TLR9 is an innate immune receptor important for recognizing DNA of host and foreign origin. A mechanism proposed to prevent excessive response to host DNA is the requirement for proteolytic cleavage of TLR9 in endosomes to generate a mature form of the receptor (TLR9471–1032). We previously described another cleavage event in the juxtamembrane region of the ectodomain that generated a dominant-negative form of TLR9. Thus, there are at least two independent cleavage events that regulate TLR9. In this study, we investigated whether an N-terminal fragment of TLR9 could be responsible for regulation of the mature or negative-regulatory form. We show that TLR9471–1032, corresponding to the proteolytically cleaved form, does not function on its own. Furthermore, activity is not rescued by coexpression of the N-terminal fragment (TLR91–440), inclusion of the hinge region (TLR9441–1032), or overexpression of UNC93B1, the last of which is critical for trafficking and cleavage of TLR9. TLR91–440 coimmunoprecipitates with full-length TLR9 and TLR9471–1032 but does not rescue the native glycosylation pattern; thus, inappropriate trafficking likely explains why TLR9471–1032 is nonfunctional. Lastly, we show that TLR9471–1032 is also a dominant-negative regulator of TLR9 signaling. Together, these data provide a new perspective on the complexity of TLR9 regulation by proteolytic cleavage and offer potential ways to inhibit activity through this receptor, which may dampen autoimmune inflammation.

Innate immune receptors are positioned at various places within and on cells to allow broad detection of microbial patterns. Because DNA and RNA are encapsulated within microbes and only released upon microbial internalization into endosomes, nucleic acid sensors are positioned on host endosomal membranes or in the cytosol (1, 2). For example, nucleic acid–sensing TLR7, TLR8, and TLR9 are localized primarily in the endoplasmic reticulum (ER) until they exit to survey endosomal compartments (310). The unique localization and trafficking of these TLRs was proposed as a major regulatory mechanism to limit response to host DNA and RNA (11). Indeed, artificial localization of TLR9 to the cell surface promotes response to host DNA and causes autoinflammation in mice (12). Multiple mechanisms maintain appropriate localization of TLR9, including the presence of motifs in the cytoplasmic tail that retain TLR9 in the ER prior to release to endosomal compartments (37, 13) and phosphorylation of TLR9 (14). Release of TLR9 to the endosomal compartment requires the ER protein UNC93B1 (15, 16). Other proteins important for trafficking and signaling of TLR9 include adapter protein 3, a protein associated with TLR4, Slc15a4, and gp96 (also known as glucose regulated protein 94) (13, 1721).

Upon exit from the ER and trafficking to the endosomal compartment, TLR9 and other nucleic acid–sensing TLRs are proteolytically processed. The TLR9 ectodomain contains 26 leucine-rich repeat (LRR) structures interrupted by a disordered domain that forms a loop (22). This loop, also referred to as the hinge region or z-loop, is located between LRR1–14 and LRR15–26 and is the region where proteolytic processing to a mature form occurs in a processive manner (2325). The proteolytically cleaved form of TLR9 contains aa 471–1032 and, thus, consists of LRR15 to the end of the C terminus. Full-length and proteolytically cleaved TLR9 bind to ligand, and both are predominantly monomeric in the absence of ligand. However, although the full-length ectodomain of TLR9 remains primarily monomeric, even upon ligand addition, the ectodomain fragment corresponding to proteolytically cleaved TLR9 forms more dimers in response to ligand (23, 24).

We (26) described an alternative cleavage event in endogenous TLR9 (all other studies were performed with epitope-tagged TLR9) that generated a soluble ectodomain. This soluble ectodomain bound to CpG DNA ligand and was a negative regulator of signaling (26). Similarly, Lee et al. (27) showed that attaching a transmembrane lysosomal targeting domain on an N-terminal fragment (LRR1–14) inhibited the signaling ability of full-length TLR9. These data suggest that the cleavage events and their regulation are complex. In this study, we investigated the ability of a fragment of TLR9 corresponding to proteolytically cleaved TLR9 (aa 471–1032, TLR9471–1032) to signal and interact with the N-terminal fragment (TLR91–440) and with full-length TLR9. Our results show that expression of TLR9471–1032 in macrophages or dendritic cells is not sufficient for response to CpG DNA. Furthermore, TLR9 is a highly glycosylated protein, but our data show that the glycosylation pattern of transfected TLR9471–1032 does not recapitulate that observed for the naturally generated form TLR9471–1032. Our data support a model in which defects in posttranslational modification (and trafficking) of TLR9471–1032 arise if cleavage is not coincident with intracellular trafficking. However, coexpression of TLR91–440 with TLR9471–1032 does not rescue proper glycosylation or restore signaling. In fact, TLR91–440 and TLR9471–1032 could be coimmunoprecipitated with full-length TLR9, and both inhibited signaling by the full-length receptor. Together, these data suggest that, if the naturally occurring TLR9471–1032 is the active signaling form, it is likely generated from full-length TLR9 in endosomes where ligand is also present.

