Eosinophilic esophagitis (EoE) is a Th2 cytokine–associated disease characterized by eosinophil infiltration, epithelial cell hyperplasia, and tissue remodeling. Recent studies highlighted a major contribution for IL-13 in EoE pathogenesis. Paired Ig-like receptor B is a cell surface immune-inhibitory receptor that is expressed by eosinophils and postulated to regulate eosinophil development and migration. We report that Pirb is upregulated in the esophagus after inducible overexpression of IL-13 (CC10-Il13Tg mice) and is overexpressed by esophageal eosinophils. CC10-Il13Tg/Pirb−/− mice displayed increased esophageal eosinophilia and EoE pathology, including epithelial cell thickening, fibrosis, and angiogenesis, compared with CC10-Il13Tg/Pirb+/+ mice. Transcriptome analysis of primary Pirb+/+ and Pirb−/− esophageal eosinophils revealed increased expression of transcripts associated with promoting tissue remodeling in Pirb−/− eosinophils, including profibrotic genes, genes promoting epithelial-to-mesenchymal transition, and genes associated with epithelial growth. These data identify paired Ig-like receptor B as a molecular checkpoint in IL-13–induced eosinophil accumulation and activation, which may serve as a novel target for future therapy in EoE.

Eosinophilic esophagitis (EoE) is an emerging inflammatory disease that is characterized by dominant eosinophilic inflammation, epithelial hyperplasia, collagen deposition, and tissue fibrosis (1, 2).

Patients with EoE have increased esophageal expression of IL-13, and ex vivo treatment of esophageal epithelial cells with IL-13 leads to dramatic gene expression alterations that are strikingly similar to those found in biopsies from patients with EoE (3). IL-13 is directly responsible for the induction of eosinophil-specific chemokines, such as those belonging to the eotaxin family. Chronic induction of IL-13 in the lungs using a doxycycline (DOX)-induced, CC10 promoter–regulated, IL-13–transgenic mouse model (CC10-Il13Tg) leads to experimental EoE with typical esophageal pathology including eosinophil accumulation, fibrosis, epithelial cell hyperplasia, and angiogenesis (4, 5). Indeed, an anti–IL-13 therapeutic in patients with EoE markedly reverses the disease-specific transcriptome, including markers of tissue remodeling and chemokine expression, proving the centrality of the IL-13–induced response in EoE (6).

Although eosinophils likely promote EoE, pathways that limit eosinophil accumulation and/or activation in EoE are poorly defined. In fact, inhibitory checkpoints, particularly in the settings of IL-13–driven inflammation, have not been described. Accordingly, we aimed to define molecular pathways that regulate the activities of esophageal eosinophils, with specific emphasis on inhibitory, Ig-like receptors, which provide counterregulatory signals for various eosinophil activities (7). Paired Ig-like receptor (PIR)-B is a member of the Ig superfamily and is expressed primarily in a pairwise fashion with PIR-A on the surface of myeloid cells, including eosinophils (8, 9). PIR-B contains four ITIMs, which are capable of binding intracellular phosphatases, such as SHP-1 and/or SHP-2, and subsequently suppress cellular activation elicited by PIR-A, cytokines, chemokines, TLRs, and adhesion molecules (1015). We demonstrated previously that PIR-B is a negative regulator of eotaxin-induced eosinophil chemotaxis and recruitment, as well as that the PIR-A/PIR-B axis plays a critical role in eosinophil development (13, 15). Although these data suggest key functions for PIR-B in eosinophil-associated pathologies, the role of PIR-B in EoE has not been defined. In this study, we demonstrate a key inhibitory function for PIR-B in EoE pathogenesis; overexpression of IL-13 in Pirb−/− mice leads to exaggerated EoE, including eosinophilic infiltration, epithelial cell thickening, fibrosis, and angiogenesis. Our results demonstrate that eosinophil activities in EoE are intrinsically suppressed by PIR-B and that loss of PIR-B by eosinophils mediates increased experimental EoE pathogenesis.

We generated bitransgenic mice (CC10-Il13Tg) in which Il13 was expressed in a lung-specific manner that allowed for external regulation of the transgene expression, as previously described (5). This model was specifically chosen because we showed previously that overexpression of IL-13 in the lungs induces esophageal disease resembling EoE (4). Male and female 6- to 8-wk-old Pirb−/− mice of generations > F9 were backcrossed to C57BL/6 mice (9). CC10-Il13Tg/Pirb−/− and CC10-Il13/Pirb+/+ mice were generated by breeding CC10-Il13Tg mice with Pirb−/− mice. For all experiments, littermates were used as controls. We induced Il13 transgene expression by feeding the CC10-Il13Tg mice DOX-impregnated food (625 mg/kg; Purina Mills, Richmond, IN) for 2 wk. Animals were housed under specific pathogen–free conditions in accordance with institutional guidelines.

RNA samples from the whole esophagus were subjected to reverse-transcription analysis using SuperScript II reverse transcriptase (Invitrogen), according to the manufacturer’s instructions. Quantitative PCR (qPCR) analysis was performed using the CFX96 system (Bio-Rad) in conjunction with the ready-to-use FastStart SYBR Green I Master reaction kit (Roche Diagnostic Systems). Results were normalized to Hprt cDNA, as previously described (16). The following primers were used in this study (5′–3′): Ccl11 (encodes eotaxin-1), forward CACGGTCACTTCCTTCACG and reverse GGGGATCTTCTTACTGGTA; Acta2 (encodes α-SMA), forward AGTCGCTGTCAGGAACCCTGAGAC and reverse CGAAGCCGGCCTTACAGAGCC; and Hprt, forward GTAATGATCAGTCAACGGGGGAC and reverse CCAGCAAGCTTGCAACCTTAACCA.

Flow cytometric analysis of bone marrow, peripheral blood cells, or enzymatically digested esophagus was conducted using the following Abs: anti-CD11b (R&D Systems, Minneapolis, MN), anti–GR-1 (BD Bioscience), anti–Siglec-F (BD Bioscience), anti-CCR3 (BD Bioscience), anti–PIR-A/B (eBioscience), IgG2b (eBioscience), anti-CD45 (eBioscience), and anti-CD11c (BD Bioscience). Cell counts were conducted using 123count eBeads (eBioscience), according to the manufacturer’s instructions. In all experiments, ≥50,000 events were acquired using a FACSCalibur (BD Bioscience), and data were analyzed using Kaluza (Beckman Coulter) or FlowJo (TreeStar) software.

