Extracellular UDP (eUDP), released as a danger signal by stressed or apoptotic cells, plays an important role in a series of physiological processes. Although the mechanism of eUDP release in apoptotic cells has been well defined, how the eUDP is released in innate immune responses remains unknown. In this study, we demonstrated that UDP was released in both Escherichia coli–infected mice and LPS- or Pam3CSK4-treated macrophages. Also, LPS-induced UDP release could be significantly blocked by selective TLR4 inhibitor Atractylenolide I and selective gap junction inhibitors carbenoxolone and flufenamic acid (FFA), suggesting the key role of TLR signaling and gap junction channels in this process. Meanwhile, eUDP protected mice from peritonitis by reducing invaded bacteria that could be rescued by MRS2578 (selective P2Y6 receptor inhibitor) and FFA. Then, connexin 43, as one of the gap junction proteins, was found to be clearly increased by LPS in a dose- and time-dependent manner. Furthermore, if we blocked LPS-induced ERK signaling by U0126, the expression of connexin 43 and UDP release was also inhibited dramatically. In addition, UDP-induced MCP-1 secretion was significantly reduced by MRS2578, FFA, and P2Y6 mutation. Accordingly, pretreating mice with U0126 and Gap26 increased invaded bacteria and aggravated mice death. Taken together, our study reveals an internal relationship between danger signals and TLR signaling in innate immune responses, which suggests a potential therapeutic significance of gap junction channel–mediated UDP release in infectious diseases.

Microbial-derived pathogen-associated molecular patterns (PAMPs), such as LPS and Pam3CSK4, are some of the strongest triggers of immune responses. However, numerous types of stimuli including mechanical trauma, ischemia, stress, and environmental cues also trigger an innate immune response through releasing pathogen-free mediators, which are collectively termed as damage-associated molecular patterns (DAMPs) (1). Meanwhile, as a kind of special stress to immune cells, the invading pathogen could also induce the release of DAMPs. In the past decades, most studies have focused on PAMP-induced secretion of cytokines, chemokines, and IFNs, whereas the internal relationship between DAMPs and PAMPs in innate immune responses has not been well investigated (2). Therefore, it is of interest to explore the function and mechanism of DAMPs release in infectious diseases.

Central among the most widely studied DAMPs are HMGB1, heat shock proteins, and extracellular nucleotides such as ATP and UDP. As the first described purinergic transmission agent, ATP has been well investigated in a series of physiological functions, including different infectious diseases (35). However, the study of UDP/P2Y6 became increasingly popular only after it was described as an immune mediator of microglial phagocytosis in 2007 (6). Since then, more and more evidence has shown the important role of UDP/P2Y6 signaling in the regulation of immune responses in bacterial infection (79) and even in atherosclerotic lesion development (10). Moreover, the apoptotic cells could release UDP as find-me signals through pannexin hemichannels that recruit motile phagocytes, leading to the prompt clearance of dying cells (11, 12). However, whether and how UDP was released in bacterial infection still need to be further explored.

It has been shown that injured or infected cells can release nucleotides through exocytosis, blebbing or passage via a plasma membrane channel. Among them, gap junction channels (GJCs) play important roles in cell–cell communications through the direct transfer of ions, second messengers, and other molecules including Ag peptides (13, 14). Generally, each GJC contains a serial docking of two hemichannels, which are composed of six protein subunits called connexins and pannexins (15). Although connexin 43 was first uncovered in heart muscle cells and plays important roles in heart development (16, 17), connexin 43 is expressed ubiquitously, in contrast to most connexin isoforms, which are restrictively expressed and their malfunction results in disorders such as deafness, skin diseases, fertility problems, and lens cataracts (18). Multiple immune cells have also been shown to express connexins. Among them, dendritic cells and monocytes/macrophages express connexin and can form functional gap junctions between identical as well as different cells (19, 20). Most notably, connexin can be upregulated when the immune cells become exposed to inflammatory factors, but the role of them in purinergic signaling–mediated immune regulation is poorly defined (21). Our previous study has shown that virus-infected cells release UDP through pannexin hemichannels that facilitate IFN-β production (22). Also, we have reported the protective role of UDP and P2Y6 in bacterial infection, but whether and how UDP is released in bacterial infection are still unknown.

In this study, we demonstrated that UDP is released from macrophages mainly through connexin-mediated GJCs during bacterial infection. Then, extracellular UDP (eUDP) plays a nonredundant role in promoting host survival from Escherichia coli–induced peritonitis through activating P2Y6 and facilitating MCP-1 production. Furthermore, we also showed that TLR-activated ERK signaling is not only involved in proinflammatory cytokine production but also can regulate innate immune responses via increasing UDP release. Taken together, our findings demonstrated a potential therapeutic significance of TLR-activated GJCs in fighting against bacterial infection through UDP release.

For peritoneal macrophages and bone marrow–derived macrophages (BMMs) isolation as well as the peritonitis mouse model, female 6- to 8-wk-old C57BL/6 mice were purchased from the Shanghai Laboratory Animal Company (Shanghai, China). The P2Y6 knockout mice were prepared as described previously (22). All mice used in these experiments were housed under pathogen-free conditions and were maintained in accordance with institutional guidelines. All experimental protocols were approved by the Animal Investigation Committee of East China Normal University.

BMMs and peritoneal macrophages were obtained as described previously (23). The mouse macrophage cell line RAW 264.7 was obtained from the American Type Culture Collection (Manassas, VA). BMMs and RAW 264.7 were maintained in DMEM containing 10% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin, at 5% CO2 and 95% humidity, with drugs added at the times indicated.

MTS assay was performed using MTS reagent, according to the manufacturer’s instructions. Briefly, cells were seeded at a density of 1 × 104 cells/well in 96-well plates and allowed to grow overnight. Then, cells were treated as indicated. After 24-h incubation with LPS (Sigma-Aldrich, St. Louis, MO) and Atractylenolide I (AOI; Sigma-Aldrich), 20 μl MTS was added to each well and incubated for 2 h at 37°C, and then, the absorbance was measured at 490-nm wavelength using a microplate reader. Cell viability of the no treatment group was normalized to 100%.

RAW 264.7 cells and BMMs were seeded into 24-well plates (Corning Costar, Corning, NY) at 6 × 104 cells/well overnight and then changed to phenol red-free DMEM. Subsequently, cells were infected with LPS for the indicated amount of time after treating with or without inhibitors. As recommended by the manufacturer of Tran screener UDP2 FP Assay Kit (Bellbrook Labs), 15 μl supernatant was added into 384-well plate for the fluorescence polarization assay.

BMMs and RAW 264.7 cells were stimulated with different concentrations of LPS or inhibitors for 1 h, and total RNA was isolated by applying TRIzol reagent (Invitrogen), according to the manufacturer’s protocol. cDNA was synthesized with 500 ng RNA using a reverse transcription kit (Prime Script First Strand cDNA Synthesis kit (TAKARA, Dalian, China), according to the manufacturer’s instructions. One microliter of template from 10-fold diluted cDNA was subjected to quantification of cytokine expression using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA), and the data were analyzed by the ECO Real Time PCR System (Illumina, San Diego, CA). The sequence-specific primers are shown in Tables I and II.