The following reagents were used: CpG oligodeoxynucleotides (5′-TCGTCGTTTCGTCGTTTTGTCGTT-3′; Eurofins MWG Operon, Huntsville, AL), ultrapure LPS 0111:B4 (Sigma), flagellin (InvivoGen), and a TNF-α ELISA kit (BioLegend, San Diego, CA). The following Abs were used: hemagglutinin (HA) tag (ABM and Roche), Flag tag (Sigma), tubulin (eBioscience), GFP (Life Technologies), and HRP-labeled secondary Abs (Southern Biotech). TLR9471–1032-HA and TLR9441–1032-HA were generated by PCR sewing using mouse TLR9-HA (Fig. 1) and the mouse IgκB leader sequence from pDisplay (Invitrogen). Two fragments were generated with primers 1 and 2 and primers 3 and 4 (Table I). Those products and primers 1 and 4 were included in a second PCR reaction to generate the sewed product, which was cloned into pcDNA3.1+(see Fig. 1 for various TLR9 mutants).

FIGURE 1.

Schematic diagram of TLR9 constructs. Full-length TLR9 has 26 LRRs, a transmembrane domain, and a C terminus containing the Toll–IL-1–resistance domain. TLR9 is proteolytically cleaved between LRR14 and LRR15, resulting in TLR9471–1032 and TLR91–440. We generated two additional forms. One form includes the hinge region (aa 441–470) on the C-terminal proteolytic cleavage product (TLR9441–1032), and the other includes the hinge region on the N-terminal cleavage product (TLR91–471).

FIGURE 1.

Schematic diagram of TLR9 constructs. Full-length TLR9 has 26 LRRs, a transmembrane domain, and a C terminus containing the Toll–IL-1–resistance domain. TLR9 is proteolytically cleaved between LRR14 and LRR15, resulting in TLR9471–1032 and TLR91–440. We generated two additional forms. One form includes the hinge region (aa 441–470) on the C-terminal proteolytic cleavage product (TLR9441–1032), and the other includes the hinge region on the N-terminal cleavage product (TLR91–471).

Close modal
Table I.
PCR primers used in the generation of TLR9471–1032-HA and TLR9441–1032-HA
ConstructForward (5′–3′)Reverse (5′–3′)
TLR9471–1032-HA Primer 1 Primer 2 
 GGCCCGCCTGGCATTATGCCCAG CAGGTCCATGGTGAACTTGAAGTTCTTACAGTCACCAGTGGAACCTGGAACCCAGAGCAGCAG 
 Primer 3 Primer 4 
 CTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACTGTAAGAACTTCAAGTTCACCATGGAGCTG TATCTCGAGCTAAGCGTAGTCTGGGACGTCGTATGGG 
TLR9441–1032-HA Primer 1 Primer 2 
 GGCCCGCCTGGCATTATGCCCAG CAACAGCTCCTCCTGCTCTGCATCATCTGCGTCACCAGTGGAACCTGGAACCCAGAGCAGCAG 
 Primer 3 Primer 4 
 CTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCAGATGATGCAGAGCAGGAGGAGCTGTTG TATCTCGAGCTAAGCGTAGTCTGGGACGTCGTATGGG 
ConstructForward (5′–3′)Reverse (5′–3′)
TLR9471–1032-HA Primer 1 Primer 2 
 GGCCCGCCTGGCATTATGCCCAG CAGGTCCATGGTGAACTTGAAGTTCTTACAGTCACCAGTGGAACCTGGAACCCAGAGCAGCAG 
 Primer 3 Primer 4 
 CTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACTGTAAGAACTTCAAGTTCACCATGGAGCTG TATCTCGAGCTAAGCGTAGTCTGGGACGTCGTATGGG 
TLR9441–1032-HA Primer 1 Primer 2 
 GGCCCGCCTGGCATTATGCCCAG CAACAGCTCCTCCTGCTCTGCATCATCTGCGTCACCAGTGGAACCTGGAACCCAGAGCAGCAG 
 Primer 3 Primer 4 
 CTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCAGATGATGCAGAGCAGGAGGAGCTGTTG TATCTCGAGCTAAGCGTAGTCTGGGACGTCGTATGGG 