Total bone marrow cells were stained with anti-CD45 (eBioscience), anti–Siglec-F, and anti-CCR3 (both from BD Bioscience). Mature eosinophils (triple positive) were sorted using a MoFlo XDP (Beckman Coulter). The cells were activated with bronchoalveolar lavage fluid (BALF), which was obtained from the lungs of CC10-Il13Tg/Pirb+/+ mice, for the indicated times (0, 5, and 10 min), and cells were fixed in 4% paraformaldehyde/PBS and permeabilized using saponin-based permeabilization buffer (X1; Invitrogen). Cells were stained with phospho-ERK1/2 (Cell Signaling). Events were acquired using a FACSCanto (BD Bioscience), and data were analyzed using Kaluza (Beckman Coulter) or FlowJo (TreeStar) software. For phosphoflow analysis, the mean fluorescence intensity (MFI) for each time point, in each biological repeat, was normalized to baseline and expressed as the fold change over baseline.

IL-13 and CCL11 levels were assessed using commercial ELISA kits (DuoSet; R&D Systems), according to the manufacturer’s instructions. The lower detection limits for IL-13 and CCL11 were 62.5 and 15.6 pg/ml, respectively.

Esophageal or lung eosinophils were detected using an immunohistochemical stain against murine eosinophilic major basic protein (MBP), as previously described (4). Quantification of positive cells was performed using Cell^A imaging software, and results were reported as immunoreactive cells/mm2.

Epithelial thickness was determined for cross-sectioned esophageal samples using MBP stain. Quantification of thickness was performed using Cell^A imaging software by taking 7–14 lengthwise measurements/slide from the lumen to the basement membrane of each esophagus. Collagen deposition was determined by staining esophageal samples with Masson’s trichrome and quantified using Cell^A software. Collagen measurements were recorded as area of collagen staining/length of basement membrane, as previously described (4).

Tissues were fixed, embedded, sectioned, prepared, and stained as previously described (4). Morphometry was used to determine the average number of CD31+ vessels/high-power field in each group.

Mouse Affymetrix (Santa Clara, CA) microarrays (2.0 ST GeneChip) were performed and analyzed using established protocols of the Cincinnati Children’s Hospital Medical Center Gene Expression Core and according to the manufacturer’s instructions. Data were analyzed using GeneSpring software, with a fold-change cutoff of 2 and unpaired Student t test (p > 0.05). Heat plots and Venn diagrams were created according to gene lists that were generated using GeneSpring software (Agilent, Santa Clara, CA).

CC10-Il13Tg/Pirb−/− and CC10-Il13/Pirb+/+ mice were fed with DOX for 2 wk. They were injected i.p. with 20 μg soluble anti-mouse Siglec-F on days −1, 1, 4, 7, and 10; Rat IgG2a was used as an isotype-matched control Ab (R&D Systems) (17). At day 14, the mice were sacrificed, and the esophagus was analyzed for eosinophil levels using anti-MBP staining. Epithelial thickness, collagen deposition, and Acta2 transcript levels were determined, as described above.

Data were analyzed by the Student t test or by ANOVA followed by the Tukey post hoc test using GraphPad Prism 5. Data are shown as mean ± SEM, and p values < 0.05 were considered statistically significant.

Pirb expression was increased in the esophagus following Il13 transgene induction (Fig. 1A). To define the cellular source accounting for increased Pirb expression, polychromatic flow cytometric staining was conducted using single-cell suspensions of esophageal tissue. After overexpression of IL-13, eosinophils constituted the largest PIR-A/B+ cellular source in the esophagus, reaching nearly 40% of the entire CD45+ cellular population, whereas neutrophil and CD11C+/GR1 cell populations were ∼7 and ∼4%, respectively. Importantly, the second major CD45+ population (>15%), the lymphocyte population, did not express PIR-A/B (Fig. 1B, 1C, Supplemental Fig. 1). Furthermore, among the CD45+ cell population, eosinophils expressed relatively high surface levels of PIR-A/B (Fig. 1C). Notably, PIR-A/B expression in the esophagus was confined to the hematopoietic compartment because CD45 cells did not express PIR-A/B (Fig. 1D). Interestingly, the expression of PIR-A/B on esophageal eosinophils was higher than that found on peripheral blood eosinophils (Fig. 1E). Thus, increased expression of PIR-B in the esophagus after IL-13 induction is attributable to infiltration of inflammatory cells, especially eosinophils.

FIGURE 1.

Expression of PIR-B in IL-13–induced experimental EoE. (A) The expression of Pirb was assessed by microarray analysis in the esophagus of CC10-Il13Tg mice after 2 wk of DOX or no DOX feeding. (B) Flow cytometric analysis of the main cellular populations infiltrating the esophagus after IL-13 overexpression. (C) Analysis of PIR-A/B surface expression in various cell types after DOX treatment. ΔMFI for PIR-A/B expression was calculated by subtracting the MFI obtained for anti–PIR-A/B staining from that obtained for the isotype control. (D) Representative plot of PIR-B expression by esophageal CD45 cells. (E) Analysis of surface PIR-A/B expression in peripheral blood eosinophils and esophageal eosinophils. Data in (A)–(C) and (E) are mean + SEM. Data are from three to five mice for each group. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 1.

Expression of PIR-B in IL-13–induced experimental EoE. (A) The expression of Pirb was assessed by microarray analysis in the esophagus of CC10-Il13Tg mice after 2 wk of DOX or no DOX feeding. (B) Flow cytometric analysis of the main cellular populations infiltrating the esophagus after IL-13 overexpression. (C) Analysis of PIR-A/B surface expression in various cell types after DOX treatment. ΔMFI for PIR-A/B expression was calculated by subtracting the MFI obtained for anti–PIR-A/B staining from that obtained for the isotype control. (D) Representative plot of PIR-B expression by esophageal CD45 cells. (E) Analysis of surface PIR-A/B expression in peripheral blood eosinophils and esophageal eosinophils. Data in (A)–(C) and (E) are mean + SEM. Data are from three to five mice for each group. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

To define the role of PIR-B in IL-13–induced esophageal pathology, Pirb−/− mice were mated with CC10-Il13Tg mice to generate CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice. Thereafter, the mice were fed with DOX for 2 wk, and eosinophil infiltration into the esophagus was determined. CC10-Il13Tg/Pirb+/+ mice displayed increased eosinophil accumulation in the esophagus, as assessed by antieosinophil MBP staining (Fig. 2A, 2B) and flow cytometric analysis of CD45+/CD11b+/Siglec-F+/SSChi cells (Fig. 2C). DOX-treated CC10-Il13Tg/Pirb−/− mice displayed a nearly 2-fold increase in the levels of esophageal eosinophilia in comparison with DOX-treated CC10-Il13Tg/Pirb+/+mice (Fig. 2D). This increase is impressive considering the already marked increased eosinophilia in the esophagus and lungs of CC10-Il13Tg mice (3). Moreover, the Pirb−/− eosinophil population was ∼60% of the entire CD45+ cell population. Other examined CD45+ cell populations did not increase, which demonstrates that the inhibitory regulatory role of PIR-B in the accumulation of CD45+ cells is specific to eosinophils (Fig. 2E, Supplemental Fig. 2). Increased eosinophil infiltration was not confined to the esophagus, because analysis of anti-MBP–stained lung specimens and differential cell counts from BALF reveled increased lung eosinophilia in DOX-treated CC10-Il13Tg/Pirb−/− mice in comparison with CC10-Il13Tg/Pirb+/+ mice (Supplemental Fig. 3). Furthermore, increased eosinophil infiltration into the esophagus and lungs of DOX-treated CC10-Il13Tg/Pirb−/− mice was not due to alterations in IL-13 or eosinophil chemoattractant expression, because BALF and esophageal levels of IL-13 and CCL11 were similar in DOX-treated CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice (Fig. 2F–H).

