCCAGGACGCCGAGAGCGTGCTGGAACAGAAGCTGATCAGCGAAGAGGACCTGTGATAA-3′. The polytope construct was attached to the H chain via an alanine linker and a FLAG-tag and contained the following MHC I– and MHC II–restricted epitopes: Kb-restricted SIINFEKL (OVA257–264) and SSIEFARL (HSV-1 glycoprotein B498–505), IAb/IAd-restricted KISQAVHAAHAEINEAG (OVA323–339), IAd-restricted HNTNGVTAACSHE (Influenza A hemagglutinin143–155), Kd-restricted and IYSTVASSL (Influenza A hemagglutinin518–526), and IAb-restricted IPPNWHIPSIQDA (HSV-1 gD315–327), followed by a Myc-tag. For the mAb-gD, constant regions of anti-Clec9A or the rat IgG2a isotype control were replaced with the mouse IgG1 C region carrying a point mutation interfering with Fc receptor binding as previously described (12).

Lymph node and/or spleen cell suspensions from CD4+ TCR transgenic mice (OT-II, gDT-II) were stained with anti–Mac-1 (M1/70), anti-F4/80 (F4/80), anti-erythrocytes (anti-Ter119), anti–Gr-1 (RB6-8C5), anti–I-A/E (M5/114), and anti-CD8 (53.6-7). Non-CD4 T cells were magnetically removed using BioMag goat anti-rat IgG (Qiagen). In most cases, small numbers (5 × 104) of naive CD4+ T cells were injected i.v. into B6 mice 1–2 d before immunization unless otherwise stated in the figure legend. Mice were immunized i.v. with specified amounts of mAb constructs in the absence of adjuvant or infected epicutaneously on the flank with 1 × 106 PFU HSV-1 (38) or i.v. with 2 × 105 PFU HSV-1.

The following fluorochrome-conjugated mAbs were used against mouse CD4 (RM4.5-Alexa Fluor 700, PECy7, PE; BD Biosciences; RM4.5-Alexa Fluor 405; Invitrogen; GK1.5-allophycocyanin-Cy7; BD Biosciences), TCR-Vα2 (B20.1-Alexa Fluor 700; BD Biosciences), TCR-Vα3.2 (RR3-16-FITC, PE; BD Biosciences), CXCR5 (2G8-biotin; BD Biosciences), CD19 (1D3-Brilliant Violet 605; Biolegend), CD45R/B220 (RA3-6B2-Pacific blue; BD Biosciences), CD45.1 (A20-PECy7, FITC, Alexa Fluor 700; BD Biosciences), CD45.2 (104-PECy7, PerCPCy5.5; BD Biosciences; 104-allophycocyanin-eFlour 780; eBioscience), GL7 (GL7-Alexa Fluor 647; eBioscience), CD95 (Jo2-PE; BD Biosciences), PD1 (RMP1-30-allophycocyanin; Biolegend), Bcl6 (K112-91-PE; BD Biosciences), TNF-α (MP6-XT22-allophycocyanin; BD Biosciences), IFN-γ (XMG1.2-PECy7; BD Biosciences), and IL-2 (JES6-5H4-PerCPCy5.5; BD Biosciences). Biotin was detected using streptavidin PECy7 (Biolegend), streptavidin Qdot 605 (Invitrogen), or streptavidin Brilliant Violet 605 (Biolegend). Nonspecific binding was blocked with anti-CD16/32 (2.4G2) plus 1% normal rat serum. Propidium iodide (PI; 0.5 mg/ml) was added to the final cell wash, and PI+ dead cells were excluded from analysis. Alternatively, cells were stained with LIVE/DEAD Fixable Near-IR Stain (Invitrogen) before cell fixation. For intracellular Bcl6 staining, cells were fixed and permeabilized using Foxp3/Transcription Factor Staining Buffer Set (eBioscience) and stained at room temperature for 45 min.

A total of 1–2 × 106 splenocytes was restimulated with 1 μM HSV-1 gD315–327 peptide or media alone in the presence of 5 mg/ml brefeldin A (Sigma-Aldrich). Restimulation was carried out in round-bottom 96-well plates for 5 h in 200 μl RPMI 1640 medium supplemented with 10% FCS (CSL), 2 mM l-glutamine (Life Technologies), 1 mM sodium pyruvate, 100 mM nonessential amino acids, 5 mM HEPES (Life Technologies), 5 × 10−5 2-ME (Sigma), 11 U/ml penicillin (CSL), and 100 mg/ml streptomycin (CSL) before surface staining as detailed earlier. Cells were then fixed and permeabilized using a Cytofix/Cytoperm kit (BD Biosciences) and stained for cytokines at 4°C for 45 min.

Nunc MaxiSorp round-bottom 96-well ELISA microtiter plates (Thermo Scientific) were coated overnight at 4°C with 1.5 μg/ml rat GL117 mAb, 10 μg/ml OVA (Sigma-Aldrich), 10 μg/ml HSV-1 inactivated Vero cell extract (Advanced Biotechnologies), or 2.5 μg/ml HSV-1 gD protein (Abcam). Unbound protein was then washed away (PBS, 0.05% Tween 20). Serially diluted serum samples (PBS, 5% milk powder) were plated and incubated at 4°C overnight. Bound mouse IgG Abs were detected using donkey anti-mouse IgG-HRP (Millipore) and visualized using ABTS. The OD readings were determined at 405/492 nm. End-point titers of anti-OVA, anti-rat, anti-gD, and anti–HSV-1 were calculated by using cutoff values defined as double the OD of no serum control.

Spleens were fixed overnight in PLP buffer (1% paraformaldehyde, 0.075 M l-lysine, and 2.1 mg/ml sodium periodate in 0.0375 M phosphate buffer (pH 7.4) at 4°C and prepared for immunofluorescence staining as previously described (16). Twelve-micrometer spleen sections were blocked for 10 min with serum-free protein block (Dako) and then stained with rhodamine-labeled peanut agglutinin (PNA; Vector Laboratories), anti-IgD Alexa Fluor 647 (11-26c.2a; Biolegend), and rabbit polyclonal anti-laminin (AbD Serotec), followed by polyclonal goat anti-rabbit IgG Alexa Fluor 405 (Invitrogen). Slides were mounted using ProLongGold antifade reagent (Invitrogen). Z-stacks of tile images covering ∼1600 × 3700 μm area were acquired for each spleen section using a 20× objective on an LSM700 confocal microscope (Zeiss). To quantify the distribution of GFP+ OT-II cells in the spleen, two nonconsecutive sections at least 100 μm apart were examined for each mouse. Laminin staining was used to distinguish the white pulp from the red pulp. Within the white pulp, the T cell zone was defined as the IgD PNA area and the B cell follicles were defined as the IgD+ area. GCs were identified as the PNA+ IgD area within the B cell follicles. The area of T cell zone, non-GC B cell zone, and GCs were measured, and the number of GFP+ OT-II cells within each defined area were counted using ImageJ (National Institutes of Health).

We previously showed that a single injection of a small amount of OVA linked to an anti-Clec9A mAb ( anti-Clec9A–OVA) was able to induce potent humoral immunity without adjuvant, and that this was associated with expansion of Ag-specific cells expressing CXCR5 and PD1, presumed to be TFH (16). To further characterize the phenotype of T cells induced by Clec9A-targeted priming, we examined their expression of the transcriptional repressor Bcl6 and the cytokine IL-21, characteristically expressed by TFH. To achieve this, we adoptively transferred 5 × 104 IL-21 reporter OT-II cells (with GFP knocked into one locus of IL-21 [OT-II.IL21GFP/+]) into congenic mice, which were then immunized with anti–Clec9A-OVA or isotype control-OVA mAb. As previously reported (16), a substantial proportion (∼10%) of OT-II cells expressed high levels of CXCR5 and PD1 on days 6 and 8 after injection of anti–Clec9A-OVA, consistent with TFH induction (Fig. 1A, 1B, top panels, and Supplemental Fig. 1A, 1B). In support of this phenotype, CXCR5+ cells expressed high levels of Bcl6 (Fig. 1A, 1B, bottom panels, and Supplemental Fig. 1A, 1B), and a proportion of the OT-II cells expressed IL-21, as measured by upregulation of GFP, although this was not solely restricted to CXCR5+ cells (Fig. 1A, 1B, middle panels, and Supplemental Fig. 1A, 1B). As an additional measure of TFH activity, endogenous GC responses were monitored by examining B cell expression of GL7 and CD95 (Fig. 1C, 1D, and Supplemental Fig. 1C). Anti–Clec9A-OVA increased the proportion of GL7+ CD95+ GC B cells compared with control groups as early as day 6 after priming, and this was more pronounced by day 8. Furthermore, OVA and rat-specific Ab production were dependent on IL-21R, because minimal responses were detected in IL-21R-deficient mice (Fig. 1E).