The macrophage cell line derived from TLR9-knockout mice (NR-9569; BEI Resources, National Institute of Allergy and Infectious Diseases, National Institutes of Health) was cultured in DMEM with 10% (v/v) heat-inactivated low-endotoxin FCS, 2 mM l-glutamine, 10 mM HEPES, and 1 mM sodium pyruvate with the addition of 50 U/ml penicillin, 50 μg/ml streptomycin, and 10 μg/ml ciprofloxacin. The cells were cultured at 37°C with 5% CO2 and routinely tested negative for mycoplasma by PCR.

To generate transduced bone marrow–derived macrophages (BMMs), femurs and tibias from were collected from 8- to 10-wk-old mice TLR9-deficient mice. Bone marrow was flushed from the bones with cold DMEM supplemented with 20% L-929 cell-conditioned medium, 10% (v/v) heat-inactivated FCS, 2 mM l-glutamine, 10 mM HEPES, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 mg/ml streptomycin. Bone marrow cells were cultured in 10-cm Petri dishes (10 ml volume) at 1 × 106 cells/ml at 37°C, 5% CO2 for 7 d. On days 1 and 3, 1 ml of the media was removed and replaced with 1 ml of retrovirus-containing supernatant mixed with Polybrene (final concentration 8 μg/ml). Plates were centrifuged at 1811 × g at 32°C for 90 min. Postcentrifugation, 1 ml of the media was removed and replaced with fresh media. At the end of 7 d, adherent cells were collected. Differentiation was confirmed by flow cytometry after staining the cells with anti-F4/80 (PE) Ab. Cultures were routinely >95% F4/80+.

A similar procedure was used to generate BM-derived dendritic cells (BM-DCs), except that cells were cultured in six-well plates at 1 × 106 cells/ml (2 ml volume) of RPMI 1640 media supplemented with 2 mM l-glutamine, 50 U/ml penicillin, 50 mg/ml streptomycin, 10% low-endotoxin FBS, 20 ng/ml GM-CSF, and 50 nM 2-ME. On days 2 and 4, 1 ml of media was removed and replaced with 1.5 ml of retrovirus-containing supernatant mixed with Polybrene (final concentration 8 μg/ml). Plates were centrifuged at 1811 × g at 32°C for 90 min. Postcentrifugation, 1 ml of media was removed and replaced with fresh high–2-ME media (same as the original media, but with 50 μM 2-ME). Lightly adherent and floating cells were harvested on day 7. Differentiation was confirmed by flow cytometry with anti-CD11c (PE) Ab. Cultures were routinely 80% CD11c+, and only CD11c+ cells were included in the analysis.

Retroviral supernatants were generated using ØNX-Ampho cells transfected with Lipofectamine 2000 (Invitrogen). TLR9−/− macrophages were spin transduced with retroviral supernatants plus Polybrene (8 μg/ml final concentration) and cultured at 37°C for 44–48 h prior to stimulation.

TLR9−/− macrophages, BMMs, or BM-DCs were retrovirally transduced with constructs encoding murine TLR9-HA or TLR9471–1032-HA. Then cells were stimulated with 3 μM CpG 10104 for 6 h, with the addition of 10 μg/ml brefeldin A for the last 4 h. Cells were fixed with 3% PFA for 15 min on ice and then stained with anti-HA FITC and anti–TNF-α allophycocyanin in 0.1% saponin in PBS with 10% mouse serum for 1 h on ice. Fluorescence intensity was measured with a FACSCanto II flow cytometer. Data were collected with a FACSDiva (BD Biosciences) and analyzed with FlowJo software.

TNF-α in the supernatants was measured by ELISA, according to the manufacturer’s recommendations (BioLegend).