Table I.
Sequence-specific primers for connexin family genes
Gene NamePrimers (5′-3′)Size (bp)
Connexin 26 CGGAAGTTCATGAAGGGAGAGAT (sense) 531 
ACGAGTCCTTTCAGGTTTTCTGG (antisense) 
Connexin 29 TCAAAATGGCTCTTTTGCCTC (sense) 154 
CTTGGAGCTTGCGCTTTTGGG (antisense) 
Connexin 30 GGCTTGGTTTTCAGAGATAG (sense) 369 
GAGTTGTGTTACCTGCTGC (antisense) 
Connexin 31 TGAAAGAAAGGAGATGGG (sense) 364 
GCTTTTAAGGAAACGGAC (antisense) 
Connexin 32 TCCATCAAACCTTCCCTC (sense) 391 
TTCTCTCTCCATAACTCCCTC (antisense) 
Connexin 33 AAACCATCTTCATCCTCTTC (sense) 386 
GCTTTTCTGTCTACCTAAAACC (antisense) 
Connexin 36 TACTGCCCAGTCTTTGTCTGCTGC (sense) 296 
CACACCATTATGATCTGGAAGACC (antisense) 
Connexin 40 TTTGGCAAGTCACGGCAGGG (sense) 311 
TTGTCACTGTGGTAGCCCTGAGG (antisense) 
Connexin 43 CCCCACTCTCACCTATGTCTCC (sense) 519 
ACTTTTGCCGCCTAGCTATCCC (antisense) 
Connexin 45 AAAGAGCAGAGCCAACCAAA (sense) 313 
GTCCCAAACCCTAAGTGAAGC (antisense) 
Connexin 46 GGAAAGGCCACAGGGTTTCCTGG (sense) 331 
GGGTCCAGGAGGACCAACGG (antisense) 
Connexin 47 TCCAAGTTCACCTGCAACACG (sense) 111 
GGAGATGACCACTATCTGGAAGACC (antisense) 
Connexin 50 GGAAGGAGGATGAGAAAG (sense) 462 
GAGAATGGAGGAGGAAAG (antisense) 
GAPDH GGGCATCTTGGGCTACACT (sense) 261 
GCCGAGTTGGGATAGGG (antisense) 
Gene NamePrimers (5′-3′)Size (bp)
Connexin 26 CGGAAGTTCATGAAGGGAGAGAT (sense) 531 
ACGAGTCCTTTCAGGTTTTCTGG (antisense) 
Connexin 29 TCAAAATGGCTCTTTTGCCTC (sense) 154 
CTTGGAGCTTGCGCTTTTGGG (antisense) 
Connexin 30 GGCTTGGTTTTCAGAGATAG (sense) 369 
GAGTTGTGTTACCTGCTGC (antisense) 
Connexin 31 TGAAAGAAAGGAGATGGG (sense) 364 
GCTTTTAAGGAAACGGAC (antisense) 
Connexin 32 TCCATCAAACCTTCCCTC (sense) 391 
TTCTCTCTCCATAACTCCCTC (antisense) 
Connexin 33 AAACCATCTTCATCCTCTTC (sense) 386 
GCTTTTCTGTCTACCTAAAACC (antisense) 
Connexin 36 TACTGCCCAGTCTTTGTCTGCTGC (sense) 296 
CACACCATTATGATCTGGAAGACC (antisense) 
Connexin 40 TTTGGCAAGTCACGGCAGGG (sense) 311 
TTGTCACTGTGGTAGCCCTGAGG (antisense) 
Connexin 43 CCCCACTCTCACCTATGTCTCC (sense) 519 
ACTTTTGCCGCCTAGCTATCCC (antisense) 
Connexin 45 AAAGAGCAGAGCCAACCAAA (sense) 313 
GTCCCAAACCCTAAGTGAAGC (antisense) 
Connexin 46 GGAAAGGCCACAGGGTTTCCTGG (sense) 331 
GGGTCCAGGAGGACCAACGG (antisense) 
Connexin 47 TCCAAGTTCACCTGCAACACG (sense) 111 
GGAGATGACCACTATCTGGAAGACC (antisense) 
Connexin 50 GGAAGGAGGATGAGAAAG (sense) 462 
GAGAATGGAGGAGGAAAG (antisense) 
GAPDH GGGCATCTTGGGCTACACT (sense) 261 
GCCGAGTTGGGATAGGG (antisense) 
Table II.
Sequence-specific primers for connexin 43/MCP-1
Primers (5′-3′)Size (bp)
Connexin 43 for Q-PCR CGGTTGTGAAAATGTCTGCTATG (sense) 87 
GGCACAGACACGAATATGATCTG (antisense) 
MCP-1 for Q-PCR CCTGCTGTTCACAGTTGC (sense) 181 
GCTTCAGATTTACGGGTC (antisense) 
GAPDH for Q-PCR ACAGTCCATGCCATCACTGCC (sense) 266 
GCCTGCTTCACCACCTTCTTG (antisense) 
Primers (5′-3′)Size (bp)
Connexin 43 for Q-PCR CGGTTGTGAAAATGTCTGCTATG (sense) 87 
GGCACAGACACGAATATGATCTG (antisense) 
MCP-1 for Q-PCR CCTGCTGTTCACAGTTGC (sense) 181 
GCTTCAGATTTACGGGTC (antisense) 
GAPDH for Q-PCR ACAGTCCATGCCATCACTGCC (sense) 266 
GCCTGCTTCACCACCTTCTTG (antisense) 

Q-PCR, quantitative PCR.

For ELISA assay, RAW 264.7 cells or peritoneal macrophages were seeded into 12-well plates at 1 × 105/well and incubated overnight. Cells were preincubated with or without 10 μM MRS2578 for 30 min and then stimulated with 100 μM UDP or LPS for 12 h, respectively. The concentration of MCP-1 in the supernatant was measured using the mouse MCP-1 ELISA Set, as recommended by the manufacturer (BioLegend).

RAW 264.7 were seeded in 6-well plates (Corning Costar) and stimulated with LPS at the times indicated and at different dose. The concentration of protein was measured by bicinchoninic acid assay (Pierce) and equalized to the same concentration with the extraction reagent. Samples were separated by 12% SDS-PAGE and transferred to polyvinylidene fluoride membranes (Bio-Rad, Hercules, CA). After incubation with phospho-ERK1/2, ERK1/2, phospho-AKT, AKT, β-actin, phospho-p65, and p65 Ab (Cell Signaling Technology, Danvers, MA), the polyvinylidene fluoride membranes were incubated with appropriate HRP-conjugated secondary Abs (Sigma-Aldrich). Finally, the ECL (Pierce, Rockford, IL) method was applied to detect those proteins.