FIGURE 1.

Ag targeted to Clec9A induces IL-21–producing TFH that support GC responses. (AD) OT-II.IL21+/GFP cells (5 × 104) were adoptively transferred into B6.Ly5.1 mice 1 d before i.v. immunization with 0.5 μg anti–Clec9A-OVA or isotype-OVA. (A and B) Spleen cells were harvested on days 6 and 8 postimmunization, and OT-II cells (CD45.2+ Vα2+) were assessed by flow cytometry for expression of TFH markers CXCR5 and either PD1, IL21-GFP, or Bcl6. (A) Representative dot plots of OT-II cells from day 8. Gates on plots show frequency ± SEM. (B) Percentage of OT-II cells that were CXCR5hi PD1hi (upper panels), IL-21–GFP+ (middle panels), or CXCR5hi Bcl6hi (lower panels) for individual mice on days 6 and 8. Bars represent the mean. (C and D) CD19+ B220+ B cells were assessed for expression of GC markers GL7 and CD95. (C) Representative dot plots of B cells for day 8. Gates show frequency ± SEM. (D) Percentage of B cells that were GL7+ and CD95+ for individual mice on days 6 and 8. Bars represent the mean. (A–D) Presented are the cumulative data of three independent experiments for all except Bcl6 staining, which was from two independent experiments. Statistical analysis was performed using one-way ANOVA, followed by Tukey’s test. (E) B6 and IL21R−/− mice were immunized with 1 μg anti–Clec9A-OVA i.v. and serum anti-OVA IgG (left), and anti-rat IgG (right) responses were assessed by ELISA on day 6. Each point represents a mouse, and the bars represent the geometric mean. Pooled data from two independent experiments are shown. For statistical analysis, data sets were log-transformed and then subjected to a Mann–Whitney U test. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 1.

Ag targeted to Clec9A induces IL-21–producing TFH that support GC responses. (AD) OT-II.IL21+/GFP cells (5 × 104) were adoptively transferred into B6.Ly5.1 mice 1 d before i.v. immunization with 0.5 μg anti–Clec9A-OVA or isotype-OVA. (A and B) Spleen cells were harvested on days 6 and 8 postimmunization, and OT-II cells (CD45.2+ Vα2+) were assessed by flow cytometry for expression of TFH markers CXCR5 and either PD1, IL21-GFP, or Bcl6. (A) Representative dot plots of OT-II cells from day 8. Gates on plots show frequency ± SEM. (B) Percentage of OT-II cells that were CXCR5hi PD1hi (upper panels), IL-21–GFP+ (middle panels), or CXCR5hi Bcl6hi (lower panels) for individual mice on days 6 and 8. Bars represent the mean. (C and D) CD19+ B220+ B cells were assessed for expression of GC markers GL7 and CD95. (C) Representative dot plots of B cells for day 8. Gates show frequency ± SEM. (D) Percentage of B cells that were GL7+ and CD95+ for individual mice on days 6 and 8. Bars represent the mean. (A–D) Presented are the cumulative data of three independent experiments for all except Bcl6 staining, which was from two independent experiments. Statistical analysis was performed using one-way ANOVA, followed by Tukey’s test. (E) B6 and IL21R−/− mice were immunized with 1 μg anti–Clec9A-OVA i.v. and serum anti-OVA IgG (left), and anti-rat IgG (right) responses were assessed by ELISA on day 6. Each point represents a mouse, and the bars represent the geometric mean. Pooled data from two independent experiments are shown. For statistical analysis, data sets were log-transformed and then subjected to a Mann–Whitney U test. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

To determine whether anti–Clec9A-OVA–primed OT-II cells entered GCs, a known function of TFH, we examined by histology the location of OT-II cells within the spleen for the first 10 d after priming. In these experiments, 5 × 104 purified CD4+ OT-II cells expressing GFP under the ubiquitin promoter were adoptively transferred into congenic mice before priming with anti–Clec9A-OVA or isotype control-OVA mAb. The distribution of adoptively transferred GFP+ OT-II cells was then examined at different time points after immunization (Fig. 2). OT-II cells were predominantly found within the T cell zone at day 3 postimmunization with anti–Clec9A-OVA (Fig. 2A), consistent with the idea that CD8α+ DCs located within this zone were responsible for priming. A proportion of the OT-II cells then relocated to the B cell follicles and GCs over the course of the response. Relocation of OT-II cells was quantitated by enumerating OT-II cells found in the T zone, the non-GC B zone, and the GCs, and normalized to the total area of white pulp examined (Fig. 2B). Based on these analyses, the frequency of OT-II cells in the T zone peaked between days 3 and 6 and contracted thereafter. The frequency within the non-GC B zone increased from days 3 to 6, peaking around day 7. OT-II cells were first detected in the GC on day 6 and similar frequencies were maintained from days 6 to 10, despite contraction of the response in other areas. The gradual infiltration of OT-II cells from the T zone into B cell follicles and GCs resulted in a proportional increase of OT-II cells in the B cell follicles and GCs as the response progressed (Fig. 2C). Few OT-II cells were detectable in the spleen after isotype-OVA mAb immunization even at day 6 (Fig. 2C), and this was reflected by minimal GC localization (Fig. 2B). Together, these data indicated that priming with anti–Clec9A-OVA induced OVA-specific T cells of a TFH phenotype that appeared to migrate into GCs to help development of GC B cell responses.

FIGURE 2.

Kinetic analysis of OT-II cell localization in the spleen after immunization with anti–Clec9A-OVA. A total of 5 × 104 OT-IIEGFP cells were adoptively transferred into B6 recipient mice 1 d before i.v. immunization with 0.5 μg anti–Clec9A-OVA or isotype-OVA. Spleens were harvested on days 3, 6, 7, and 10 postimmunization with anti–Clec9A-OVA or day 6 postimmunization with isotype-OVA and prepared for histology. (A) Representative immunofluorescence images of splenic white pulp showing changes in the distribution of OT-IIEGFP cells (green) over time. IgD (blue) and PNA (red) are visualized to highlight non-GC B cell follicles and GCs, respectively. Scale bars, 100 μm. (B) Relative distribution of OT-II cells over time. OT-II cells in the T cell zone, non-GC B cell follicles, and GCs were counted and values expressed as a percentage of the total OT-II cells in the white pulps (i.e., sum of OT-II cells in T zone, non-GC B cell follicle, and GCs). (C) Number of OT-II cells in the T cell zone, non-GC B cell zone, and GCs per square millimeter of the white pulps. Cumulative data of two independent experiments with a total of three to four mice (six to eight spleen sections) per time point is presented. Error bars indicate the SEM. Statistical analysis was performed using a Mann–Whitney U test (d6 anti–Clec9A-OVA versus d6 isotype-OVA). *p < 0.05, **p < 0.01.

FIGURE 2.

Kinetic analysis of OT-II cell localization in the spleen after immunization with anti–Clec9A-OVA. A total of 5 × 104 OT-IIEGFP cells were adoptively transferred into B6 recipient mice 1 d before i.v. immunization with 0.5 μg anti–Clec9A-OVA or isotype-OVA. Spleens were harvested on days 3, 6, 7, and 10 postimmunization with anti–Clec9A-OVA or day 6 postimmunization with isotype-OVA and prepared for histology. (A) Representative immunofluorescence images of splenic white pulp showing changes in the distribution of OT-IIEGFP cells (green) over time. IgD (blue) and PNA (red) are visualized to highlight non-GC B cell follicles and GCs, respectively. Scale bars, 100 μm. (B) Relative distribution of OT-II cells over time. OT-II cells in the T cell zone, non-GC B cell follicles, and GCs were counted and values expressed as a percentage of the total OT-II cells in the white pulps (i.e., sum of OT-II cells in T zone, non-GC B cell follicle, and GCs). (C) Number of OT-II cells in the T cell zone, non-GC B cell zone, and GCs per square millimeter of the white pulps. Cumulative data of two independent experiments with a total of three to four mice (six to eight spleen sections) per time point is presented. Error bars indicate the SEM. Statistical analysis was performed using a Mann–Whitney U test (d6 anti–Clec9A-OVA versus d6 isotype-OVA). *p < 0.05, **p < 0.01.