The deglycosylation assay was performed as previously described (3). Immunoprecipitates on beads were suspended in 100 μl of deglycosidase buffer, divided into three equal portions, and left untreated or treated with endoglycosidase H (endoH) or peptide N glycosidase F (PNGaseF) overnight at 37°C. The reactions were stopped by adding 6× SDS-PAGE–reduced sample buffer and boiling at 95°C for 5 min prior to SDS-PAGE.

Immunoblotting was performed as previously described (4, 5, 26, 28). Briefly, stimulated cells were washed with ice-cold HBSS and lysed for direct immunoblotting with 1× SDS-PAGE–reduced sample buffer (62.5 mM Tris [pH 6.8], 12.5% glycerol, 1% SDS, 0.005% bromophenol blue, 1.7% 2-ME) or for immunoprecipitation (IP) or coimmunoprecipitation with lysis buffer (50 mM Tris-Cl [pH 7.4], 150 mM NaCl, 10% [w/v] glycerol, 1 mM EDTA, and protease inhibitors). Lysates were incubated at 95°C for 5 min prior to resolving by 10% SDS-PAGE. Proteins were transferred to nitrocellulose membranes and immunoblotted with the indicated Abs. Membranes were incubated with a SuperSignal West Pico chemiluminescence Western blotting detection system (Thermo Scientific) and exposed to x-ray film. Films were scanned, and images were assembled in Photoshop. For IP experiments, total protein was determined in clarified lysates using the BCA protein assay (Bio-Rad), and 5 μg of indicated Ab was used for IP. For coimmunoprecipitations, one SDS-PAGE gel was run and transferred to nitrocellulose. The blots were sequentially probed with the indicated Abs.

Luciferase assay was performed as previously described (6, 26, 29). Briefly, HEK293 cells were transfected using TransIT (Mirus) with the indicated plasmids plus 5× NF-κB–luciferase reporter and empty vector to total 200 ng of DNA/well of a 96-well plate. After 24 h, cells were stimulated with CpG DNA (3 μM), ultrapure LPS (100 ng/ml), or flagellin (100 ng/ml) for an additional 24 h. Cells were lysed in Reporter Lysis Buffer (Promega) and assayed using a Veritas luminometer with luciferase substrate (20 nM tricine, 2.67 mM MgSO4·7 H2O, 33.3 mM DTT, 100 μM EDTA, 530 μM ATP, 270 μM Acetyl CoA, 12 μg/ml luciferin, 5 mM NaOH, and 265 μM magnesium carbonate hydroxide).

Data were collected in quadruplicate. Comparisons were analyzed using one-way ANOVA with the Tukey post hoc correction, assuming a Gaussian distribution (GraphPad Prism).

TLR9 is proteolytically cleaved between aa 441 and 470 to generate a mature form (Fig. 1, TLR9471–1032) that is proposed to be the active form of the receptor (23, 24). To determine whether TLR9471–1032 supported a response to CpG DNA, we reconstituted a mouse macrophage cell line derived from TLR9-deficient mice on a C57BL/6 background. Reconstitution of TLR9-deficient macrophages with empty vector did not support secretion of TNF-α in response to CpG DNA (Fig. 2A, Table I). As expected, expression of full-length wild-type (WT) TLR9-HA in TLR9-deficient macrophages restored the response to CpG DNA (Fig. 2A). However, expression of HA- or myc-tagged TLR9471–1032 did not support a CpG DNA response (Fig. 2A). Untransduced macrophages, as well as those expressing any of the TLR9 constructs, responded similarly to LPS (Fig. 2A). The level of TNF-α production by the same number of WT unmanipulated BMMs to 1 μM CpG DNA and 100 ng/ml LPS was similar to what we observed with retroviral reconstitution of TLR9-deficient macrophages stimulated with 3 μM CpG DNA or 100 ng/ml LPS (Supplemental Fig. 1). We next investigated TNF-α production by intracellular cytokine staining, thus differentiating transduced and untransduced macrophages. Retroviral transduction resulted in TLR9 or mutant TLR9 expression in ∼15% of the cells (Fig. 2B). Intracellular cytokine staining demonstrated that all cells responded to LPS, regardless of transduction status (Fig. 2B). Despite similar levels of transduction and expression of the full-length and TLR9471–1032 forms, only cells expressing the full-length TLR9-HA responded to CpG DNA stimulation to produce TNF-α (Fig. 2B). This was not unique to the macrophage cell line because reconstitution during in vitro differentiation of primary TLR9-deficient BMMs (15% transduction efficiency, >95% viability) or BM-DCs (5% transduction efficiency, >95% viability) with TLR9-HA, but not TLR9471–1032-HA, supported TNF-α production in response to CpG DNA, whereas all of the cells produced TNF-α in response to LPS (Fig. 2C).