FIGURE 2.

Eosinophil levels in the esophagus of CC10-Il13Tg/Pirb−/− mice. CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice were treated or not with DOX for 2 wk. Thereafter, the mice were sacrificed, and the esophageal tissue was used for histology (A and B) or flow cytometric analysis (C). Representative photomicrograph [(A), original magnification ×400] and quantitation (B) of antieosinophil MBP immunohistochemical stain. Representative gating strategy (C) and quantification (D) of esophageal eosinophils from mice treated or not with DOX, as determined by flow cytometry. (E) Flow cytometric analysis of the main cellular populations infiltrating the esophagus after IL-13 overexpression. Lung and esophageal IL-13 (F) and CCL11 (H) protein expression levels, as well as expression of esophageal Ccl11 transcripts [(G), fold over housekeeping gene]. Data are from two or three independent experiments in which n = 2 for each of the groups not treated with DOX and n = 4 for each of the DOX-treated groups. Data in (B) and (D)–(H) are mean + SEM. **p < 0.01.

FIGURE 2.

Eosinophil levels in the esophagus of CC10-Il13Tg/Pirb−/− mice. CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice were treated or not with DOX for 2 wk. Thereafter, the mice were sacrificed, and the esophageal tissue was used for histology (A and B) or flow cytometric analysis (C). Representative photomicrograph [(A), original magnification ×400] and quantitation (B) of antieosinophil MBP immunohistochemical stain. Representative gating strategy (C) and quantification (D) of esophageal eosinophils from mice treated or not with DOX, as determined by flow cytometry. (E) Flow cytometric analysis of the main cellular populations infiltrating the esophagus after IL-13 overexpression. Lung and esophageal IL-13 (F) and CCL11 (H) protein expression levels, as well as expression of esophageal Ccl11 transcripts [(G), fold over housekeeping gene]. Data are from two or three independent experiments in which n = 2 for each of the groups not treated with DOX and n = 4 for each of the DOX-treated groups. Data in (B) and (D)–(H) are mean + SEM. **p < 0.01.

Close modal

The elevated levels of eosinophils in the esophagus of DOX-treated CC10-Il13Tg/Pirb−/− mice suggested a possible role for PIR-B in regulating IL-13–induced esophageal pathology. Masson’s trichrome staining revealed increased areas of esophageal collagen deposition in DOX-treated CC10-Il13Tg/Pirb−/− mice (Fig. 3A, 3B). Furthermore, qPCR analysis of Acta2 expression, a prototype marker of myofibroblasts, revealed substantially increased Acta2 expression in DOX-treated CC10-Il13Tg/Pirb−/− mice (Fig. 3C). Moreover, the epithelial cell layer was significantly increased in DOX-treated CC10-Il13Tg/Pirb−/− mice (Fig. 3D). Assessment of IL-13–induced blood vessel formation using anti-CD31 staining revealed greater vessel size (Fig. 3E) and quantity (Fig. 3F) in DOX-treated CC10-Il13Tg/Pirb−/− mice than DOX-treated CC10-Il13Tg/Pirb+/+ mice.

FIGURE 3.

Esophageal tissue remodeling in CC10-Il13Tg/Pirb−/− mice. CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice were treated or not with DOX for 2 wk. Thereafter, the mice were sacrificed, and the esophageal tissues were obtained. Representative photomicrographs of Masson’s trichrome staining [(A), original magnification ×400] and morphometric and quantitative analysis of collagen deposition (B). (C) α-Smooth muscle actin gene expression (Acta2) in the esophagus was determined by qPCR analysis and normalized to the housekeeping gene Hprt. (D) Quantitative analysis of epithelial cell thickness. Morphometric (E) and quantitative (F) analysis of anti-CD31 staining per high power field (HPF). Original magnification ×100. Data were obtained from three independent experiments, with ≥4 mice for each group. Data in (B)–(D) and (F) are mean + SEM. *p < 0.05.

FIGURE 3.

Esophageal tissue remodeling in CC10-Il13Tg/Pirb−/− mice. CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice were treated or not with DOX for 2 wk. Thereafter, the mice were sacrificed, and the esophageal tissues were obtained. Representative photomicrographs of Masson’s trichrome staining [(A), original magnification ×400] and morphometric and quantitative analysis of collagen deposition (B). (C) α-Smooth muscle actin gene expression (Acta2) in the esophagus was determined by qPCR analysis and normalized to the housekeeping gene Hprt. (D) Quantitative analysis of epithelial cell thickness. Morphometric (E) and quantitative (F) analysis of anti-CD31 staining per high power field (HPF). Original magnification ×100. Data were obtained from three independent experiments, with ≥4 mice for each group. Data in (B)–(D) and (F) are mean + SEM. *p < 0.05.

Close modal

We hypothesized that PIR-B inhibits IL-13–mediated eosinophil-dependent increased tissue remodeling, as seen in CC10-Il13Tg/Pirb−/− mice. To test this hypothesis, we injected anti-Siglec-F–specific Abs, which are known to induce eosinophil apoptosis (17, 18), and monitored esophageal pathology. Anti–Siglec-F treatment resulted in complete depletion of esophageal eosinophils in DOX-treated CC10-Il13Tg/Pirb+/+ and CC10-Il13Tg/Pirb−/− mice (Supplemental Fig. 4). If the worsened pathology in CC10-Il13Tg/Pirb−/− mice was dependent on the expression of PIR-B in eosinophils, depletion of eosinophils in DOX-treated CC10-Il13Tg/Pirb−/− mice should result in a similar severity of pathology as in CC10-Il13Tg/Pirb+/+ mice. Indeed, assessment of esophageal pathology in eosinophil-depleted, DOX-treated CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice revealed that, in the absence of eosinophils, CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice displayed similar pathology in terms of collagen deposition and angiogenesis (as revealed by Masson’s trichrome staining and anti-CD31 staining) (Fig. 4A–D). Notably, eosinophil depletion did not prevent the increased epithelial thickness and increased Acta2 expression in DOX-treated CC10-Il13Tg/Pirb−/− mice, indicating that PIR-B may regulate the activities of additional noneosinophil cells that are responsible for these aspects of tissue remodeling (Fig. 4E).

FIGURE 4.