Close modal

Having shown that OVA-specific TFH can be induced by anti–Clec9A-OVA, we examined whether TFH induction was unique to the use of OVA or could be extended to other Ags. To this end, we designed an anti–Clec9A-polytope carrying various peptide epitopes including MHC II–restricted epitopes from OVA and from gD of HSV-1. To ensure that polytope Ags could induce TFH, we first examined whether this construct could induce OVA-specific TFH, as seen for targeted whole OVA. OVA targeted to Clec9A in the context of a polytope induced CXCR5hi PD1hi OT-II TFH, and this occurred in an Ag-specific and dose-dependent manner (Fig. 3A). We next extended our analysis to examine the induction of TFH to the new Ag, gD, by using CD4+ T cells specific for gD315–327 from the gDT-II TCR transgenic line. This revealed that anti–Clec9A-polytope was able to induce a potent gDT-II TFH response as determined by the high expression of CXCR5 and PD1 (Fig. 3B) and Bcl6 (Fig. 3C) on gDT-II cells and by expansion of gDT-II TFH numbers (Fig. 3B, 3C), peaking around day 6. These findings show that Clec9A targeting induced strong expansion of CD4+ TFH to multiple Ags.

FIGURE 3.

Targeting a polytope to Clec9A in vivo induces TFH responses to multiple CD4+ T cell epitopes. (A) OT-IILy5.1 cells (5 × 104) were adoptively transferred into B6 recipient mice 1 d before i.v. immunization with 0.2–5 μg anti–Clec9A-polytope or 5 μg isotype-polytope. Left panel, Representative dot plots for splenic OT-II cells 5 d after injection of 5 μg mAb-polytope. Gates show the frequency (mean ± SEM) of PD1hi CXCR5hi cells. Right panel, Absolute number of CXCR5hi PD1hi OT-II TFH in the spleen of individual mice on day 5. Bars represent the mean. Pooled data from two independent experiments are presented. (B and C) gDT-IILy5.1 cells (5 × 104) were adoptively transferred into B6 recipient mice 1 d before i.v. immunization with 0.2 μg anti–Clec9A-polytope. Kinetics are shown for gDT-II TFH induction in the spleen as measured by expression of CXCR5 and either PD1 (B) or Bcl6 (C). Left panels, Representative dot plots of gDT-II cells at each time point; gated cells (mean ± SEM). Right panels, Histogram showing the frequency of gDT-II cells of a TFH phenotype per 106 splenocytes (mean ± SEM) for individual mice. Pooled data from three independent experiments are presented.

FIGURE 3.

Targeting a polytope to Clec9A in vivo induces TFH responses to multiple CD4+ T cell epitopes. (A) OT-IILy5.1 cells (5 × 104) were adoptively transferred into B6 recipient mice 1 d before i.v. immunization with 0.2–5 μg anti–Clec9A-polytope or 5 μg isotype-polytope. Left panel, Representative dot plots for splenic OT-II cells 5 d after injection of 5 μg mAb-polytope. Gates show the frequency (mean ± SEM) of PD1hi CXCR5hi cells. Right panel, Absolute number of CXCR5hi PD1hi OT-II TFH in the spleen of individual mice on day 5. Bars represent the mean. Pooled data from two independent experiments are presented. (B and C) gDT-IILy5.1 cells (5 × 104) were adoptively transferred into B6 recipient mice 1 d before i.v. immunization with 0.2 μg anti–Clec9A-polytope. Kinetics are shown for gDT-II TFH induction in the spleen as measured by expression of CXCR5 and either PD1 (B) or Bcl6 (C). Left panels, Representative dot plots of gDT-II cells at each time point; gated cells (mean ± SEM). Right panels, Histogram showing the frequency of gDT-II cells of a TFH phenotype per 106 splenocytes (mean ± SEM) for individual mice. Pooled data from three independent experiments are presented.

Close modal

The use of gD as an alternative Ag provided several advantages, including allowing the use of gDT-II T cells instead of OT-II cells to monitor long-term immunity or tolerance induction: OT-II cells survive very poorly long term in vivo and are therefore difficult to use in such studies. gDT-II cells also have a corresponding pathogen for which they are specific, that is, HSV-1, which allows the use of an infectious agent to monitor recall responses or to compare responses induced by Clec9A targeting with those induced by an infectious immunogen.

Ags targeted to CD8α+ DCs through the surface receptor DEC205 have been shown to induce transient Ag-specific CD4+ T cell responses followed by tolerance, which is characterized by a reduced capacity to respond to secondary immunization (12, 13). Although Clec9A-targeted Ags induced a potent Ag-specific primary CD4+ T cell response, it was unclear whether the responding T cells persisted as functional memory or underwent tolerance induction. To address this issue, we examined the memory response after targeting gD to Clec9A in mice adoptively transferred with small numbers of gDT-II T cells. Twenty-eight days after immunization, a substantially higher number of gDT-II cells could be found in the spleen of mice immunized with anti–Clec9A-polytope compared with mice immunized with isotype-polytope mAb or left unprimed (Fig. 4A), indicating expansion and persistence of Ag-specific cells. CD4+ memory T cells with a TFH-like CXCR5+ phenotype have been reported to provide superior B cell help relative to other CD4+ memory T cells (3942). gDT-II cells persisting 28 d after anti–Clec9A-polytope immunization expressed higher levels of CXCR5 and PD1, consistent with the formation of TFH memory (Fig. 4B). In line with other reports of TFH memory phenotype, these cells did not maintain higher levels of Bcl6 than their naive counterparts (41, 42).

FIGURE 4.

Clec9A targeting generates Ag-specific CD4+ T cell memory. (A and B) gDT-IILy5.1 cells (5 × 104) were adoptively transferred into B6 mice 1 d before i.v. immunization with 0.2 μg mAb-polytope or cutaneous infection with 106 PFU HSV-1. (A) The absolute number of gDT-II (CD45.1+ Vα3.2+) cells recovered per spleen of individual mice is shown for day 28 after priming; bars represent the mean. Pooled data from three independent experiments are presented. For statistical analysis, the data set was log-transformed and subjected to one-way ANOVA followed by Tukey’s test. ns = p ≥ 0.05, ***p < 0.001. (B) Representative histograms depicting CXCR5, PD1, and Bcl-6 expression by unprimed (naive) and memory gDT-II cells (left) and geometric mean fluorescence intensity (GMFI) of each marker for individual mice (right). Bars represent the mean. Pooled data from two independent experiments are presented. Statistical analysis was performed using two-tailed unpaired t test. ns = p ≥ 0.05, ****p < 0.0001. (C and D) Cytokine profile of gDT-II cells from mice primed as in (A). High numbers (106) of gDT-II were transferred into naive control mice to increase recovery from spleens on day 28. (C) Representative dot plots showing IL-2 and IFN-γ or TNF-α production by gDT-II cells after in vitro restimulation. Mean percentage in each quadrant is indicated. (D) Percentage (mean ± SEM) of gDT-II cells producing IFN-γ, IL-2, and/or TNF-α is represented in stacked columns. Pooled data from two independent experiments are presented. Statistical analysis was performed using one-way ANOVA, followed by Tukey's test. ns = p ≥ 0.05, *p < 0.05, **p < 0.01, ***p < 0.001. (E and F) gDT-IIEGFP cells were transferred into B6 mice 1 d before immunization as in (A)–(D). At day 28, CD4+ T cells were purified from the spleens of primed mice and the equivalent of 2 × 103 gDT-II cells transferred to two naive B6 hosts per donor mouse. Twenty-four hours after the transfer of memory cells, the naive B6 hosts were either boosted i.v. with 1 μg anti–Clec9A-gD or left unprimed. (E) Representative dot plot of PI CD4+ cells in the spleen on day 5 after the boost (or no boost). The gates identify gDT-IIEGFP cells, and the average absolute number in the spleen is indicated. (F) Absolute number of gDT-IIEGFP cells in the spleen of individual mice on day 5 after the boost (or no boost); bars represent the mean. Pooled data from two independent experiments are presented. Statistical analysis was performed using one-way ANOVA, followed by Tukey’s test. ns = p ≥ 0.05, ***p < 0.001.