FIGURE 2.

TLR9471–1032 does not respond to CpG DNA. (A) A TLR9-deficient macrophage cell line was retrovirally transduced with empty vector, full-length TLR9-HA, or TLR9471–1032 tagged with HA or myc at the C terminus. Transduced cells were replated at 2 × 105 cells/well in 24-well plates and treated with media, 3 μM CpG DNA, or 100 ng/ml LPS for 6 h in quadruplicate. Supernatants were assayed for TNF-α by ELISA. This experiment was performed three times. (B) A TLR9-deficient macrophage cell line was retrovirally transduced with empty vector, TLR9, or TLR9471–1032 for 24 h. Cells were stimulated with 3 μM CpG DNA or 100 ng/ml LPS for 6 h, and 10 μg/ml brefeldin A was added for the final 4 h of stimulation. Cells were fixed, permeabilized, and stained for intracellular TNF-α and the HA tag on TLR9. This experiment was performed three times. (C) Primary mouse BMMs and BM-DCs were reconstituted, stimulated, and stained as in (B). This experiment was performed two times.

FIGURE 2.

TLR9471–1032 does not respond to CpG DNA. (A) A TLR9-deficient macrophage cell line was retrovirally transduced with empty vector, full-length TLR9-HA, or TLR9471–1032 tagged with HA or myc at the C terminus. Transduced cells were replated at 2 × 105 cells/well in 24-well plates and treated with media, 3 μM CpG DNA, or 100 ng/ml LPS for 6 h in quadruplicate. Supernatants were assayed for TNF-α by ELISA. This experiment was performed three times. (B) A TLR9-deficient macrophage cell line was retrovirally transduced with empty vector, TLR9, or TLR9471–1032 for 24 h. Cells were stimulated with 3 μM CpG DNA or 100 ng/ml LPS for 6 h, and 10 μg/ml brefeldin A was added for the final 4 h of stimulation. Cells were fixed, permeabilized, and stained for intracellular TNF-α and the HA tag on TLR9. This experiment was performed three times. (C) Primary mouse BMMs and BM-DCs were reconstituted, stimulated, and stained as in (B). This experiment was performed two times.

Close modal

We next asked whether inclusion of the hinge region (aa 440–470), and thus the potential to be processed proteolytically, would restore signaling. Reconstitution of BMMs or BM-DCs with TLR9471–1032-HA (without the hinge) or TLR9441–1032-HA (with the hinge) (Fig. 1) failed to support TNF-α production in response to CpG DNA (Fig. 3A, 3C). Similarly, reconstitution of the TLR9-deficient macrophage cell line with untagged TLR9471–1032 (without the hinge) or with TLR9441–1032 (with the hinge) also failed to support TNF-α secretion (Fig. 3E). However, cells transduced with full-length TLR9-HA (Fig. 3A, 3C) or untagged TLR9 (Fig. 3E) responded to CpG DNA. All cells also responded to LPS (Fig. 3B, 3D, 3F). These findings suggest that TLR91–440 is structurally required for appropriate trafficking and cleavage or that it is required for signaling, despite being proteolytically removed.

FIGURE 3.

Inclusion of the hinge region TLR9441–470 does not restore signaling by TLR9471–1032. (A and B) Primary BMMs were retrovirally reconstituted with TLR9-HA, TLR9471–1032, or TLR9441–1032 and stimulated with media, 5 μM CpG DNA (A), or 100 ng/ml LPS (B) for 6 h. Brefeldin A was added for the final 4 h of stimulation. Cells were fixed, permeabilized, and stained for intracellular TNF-α and the HA tag on TLR9. Mean fluorescence intensity (MFI) of HA+ cells is shown. (C and D) As in (A and B), except that primary BM-DCs were reconstituted by retroviral transduction. (E and F) A TLR9-deficient macrophage cell line (TLR9-knockout line) was reconstituted with empty vector, TLR9, TLR9471–1032, or TLR9441–1032 and stimulated with media, 3 μM CpG DNA (E), or 100 ng/ml LPS (F) for 6 h. Supernatants were assayed for TNF-α by ELISA. Each experiment was performed two times.