Eosinophil-dependent esophageal tissue remodeling in CC10-Il13Tg/Pirb−/− mice. CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice were treated with DOX for 2 wk. Anti–Siglec F (or suitable isotype control) was injected into the peritoneal cavity on days −1, 0, 1, 4, 7, and 10. The mice were sacrificed on day 14, and esophageal tissues were obtained. Representative photomicrographs of Masson’s trichrome stain (A) and anti-CD31 stain (C) (original magnification ×400). Quantitative analysis of collagen deposition (B) and the number of blood vessels in the esophagus per high power field (HPF) (D). (E) Expression of α-smooth muscle actin (Acta2) in the esophagus was determined by qPCR analysis and normalized to the housekeeping gene Hprt. Data are from five or six mice for each group. Data in (B), (D), and (E) are mean + SEM. *p < 0.05.

FIGURE 4.

Eosinophil-dependent esophageal tissue remodeling in CC10-Il13Tg/Pirb−/− mice. CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice were treated with DOX for 2 wk. Anti–Siglec F (or suitable isotype control) was injected into the peritoneal cavity on days −1, 0, 1, 4, 7, and 10. The mice were sacrificed on day 14, and esophageal tissues were obtained. Representative photomicrographs of Masson’s trichrome stain (A) and anti-CD31 stain (C) (original magnification ×400). Quantitative analysis of collagen deposition (B) and the number of blood vessels in the esophagus per high power field (HPF) (D). (E) Expression of α-smooth muscle actin (Acta2) in the esophagus was determined by qPCR analysis and normalized to the housekeeping gene Hprt. Data are from five or six mice for each group. Data in (B), (D), and (E) are mean + SEM. *p < 0.05.

Close modal

We hypothesized that PIR-B may serve as an intrinsic inhibitor of eosinophil activation in the esophagus. To assess this possibility, we examined the activation (i.e., phosphorylation) status of ERK in eosinophils (as a surrogate marker for eosinophil activation) in response to the inflammatory milieu, which is elicited by IL-13. To this end, naive primary eosinophils were sorted from the bone marrow of CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice. Thereafter, the cells were activated with BALF obtained from the lungs of DOX-treated CC10-Il13Tg/Pirb+/+ mice. Eosinophils activated with BALF from CC10-Il13Tg/Pirb+/+ mice had readily detectable phosphorylation of ERK (∼1.25-fold increase over baseline). In contrast, activation of Pirb−/− eosinophils resulted in substantially greater ERK phosphorylation (∼1.9-fold increase over baseline, Fig. 5) than did activation of Pirb+/+ eosinophils. These data demonstrate that PIR-B is an intrinsic negative regulator of eosinophil activation in response to the IL-13–induced microenvironment.

FIGURE 5.

The role of PIR-B in eosinophil activation in response to the esophageal microenvironment. Primary naive mature (i.e., CD45+/CCR3+/Siglec-F+/SSChi) bone marrow eosinophils were sorted from CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice and activated with BALF from DOX-treated CC10-Il13Tg/Pirb+/+ mice for the indicated time. Phosphorylation of ERK1/2 was determined by phosphoflow analysis. (A) Kinetics. (B) Graphic representation of data. Data are from four mice for each group. *p < 0.05.

FIGURE 5.

The role of PIR-B in eosinophil activation in response to the esophageal microenvironment. Primary naive mature (i.e., CD45+/CCR3+/Siglec-F+/SSChi) bone marrow eosinophils were sorted from CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice and activated with BALF from DOX-treated CC10-Il13Tg/Pirb+/+ mice for the indicated time. Phosphorylation of ERK1/2 was determined by phosphoflow analysis. (A) Kinetics. (B) Graphic representation of data. Data are from four mice for each group. *p < 0.05.

Close modal

Next, we aimed to define the transcriptome signature of Pirb+/+ and Pirb−/− esophageal eosinophils. To this end, microarray analysis was performed on primary eosinophils that were sorted from the bone marrow and esophagus of DOX-treated CC10-Il13Tg/Pirb+/+ and CC10-Il13Tg/Pirb−/− mice (the complete data set can be found at http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE81135).

To determine whether local overexpression of IL-13 exerts any systemic effects on bone marrow eosinophils, bone marrow eosinophils were obtained and subjected to microarray analysis. Elevated expression of IL-13 resulted in modest effects on Pirb+/+ bone marrow eosinophils; it induced alteration of 76 genes (55 upregulated genes and 21 downregulated genes; Fig. 6A, gene lists 1 and 2 online). In contrast, IL-13 induced marked alterations in Pirb+/+ esophageal eosinophils (Fig. 6A); there was an ∼8-fold increase in the total amount of upregulated genes in esophageal eosinophils (433 genes) compared with bone marrow eosinophils (Fig. 6A, gene lists 3 and 4 online). These genes included multiple cell surface receptors: cytokine and chemokine receptors (e.g., Ccrl2, Il1r2, Ccr1, and Csf2rb2), Ig-like receptors (e.g., Lilrb3/Pirb, Lilra6/Pira, Cd300lf, Cd300ld, Cd300lb, and Gp49a), and cell adhesion and migration molecules (e.g., Cd44, Itga2, and Itga4). In addition, various enzymatic pathways (e.g., Ptgs2, Ear11, Adam8, and Mmp25) and secreted factors, such as cytokines (e.g., Il1a, Il1b, and Il4), chemokines (e.g., Cxcl2, Ccl3, Ccl2, Ccl4, and Csf1), and profibrogenic molecules (e.g., Rentla, Retnlg, Postn, and Tnfaip3), were upregulated. Moreover, IL-13 altered the expression of numerous intracellular signaling molecules (e.g., MAPK pathway [Mapk6, Mapkapk2, and Mapk1ip1], JunB, Nfkb pathway [Nfkbiz, Nfkbia, and Nfkbie], and transcription factors [Cebpb]). Finally, IL-13 induced a pronounced effect on the expression of Pirb+/+eosinophil microRNAs (e.g., Mir21, Mir1931, and Mir146b), cell cycle–related molecules (e.g., G0S2, cyclinG2, Gadd45a, S100a10, and S100a4), and survival molecules (e.g., Bcl2l11 and Fas) (Table I). Collectively, these data suggest a profound impact of IL-13 on esophageal eosinophils in the presence of PIR-B.

FIGURE 6.

Gene expression profile in esophageal eosinophils after IL-13–induced experimental EoE. CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice were treated or not with DOX for 2 wk. Thereafter, the mice were sacrificed, and eosinophils were sorted from the esophagus and bone marrow and subjected to microarray analysis. (A) Heat plot analysis comparing Pirb+/+ bone marrow (BM) eosinophils from mice treated or not with DOX (left panel). Heat plot analysis of DOX-treated BM and esophageal (Eso) Pirb+/+ eosinophils (A, right panel) and Pirb−/− eosinophils (B). (C) Venn diagram of the upregulated genes in DOX-treated esophageal Pirb+/+ and Pirb−/− eosinophils. (D) Representative genes that were upregulated in esophageal eosinophils compared with bone marrow eosinophils from CC10-Il13Tg/Pirb+/+and CC10-Il13Tg/Pirb−/− mice. (E) Representative genes that were exclusively upregulated in esophageal eosinophils compared with bone marrow eosinophils from CC10-Il13Tg/Pirb−/− mice. Data are from three mice from each group with inclusion criteria of p > 0.05 and fold change > 2.