Transfer of a single colony from an E. coli 0111:B4 plate into 2 ml Luria–Bertani (LB) liquid medium at 220 rpm and 37°C for 16 h and the bacteria was diluted 1:100 for another 2 h vigorous shaking to prepare the E. coli in log phase. Then, the E. coli was treated with 0, 100, 500, and 1000 μM UDP, respectively, for 12 h, and then, bacteria were cultured in solid LB medium to get the single clone for counting.

Six- to eight-week-old C57BL/6 female mice were chosen to induce bacteria-mediated peritonitis. Peritoneal bacteria and survival curves were detected to reflect the protective effect of UDP. To count peritoneal fluid E. coli, mice were divided randomly into six groups and pretreated with an i.p. injection of 300 μl PBS, 100 μM UDP (Sigma-Aldrich), 10 μM FFA (Sigma-Aldrich), 10 μM MRS2578 (Sigma-Aldrich), 10 μM U0126 (GeneOperation, Ann Arbor, MI), and 10 μM Gap26 (GL Biochem, Shanghai, China). Twelve hours later, each mouse was challenged with E. coli 0111:B4 through i.p. injection. After 12 h, E. coli were lavaged with 3 ml PBS from each mouse’s abdominal cavity and then diluted 10-fold in PBS, and 20 μl bacterial suspension was cultured in solid LB medium for 12 h. Single CFU were counted to determine peritoneal fluid E. coli. Another six groups were divided and treated as described above, but instead of counting peritoneal fluid E. coli, the mice were checked every 2 h to monitor the survival.

Data are presented as mean ± SEM (n = 3–6). Statistical significance was evaluated with the Student t test or one-way ANOVA, followed by Dunnett’s multiple comparison. A p value < 0.05 was considered significant. For survival curve analysis, the log-rank test was performed, and a p value < 0.05 was considered significant.

To elucidate the potential significance of eUDP in antibacterial immune responses, we measured the UDP release using the Transcreener UDP2 FP Assay kit in both E. coli–infected mice and LPS- or Pam3CSK4-treated macrophages. As shown in Fig. 1A, a persistent increase of eUDP was observed in the peritoneal cavity of mice challenged with E. coli 0111:B4 for 24 h. To exclude the potential influence of LPS on cell viability, RAW 264.7 cells were treated with gradient concentration of LPS. Little influence on cell viability was observed in LPS-treated cells (Fig. 1B), whereas eUDP was obviously induced by LPS in a dose (Fig. 1C)- and time (Fig. 1D)-dependent manner in RAW 264.7 cells. This kind of UDP release could also be observed in LPS-treated BMMs in a time-dependent manner (Fig. 1E). Similar data can also be seen in Pam3CSK4-treated cells (Fig. 1F). Furthermore, LPS-induced UDP release could be rescued obviously by AOI (a selective inhibitor to TLR4) (24), suggesting the important role of TLR signaling in UDP release (Fig. 1G).

FIGURE 1.

Characterization of UDP release during bacterial infection. (A) E. coli 0111:B4 (1 × 108 CFU/ml) or PBS was injected into the mouse abdominal cavity. Then, eUDP was detected using Transcreener UDP2 FP Assay kit at different time points, and UDP was calculated according to a standard curve. (B) RAW 264.7 cells were stimulated with LPS for 24 h at different concentrations, and then, cell viability was appraised by the MTS assay. (C and D) RAW 264.7 cells were treated with LPS at different concentrations for 12 h (C) or with 100 ng/ml LPS for the indicated times (D), and then, cell supernatants were collected to detect the release of eUDP. (E) BMMs were stimulated with 100 ng/ml LPS at the times indicated, and then, cultured cell supernatants were collected and subjected to eUDP assay. (F) RAW 264.7 cells were treated with 100 ng/ml LPS or PAM3CSK4 for 12 h to detect the release of eUDP. (G) RAW 264.7 cells were treated with 100 ng/ml LPS or 100 μM AOI for 6 h to detect the release of eUDP. Data are presented as mean ± SEM (n = 3, *p < 0.05, **p < 0.01, ***p < 0.001).

FIGURE 1.

Characterization of UDP release during bacterial infection. (A) E. coli 0111:B4 (1 × 108 CFU/ml) or PBS was injected into the mouse abdominal cavity. Then, eUDP was detected using Transcreener UDP2 FP Assay kit at different time points, and UDP was calculated according to a standard curve. (B) RAW 264.7 cells were stimulated with LPS for 24 h at different concentrations, and then, cell viability was appraised by the MTS assay. (C and D) RAW 264.7 cells were treated with LPS at different concentrations for 12 h (C) or with 100 ng/ml LPS for the indicated times (D), and then, cell supernatants were collected to detect the release of eUDP. (E) BMMs were stimulated with 100 ng/ml LPS at the times indicated, and then, cultured cell supernatants were collected and subjected to eUDP assay. (F) RAW 264.7 cells were treated with 100 ng/ml LPS or PAM3CSK4 for 12 h to detect the release of eUDP. (G) RAW 264.7 cells were treated with 100 ng/ml LPS or 100 μM AOI for 6 h to detect the release of eUDP. Data are presented as mean ± SEM (n = 3, *p < 0.05, **p < 0.01, ***p < 0.001).

Close modal

Generally, the specific channel inhibitors such as N-ethylmaleimide (NEM, a specific inhibitor to exocytosis), carbenoxolone (CBX, a nonspecific pannexin channel inhibitor), and flufenamic acid (FFA, a specific connexin channel inhibitor) are powerful tools for investigating the mechanism of DAMPs’ release. In contrast to LPS-induced ATP release (25), LPS-induced UDP release was significantly inhibited by both CBX and FFA but not NEM, suggesting the key role of gap junctions in this process. Furthermore, FFA reduced UDP release much more than CBX, implying that LPS-induced UDP release mainly occurs through connexin channels (Fig. 2A).

FIGURE 2.

Bacterial infection induces UDP release through connexin-mediated gap junctions and protects mice from bacterial infection. (A) RAW 264.7 cells were pretreated with or without 1 μM CBX, 5 μM NEM, and 10 μM FFA for 1 h before being stimulated with LPS as the indicated time. UDP release was measured by Transcreener UDP2 FP Assay kit. (B and C) WT (B) and P2Y6 knockout (C) mice received an i.p. injection of PBS (300 μl), UDP (100 μM), MRS2578 (10 μM), and FFA (10 μM) as indicated before infection with 1 × 108 CFU E. coli 0111:B4 (n = 3). Twelve hours after i.p. injection of E. coli, peritoneal fluid was lavaged with 3 ml PBS and then diluted 10-fold in PBS, and 20 μl of the bacterial suspension was cultured on solid LB medium for 12 h to count CFU. (D) Appropriated concentration of E. coli was treated with UDP as shown, and then, bacteria were cultured in solid LB medium for 12 h. (E) Mice were received an i.p. injection of PBS (300 μl), UDP (100 μM), MRS2578 (10 μM), and FFA (10 μM) as indicated (n = 10). (F) WT (n = 8) and P2Y6 knockout (n = 7) mice were received an i.p. injection of PBS (300 μl) and UDP (100 μM) as indicated. Twelve hours later, 1 × 108 CFU E. coli 0111:B4 were injected into the mouse abdominal cavity. Then, mouse survival was checked every 2 h for the next 48 h. Data are presented as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).