FIGURE 3.

Inclusion of the hinge region TLR9441–470 does not restore signaling by TLR9471–1032. (A and B) Primary BMMs were retrovirally reconstituted with TLR9-HA, TLR9471–1032, or TLR9441–1032 and stimulated with media, 5 μM CpG DNA (A), or 100 ng/ml LPS (B) for 6 h. Brefeldin A was added for the final 4 h of stimulation. Cells were fixed, permeabilized, and stained for intracellular TNF-α and the HA tag on TLR9. Mean fluorescence intensity (MFI) of HA+ cells is shown. (C and D) As in (A and B), except that primary BM-DCs were reconstituted by retroviral transduction. (E and F) A TLR9-deficient macrophage cell line (TLR9-knockout line) was reconstituted with empty vector, TLR9, TLR9471–1032, or TLR9441–1032 and stimulated with media, 3 μM CpG DNA (E), or 100 ng/ml LPS (F) for 6 h. Supernatants were assayed for TNF-α by ELISA. Each experiment was performed two times.

Close modal

We and others investigators routinely used HEK293 cells to assay for TLR9 activity, yet TLR9 is poorly proteolytically processed to TLR9471–1032 in these cells (Fig. 4A). These data raise the possibility that full-length TLR9 is capable of inducing signal transduction, which is consistent with its ability to bind ligand (22). The TLR9-trafficking chaperone UNC93B1 is required for TLR9 trafficking to endosomes (16, 30), and the mutation H412R on UNC93B1 (referred to as UNC93B1 3d) fails to support trafficking and signaling of TLR9 (16, 31). In HEK293 cells, overexpression of WT UNC93B1, but not the UNC93B1 3d mutant, enhanced TLR9 proteolytic cleavage (Fig. 4A). Expression of WT UNC93B1 correlated with a slight, but statistically significant, increase in TLR9 signaling (Fig. 4B). The 3d mutant did not enhance signaling (Fig. 4B). Expression of UNC93B1 or the 3d mutant had no effect on TLR5 response to flagellin (Fig. 4B), although cells transfected with either form of UNC93B1 had an unexplained, but reproducible, increase in control β-galactosidase activity (Supplemental Fig. 2A). Importantly, overexpression of UNC93B1, or the 3d mutant, did not rescue signaling by TLR9471–1032 (Fig. 4B). Together, these data demonstrate that TLR9 is cleaved and that cleavage correlates with a slight increase in signaling; however, expression of TLR9471–1032, which correlates with the cleaved form, is not sufficient for signaling, and overexpression of UNC93B1 does not rescue TLR9471–1032.

FIGURE 4.

Increased expression of UNC93B1 enhances proteolytic cleavage of TLR9 but does not restore signaling by TLR9471–1032. (A) HEK293 cells were transfected with TLR9-HA (1.3 μg/well of a six-well plate, total DNA 4 μg/well), with or without UNC93B1 WT or 3d mutant (0.065 μg/well) overnight. Lysates were resolved by SDS-PAGE and analyzed by immunoblotting for HA and tubulin (tub). This experiment was performed two times. (B) HEK293 cells were transfected with empty vector, TLR9-HA, or TLR9471–1032 (5 ng/well of a total of 200 ng/well of a 96-well plate), with or without UNC93B1 WT or 3d mutant (0.25 ng/well), plus an NF-κB–luciferase reporter overnight. Cells were stimulated with 3 μM CpG DNA (upper panel) or 100 ng/ml flagellin (lower panel) for 18 h, lysed, and assayed for luciferase activity. This experiment was performed three times. ***p < 0.01 compared to TLR9. FL, full-length TLR9.

FIGURE 4.

Increased expression of UNC93B1 enhances proteolytic cleavage of TLR9 but does not restore signaling by TLR9471–1032. (A) HEK293 cells were transfected with TLR9-HA (1.3 μg/well of a six-well plate, total DNA 4 μg/well), with or without UNC93B1 WT or 3d mutant (0.065 μg/well) overnight. Lysates were resolved by SDS-PAGE and analyzed by immunoblotting for HA and tubulin (tub). This experiment was performed two times. (B) HEK293 cells were transfected with empty vector, TLR9-HA, or TLR9471–1032 (5 ng/well of a total of 200 ng/well of a 96-well plate), with or without UNC93B1 WT or 3d mutant (0.25 ng/well), plus an NF-κB–luciferase reporter overnight. Cells were stimulated with 3 μM CpG DNA (upper panel) or 100 ng/ml flagellin (lower panel) for 18 h, lysed, and assayed for luciferase activity. This experiment was performed three times. ***p < 0.01 compared to TLR9. FL, full-length TLR9.