FIGURE 6.

Gene expression profile in esophageal eosinophils after IL-13–induced experimental EoE. CC10-Il13Tg/Pirb−/− and CC10-Il13Tg/Pirb+/+ mice were treated or not with DOX for 2 wk. Thereafter, the mice were sacrificed, and eosinophils were sorted from the esophagus and bone marrow and subjected to microarray analysis. (A) Heat plot analysis comparing Pirb+/+ bone marrow (BM) eosinophils from mice treated or not with DOX (left panel). Heat plot analysis of DOX-treated BM and esophageal (Eso) Pirb+/+ eosinophils (A, right panel) and Pirb−/− eosinophils (B). (C) Venn diagram of the upregulated genes in DOX-treated esophageal Pirb+/+ and Pirb−/− eosinophils. (D) Representative genes that were upregulated in esophageal eosinophils compared with bone marrow eosinophils from CC10-Il13Tg/Pirb+/+and CC10-Il13Tg/Pirb−/− mice. (E) Representative genes that were exclusively upregulated in esophageal eosinophils compared with bone marrow eosinophils from CC10-Il13Tg/Pirb−/− mice. Data are from three mice from each group with inclusion criteria of p > 0.05 and fold change > 2.

Close modal
Table I.
Genes of interest that were upregulated in eosinophils in the esophagus compared with the bone marrow of CC10-Il13Tg/Pirb+/+ mice
Gene SymbolFold Change (Esophagus/Bone Marrow)
Surface molecules Ccrl2 29.3 
 Gp49a 16.1 
 Il1r2 6.97 
 Cd300ld 6.36 
 Ccr1 3.38 
 Cd300lf 3.22 
 Cd300lb 2.96 
 Lilrb3 2.90 
 Lilra6| 2.79 
 Csf2rb2 2.78 
Cell adhesion and migration molecules Itga2 3.07 
 Itga4 2.75 
 Cd44 2.61 
Enzymes Ptgs2 74.8 
 Ear11 50.7 
 Adam8 6.42 
 Mmp25 2.54 
Secreted factors Il1a 34.9 
 Il1b 21.0 
 Cxcl2 20.8 
 Tnfaip3 15.6 
 Ccl3 11.8 
 Ccl2 5.76 
 Retnlg 5.43 
 Il4 5.40 
 Retnla 3.87 
 Postn 3.60 
 Csf1 2.59 
 Ccl4 2.08 
Intracellular signal molecules Nfkbiz 7.63 
 Nfkbia 3.47 
 Nfkbie 2.44 
 Mapkapk2 2.30 
 Junb 2.30 
 Cebpb 2.27 
 Mapk6 2.24 
 Mapk1ip1 2.06 
MicroRNA Mir1931 16.8 
 Mir146b 3.64 
 Mir21 2.75 
Cell cycle molecules G0s2 7.09 
 Ccng2 4.75 
 S100a4 3.72 
 Gadd45a 3.50 
 S100a10 2.61 
Survival molecule Bcl2l11 6.59 
 Fas 5.83 
Gene SymbolFold Change (Esophagus/Bone Marrow)
Surface molecules Ccrl2 29.3 
 Gp49a 16.1 
 Il1r2 6.97 
 Cd300ld 6.36 
 Ccr1 3.38 
 Cd300lf 3.22 
 Cd300lb 2.96 
 Lilrb3 2.90 
 Lilra6| 2.79 
 Csf2rb2 2.78 
Cell adhesion and migration molecules Itga2 3.07 
 Itga4 2.75 
 Cd44 2.61 
Enzymes Ptgs2 74.8 
 Ear11 50.7 
 Adam8 6.42 
 Mmp25 2.54 
Secreted factors Il1a 34.9 
 Il1b 21.0 
 Cxcl2 20.8 
 Tnfaip3 15.6 
 Ccl3 11.8 
 Ccl2 5.76 
 Retnlg 5.43 
 Il4 5.40 
 Retnla 3.87 
 Postn 3.60 
 Csf1 2.59 
 Ccl4 2.08 
Intracellular signal molecules Nfkbiz 7.63 
 Nfkbia 3.47 
 Nfkbie 2.44 
 Mapkapk2 2.30 
 Junb 2.30 
 Cebpb 2.27 
 Mapk6 2.24 
 Mapk1ip1 2.06 
MicroRNA Mir1931 16.8 
 Mir146b 3.64 
 Mir21 2.75 
Cell cycle molecules G0s2 7.09 
 Ccng2 4.75 
 S100a4 3.72 
 Gadd45a 3.50 
 S100a10 2.61 
Survival molecule Bcl2l11 6.59 
 Fas 5.83 

IL-13 had a dramatic effect on primary esophageal Pirb+/+ eosinophils. Nonetheless, primary esophageal eosinophils that were sorted from CC10-Il13Tg/Pirb−/− mice displayed a substantial hyperactivated phenotype in comparison with primary esophageal eosinophils that were sorted from CC10-Il13Tg/Pirb+/+ mice (Fig. 6B versus Fig. 6A, right panels). For example, Pirb−/− esophageal eosinophils showed induction of nearly 2-fold more genes than did Pirb+/+ esophageal eosinophils (854 and 433 genes, respectively) (Fig. 6A, 6B, gene lists 5 and 6). Importantly, altered gene expression in Pirb−/− esophageal eosinophils was not due to systemic effects of IL-13, because Pirb−/− bone marrow eosinophils from CC10-Il13Tg/Pirb−/− mice showed minimal gene alterations after induction of IL-13 (lists 7 and 8 online), and these alterations were similar to those observed in Pirb+/+ cells.

Analysis of the 854 genes that were induced in Pirb−/− eosinophils revealed that the majority of these genes was also induced in wild-type eosinophils (354 of 433 genes, making up 82% of the IL-13–activated esophageal eosinophil transcriptome) (Fig. 6C, gene list 9 online). Importantly, among these 354 common genes, 30 were upregulated >2-fold in Pirb−/− esophageal eosinophils, including various surface molecules (e.g., Ccr1 and Lilra6), enzymes (e.g., Adamdec1 and Pla2g7), secreted factors (e.g., Retnla, Cxcl3, and Csf1), and intracellular signal molecules (e.g., Btg2 and Irg1) (Fig. 6D, Table II, gene list 10 online).