FIGURE 2.

Bacterial infection induces UDP release through connexin-mediated gap junctions and protects mice from bacterial infection. (A) RAW 264.7 cells were pretreated with or without 1 μM CBX, 5 μM NEM, and 10 μM FFA for 1 h before being stimulated with LPS as the indicated time. UDP release was measured by Transcreener UDP2 FP Assay kit. (B and C) WT (B) and P2Y6 knockout (C) mice received an i.p. injection of PBS (300 μl), UDP (100 μM), MRS2578 (10 μM), and FFA (10 μM) as indicated before infection with 1 × 108 CFU E. coli 0111:B4 (n = 3). Twelve hours after i.p. injection of E. coli, peritoneal fluid was lavaged with 3 ml PBS and then diluted 10-fold in PBS, and 20 μl of the bacterial suspension was cultured on solid LB medium for 12 h to count CFU. (D) Appropriated concentration of E. coli was treated with UDP as shown, and then, bacteria were cultured in solid LB medium for 12 h. (E) Mice were received an i.p. injection of PBS (300 μl), UDP (100 μM), MRS2578 (10 μM), and FFA (10 μM) as indicated (n = 10). (F) WT (n = 8) and P2Y6 knockout (n = 7) mice were received an i.p. injection of PBS (300 μl) and UDP (100 μM) as indicated. Twelve hours later, 1 × 108 CFU E. coli 0111:B4 were injected into the mouse abdominal cavity. Then, mouse survival was checked every 2 h for the next 48 h. Data are presented as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).

Close modal

A series of studies has shown the protective role of UDP in bacterial infection. Therefore, to further confirm the potential role of UDP release in host defense against invading bacteria, we set up a mouse peritonitis model by i.p. injection of E. coli 0111:B4 to monitor the clearance of bacteria and mouse survival. As shown in Fig. 2B, the total quantity of bacteria in the peritoneal cavity was reduced in UDP-injected mice, and this kind of protection could be rescued by the P2Y6-specific inhibitor MRS2578. In addition, if we treated the mice with FFA to block UDP release, the invading bacteria were also increased. Furthermore, the total quantity of bacteria in the peritoneal cavity was increased in P2Y6−/− mice and UDP-induced clearance to bacteria also reduced obviously in P2Y6−/− mice (Fig. 2C). Although the proliferation of E. coli 0111 was little changed by high concentration of UDP (Fig. 2D), similar data were also observed in the mouse survival assay; the survival of infected mice could be increased from 30 to 60% if the mice were treated with UDP. In contrast, if we treated the mice with FFA to block UDP release and MRS2578 to inhibit P2Y6 signaling, the mice were all dead within 31 and 38 h, respectively (Fig. 2E). To further confirm the key role of P2Y6 in antibacterial immune responses, we infected the wild-type (WT) and P2Y6−/− mice with E. coli 0111:B4 to monitor the mouse survival. As shown in Fig. 2F, the survival of P2Y6−/− mice was decreased obviously, and UDP-mediated protection also eliminated in P2Y6−/− mice (Fig. 2F). These data further confirmed the protective role of endogenous UDP release and P2Y6 in bacterial infection.

As mentioned before, GJCs are composed of different connexins proteins. Therefore, we checked the expression level of connexin family members in RAW 264.7 cells (Tables I, II). As shown in Fig. 3A, connexin 43 was most abundant in RAW 264.7 cells. Interestingly, the expression of connexin 43 was also obviously increased by LPS in RAW 264.7 (Fig. 3B) and BMMs (Fig. 3C). Furthermore, the expression of connexin 43 could also be increased by LPS in a dose (Fig. 3D)- and time-dependent (Fig. 3E) manner. Similarly, protein levels of connexin 43 were increased significantly by LPS at 12 h (Fig. 3F). These data suggested the potential role of connexin 43 in LPS-mediated immune responses.

FIGURE 3.

LPS-mediated UDP release through connexin 43. (A) RNA from RAW 264.7 cells was isolated to quantify expression of the connexin family using RT-PCR assay. (B and C) RNA from RAW 264.7 cells and BMMs was isolated to quantify the expression of connexin 43 using RT-PCR assay. (D and E) RNA from dose-dependent (12 h) or time-dependent (100 ng/ml) RAW 264.7 cells was isolated to quantify the expression of connexin 43 using quantitative RT-PCR. (F) RAW 264.7 cells were treated with 100 ng/ml LPS at the indicated times. Connexin 43 was detected by Western blot analysis. Data are presented as mean ± SEM (n = 3, *p < 0.05, **p < 0.01, ***p < 0.001).

FIGURE 3.

LPS-mediated UDP release through connexin 43. (A) RNA from RAW 264.7 cells was isolated to quantify expression of the connexin family using RT-PCR assay. (B and C) RNA from RAW 264.7 cells and BMMs was isolated to quantify the expression of connexin 43 using RT-PCR assay. (D and E) RNA from dose-dependent (12 h) or time-dependent (100 ng/ml) RAW 264.7 cells was isolated to quantify the expression of connexin 43 using quantitative RT-PCR. (F) RAW 264.7 cells were treated with 100 ng/ml LPS at the indicated times. Connexin 43 was detected by Western blot analysis. Data are presented as mean ± SEM (n = 3, *p < 0.05, **p < 0.01, ***p < 0.001).

Close modal

To explore the mechanism of LPS-induced connexin 43 expression, we assessed the LPS-induced signaling by Western blotting assay. As shown in Fig. 4A and 4B, the phosphorylation of P65, AKT, and ERK was increased by LPS in a dose- and time-dependent manner. Then, we pretreated the cells with U0126 (inhibitor to MEK1/2), Bay 11-7082 (inhibitor to NF-κB), and Ly294002 (inhibitor to PI3K/Akt) to appraise the influence of those signaling pathways on LPS-induced expression of connexin 43. As shown in Fig. 4C, the LPS-induced RNA expression of connexin 43 was clearly reduced by U0126, which is a specific inhibitor to ERK signaling. In contrast, little change was seen in Bay 11-7082– and Ly294002-treated cells. Furthermore, the expression of connexin 43 at the protein level could also be reduced by U0126, suggesting the key role of ERK signaling in LPS-induced connexin 43 expression (Fig. 4D). In addition, UDP release was also measured in U0126- and Gap26-treated cells. (Fig. 4E) Consistent with the inhibition of connexin 43 expression, UDP release was clearly reduced by the ERK inhibitor U0126 and Gap26 (connexin 43 blocker peptide).

FIGURE 4.