Close modal

A previous study (32) demonstrated that an N-terminal fragment of TLR9 associates with TLR9471–1032. Furthermore, the hinge region is processively cleaved and may play a role in localization and trafficking of TLR9 to yeast-containing phagosomes (33, 34). Thus, we next asked whether the hinge was required for an association between TLR9471–1032 and TLR91–440. When expressed in macrophages, TLR9471–1032 coimmunoprecipitated with the N terminus, regardless of whether the hinge region was present (TLR91–440 or TLR91–470) (Fig. 5A). TLR9441–1032 (including the hinge region) also coimmunoprecipitated with the N-terminal fragment TLR91–440 (Fig. 5A). Thus, N- and C-terminal fragments associate, whether or not they contain the hinge region.

FIGURE 5.

Glycosylation of TLR9471–1032 does not mimic the glycosylation pattern of naturally generated TLR9471–1032, and addition of the N-terminal fragment TLR91–470 in trans does not rescue glycosylation or signaling of TLR9471–1032. (A) HEK293 cells were transfected with (1.3 μg of a total of 4 μg DNA per six-well plate) TLR9-HA, TLR9471-1032-HA, TLR9441–1032-HA, Flag-TLR9 (FL-TLR9), Flag-TLR91–470, Flag-TLR91–440, or 1.3 μg of each of the combinations of the indicated plasmids. Cells were lysed and immunoprecipitated with Ab to HA or Flag, resolved by SDS-PAGE, and analyzed by immunoblotting for HA or Flag. The arrows indicate coimmunoprecipitated proteins. This experiment was performed three times. (B) HEK293 cells were transfected with TLR9-HA, TLR9471–1032, or TLR9471–1032 plus Flag-tagged TLR91–440 (1 μg/well plus 1 μg/well of UNC93B1 and 2 μg/well empty vector for a total of 4 μg/well of a six-well plate). Cells were lysed, and lysates were deglycosylated with endoH (H) or PNGaseF (F) and resolved by SDS-PAGE. Following transfer to nitrocellulose, the blots were probed sequentially for HA and Flag. This experiment was performed two times. (C) HEK293 cells were transfected with TLR9-HA, TLR9471–1032, Flag-TLR91–440, or TLR9471–1032 plus Flag-TLR91–440 (5 ng/well of a total of 200 ng/well of a 96-well plate) for 24 h. Cells were stimulated with media, 3 μM CpG DNA, or 100 ng/ml flagellin (cells endogenously express TLR5) for 18 h, lysed, and assayed for luciferase activity. This experiment was performed four times. *p < 0.05 compared to TLR9.

FIGURE 5.

Glycosylation of TLR9471–1032 does not mimic the glycosylation pattern of naturally generated TLR9471–1032, and addition of the N-terminal fragment TLR91–470 in trans does not rescue glycosylation or signaling of TLR9471–1032. (A) HEK293 cells were transfected with (1.3 μg of a total of 4 μg DNA per six-well plate) TLR9-HA, TLR9471-1032-HA, TLR9441–1032-HA, Flag-TLR9 (FL-TLR9), Flag-TLR91–470, Flag-TLR91–440, or 1.3 μg of each of the combinations of the indicated plasmids. Cells were lysed and immunoprecipitated with Ab to HA or Flag, resolved by SDS-PAGE, and analyzed by immunoblotting for HA or Flag. The arrows indicate coimmunoprecipitated proteins. This experiment was performed three times. (B) HEK293 cells were transfected with TLR9-HA, TLR9471–1032, or TLR9471–1032 plus Flag-tagged TLR91–440 (1 μg/well plus 1 μg/well of UNC93B1 and 2 μg/well empty vector for a total of 4 μg/well of a six-well plate). Cells were lysed, and lysates were deglycosylated with endoH (H) or PNGaseF (F) and resolved by SDS-PAGE. Following transfer to nitrocellulose, the blots were probed sequentially for HA and Flag. This experiment was performed two times. (C) HEK293 cells were transfected with TLR9-HA, TLR9471–1032, Flag-TLR91–440, or TLR9471–1032 plus Flag-TLR91–440 (5 ng/well of a total of 200 ng/well of a 96-well plate) for 24 h. Cells were stimulated with media, 3 μM CpG DNA, or 100 ng/ml flagellin (cells endogenously express TLR5) for 18 h, lysed, and assayed for luciferase activity. This experiment was performed four times. *p < 0.05 compared to TLR9.