Table II.
Genes of interest that were upregulated in eosinophils of the esophagus compared with the bone marrow of CC10-Il13Tg/Pirb+/+ and CC10-Il13Tg/Pirb−/− mice
Gene SymbolPirb+/+Pirb−/−Fold Change (Pirb−/−/Pirb+/+)
Adamdec1 3.15 16.0 5.08 
Btg2 5.44 22.0 4.03 
Cxcl3 8.84 30.9 3.49 
Retnla 3.87 13.3 3.43 
Irg1 13.2 41.9 3.17 
Csf1 2.59 7.53 2.91 
Pla2g7 4.20 9.90 2.36 
Ccr1 3.38 7.92 2.34 
Lilra6 2.79 6.46 2.31 
Gene SymbolPirb+/+Pirb−/−Fold Change (Pirb−/−/Pirb+/+)
Adamdec1 3.15 16.0 5.08 
Btg2 5.44 22.0 4.03 
Cxcl3 8.84 30.9 3.49 
Retnla 3.87 13.3 3.43 
Irg1 13.2 41.9 3.17 
Csf1 2.59 7.53 2.91 
Pla2g7 4.20 9.90 2.36 
Ccr1 3.38 7.92 2.34 
Lilra6 2.79 6.46 2.31 

Further analysis revealed that Pirb−/− esophageal eosinophils displayed a distinct genetic signature involving an exclusive upregulation of 500 additional genes (gene list 11 online). These genes included cell surface molecules, such as cytokine receptors (e.g., Il5ra, Il12rb2, Ifnar1, and Bmpr2), inhibitory receptors (e.g., Cd300a), and cell adhesion and migration molecules (e.g., Itgax, Itgb3, Itgal, Ezr, acta1, Vasp, and Cd24) (Fig. 6E). In addition, gene expression of various enzymatic pathways (e.g., Mmp9, Capn2, and Adam19), secreted factors (e.g., Il6, Tnf, Cxcl10, Tgfbi, Areg, and Ccl8), and receptors (e.g., Notch1 and Notch2) that have been linked with tissue fibrosis was increased in Pirb−/− eosinophils (Fig. 6E). Moreover, gene expression of intracellular signaling molecules, including key molecules of the IL-4/IL-13 signaling pathway (e.g., Stat6, Jak2), NF-κB signaling pathway (e.g., Nfkb2, Rela, Nfkbib), and signaling pathways that are involved in healing responses (e.g., Jun, Fosl1, Tnik, and Irak2), were elevated. Finally, genes of additional microRNAs (e.g., Mir142 and Mir1957), as well as cell cycle (Gadd45b and S100a6) and survival molecules (e.g., Bcl10), had elevated expression (Table III).

Table III.
Genes of interest that were upregulated in eosinophils of the esophagus compared with the bone marrow in CC10Il13Tg/Pirb−/−mice but not in CC10Il13Tg/Pirb+/+mice
Gene SymbolFold Change (Esophagus/Bone Marrow)
Surface molecules Il5ra 5.73 
 Il12rb2 4.24 
 Notch2 3.69 
 Notch1 2.58 
 Bmpr2 2.52 
 Ifnar1 2.28 
 Cd300a 2.61 
Cell adhesion and migration molecules Itgax 6.04 
 Itgb3 4.67 
 Itgal 3.75 
 Vasp 3.21 
 Ezr 2.84 
 Acta1 2.75 
 Cd24a 2.07 
Enzymes Capn2 5.66 
 Mmp9 3.49 
 Adam19 2.73 
Secreted factors Il6 18.9 
 Tnf 5.72 
 Cxcl10 4.43 
 Tgfbi 4.42 
 Ccl8 3.84 
 Areg 2.18 
Intracellular signaling molecules Jun 3.72 
 Stat6 3.44 
 Nfkb2 2.90 
 Tnik 2.71 
 Rela 2.69 
 Fosl1 2.35 
 Jak2 2.25 
 Nfkbib 2.24 
 Irak2 2.03 
MicroRNA Mir1957 9.22 
 Mir142 8.29 
Cell cycle molecules Gadd45b 5.63 
 S100a6 2.09 
Survival molecule Bcl10 2.20 
Gene SymbolFold Change (Esophagus/Bone Marrow)
Surface molecules Il5ra 5.73 
 Il12rb2 4.24 
 Notch2 3.69 
 Notch1 2.58 
 Bmpr2 2.52 
 Ifnar1 2.28 
 Cd300a 2.61 
Cell adhesion and migration molecules Itgax 6.04 
 Itgb3 4.67 
 Itgal 3.75 
 Vasp 3.21 
 Ezr 2.84 
 Acta1 2.75 
 Cd24a 2.07 
Enzymes Capn2 5.66 
 Mmp9 3.49 
 Adam19 2.73 
Secreted factors Il6 18.9 
 Tnf 5.72 
 Cxcl10 4.43 
 Tgfbi 4.42 
 Ccl8 3.84 
 Areg 2.18 
Intracellular signaling molecules Jun 3.72 
 Stat6 3.44 
 Nfkb2 2.90 
 Tnik 2.71 
 Rela 2.69 
 Fosl1 2.35 
 Jak2 2.25 
 Nfkbib 2.24 
 Irak2 2.03 
MicroRNA Mir1957 9.22 
 Mir142 8.29 
Cell cycle molecules Gadd45b 5.63 
 S100a6 2.09 
Survival molecule Bcl10 2.20 

IL-13 is a key Th2 cytokine that can directly promote many of the disease features associated with EoE, including eosinophil infiltration and esophageal remodeling. Most studies focused on downstream effects of IL-13, and substantially less is known about the negative regulators of IL-13–induced esophageal pathology. In this study, we establish PIR-B as a novel inhibitory pathway that suppresses IL-13–induced eosinophil accumulation and subsequent activation in the esophagus. We demonstrated that the expression of Pirb is increased in the esophagus after exposure to IL-13; eosinophils are the predominant contributors to the increased PIR-A/B expression in EoE; PIR-B inhibits the development of IL-13–induced esophageal pathology, including eosinophilic accumulation, epithelial cell hyperplasia, collagen deposition, increased Acta2 levels, and angiogenesis; eosinophil-depletion experiments suggest that increased collagen deposition and angiogenesis in response to IL-13 in CC10-Il13Tg/Pirb−/− mice are likely due to loss of negative regulation in esophageal eosinophils; and Pirb−/− esophageal eosinophils display a distinct genetic signature associated with tissue repair. Collectively, our data establish PIR-B as an intrinsic negative regulator of eosinophil functions in IL-13–driven experimental EoE. This experimental finding may have implications for human EoE, which is characterized by IL-13–driven responses, as demonstrated by recent findings using anti–IL-13 treatment of patients with EoE (6).