FIGURE 4.

Clec9A targeting generates Ag-specific CD4+ T cell memory. (A and B) gDT-IILy5.1 cells (5 × 104) were adoptively transferred into B6 mice 1 d before i.v. immunization with 0.2 μg mAb-polytope or cutaneous infection with 106 PFU HSV-1. (A) The absolute number of gDT-II (CD45.1+ Vα3.2+) cells recovered per spleen of individual mice is shown for day 28 after priming; bars represent the mean. Pooled data from three independent experiments are presented. For statistical analysis, the data set was log-transformed and subjected to one-way ANOVA followed by Tukey’s test. ns = p ≥ 0.05, ***p < 0.001. (B) Representative histograms depicting CXCR5, PD1, and Bcl-6 expression by unprimed (naive) and memory gDT-II cells (left) and geometric mean fluorescence intensity (GMFI) of each marker for individual mice (right). Bars represent the mean. Pooled data from two independent experiments are presented. Statistical analysis was performed using two-tailed unpaired t test. ns = p ≥ 0.05, ****p < 0.0001. (C and D) Cytokine profile of gDT-II cells from mice primed as in (A). High numbers (106) of gDT-II were transferred into naive control mice to increase recovery from spleens on day 28. (C) Representative dot plots showing IL-2 and IFN-γ or TNF-α production by gDT-II cells after in vitro restimulation. Mean percentage in each quadrant is indicated. (D) Percentage (mean ± SEM) of gDT-II cells producing IFN-γ, IL-2, and/or TNF-α is represented in stacked columns. Pooled data from two independent experiments are presented. Statistical analysis was performed using one-way ANOVA, followed by Tukey's test. ns = p ≥ 0.05, *p < 0.05, **p < 0.01, ***p < 0.001. (E and F) gDT-IIEGFP cells were transferred into B6 mice 1 d before immunization as in (A)–(D). At day 28, CD4+ T cells were purified from the spleens of primed mice and the equivalent of 2 × 103 gDT-II cells transferred to two naive B6 hosts per donor mouse. Twenty-four hours after the transfer of memory cells, the naive B6 hosts were either boosted i.v. with 1 μg anti–Clec9A-gD or left unprimed. (E) Representative dot plot of PI CD4+ cells in the spleen on day 5 after the boost (or no boost). The gates identify gDT-IIEGFP cells, and the average absolute number in the spleen is indicated. (F) Absolute number of gDT-IIEGFP cells in the spleen of individual mice on day 5 after the boost (or no boost); bars represent the mean. Pooled data from two independent experiments are presented. Statistical analysis was performed using one-way ANOVA, followed by Tukey’s test. ns = p ≥ 0.05, ***p < 0.001.

Close modal

The number of gDT-II cells that persisted 28 d after anti–Clec9A-polytope immunization was comparable with that found after cutaneous HSV-1 infection (Fig. 4A), which is known to generate strong CD4+ T cell memory (43). These findings suggested that Clec9A-targeted Ag induced a memory response, although it remained possible that the persisting gDT-II cells were anergic. Thus, we examined their ability to produce the cytokines IL-2, TNF-α, and IFN-γ upon ex vivo restimulation with gD peptide. Relative to naive cells, anti–Clec9A-polytope–primed gDT-II cells showed an enhanced capacity to produce IL-2 and IFN-γ (Fig. 4C, 4D), consistent with a functional phenotype. Their cytokine production was not as strong as seen for HSV-1–primed gDT-II cells (Fig. 4C, 4D), but this was not unexpected given that cutaneous HSV-1 infection induces the Th1 skewing associated with these cytokines (35), whereas Clec9A priming favors TFH induction (16).

To further assess the functional capacity of memory gDT-II cells, we examined their secondary responses using anti-Clec9A genetically fused to whole gD (anti–Clec9A-gD) to boost responses. Initial attempts to boost anti–Clec9A-polytope–primed gDT-II cells with an injection of anti–Clec9A-gD 28 d later were not successful, most likely due to induction of Abs to anti–Clec9A-polytope that efficiently cross-reacted to anti–Clec9A-gD (Supplemental Fig. 2) and cleared it from circulation. To avoid the effects of persisting cross-reactive Abs against anti–Clec9A-gD, we set up a model where memory T cells were adoptively transferred into naive recipients before boosting. Small numbers of naive GFP+ gDT-II T cells were first transferred into congenic mice, before priming with Clec9A-polytope or, as a control, HSV-1. After 28 d, splenic memory CD4+ T cells were purified and the equivalent of 2000 GFP+ gDT-II cells were transferred from these immune mice into naive recipients. One day later, recipient mice were boosted with anti–Clec9A-gD or left unprimed and then 5 d after boosting, cells in the spleen were enumerated (Fig. 4E, 4F). In this setting, gDT-II cells primed with anti–Clec9A-polytope or HSV-1 expanded to a similar extent when boosted by anti–Clec9A-gD. These data indicated that anti-Clec9A–targeted priming does not cause tolerance induction but generates memory T cells that are able to proliferate in response to secondary boosting. As an aside, these data also revealed that Clec9A-targeted Ags can boost memory responses to viruses.

Although the earlier data indicated that memory cells survived after priming and were able to be boosted in number by secondary challenge with targeted Ag, they did not examine the functional capacity of these memory T cells. To examine function, we measured the response of memory gDT-II cells to an i.v. infection with HSV-1. Mice containing memory gDT-II cells were generated by adoptively transferring 5 × 104 naive gDT-II T cells into congenic mice followed by priming with Clec9A-polytope. As a control, we also made mice containing a similar number of naive gDT-II cells by transferring 106 naive gDT-II cells into congenic unprimed mice (Fig. 5A). At day 28 after the primary immunization, memory and naive gDT-II cells were compared for their expansion after i.v. challenge with HSV-1. Both naive and memory gDT-II cells expanded dramatically in response to infection (Fig. 5B). However, consistent with a previous study suggesting naive CD4+ T cells are more competent at proliferation than memory T cells (44), naive gDT-II cells expanded more vigorously than the anti–Clec9A-polytope primed memory gDT-II cells upon challenge with HSV-1. Importantly, anti–Clec9A-polytope primed memory gDT-II had a much greater propensity to become CXCR5hi PD1hi TFH than the naive gDT-II population, particularly earlier in the response (Fig. 5C, 5D). Polarization of TFH involves downregulation of transcription factors that define other effector CD4+ T cell lineages (4547). In the case of HSV-1 infection, TFH need to repress expression of Tbet, which otherwise drives a Th1 CD4+ T cell response (48, 49). Indeed, we found that after challenge with HSV-1, activated memory gDT-II TFH repressed expression of Tbet more effectively than naive gDT-II (Fig. 5E, 5F), indicative of efficient TFH polarization. By contrast, Tbet expression in the non-TFH (CXCR5 PD1lo/−) population of anti–Clec9A-polytope–primed memory gDT-II and the naive gDT-II population showed similar dynamics after the HSV-1 infection (Fig. 5E, 5F). Thus, anti–Clec9A-polytope–primed CD4+ memory cells converted rapidly to CXCR5hi PD1hi Tbetlow TFH effectors after HSV-1 challenge. In addition, enhancement of the TFH response augmented the formation of GL7+ CD95+ GC B cells (Fig. 5G, 5H) and accelerated the production of serum IgG to HSV-1 (Fig. 5I), although this did not reach significance. Importantly, mice primed with anti–Clec9A-polytope containing the gD epitope had a significantly enhanced Ab response to the gD protein (Fig. 5J).

FIGURE 5.