LPS upregulates connexin 43 expression through ERK signaling. (A and B) RAW 264.7 cells were treated with different concentrations of LPS for 30 min and with 100 ng/ml LPS at the indicated times. Proteins involved in LPS-associated signaling and β-actin were detected by Western blot analysis. (C) RAW 264.7 cells were pretreated with 1 μM Bay11, 10 μM U0126, or 1 μM Ly294002 for 1 h and then exposed to 100 ng/ml LPS for 12 h. RNA from RAW 264.7 cells was isolated to quantify the signal protein expression by quantitative RT-PCR. Results are normalized to the expression of β-actin. (D) RAW 264.7 cells were pretreated with or without 10 μM U0126 for 1 h. RAW 264.7 cells were treated with 100 ng/ml LPS at 12 h. Connexin 43 was detected by Western blot analysis. (E) RAW 264.7 cells were pretreated with 10 μM U0126 or Gap26 for 1 h before stimulated by LPS. After 12 h, UDP release was measured by Transcreener UDP2 FP Assay kit. Data are presented as mean ± SEM (n = 3, *p < 0.05, **p < 0.01, ***p < 0.001).

FIGURE 4.

LPS upregulates connexin 43 expression through ERK signaling. (A and B) RAW 264.7 cells were treated with different concentrations of LPS for 30 min and with 100 ng/ml LPS at the indicated times. Proteins involved in LPS-associated signaling and β-actin were detected by Western blot analysis. (C) RAW 264.7 cells were pretreated with 1 μM Bay11, 10 μM U0126, or 1 μM Ly294002 for 1 h and then exposed to 100 ng/ml LPS for 12 h. RNA from RAW 264.7 cells was isolated to quantify the signal protein expression by quantitative RT-PCR. Results are normalized to the expression of β-actin. (D) RAW 264.7 cells were pretreated with or without 10 μM U0126 for 1 h. RAW 264.7 cells were treated with 100 ng/ml LPS at 12 h. Connexin 43 was detected by Western blot analysis. (E) RAW 264.7 cells were pretreated with 10 μM U0126 or Gap26 for 1 h before stimulated by LPS. After 12 h, UDP release was measured by Transcreener UDP2 FP Assay kit. Data are presented as mean ± SEM (n = 3, *p < 0.05, **p < 0.01, ***p < 0.001).

Close modal

As the initial step in antibacterial immune responses, chemokine-mediated immune cell recruitment is important. As shown in Fig. 5A, the expression of MCP-1 is dramatically increased by UDP in RAW 264.7 cells. Interestingly, UDP- and LPS-induced MCP-1 expression could also be blocked by the P2Y6-specific antagonist MRS2578, implying that UDP/P2Y6 signaling is involved in LPS-induced immune responses. Accordingly, the protein level of MCP-1 in LPS-untreated or -treated cells was both increased obviously by UDP, and this kind of activation could be blocked by P2Y6-specific inhibitor MRS2578 (Fig. 5B), and similar data also confirmed in P2Y6−/− peritoneal macrophages (Fig. 5C). Also, we pretreated cells with the plasma membrane channel inhibitors FFA, CBX, and NEM to explore the key role of nucleotide release in LPS-induced MCP-1 production. The LPS-induced MCP-1 production was blocked by FFA, which can also prevent LPS-induced UDP release. In contrast, the LPS-induced MCP-1 production was poorly influenced by CBX and NEM, which are involved in pannexin channels and exocytosis (Fig. 5D). To further confirm the role of UDP/P2Y6 signaling in LPS-induced MCP-1 production, we treated WT and P2Y6−/− peritoneal macrophages with LPS for 12 and 24 h. Similar to the data in RAW 264.7 cells, the RNA (Fig. 5E) and protein (Fig. 5F) level of MCP-1 was increased by LPS in both WT and P2Y6−/− peritoneal macrophages, whereas both the basal level and the LPS-induced expression of MCP-1 were much lower in P2Y6−/− peritoneal macrophages. Thus, these data further confirmed the key role of P2Y6 in LPS-induced immune responses.

FIGURE 5.

Released eUDP induces the expression of MCP-1. (A) RAW 264.7 cells were treated with 100 ng/ml LPS, 300 μM UDP, and 10 μM MRS2578 for 1 h. RNA from RAW 264.7 cells was isolated to quantify MCP-1 expression by quantitative RT-PCR. (B) RAW 264.7 cells were treated with 100 ng/ml LPS, 300 μM UDP, and 10 μM MRS2578 for 24 h. Then, the cell supernatants were collected to detect MCP-1 by ELISA. (C) WT and P2Y6 knockout peritoneal macrophages were pretreated with different concentration of UDP for 24 h. Then, the cell supernatants were collected to detect MCP-1 by ELISA. (D) RAW 264.7 cells were pretreated with or without FFA, NEM, and CBX for 1 h before LPS. RNA from RAW 264.7 cells was isolated to quantify MCP-1 expression by quantitative RT-PCR. (E) Peritoneal macrophages from WT and P2Y6−/− mice were treated with 100 ng/ml LPS for 12 h. RNA was isolated to quantify MCP-1 expression by quantitative RT-PCR. (F) Peritoneal macrophages from WT and P2Y6−/− mice were treated with 100 ng/ml LPS for 24 h. Then, the cell supernatants were collected to detect MCP-1 by ELISA. Data are presented as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).

FIGURE 5.

Released eUDP induces the expression of MCP-1. (A) RAW 264.7 cells were treated with 100 ng/ml LPS, 300 μM UDP, and 10 μM MRS2578 for 1 h. RNA from RAW 264.7 cells was isolated to quantify MCP-1 expression by quantitative RT-PCR. (B) RAW 264.7 cells were treated with 100 ng/ml LPS, 300 μM UDP, and 10 μM MRS2578 for 24 h. Then, the cell supernatants were collected to detect MCP-1 by ELISA. (C) WT and P2Y6 knockout peritoneal macrophages were pretreated with different concentration of UDP for 24 h. Then, the cell supernatants were collected to detect MCP-1 by ELISA. (D) RAW 264.7 cells were pretreated with or without FFA, NEM, and CBX for 1 h before LPS. RNA from RAW 264.7 cells was isolated to quantify MCP-1 expression by quantitative RT-PCR. (E) Peritoneal macrophages from WT and P2Y6−/− mice were treated with 100 ng/ml LPS for 12 h. RNA was isolated to quantify MCP-1 expression by quantitative RT-PCR. (F) Peritoneal macrophages from WT and P2Y6−/− mice were treated with 100 ng/ml LPS for 24 h. Then, the cell supernatants were collected to detect MCP-1 by ELISA. Data are presented as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).

Close modal

To investigate the role of connexin 43–mediated UDP release in antibacterial immunity, we pretreated the acute peritonitis mouse model with ERK inhibitors and the connexin 43 blocking peptide. As shown in Fig. 6A, the residual bacteria in the abdominal cavity were significantly increased by pretreating the mice with U0126 and Gap26. Consequently, the survival of infected mice was also decreased dramatically by U0126 and Gap26 (Fig. 6B). Thus, our results suggest a critical role of connexin 43–mediated UDP release in the regulation of immune response and pathogen clearance in bacterial infection (Fig. 6C).