We established that, following aeroallergen challenge, Pirb−/− mice display decreased lung eosinophilia and that PIRs critically regulate eosinophil maturation and expansion in homeostasis and in settings of aeroallergen-induced asthma (13). Subsequently, allergen-induced eosinophil infiltration into the lungs is decreased. In contrast, IL-13–induced eosinophil levels in the lung and esophageal compartment are elevated. This finding is likely due to the fact that the regulation of eosinophil functions by PIRs is confined to a particular anatomical location and specifically regulates IL-5–induced eosinophilpoiesis. For example, the role of PIRs in eosinophil expansion is restricted to the bone marrow compartment. However, once eosinophils “escape” the developmental regulation by PIRs and enter the blood, PIR-B is capable of suppressing eosinophil migration in response to eotaxins (15). This notion is reinforced by this study’s microarray data demonstrating a tissue-specific suppressive function for PIR-B (in terms of IL-13–regulated gene expression) in the esophagus but not the bone marrow. In addition, IL-13 induces eosinophilic inflammation via the generation of a strong chemotactic gradient for eosinophil recruitment independently of increasing the level of IL-5. We demonstrated recently that PIR-B is a negative regulator of eosinophil chemotaxis in response to eotaxins (15). Consistently, CC10-Il13Tg/Pirb−/− mice express comparable levels of eotaxins to those found in CC10-Il13Tg/Pirb+/+ mice. Yet, they still display markedly increased infiltration of eosinophils in the lungs and esophagus. Collectively, this suggests that Pirb−/− eosinophils hypermigrate in response to eotaxins, as we showed previously (15).

Global microarray analyses revealed that IL-13–elicited esophageal eosinophils express multiple genes that are associated with fibrosis and tissue remodeling (e.g., Adam8, Ear11, Arg2, Mmp25, Ecm1, Retnla, Postn, Il1a, Il1b, and Hif1a). Although these data are limited by the fact that we could not compare the genetic signature of IL-13–induced esophageal eosinophils with naive esophageal eosinophils, it is important to note that the inflammatory conditions that promoted tissue eosinophilia were associated with increased IL-13 (3, 4, 19) and that the normal esophagus is devoid of eosinophils. Thus, our results may reflect the genetic signature of eosinophils under disease conditions.

One of the notable findings of our study was that CC10-Il13Tg/Pirb−/− mice display markedly increased tissue remodeling. This finding is of specific interest because structural cells, such as epithelial cells, fibroblasts, and endothelial cells, do not express PIR-B. Thus, the increased tissue remodeling in CC10-Il13Tg/Pirb−/− mice may be due to the lack of PIR-B’s negative regulation of IL-13–mediated responses in a PIR-B+ cell type. Our findings suggest that PIR-B is a key negative regulator of eosinophil effector functions and may offer an explanation for the lack of eosinophil-dependent pathology in IL-13–transgenic mice (4). In fact, our finding suggests that expression of PIR-B in eosinophils may be sufficient to dampen their pathological activities in the esophagus. Indeed, the expression of PIR-B in the esophagus was predominantly associated with its expression in eosinophils, and CC10-Il13Tg/Pirb−/− mice display increased eosinophilic infiltration to the esophagus, which was associated with increased tissue remodeling. In support of this notion, eosinophils express various profibrogenic mediators, including MMPs, TIMPs, VEGF, TGF-β, FGF, and CCL18. Furthermore, clinical and experimental studies using eosinophil-deficient or hypereosinophilic mice tightly link eosinophils with tissue remodeling in numerous diseases, including asthma and EoE. Thus, loss of PIR-B’s negative regulation in eosinophils may result in increased tissue remodeling. Indeed, using ERK phosphorylation as a surrogate marker for eosinophil activation, we clearly show that PIR-B negatively regulates ERK phosphorylation in response to the IL-13–induced esophageal microenvironment. Furthermore, microarray analyses on primary Pirb−/− esophageal eosinophils demonstrated a distinct genetic signature that was associated with a hyperactivated eosinophil phenotype. For example, genes of TGF-β signaling molecules that promote epithelial growth, fibrosis, and tissue remodeling (i.e., Bmpr2, Bmp2, Tgfbi, and Smad3), as well as various factors that promote epithelial to mesenchymal transition (a recent pathway identified in EoE) and fibrosis (i.e., Notch1, Notch2, Mmp9, Adam19, and Areg), had increased expression in Pirb−/− cells (2, 2022). Integration of the ERK phosphorylation data and genetic signature analysis suggests that increased pathology in CC10-Il13Tg/Pirb−/− mice is not merely due to increased eosinophil numbers in the tissue; it is also attributed to the fact that these eosinophils are hyperactivated.

Collectively, we demonstrate an inhibitory role for PIR-B in the regulation of esophageal eosinophil recruitment and activation, as well as the consequent esophageal pathology, in response to IL-13 induction. Given the involvement of IL-13 in EoE and additional allergic diseases, the identification of an IL-13–dampening loop that is dependent upon PIR-B may have implications for human disease, because PIR-B human orthologs are readily expressed by eosinophils (23). These data provide new understanding of the signaling mechanisms that restrict eosinophil functions in EoE and may provide new therapeutic targets for combating it.

We thank H. Kubagawa (University of Alabama, Tuscaloosa, AL) for providing Pirb−/− mice, Dr. Jamie Lee (Mayo Clinic, Scottsdale, AZ) for the anti-MBP reagent, and Shawna Hottinger for editorial assistance.

This work was supported by the US-Israel Binational Science Foundation (Grant 2011244), the Israel Science Foundation (Grant 955/11), an Israel Cancer Research Foundation Research Career Development Award, and a Boaz and Varda Dotan Center Grant for Hemato-Oncology Research (all to A.M.); the US-Israel Binational Science Foundation (Grant 2009222 to A.M. and M.E.R.); and the National Institutes of Health National Institute of Allergy and Infectious Diseases (R01AI083450 and R37AI045898), the CURED Foundation, and the Buckeye Foundation (all to M.E.R.). This work was performed in partial fulfillment of the requirements for the Ph.D. degree of N.B.B.-M. at Tel Aviv University.

The data set in this article has been submitted to the Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE81135) under accession number GSE81135.

The online version of this article contains supplemental material.

Abbreviations used in this article:

     
  • BALF

    bronchoalveolar lavage fluid

  •  
  • DOX

    doxycycline

  •  
  • EoE

    eosinophilic esophagitis

  •  
  • MBP

    major basic protein

  •  
  • MFI

    mean fluorescence intensity

  •  
  • PIR

    paired Ig-like receptor

  •  
  • qPCR

    quantitative PCR.