Ag-specific memory CD4+ T cells generated by Clec9A targeting mount an accelerated TFH response upon recall. B6 mice previously transferred with 5 × 104 or 106 gDT-IILy5.1 were immunized i.v. with 0.2 μg anti–Clec9A-polytope or left unprimed, respectively. Twenty-eight days after the primary immunization, some B6 mice were further boosted with HSV-1 i.v., and the response was monitored at days 3 and 6 after boosting. (A) A schematic of the experimental setup. (B) Absolute number of gDT-II in the spleen was enumerated before and after boosting with HSV-1 i.v. (C) Representative dot plots depicting the PD1 and CXCR5 expression by gDT-II cells, with the numbers indicating frequencies within gated regions (mean ± SEM). (D) Percentage (upper panel) and absolute number (lower panel) of gDT-II cells that were CXCR5hi PD1hi cells of a TFH phenotype for individual mice; bars represent the mean. (E) Representative histograms comparing Tbet expression by total gDT-II cells before the boost (upper histogram) or by CXCR5hi PD1hi TFH (middle histogram) or CXCR5 PD1 non-TFH (lower histogram) of primary responding gDT-II cells (broken line) or memory gDT-II cells (unbroken line) 3 d after the boost. (F) Changes in the geometric mean fluorescence intensity (GMFI) of Tbet staining on gDT-II TFH [as gated in (E)] and gDT-II non-TFH [as gated in (E)] before and after the boost. Each point represents a single mouse; bars represent the mean. (G) Representative dot plots showing CD19+ B220+ endogenous B cell responses in the spleen before and after the boost. Numbers indicate percentage of GL7+ CD95+ GC B cells (mean ± SEM). (H) Absolute number (upper panel) and percentage of total B cells (lower panel) of GL7+ CD95+ GC B cells in the spleen. (I) Serum anti–HSV-1 IgG titer as assessed by ELISA. The points represent the geometric means, and the error bars indicate SEM of log-transformed data. (J) Anti-gD IgG titer as measured by ELISA. The points represent the geometric means and the error bars indicate SEM of log-transformed data. (B–J) Pooled data of two independent experiments with a total of five to six mice per group at each time point. Statistical analysis was performed using two-tailed unpaired t test for (B), (D), (F), and (H), and Mann–Whitney U test was used on log-transformed values for (I) and (J). ns = p ≥ 0.5, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

FIGURE 5.

Ag-specific memory CD4+ T cells generated by Clec9A targeting mount an accelerated TFH response upon recall. B6 mice previously transferred with 5 × 104 or 106 gDT-IILy5.1 were immunized i.v. with 0.2 μg anti–Clec9A-polytope or left unprimed, respectively. Twenty-eight days after the primary immunization, some B6 mice were further boosted with HSV-1 i.v., and the response was monitored at days 3 and 6 after boosting. (A) A schematic of the experimental setup. (B) Absolute number of gDT-II in the spleen was enumerated before and after boosting with HSV-1 i.v. (C) Representative dot plots depicting the PD1 and CXCR5 expression by gDT-II cells, with the numbers indicating frequencies within gated regions (mean ± SEM). (D) Percentage (upper panel) and absolute number (lower panel) of gDT-II cells that were CXCR5hi PD1hi cells of a TFH phenotype for individual mice; bars represent the mean. (E) Representative histograms comparing Tbet expression by total gDT-II cells before the boost (upper histogram) or by CXCR5hi PD1hi TFH (middle histogram) or CXCR5 PD1 non-TFH (lower histogram) of primary responding gDT-II cells (broken line) or memory gDT-II cells (unbroken line) 3 d after the boost. (F) Changes in the geometric mean fluorescence intensity (GMFI) of Tbet staining on gDT-II TFH [as gated in (E)] and gDT-II non-TFH [as gated in (E)] before and after the boost. Each point represents a single mouse; bars represent the mean. (G) Representative dot plots showing CD19+ B220+ endogenous B cell responses in the spleen before and after the boost. Numbers indicate percentage of GL7+ CD95+ GC B cells (mean ± SEM). (H) Absolute number (upper panel) and percentage of total B cells (lower panel) of GL7+ CD95+ GC B cells in the spleen. (I) Serum anti–HSV-1 IgG titer as assessed by ELISA. The points represent the geometric means, and the error bars indicate SEM of log-transformed data. (J) Anti-gD IgG titer as measured by ELISA. The points represent the geometric means and the error bars indicate SEM of log-transformed data. (B–J) Pooled data of two independent experiments with a total of five to six mice per group at each time point. Statistical analysis was performed using two-tailed unpaired t test for (B), (D), (F), and (H), and Mann–Whitney U test was used on log-transformed values for (I) and (J). ns = p ≥ 0.5, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Close modal

In this article, we have shown that Clec9A targeting induced bona-fide TFH differentiation as revealed by elevated expression of Bcl-6, along with CXCR5 and PD1. IL-21 is required for optimal humoral responses, particularly for IgG1 (50, 51), which is also the dominant isotype induced by Clec9A targeting in the absence of adjuvant (14). We demonstrated that CD4+ T cells induced by Clec9A targeting produced IL-21, and that the potency of the induced Ab responses critically depended on IL-21/IL-21R interactions. Although GC formation was clearly driven by Clec9A targeting, even as early as day 6, it is likely that at least some Ag-specific Abs generated at this time were derived from extrafollicular responses, which also depend on IL-21 (51). In this sense, neither expression of IL-21 nor dependence on this cytokine proves the involvement of GC TFH. However, Clec9A targeting clearly induces GC formation, as shown in this article and previously (25). Furthermore, the observed persistence of Ag-specific CD4+ T cells within these GCs suggests TFH play a central role in supporting potent Ab responses induced.

Clec9A targeting is unique in its capacity to generate TFH and their associated GC responses in the absence of adjuvant. Although targeting Ag to CD8 DCs in the absence of adjuvant can induce humoral immunity, responses such as those targeted to DCIR-2 are extrafollicular and do not involve GC formation (30). There are several possible explanations for the differences. One, discussed previously (16), is the persistence of anti-Clec9A constructs in the bloodstream, leading to prolonged Ag presentation that drives effective priming even in the absence of activated CD8+ DCs. A second possibility is that the location of the targeted DC may be critical. CD4+ CD11b+ DCs targeted by DCIR-2 predominantly localize in marginal zone (MZ) bridging channels, allowing efficient capture of particulate Ag (31, 52). It has been shown that CD4+ CD11b+ DCs that capture “SRBCs,” a classical type of particulate Ag, move from the MZ bridging channels to the T/B border (52), where responses eventually lead to GC formation. Because targeting Ag via DCIR-2 did not induce such movement of DCs, but left them within the MZ bridging channels (30, 31), their capacity to induce GC formation may have been compromised. Interestingly, location within the bridging channels is where CD11clow blood “DCs” were reported to support T cell–independent B cell responses by providing survival signals such as BAFF and APRIL (53). Thus, remaining in this region, CD4+ CD11b+ DCs that have captured Ag via DCIR-2 may have efficient interactions with Ag-specific B cells (30), but little chance to form prolonged interaction with CD4+ T cells. By contrast, CD8α+ DCs, which are targeted by Clec9A, are predominantly located within the T cell zone but can also be found in the MZ and red pulp of the spleen (5456 and data not shown). Localization within the T cell zone would allow CD8+ DCs to readily prime naive CD4+ T cells without requiring movement. In addition, it has been reported that Ag-specific B cells undergo clonal expansion in the outer follicle adjacent to the MZ before forming GCs in some circumstances (57, 58). Thus, CD8α+ DCs seem to be strategically located within the spleen to present Ag to CD4+ T cells and possibly B cells to initiate TFH and GC responses.

Targeting a polytope to Clec9A induced potent TFH responses to the defined CD4+ T cell epitopes OVA323–339 and gD290–302. Furthermore, generation of CD4+ T cell memory was evident in immunized mice. Memory CD4+ T cells provide better help than naive CD4+ T cells because of an enhanced ability to exert effector functions and an increased precursor frequency (59). TFH themselves have been shown to survive for an extended period without Ag as memory cells that can be recalled efficiently (36, 40). In the mouse model of Listeria monocytogenes infection, CXCR5+ PD1 CD4+ T cells were found to be the subset of central memory precursors that formed TFH more efficiently than Th1 upon boosting (60). In another study, LCMV-derived 3K peptide plus LPS immunization generated CXCR5+ endogenous CD4+ memory T cells that accelerated the kinetics (expansion/isotype switching) of cognate naive B cell responses in a subsequent boost with 3K-OVA (61). In this study, we observed higher expression of CXCR5 and PD1 on gD-specific memory cells generated through Clec9A targeting, suggesting formation of TFH memory. Their relatively low expression of Bcl6 was also consistent with a memory phenotype (42), rather than with cells that had recently left ongoing active GCs. These cells were qualitatively superior to their primary counterparts at inducing polarized Tbetlow TFH after recall with HSV-1 and were able to accelerate GC B cell responses. Together, these findings support the conclusion that Clec9A-targeted priming generates strong TFH responses that form TFH-polarized memory. However, Tbet upregulation in CXCR5 PD1 cells suggests that efficient Th1 development is possible for a proportion of memory cells induced by prior immunization with anti–Clec9A-polytope.