FIGURE 6.

Function and mechanism of released eUDP during the bacterial infection. (A) Mice received an i.p. injection of PBS (300 μl), U0126 (10 μM), and Gap26 (10 μM) before infection with E. coli 0111:B4 (1× 108 CFU). After i.p. injection of E. coli for 12 h, peritoneal fluid was lavaged with 3 ml PBS and then diluted 10-fold in PBS, and 20 μl of the bacterial suspension was cultured in solid LB medium for 12 h. Data are presented as mean ± SEM (n = 3, *p < 0.05, **p < 0.01). (B) Mice received an i.p. injection of 300 μl PBS (same with Fig. 2E), 100 μM UDP (same with Fig. 2E), 10 μM U0126 (n = 9), and 10 μM Gap26 (n = 10) before infection with E. coli 0111:B4, respectively, for 12 h, and then, 1 × 108 CFU E. coli 0111:B4 were injected into the mouse abdominal cavity. Then, the mice were checked every 2 h for the next 48 h (p < 0.05 by log-rank test). (C) Model showing the function and mechanism of released UDP during bacterial infection.

FIGURE 6.

Function and mechanism of released eUDP during the bacterial infection. (A) Mice received an i.p. injection of PBS (300 μl), U0126 (10 μM), and Gap26 (10 μM) before infection with E. coli 0111:B4 (1× 108 CFU). After i.p. injection of E. coli for 12 h, peritoneal fluid was lavaged with 3 ml PBS and then diluted 10-fold in PBS, and 20 μl of the bacterial suspension was cultured in solid LB medium for 12 h. Data are presented as mean ± SEM (n = 3, *p < 0.05, **p < 0.01). (B) Mice received an i.p. injection of 300 μl PBS (same with Fig. 2E), 100 μM UDP (same with Fig. 2E), 10 μM U0126 (n = 9), and 10 μM Gap26 (n = 10) before infection with E. coli 0111:B4, respectively, for 12 h, and then, 1 × 108 CFU E. coli 0111:B4 were injected into the mouse abdominal cavity. Then, the mice were checked every 2 h for the next 48 h (p < 0.05 by log-rank test). (C) Model showing the function and mechanism of released UDP during bacterial infection.

Close modal

As the first defense against invaded pathogen, innate immune cells recognize PAMPs through pattern recognition receptors to initiate systemic immune responses. Therefore, communication between immune cells is a crucial part in this process. In this paper, we demonstrated a novel, to our knowledge, communication strategy between immune cells that relies on the formation of connexin-based gap junctions and eUDP release. First, we showed a persistent accumulation of eUDP in both the abdominal cavity of infected mice and LPS- or Pam3CSK4-treated cell supernatant. Consistent with our previous data, released UDP can protect mice from bacterial infection through increasing MCP-1 production. Accordingly, if we blocked endogenous UDP release by FFA or U0126, the survival of infected mice reduced obviously, suggesting the crucial role of UDP release in antibacterial immune responses.

Extracellular nucleotides were first termed a find-me signal from dying cells to enhance phagocyte recruitment. Then, more and more papers have published damage-induced nucleotide release and its predominant role in different pathological and physiological processes (2629). In contrast to pathogen-induced inflammation, sterile inflammation was activated by the detection of endogenous signals. Among them, extracellular ATP has been well recognized as an endogenous signaling molecule in immunity and inflammation (30). Actually, extracellular nucleotides are tightly controlled by both cell membrane channels and ectonucleotidases, which are also involved in balancing immune responses. Thus, extracellular nucleotide signaling and metabolism is a dynamic area of research with important opportunities for novel treatments for inflammatory or infectious diseases (31).

As the initiation of inflammation during infection, endogenous nucleotides can be released through multiple channels to regulate immune responses at different times. For example, ATP can be released via exocytosis 30 min after challenged by bacterial infection, both in vivo and in vitro (25, 32). We also found that UDP could be highly released through pannexin channel in 24 h after virus infection. Therefore, it implied that the release of endogenous nucleotides is also accurately regulated by distinct infection. Interestingly, we observed a long-term and persistent release of UDP after bacterial infection, whereas the mechanism seems different from viral infection. The LPS-induced UDP release can be dramatically blocked by the connexin channel inhibitor FFA, but only slight UDP release was reduced by the pannexin channel inhibitor CBX, which was found to almost totally block virus induced UDP release (Fig. 2A). It has been well accepted that pannexin channels can be activated by caspases during apoptosis; however, the reason why connexin channels were activated in LPS-treated cells still needs to be further explored.

As the most important pattern recognition receptors in the innate immune system, TLRs sense the invasion of microbes by recognizing their PAMPs and activate intracellular signaling pathways leading to the expression of genes responsible for inflammatory and immune responses (33). About 10 human and 12 mouse TLRs were identified, each of which has distinct recognition patterns. Interestingly, although the recognition patterns of each TLR are different, the downstream signaling of each TLR is similar. TLR ligands induce formation of homodimers or heterodimers of TLRs to recruit MyD88 and dissociate IL-1R–associated kinase. Then, IL-1R–associated kinase interacts with TNFR-associated factor 6 and recruits TAK1 to phosphorylate IKKβ and MAPK (34). As shown in Fig. 1F, both LPS and Pam3CSK4 can induce UDP release, implying that the connexin-mediated UDP release through a classical and common TLR signaling pathway. Therefore, we pretreated the cells with U0126, Bay11, and Ly294002 to explore the key role of ERK, NF-κB, and AKT signaling in TLR-induced UDP release. As shown in Fig. 4C and 4D, the expression of connexin 43 was reduced obviously by U0126 both in mRNA and protein level, whereas LPS-induced connexin 43 was little changed by Bay11 and Ly294002. Consequently, LPS-induced UDP release, also inhibited by U0126 and connexin 43 blocking peptide Gap26, suggested the fundamental role of ERK activated connexin 43 in UDP release. More interestingly, like most other P2Y receptors, P2Y6 is coupled with Gq to activate PLCβ and MAPKs (35). Also, protein kinase C and Erk1/2 has been found to play an important role in P2Y6-mediated antiapoptotic functions (36). That is to say, LPS increased ERK signaling could induce UDP release and then eUDP bound to P2Y6 further enhanced ERK activation, which constitutes a positive feedback loop in the initiation of innate immune responses. These findings provide solid evidence that eUDP could serve as a positive regulator in macrophage mediated innate immunity.

To further elucidate the important role of eUDP and P2Y6 in TLR mediated innate immune responses, we treated RAW 264.7 cells with UDP and the P2Y6 inhibitor MRS2578. As shown in Fig. 5, both UDP and LPS can increase MCP-1 expression obviously. However, LPS-induced MCP-1 production could be restrained by MRS2578 or P2Y6 deficiency obviously, suggested UDP/P2Y6 signaling also being involved in LPS mediated immune responses. Furthermore, the blocking of connexin 43–mediated UDP release by FFA can also decrease LPS-induced MCP-1 production. Accordingly, the clearance of invaded bacteria and mice survival in the acute peritonitis mouse model was depressed by U0126 and Gap26, which further confirmed the pivotal role of connexin 43–mediated GJC in the fight against bacterial infection. Taken together, our study reveals the internal relationship between danger signals and TLR signaling in innate immune responses, which suggest a potential therapeutic significance of the GJC and UDP/P2Y6-associated signaling pathway in the prevention and control of bacterial diseases.