1
Rothenberg
M. E.
2009
.
Biology and treatment of eosinophilic esophagitis.
Gastroenterology
137
:
1238
1249
.
2
Aceves
S. S.
,
Newbury
R. O.
,
Dohil
R.
,
Bastian
J. F.
,
Broide
D. H.
.
2007
.
Esophageal remodeling in pediatric eosinophilic esophagitis.
J. Allergy Clin. Immunol.
119
:
206
212
.
3
Blanchard
C.
,
Mingler
M. K.
,
Vicario
M.
,
Abonia
J. P.
,
Wu
Y. Y.
,
Lu
T. X.
,
Collins
M. H.
,
Putnam
P. E.
,
Wells
S. I.
,
Rothenberg
M. E.
.
2007
.
IL-13 involvement in eosinophilic esophagitis: transcriptome analysis and reversibility with glucocorticoids.
J. Allergy Clin. Immunol.
120
:
1292
1300
.
4
Zuo
L.
,
Fulkerson
P. C.
,
Finkelman
F. D.
,
Mingler
M.
,
Fischetti
C. A.
,
Blanchard
C.
,
Rothenberg
M. E.
.
2010
.
IL-13 induces esophageal remodeling and gene expression by an eosinophil-independent, IL-13R alpha 2-inhibited pathway.
J. Immunol.
185
:
660
669
.
5
Fulkerson
P. C.
,
Fischetti
C. A.
,
Hassman
L. M.
,
Nikolaidis
N. M.
,
Rothenberg
M. E.
.
2006
.
Persistent effects induced by IL-13 in the lung.
Am. J. Respir. Cell Mol. Biol.
35
:
337
346
.
6
Rothenberg
M. E.
,
Wen
T.
,
Greenberg
A.
,
Alpan
O.
,
Enav
B.
,
Hirano
I.
,
Nadeau
K.
,
Kaiser
S.
,
Peters
T.
,
Perez
A.
, et al
.
2015
.
Intravenous anti-IL-13 mAb QAX576 for the treatment of eosinophilic esophagitis.
J. Allergy Clin. Immunol.
135
:
500
507
.
7
Munitz
A.
2010
.
Inhibitory receptors on myeloid cells: new targets for therapy?
Pharmacol. Ther.
125
:
128
137
.
8
Kubagawa
H.
,
Chen
C. C.
,
Ho
L. H.
,
Shimada
T. S.
,
Gartland
L.
,
Mashburn
C.
,
Uehara
T.
,
Ravetch
J. V.
,
Cooper
M. D.
.
1999
.
Biochemical nature and cellular distribution of the paired immunoglobulin-like receptors, PIR-A and PIR-B.
J. Exp. Med.
189
:
309
318
.
9
Kubagawa
H.
,
Burrows
P. D.
,
Cooper
M. D.
.
1997
.
A novel pair of immunoglobulin-like receptors expressed by B cells and myeloid cells.
Proc. Natl. Acad. Sci. USA
94
:
5261
5266
.
10
Ujike
A.
,
Takeda
K.
,
Nakamura
A.
,
Ebihara
S.
,
Akiyama
K.
,
Takai
T.
.
2002
.
Impaired dendritic cell maturation and increased T(H)2 responses in PIR-B(−/−) mice.
Nat. Immunol.
3
:
542
548
.
11
Wheadon
H.
,
Paling
N. R.
,
Welham
M. J.
.
2002
.
Molecular interactions of SHP1 and SHP2 in IL-3-signalling.
Cell. Signal.
14
:
219
229
.
12
Mitsuhashi
Y.
,
Nakamura
A.
,
Endo
S.
,
Takeda
K.
,
Yabe-Wada
T.
,
Nukiwa
T.
,
Takai
T.
.
2012
.
Regulation of plasmacytoid dendritic cell responses by PIR-B.
Blood
120
:
3256
3259
.
13
Ben Baruch-Morgenstern
N.
,
Shik
D.
,
Moshkovits
I.
,
Itan
M.
,
Karo-Atar
D.
,
Bouffi
C.
,
Fulkerson
P. C.
,
Rashkovan
D.
,
Jung
S.
,
Rothenberg
M. E.
,
Munitz
A.
.
2014
.
Paired immunoglobulin-like receptor A is an intrinsic, self-limiting suppressor of IL-5-induced eosinophil development.
Nat. Immunol.
15
:
36
44
.
14
Ma
G.
,
Pan
P. Y.
,
Eisenstein
S.
,
Divino
C. M.
,
Lowell
C. A.
,
Takai
T.
,
Chen
S. H.
.
2011
.
Paired immunoglobin-like receptor-B regulates the suppressive function and fate of myeloid-derived suppressor cells.
Immunity
34
:
385
395
.
15
Munitz
A.
,
McBride
M. L.
,
Bernstein
J. S.
,
Rothenberg
M. E.
.
2008
.
A dual activation and inhibition role for the paired immunoglobulin-like receptor B in eosinophils.
Blood
111
:
5694
5703
.
16
Karo-Atar
D.
,
Moshkovits
I.
,
Eickelberg
O.
,
Königshoff
M.
,
Munitz
A.
.
2013
.
Paired immunoglobulin-like receptor-B inhibits pulmonary fibrosis by suppressing profibrogenic properties of alveolar macrophages.
Am. J. Respir. Cell Mol. Biol.
48
:
456
464
.
17
Chu
V. T.
,
Fröhlich
A.
,
Steinhauser
G.
,
Scheel
T.
,
Roch
T.
,
Fillatreau
S.
,
Lee
J. J.
,
Löhning
M.
,
Berek
C.
.
2011
.
Eosinophils are required for the maintenance of plasma cells in the bone marrow.
Nat. Immunol.
12
:
151
159
.
18
Zimmermann
N.
,
McBride
M. L.
,
Yamada
Y.
,
Hudson
S. A.
,
Jones
C.
,
Cromie
K. D.
,
Crocker
P. R.
,
Rothenberg
M. E.
,
Bochner
B. S.
.
2008
.
Siglec-F antibody administration to mice selectively reduces blood and tissue eosinophils.
Allergy
63
:
1156
1163
.
19
Rothenberg
M. E.
2004
.
Eosinophilic gastrointestinal disorders (EGID).
J. Allergy Clin. Immunol.
113
:
11
28, quiz 29
.
20
Shao
J.
,
Sheng
H.
.
2010
.
Amphiregulin promotes intestinal epithelial regeneration: roles of intestinal subepithelial myofibroblasts.
Endocrinology
151
:
3728
3737
.
21
Leask
A.
,
Abraham
D. J.
.
2004
.
TGF-beta signaling and the fibrotic response.
FASEB J.
18
:
816
827
.
22
Cheng
E.
,
Souza
R. F.
,
Spechler
S. J.
.
2012
.
Tissue remodeling in eosinophilic esophagitis.
Am. J. Physiol. Gastrointest. Liver Physiol.
303
:
G1175
G1187
.
23
Tedla
N.
,
Bandeira-Melo
C.
,
Tassinari
P.
,
Sloane
D. E.
,
Samplaski
M.
,
Cosman
D.
,
Borges
L.
,
Weller
P. F.
,
Arm
J. P.
.
2003
.
Activation of human eosinophils through leukocyte immunoglobulin-like receptor 7.
Proc. Natl. Acad. Sci. USA
100
:
1174
1179
.

M.E.R. is a consultant for Immune Pharmaceuticals, Receptos, NKT Therapeutics, Genetech/Roche, and Novartis. He has equity interest in Immune Pharmaceuticals, Celsus Therapeutics, Receptos, and NKT Therapeutics, as well as royalty rights to reslizumab being developed by Teva Pharmaceuticals. A.M. is a consultant for Compugen and Augmanity Nano Ltd. The other authors have no financial conflicts of interest.

Supplementary data