In the context of vaccination, targeting Ags to Clec9A appears to be a robust and simple approach to generate strong humoral immunity in the absence of an adjuvant. This approach has the benefit of lacking any adjuvant-associated side effects and, as shown in this article, not only generates powerful TFH responses but drives these cells to form TFH memory that is able to help subsequent B cell responses. This complements the generation of memory B cells, previously shown after targeting of nitrophenol hapten to Clec9A (25). Given that Clec9A targeting does not activate CD8α+ DCs (1416), it will be interesting to decipher precisely how it leads to such strong TFH immunity and whether there are any control mechanisms that normally prevent such responses to authentic Clec9A ligands such as F-actin–associated proteins in the absence of infection.

Immunofluorescence microscopy was performed at the Biological Optical Microscopy Platform, The University of Melbourne. We thank Ming Li, Melanie Damtsis, Brook Davies, and Fatma Ahmet for technical assistance.

This work was supported by the National Health and Medical Research Council of Australia and the Australian Research Council.

The online version of this article contains supplemental material.

Abbreviations used in this article:

DC

dendritic cell

GC

germinal center

gD

glycoprotein D

MZ

marginal zone

PI

propidium iodide

PNA

peanut agglutinin

TFH

follicular Th cell.

1
Pooley
J. L.
,
Heath
W. R.
,
Shortman
K.
.
2001
.
Cutting edge: intravenous soluble antigen is presented to CD4 T cells by CD8- dendritic cells, but cross-presented to CD8 T cells by CD8+ dendritic cells.
J. Immunol.
166
:
5327
5330
.
2
den Haan, J. M., S. M. Lehar, and M. J. Bevan. 2000. CD8+ but not CD8−dendritic cells cross-prime cytotoxic T cells in vivo. J. Exp. Med. 192: 1685–1696
.
3
Smith
C. M.
,
Belz
G. T.
,
Wilson
N. S.
,
Villadangos
J. A.
,
Shortman
K.
,
Carbone
F. R.
,
Heath
W. R.
.
2003
.
Cutting edge: conventional CD8 alpha+ dendritic cells are preferentially involved in CTL priming after footpad infection with herpes simplex virus-1.
J. Immunol.
170
:
4437
4440
.
4
Belz
G. T.
,
Smith
C. M.
,
Eichner
D.
,
Shortman
K.
,
Karupiah
G.
,
Carbone
F. R.
,
Heath
W. R.
.
2004
.
Cutting edge: conventional CD8 alpha+ dendritic cells are generally involved in priming CTL immunity to viruses.
J. Immunol.
172
:
1996
2000
.
5
Dudziak
D.
,
Kamphorst
A. O.
,
Heidkamp
G. F.
,
Buchholz
V. R.
,
Trumpfheller
C.
,
Yamazaki
S.
,
Cheong
C.
,
Liu
K.
,
Lee
H.-W.
,
Park
C. G.
, et al
.
2007
.
Differential antigen processing by dendritic cell subsets in vivo.
Science
315
:
107
111
.
6
Schnorrer
P.
,
Behrens
G. M. N.
,
Wilson
N. S.
,
Pooley
J. L.
,
Smith
C. M.
,
El-Sukkari
D.
,
Davey
G.
,
Kupresanin
F.
,
Li
M.
,
Maraskovsky
E.
, et al
.
2006
.
The dominant role of CD8+ dendritic cells in cross-presentation is not dictated by antigen capture.
Proc. Natl. Acad. Sci. USA
103
:
10729
10734
.
7
Hochrein
H.
,
O’Keeffe
M.
,
Luft
T.
,
Vandenabeele
S.
,
Grumont
R. J.
,
Maraskovsky
E.
,
Shortman
K.
.
2000
.
Interleukin (IL)-4 is a major regulatory cytokine governing bioactive IL-12 production by mouse and human dendritic cells.
J. Exp. Med.
192
:
823
833
.
8
Maldonado-López
R.
,
De Smedt
T.
,
Michel
P.
,
Godfroid
J.
,
Pajak
B.
,
Heirman
C.
,
Thielemans
K.
,
Leo
O.
,
Urbain
J.
,
Moser
M.
.
1999
.
CD8alpha+ and CD8alpha- subclasses of dendritic cells direct the development of distinct T helper cells in vivo.
J. Exp. Med.
189
:
587
592
.
9
Pulendran
B.
,
Smith
J. L.
,
Caspary
G.
,
Brasel
K.
,
Pettit
D.
,
Maraskovsky
E.
,
Maliszewski
C. R.
.
1999
.
Distinct dendritic cell subsets differentially regulate the class of immune response in vivo.
Proc. Natl. Acad. Sci. USA
96
:
1036
1041
.
10
Bonifaz
L.
,
Bonnyay
D.
,
Mahnke
K.
,
Rivera
M.
,
Nussenzweig
M. C.
,
Steinman
R. M.
.
2002
.
Efficient targeting of protein antigen to the dendritic cell receptor DEC-205 in the steady state leads to antigen presentation on major histocompatibility complex class I products and peripheral CD8+ T cell tolerance.
J. Exp. Med.
196
:
1627
1638
.
11
Bonifaz
L. C.
,
Bonnyay
D. P.
,
Charalambous
A.
,
Darguste
D. I.
,
Fujii
S.
,
Soares
H.
,
Brimnes
M. K.
,
Moltedo
B.
,
Moran
T. M.
,
Steinman
R. M.
.
2004
.
In vivo targeting of antigens to maturing dendritic cells via the DEC-205 receptor improves T cell vaccination.
J. Exp. Med.
199
:
815
824
.
12
Hawiger
D.
,
Inaba
K.
,
Dorsett
Y.
,
Guo
M.
,
Mahnke
K.
,
Rivera
M.
,
Ravetch
J. V.
,
Steinman
R. M.
,
Nussenzweig
M. C.
.
2001
.
Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo.
J. Exp. Med.
194
:
769
779
.
13
Mahnke
K.
,
Qian
Y.
,
Knop
J.
,
Enk
A. H.
.
2003
.
Induction of CD4+/CD25+ regulatory T cells by targeting of antigens to immature dendritic cells.
Blood
101
:
4862
4869
.
14
Caminschi
I.
,
Proietto
A. I.
,
Ahmet
F.
,
Kitsoulis
S.
,
Shin Teh
J.
,
Lo
J. C. Y.
,
Rizzitelli
A.
,
Wu
L.
,
Vremec
D.
,
van Dommelen
S. L. H.
, et al
.
2008
.
The dendritic cell subtype-restricted C-type lectin Clec9A is a target for vaccine enhancement.
Blood
112
:
3264
3273
.
15
Joffre
O. P.
,
Sancho
D.
,
Zelenay
S.
,
Keller
A. M.
,
Reis e Sousa
C.
.
2010
.
Efficient and versatile manipulation of the peripheral CD4+ T-cell compartment by antigen targeting to DNGR-1/CLEC9A.
Eur. J. Immunol.
40
:
1255
1265
.
16
Lahoud
M. H.
,
Ahmet
F.
,
Kitsoulis
S.
,
Wan
S. S.
,
Vremec
D.
,
Lee
C.-N.
,
Phipson
B.
,
Shi
W.
,
Smyth
G. K.
,
Lew
A. M.
, et al
.
2011
.
Targeting antigen to mouse dendritic cells via Clec9A induces potent CD4 T cell responses biased toward a follicular helper phenotype.