This work was supported by National Basic Research Program of China Grant 2012CB910404; National Natural Science Foundation of China Grants 81272369, 81172816, and 31570896; Ministry of Education of China Doctoral Fund 20130076110013; Fundamental Research Funds for the Central Universities; and Science and Technology Commission of Shanghai Municipality Grant 15JC1401500.

Abbreviations used in this article:

     
  • AOI

    atractylenolide I

  •  
  • BMM

    bone marrow–derived macrophage

  •  
  • CBX

    carbenoxolone

  •  
  • DAMP

    damage-associated molecular pattern

  •  
  • eUDP

    extracellular UDP

  •  
  • FFA

    flufenamic acid

  •  
  • GJC

    gap junction channel

  •  
  • LB

    Luria–Bertani

  •  
  • PAMP

    pathogen-associated molecular pattern

  •  
  • WT

    wild-type.

1
Feldman
N.
,
Rotter-Maskowitz
A.
,
Okun
E.
.
2015
.
DAMPs as mediators of sterile inflammation in aging-related pathologies.
Ageing Res. Rev.
24
(
Pt A
):
29
39
.
2
Ibrahim
Z. A.
,
Armour
C. L.
,
Phipps
S.
,
Sukkar
M. B.
.
2013
.
RAGE and TLRs: relatives, friends or neighbours?
Mol. Immunol.
56
:
739
744
.
3
Graziano
F.
,
Desdouits
M.
,
Garzetti
L.
,
Podini
P.
,
Alfano
M.
,
Rubartelli
A.
,
Furlan
R.
,
Benaroch
P.
,
Poli
G.
.
2015
.
Extracellular ATP induces the rapid release of HIV-1 from virus containing compartments of human macrophages.
Proc. Natl. Acad. Sci. USA
112
:
E3265
E3273
.
4
Proietti
M.
,
Cornacchione
V.
,
Rezzonico Jost
T.
,
Romagnani
A.
,
Faliti
C. E.
,
Perruzza
L.
,
Rigoni
R.
,
Radaelli
E.
,
Caprioli
F.
,
Preziuso
S.
, et al
.
2014
.
ATP-gated ionotropic P2X7 receptor controls follicular T helper cell numbers in Peyer’s patches to promote host-microbiota mutualism.
Immunity
41
:
789
801
.
5
Amaral
E. P.
,
Ribeiro
S. C.
,
Lanes
V. R.
,
Almeida
F. M.
,
de Andrade
M. R.
,
Bomfim
C. C.
,
Salles
E. M.
,
Bortoluci
K. R.
,
Coutinho-Silva
R.
,
Hirata
M. H.
, et al
.
2014
.
Pulmonary infection with hypervirulent Mycobacteria reveals a crucial role for the P2X7 receptor in aggressive forms of tuberculosis.
PLoS Pathog.
10
:
e1004188
.
6
Koizumi
S.
,
Shigemoto-Mogami
Y.
,
Nasu-Tada
K.
,
Shinozaki
Y.
,
Ohsawa
K.
,
Tsuda
M.
,
Joshi
B. V.
,
Jacobson
K. A.
,
Kohsaka
S.
,
Inoue
K.
.
2007
.
UDP acting at P2Y6 receptors is a mediator of microglial phagocytosis.
Nature
446
:
1091
1095
.
7
Ben Yebdri
F.
,
Kukulski
F.
,
Tremblay
A.
,
Sévigny
J.
.
2009
.
Concomitant activation of P2Y(2) and P2Y(6) receptors on monocytes is required for TLR1/2-induced neutrophil migration by regulating IL-8 secretion.
Eur. J. Immunol.
39
:
2885
2894
.
8
Kim
B.
,
Jeong
H. K.
,
Kim
J. H.
,
Lee
S. Y.
,
Jou
I.
,
Joe
E. H.
.
2011
.
Uridine 5′-diphosphate induces chemokine expression in microglia and astrocytes through activation of the P2Y6 receptor.
J. Immunol.
186
:
3701
3709
.
9
Zhang
Z.
,
Wang
Z.
,
Ren
H.
,
Yue
M.
,
Huang
K.
,
Gu
H.
,
Liu
M.
,
Du
B.
,
Qian
M.
.
2011
.
P2Y(6) agonist uridine 5′-diphosphate promotes host defense against bacterial infection via monocyte chemoattractant protein-1‑mediated monocytes/macrophages recruitment.
J. Immunol.
186
:
5376
5387
.
10
Garcia
R. A.
,
Yan
M.
,
Search
D.
,
Zhang
R.
,
Carson
N. L.
,
Ryan
C. S.
,
Smith-Monroy
C.
,
Zheng
J.
,
Chen
J.
,
Kong
Y.
, et al
.
2014
.
P2Y6 receptor potentiates pro-inflammatory responses in macrophages and exhibits differential roles in atherosclerotic lesion development.
PLoS One
9
:
e111385
.
11
Elliott
M. R.
,
Chekeni
F. B.
,
Trampont
P. C.
,
Lazarowski
E. R.
,
Kadl
A.
,
Walk
S. F.
,
Park
D.
,
Woodson
R. I.
,
Ostankovich
M.
,
Sharma
P.
, et al
.
2009
.
Nucleotides released by apoptotic cells act as a find-me signal to promote phagocytic clearance.
Nature
461
:
282
286
.
12
Chekeni
F. B.
,
Elliott
M. R.
,
Sandilos
J. K.
,
Walk
S. F.
,
Kinchen
J. M.
,
Lazarowski
E. R.
,
Armstrong
A. J.
,
Penuela
S.
,
Laird
D. W.
,
Salvesen
G. S.
, et al
.
2010
.
Pannexin 1 channels mediate “find-me” signal release and membrane permeability during apoptosis.
Nature
467
:
863
867
.
13
Orellana
J. A.
,
Sáez
P. J.
,
Shoji
K. F.
,
Schalper
K. A.
,
Palacios-Prado
N.
,
Velarde
V.
,
Giaume
C.
,
Bennett
M. V.
,
Sáez
J. C.
.
2009
.
Modulation of brain hemichannels and gap junction channels by pro-inflammatory agents and their possible role in neurodegeneration.
Antioxid. Redox Signal.
11
:
369
399
.
14
Neijssen
J.
,
Pang
B.
,
Neefjes
J.
.
2007
.
Gap junction-mediated intercellular communication in the immune system.
Prog. Biophys. Mol. Biol.
94
:
207
218
.
15
Sáez
P. J.
,
Shoji
K. F.
,
Retamal
M. A.
,
Harcha
P. A.
,
Ramírez
G.
,
Jiang
J. X.
,
von Bernhardi
R.
,
Sáez
J. C.
.
2013
.
ATP is required and advances cytokine-induced gap junction formation in microglia in vitro.