J. Immunol.
187
:
842
850
.
17
Li
J.
,
Ahmet
F.
,
Sullivan
L. C.
,
Brooks
A. G.
,
Kent
S. J.
,
De Rose
R.
,
Salazar
A. M.
,
Reis e Sousa
C.
,
Shortman
K.
,
Lahoud
M. H.
, et al
.
2015
.
Antibodies targeting Clec9A promote strong humoral immunity without adjuvant in mice and non-human primates.
Eur. J. Immunol.
45
:
854
864
.
18
Idoyaga
J.
,
Cheong
C.
,
Suda
K.
,
Suda
N.
,
Kim
J. Y.
,
Lee
H.
,
Park
C. G.
,
Steinman
R. M.
.
2008
.
Cutting edge: langerin/CD207 receptor on dendritic cells mediates efficient antigen presentation on MHC I and II products in vivo.
J. Immunol.
180
:
3647
3650
.
19
Idoyaga
J.
,
Lubkin
A.
,
Fiorese
C.
,
Lahoud
M. H.
,
Caminschi
I.
,
Huang
Y.
,
Rodriguez
A.
,
Clausen
B. E.
,
Park
C. G.
,
Trumpfheller
C.
,
Steinman
R. M.
.
2011
.
Comparable T helper 1 (Th1) and CD8 T-cell immunity by targeting HIV gag p24 to CD8 dendritic cells within antibodies to Langerin, DEC205, and Clec9A.
Proc. Natl. Acad. Sci. USA
108
:
2384
2389
.
20
Lahoud
M. H.
,
Proietto
A. I.
,
Ahmet
F.
,
Kitsoulis
S.
,
Eidsmo
L.
,
Wu
L.
,
Sathe
P.
,
Pietersz
S.
,
Chang
H. W.
,
Walker
I. D.
, et al
.
2009
.
The C-type lectin Clec12A present on mouse and human dendritic cells can serve as a target for antigen delivery and enhancement of antibody responses.
J. Immunol.
182
:
7587
7594
.
21
Sancho
D.
,
Mourão-Sá
D.
,
Joffre
O. P.
,
Schulz
O.
,
Rogers
N. C.
,
Pennington
D. J.
,
Carlyle
J. R.
,
Reis e Sousa
C.
.
2008
.
Tumor therapy in mice via antigen targeting to a novel, DC-restricted C-type lectin.
J. Clin. Invest.
118
:
2098
2110
.
22
Soares
H.
,
Waechter
H.
,
Glaichenhaus
N.
,
Mougneau
E.
,
Yagita
H.
,
Mizenina
O.
,
Dudziak
D.
,
Nussenzweig
M. C.
,
Steinman
R. M.
.
2007
.
A subset of dendritic cells induces CD4+ T cells to produce IFN-gamma by an IL-12-independent but CD70-dependent mechanism in vivo.
J. Exp. Med.
204
:
1095
1106
.
23
Boscardin
S. B.
,
Hafalla
J. C. R.
,
Masilamani
R. F.
,
Kamphorst
A. O.
,
Zebroski
H. A.
,
Rai
U.
,
Morrot
A.
,
Zavala
F.
,
Steinman
R. M.
,
Nussenzweig
R. S.
,
Nussenzweig
M. C.
.
2006
.
Antigen targeting to dendritic cells elicits long-lived T cell help for antibody responses.
J. Exp. Med.
203
:
599
606
.
24
Loschko
J.
,
Schlitzer
A.
,
Dudziak
D.
,
Drexler
I.
,
Sandholzer
N.
,
Bourquin
C.
,
Reindl
W.
,
Krug
A. B.
.
2011
.
Antigen delivery to plasmacytoid dendritic cells via BST2 induces protective T cell-mediated immunity.
J. Immunol.
186
:
6718
6725
.
25
Park
H. Y.
,
Light
A.
,
Lahoud
M. H.
,
Caminschi
I.
,
Tarlinton
D. M.
,
Shortman
K.
.
2013
.
Evolution of B cell responses to Clec9A-targeted antigen.
J. Immunol.
191
:
4919
4925
.
26
Kretschmer
K.
,
Apostolou
I.
,
Hawiger
D.
,
Khazaie
K.
,
Nussenzweig
M. C.
,
von Boehmer
H.
.
2005
.
Inducing and expanding regulatory T cell populations by foreign antigen.
Nat. Immunol.
6
:
1219
1227
.
27
Pereira
J. P.
,
Kelly
L. M.
,
Xu
Y.
,
Cyster
J. G.
.
2009
.
EBI2 mediates B cell segregation between the outer and centre follicle.
Nature
460
:
1122
1126
.
28
Gatto
D.
,
Paus
D.
,
Basten
A.
,
Mackay
C. R.
,
Brink
R.
.
2009
.
Guidance of B cells by the orphan G protein-coupled receptor EBI2 shapes humoral immune responses.
Immunity
31
:
259
269
.
29
Victora
G. D.
,
Schwickert
T. A.
,
Fooksman
D. R.
,
Kamphorst
A. O.
,
Meyer-Hermann
M.
,
Dustin
M. L.
,
Nussenzweig
M. C.
.
2010
.
Germinal center dynamics revealed by multiphoton microscopy with a photoactivatable fluorescent reporter.
Cell
143
:
592
605
.
30
Chappell
C. P.
,
Draves
K. E.
,
Giltiay
N. V.
,
Clark
E. A.
.
2012
.
Extrafollicular B cell activation by marginal zone dendritic cells drives T cell-dependent antibody responses.
J. Exp. Med.
209
:
1825
1840
.
31
Gatto
D.
,
Wood
K.
,
Caminschi
I.
,
Murphy-Durland
D.
,
Schofield
P.
,
Christ
D.
,
Karupiah
G.
,
Brink
R.
.
2013
.
The chemotactic receptor EBI2 regulates the homeostasis, localization and immunological function of splenic dendritic cells.
Nat. Immunol.
14
:
446
453
.
32
Corbett
A. J.
,
Caminschi
I.
,
McKenzie
B. S.
,
Brady
J. L.
,
Wright
M. D.
,
Mottram
P. L.
,
Hogarth
P. M.
,
Hodder
A. N.
,
Zhan
Y.
,
Tarlinton
D. M.
, et al
.
2005
.
Antigen delivery via two molecules on the CD8- dendritic cell subset induces humoral immunity in the absence of conventional “danger”.
Eur. J. Immunol.
35
:
2815
2825
.
33
Crotty
S.
2011
.
Follicular helper CD4 T cells (TFH).
Annu. Rev. Immunol.
29
:
621
663
.
34
Barnden
M. J.
,
Allison
J.
,
Heath
W. R.
,
Carbone
F. R.
.
1998
.
Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements.
Immunol. Cell Biol.
76
:
34
40
.
35
Bedoui
S.
,
Whitney
P. G.
,
Waithman
J.
,
Eidsmo
L.
,
Wakim
L.
,
Caminschi
I.
,
Allan
R. S.
,
Wojtasiak
M.
,
Shortman
K.
,
Carbone
F. R.
, et al
.
2009
.
Cross-presentation of viral and self antigens by skin-derived CD103+ dendritic cells.
Nat. Immunol.
10
:
488
495
.
36
Lüthje
K.
,
Kallies
A.
,
Shimohakamada
Y.
,
Belz
G. T.
,
Light
A.
,
Tarlinton
D. M.
,
Nutt
S. L.
.
2012
.
The development and fate of follicular helper T cells defined by an IL-21 reporter mouse.
Nat. Immunol.
13
:
491
498
.
37
Ozaki
K.
,
Spolski
R.
,
Feng
C. G.
,
Qi
C.-F.
,
Cheng
J.
,
Sher
A.
,
Morse
H. C.
 III
,
Liu
C.
,
Schwartzberg
P. L.
,
Leonard
W. J.
.
2002
.
A critical role for IL-21 in regulating immunoglobulin production.
Science
298
:
1630
1634
.
38
van Lint
A.
,
Ayers
M.
,
Brooks
A. G.
,
Coles
R. M.
,
Heath
W. R.
,
Carbone
F. R.
.
2004
.
Herpes simplex virus-specific CD8+ T cells can clear established lytic infections from skin and nerves and can partially limit the early spread of virus after cutaneous inoculation.
J. Immunol.
172
:
392
397
.
39
Locci
M.
,
Havenar-Daughton
C.
,
Landais
E.
,
Wu
J.
,
Kroenke
M. A.
,
Arlehamn
C. L.
,
Su
L. F.
,
Cubas
R.
,
Davis
M. M.
,
Sette
A.
, et al
International AIDS Vaccine Initiative Protocol C Principal Investigators
.
2013
.
Human circulating PD-1+CXCR3-CXCR5+ memory Tfh cells are highly functional and correlate with broadly neutralizing HIV antibody responses.
Immunity
39
:
758
769
.
40
Liu
X.
,
Yan
X.
,
Zhong
B.
,
Nurieva
R. I.
,
Wang
A.
,
Wang
X.
,
Martin-Orozco
N.
,
Wang
Y.
,
Chang
S. H.
,
Esplugues
E.
, et al
.
2012
.
Bcl6 expression specifies the T follicular helper cell program in vivo.
J. Exp. Med.
209
:
1841
1852, S1–S24
.
41
Chevalier
N.
,
Jarrossay
D.
,
Ho
E.
,
Avery
D. T.
,
Ma
C. S.
,
Yu
D.
,
Sallusto
F.
,
Tangye
S. G.
,
Mackay
C. R.
.
2011
.
CXCR5 expressing human central memory CD4 T cells and their relevance for humoral immune responses.
J. Immunol.
186
:
5556
5568
.
42
Hale
J. S.
,
Youngblood
B.
,
Latner
D. R.
,
Mohammed
A. U. R.
,
Ye
L.
,
Akondy
R. S.
,
Wu
T.
,
Iyer
S. S.
,
Ahmed
R.
.
2013
.
Distinct memory CD4+ T cells with commitment to T follicular helper- and T helper 1-cell lineages are generated after acute viral infection.
Immunity
38
:
805
817
.
43
Gebhardt
T.
,
Whitney
P. G.
,
Zaid
A.
,
Mackay
L. K.
,
Brooks
A. G.
,
Heath
W. R.
,
Carbone
F. R.
,
Mueller
S. N.
.
2011
.
Different patterns of peripheral migration by memory CD4+ and CD8+ T cells.
Nature
477
:
216
219
.
44
MacLeod
M. K. L.
,
McKee
A.
,
Crawford
F.
,
White
J.
,
Kappler
J.
,
Marrack
P.
.
2008
.
CD4 memory T cells divide poorly in response to antigen because of their cytokine profile.
Proc. Natl. Acad. Sci. USA
105
:
14521
14526
.
45
Johnston
R. J.
,
Poholek
A. C.
,
DiToro
D.
,
Yusuf
I.
,
Eto
D.
,
Barnett
B.
,
Dent
A. L.
,
Craft
J.
,
Crotty
S.
.
2009
.
Bcl6 and Blimp-1 are reciprocal and antagonistic regulators of T follicular helper cell differentiation.
Science
325
:
1006
1010
.
46
Yu
D.
,
Rao
S.
,
Tsai
L. M.
,
Lee
S. K.
,
He
Y.
,
Sutcliffe
E. L.
,
Srivastava
M.
,
Linterman
M.
,
Zheng
L.
,
Simpson
N.
, et al
.
2009
.
The transcriptional repressor Bcl-6 directs T follicular helper cell lineage commitment.
Immunity
31
:
457
468
.
47
Nurieva
R. I.
,
Chung
Y.
,
Martinez
G. J.
,
Yang
X. O.
,
Tanaka
S.
,
Matskevitch
T. D.
,
Wang
Y. H.
,
Dong
C.
.
2009
.
Bcl6 mediates the development of T follicular helper cells.
Science
325
:
1001
1005
.
48
Nakayamada
S.
,
Kanno
Y.
,
Takahashi
H.
,
Jankovic
D.
,
Lu
K. T.
,
Johnson
T. A.
,
Sun
H. W.
,
Vahedi
G.
,
Hakim
O.
,
Handon
R.
, et al
.
2011
.
Early Th1 cell differentiation is marked by a Tfh cell-like transition.
Immunity
35
:
919
931
.
49
Szabo
S. J.
,
Kim
S. T.
,
Costa
G. L.
,
Zhang
X.
,
Fathman
C. G.
,
Glimcher
L. H.
.
2000
.
A novel transcription factor, T-bet, directs Th1 lineage commitment.
Cell
100
:
655
669
.
50
Linterman
M. A.
,
Rigby
R. J.
,
Wong
R. K.
,
Yu
D.
,
Brink
R.
,
Cannons
J. L.
,
Schwartzberg
P. L.
,
Cook
M. C.
,
Walters
G. D.
,
Vinuesa
C. G.
.
2009
.
Follicular helper T cells are required for systemic autoimmunity.
J. Exp. Med.
206
:
561
576
.
51
Lee
S. K.
,
Rigby
R. J.
,
Zotos
D.
,
Tsai
L. M.
,
Kawamoto
S.
,
Marshall
J. L.
,
Ramiscal
R. R.
,
Chan
T. D.
,
Gatto
D.
,
Brink
R.
, et al
.
2011
.
B cell priming for extrafollicular antibody responses requires Bcl-6 expression by T cells.
J. Exp. Med.
208
:
1377
1388
.
52
Yi
T.
,
Cyster
J. G.
.
2013
.
EBI2-mediated bridging channel positioning supports splenic dendritic cell homeostasis and particulate antigen capture.
eLife
2
:
e00757
.
53
Balázs
M.
,
Martin
F.
,
Zhou
T.
,
Kearney
J.
.
2002
.
Blood dendritic cells interact with splenic marginal zone B cells to initiate T-independent immune responses.
Immunity
17
:
341
352
.
54
Idoyaga
J.
,
Suda
N.
,
Suda
K.
,
Park
C. G.
,
Steinman
R. M.
.
2009
.
Antibody to Langerin/CD207 localizes large numbers of CD8α+ dendritic cells to the marginal zone of mouse spleen.
Proc. Natl. Acad. Sci. USA
106
:
1524
1529
.
55
Dorner
B. G.
,
Dorner
M. B.
,
Zhou
X.
,
Opitz
C.
,
Mora
A.
,
Güttler
S.
,
Hutloff
A.
,
Mages
H. W.
,
Ranke
K.
,
Schaefer
M.
, et al
.
2009
.
Selective expression of the chemokine receptor XCR1 on cross-presenting dendritic cells determines cooperation with CD8+ T cells.
Immunity
31
:
823
833
.
56
Hartung
E.
,
Becker
M.
,
Bachem
A.
,
Reeg
N.
,
Jäkel
A.
,
Hutloff
A.
,
Weber
H.
,
Weise
C.
,
Giesecke
C.
,
Henn
V.
, et al
.
2015
.
Induction of potent CD8 T cell cytotoxicity by specific targeting of antigen to cross-presenting dendritic cells in vivo via murine or human XCR1.
J. Immunol.
194
:
1069
1079
.
57
Coffey
F.
,
Alabyev
B.
,
Manser
T.
.
2009
.
Initial clonal expansion of germinal center B cells takes place at the perimeter of follicles.
Immunity
30
:
599
609
.
58
Kerfoot
S. M.
,
Yaari
G.
,
Patel
J. R.
,
Johnson
K. L.
,
Gonzalez
D. G.
,
Kleinstein
S. H.
,
Haberman
A. M.
.
2011
.
Germinal center B cell and T follicular helper cell development initiates in the interfollicular zone.
Immunity
34
:
947
960
.
59
Ahmed
R.
,
Gray
D.
.
1996
.
Immunological memory and protective immunity: understanding their relation.
Science
272
:
54
60
.
60
Pepper
M.
,
Pagán
A. J.
,
Igyártó
B. Z.
,
Taylor
J. J.
,
Jenkins
M. K.
.
2011
.
Opposing signals from the Bcl6 transcription factor and the interleukin-2 receptor generate T helper 1 central and effector memory cells.
Immunity
35
:
583
595
.
61
MacLeod
M. K. L.
,
David
A.
,
McKee
A. S.
,
Crawford
F.
,
Kappler
J. W.
,
Marrack
P.
.
2011
.
Memory CD4 T cells that express CXCR5 provide accelerated help to B cells.
J. Immunol.
186
:
2889
2896
.

The authors have no financial conflicts of interest.

Supplementary data