Mediators Inflamm.
2013
:
216402
.
16
Shibata
Y.
,
Yamamoto
T.
.
1977
.
Gap junctions in the cardiac muscle cells of the lamprey.
Cell Tissue Res.
178
:
477
482
.
17
Reaume
A. G.
,
de Sousa
P. A.
,
Kulkarni
S.
,
Langille
B. L.
,
Zhu
D.
,
Davies
T. C.
,
Juneja
S. C.
,
Kidder
G. M.
,
Rossant
J.
.
1995
.
Cardiac malformation in neonatal mice lacking connexin43.
Science
267
:
1831
1834
.
18
Nicholson
B. J.
.
2003
.
Gap junctions—from cell to molecule.
J. Cell Sci.
116
:
4479
4481
.
19
Eugenín
E. A.
,
Brañes
M. C.
,
Berman
J. W.
,
Sáez
J. C.
.
2003
.
TNF-α plus IFN-γ induce connexin43 expression and formation of gap junctions between human monocytes/macrophages that enhance physiological responses.
J. Immunol.
170
:
1320
1328
.
20
Krenacs
T.
,
van Dartel
M.
,
Lindhout
E.
,
Rosendaal
M.
.
1997
.
Direct cell/cell communication in the lymphoid germinal center: connexin43 gap junctions functionally couple follicular dendritic cells to each other and to B lymphocytes.
Eur. J. Immunol.
27
:
1489
1497
.
21
Westphalen
K.
,
Gusarova
G. A.
,
Islam
M. N.
,
Subramanian
M.
,
Cohen
T. S.
,
Prince
A. S.
,
Bhattacharya
J.
.
2014
.
Sessile alveolar macrophages communicate with alveolar epithelium to modulate immunity.
Nature
506
:
503
506
.
22
Li
R.
,
Tan
B.
,
Yan
Y.
,
Ma
X.
,
Zhang
N.
,
Zhang
Z.
,
Liu
M.
,
Qian
M.
,
Du
B.
.
2014
.
Extracellular UDP and P2Y6 function as a danger signal to protect mice from vesicular stomatitis virus infection through an increase in IFN-β production.
J. Immunol.
193
:
4515
4526
.
23
Alatery
A.
,
Basta
S.
.
2008
.
An efficient culture method for generating large quantities of mature mouse splenic macrophages.
J. Immunol. Methods
338
:
47
57
.
24
Ji
G.
,
Chen
R.
,
Zheng
J.
.
2014
.
Atractylenolide I inhibits lipopolysaccharide-induced inflammatory responses via mitogen-activated protein kinase pathways in RAW264.7 cells.
Immunopharmacol. Immunotoxicol.
36
:
420
425
.
25
Ren
H.
,
Teng
Y.
,
Tan
B.
,
Zhang
X.
,
Jiang
W.
,
Liu
M.
,
Jiang
W.
,
Du
B.
,
Qian
M.
.
2014
.
Toll-like receptor-triggered calcium mobilization protects mice against bacterial infection through extracellular ATP release.
Infect. Immun.
82
:
5076
5085
.
26
Gulbransen
B. D.
,
Bashashati
M.
,
Hirota
S. A.
,
Gui
X.
,
Roberts
J. A.
,
MacDonald
J. A.
,
Muruve
D. A.
,
McKay
D. M.
,
Beck
P. L.
,
Mawe
G. M.
, et al
.
2012
.
Activation of neuronal P2X7 receptor-pannexin-1 mediates death of enteric neurons during colitis.
Nat. Med.
18
:
600
604
.
27
Kim
J. E.
,
Kang
T. C.
.
2011
.
The P2X7 receptor-pannexin-1 complex decreases muscarinic acetylcholine receptor-mediated seizure susceptibility in mice.
J. Clin. Invest.
121
:
2037
2047
.
28
Woehrle
T.
,
Yip
L.
,
Elkhal
A.
,
Sumi
Y.
,
Chen
Y.
,
Yao
Y.
,
Insel
P. A.
,
Junger
W. G.
.
2010
.
Pannexin-1 hemichannel‑mediated ATP release together with P2X1 and P2X4 receptors regulate T-cell activation at the immune synapse.
Blood
116
:
3475
3484
.
29
Schenk
U.
,
Westendorf
A. M.
,
Radaelli
E.
,
Casati
A.
,
Ferro
M.
,
Fumagalli
M.
,
Verderio
C.
,
Buer
J.
,
Scanziani
E.
,
Grassi
F.
.
2008
.
Purinergic control of T cell activation by ATP released through pannexin-1 hemichannels.
Sci. Signal.
1
:
ra6
.
30
Bours
M. J.
,
Swennen
E. L.
,
Di Virgilio
F.
,
Cronstein
B. N.
,
Dagnelie
P. C.
.
2006
.
Adenosine 5′-triphosphate and adenosine as endogenous signaling molecules in immunity and inflammation.
Pharmacol. Ther.
112
:
358
404
.
31
Idzko
M.
,
Ferrari
D.
,
Eltzschig
H. K.
.
2014
.
Nucleotide signalling during inflammation.
Nature
509
:
310
317
.
32
Sakaki
H.
,
Tsukimoto
M.
,
Harada
H.
,
Moriyama
Y.
,
Kojima
S.
.
2013
.
Autocrine regulation of macrophage activation via exocytosis of ATP and activation of P2Y11 receptor.
PLoS One
8
:
e59778
.
33
Akira
S.
,
Uematsu
S.
,
Takeuchi
O.
.
2006
.
Pathogen recognition and innate immunity.
Cell
124
:
783
801
.
34
Kawagoe
T.
,
Sato
S.
,
Matsushita
K.
,
Kato
H.
,
Matsui
K.
,
Kumagai
Y.
,
Saitoh
T.
,
Kawai
T.
,
Takeuchi
O.
,
Akira
S.
.
2008
.
Sequential control of Toll-like receptor-dependent responses by IRAK1 and IRAK2.
Nat. Immunol.
9
:
684
691
.
35
Malmsjö
M.
,
Adner
M.
,
Harden
T. K.
,
Pendergast
W.
,
Edvinsson
L.
,
Erlinge
D.
.
2000
.
The stable pyrimidines UDPβS and UTPγS discriminate between the P2 receptors that mediate vascular contraction and relaxation of the rat mesenteric artery.
Br. J. Pharmacol.
131
:
51
56
.
36
Kim
S. G.
,
Gao
Z.-G.
,
Soltysiak
K. A.
,
Chang
T.-S.
,
Brodie
C.
,
Jacobson
K. A.
.
2003
.
P2Y6 nucleotide receptor activates PKC to protect 1321N1 astrocytoma cells against tumor necrosis factor‑induced apoptosis.
Cell. Mol. Neurobiol.
23
:
401
418
.

The authors have no financial conflicts of interest.