Close modal

Because TLR9471–1032 did not support signaling, and glycosylation is important for proper trafficking and signaling of TLR9, we next investigated whether the glycosylation pattern on TLR9471–1032 was the same as that generated naturally for TLR9. When full-length TLR9 is proteolytically cleaved, the full-length form of the receptor is glycosylated but is completely sensitive to endoH, suggesting that the glycans contain high mannose, typically associated with immature gycosylation. The naturally generated TLR9471–1032 has a molecular mass ∼ 80 kDa (Fig. 5B, filled arrowhead) and is partially sensitive to endoH digestion. When fully deglycosylated with PNGaseF, TLR9471–1032 resolves at ∼65 kDa (Fig. 5B, open arrowhead) (23). In contrast, TLR9471–1032 expressed on its own had an unusual banding pattern. We observed a highly glycosylated form (125 kDa) that was completely sensitive to endoH (105 kDa) and an intermediate glycosylated form (100 kDa) that was resistant to endoH (resolves just above the filled arrowhead, Fig. 5B). We also observed a fragment that ran at the same molecular mass as the naturally generated mature form (80 kDa) but was completely sensitive to endoH and PNGaseF digestion (open arrowhead, Fig. 5B). These data suggest that expression of a fragment of TLR9 corresponding to the proteolytically cleaved form, TLR9471–1032, is biochemically distinct from the naturally generated mature form. We next asked whether addition of TLR91–440 could restore appropriate glycosylation of TLR9471–1032. When TLR91–440 was expressed with TLR9471–1032, we detected the same fragments and glycosylation pattern observed when TLR9471–1032 was expressed by itself. Thus, intracellular processing, and therefore posttranslational modifications of expressed TLR9471–1032, is distinct from naturally generated TLR9471–1032 in cells. Furthermore, supplying the N-terminal fragment in trans does not rescue posttranslational modification.

We next investigated whether the N-terminal fragment could rescue the lack of signaling by TLR9471–1032. Transfection of TLR9 into HEK293 cells supported signaling in response to CpG DNA (Fig. 5C). However, neither TLR9471–1032 alone nor TLR9471–1032 coexpressed with TLR91–440 supported signaling in response to CpG DNA (Fig. 5C). Low expression of TLR9471–1032 and TLR91–440 did not account for lack of activity because both protein fragments were expressed at higher levels than full-length WT TLR9 (Fig. 5A, 5B). Furthermore, cells expressing TLR9, TLR9471–1032, or TLR9471–1032 and TLR91–440 supported similar signaling in response to the TLR5 ligand flagellin (HEK293 cells endogenously express TLR5) (Fig. 5C). However, for unknown reasons, we consistently observed a reduction in TLR5 response to flagellin when cells overexpressed TLR91–440, which was not due to differences in transfection because control β-galactosidase activity was not significantly different among transfected cells (Supplemental Fig. 2B). Thus, we conclude that supplying the two independent cleavage products is not sufficient to support proper posttranslational modification and signaling of TLR9. These data do not exclude the possibility that cleavage must occur at a unique time and place within the cell to allow for appropriate generation of a functional receptor.

We showed previously that endogenous human TLR9 is proteolytically cleaved in the ectodomain near the transmembrane domain. This proteolytic event generates a soluble form of the receptor that is capable of binding CpG DNA and inhibiting signaling through the full-length receptor. Additionally, when TLR91–440 was fused to a transmembrane domain, it acted as a dominant-negative inhibitor of signaling (27). Thus, we next investigated whether the N-terminal fragment, without a transmembrane domain, could associate with full-length TLR9 and negatively regulate TLR9 signaling. TLR91–440 coimmunoprecipitated full-length TLR9-HA, and full-length TLR9 coimmunoprecipitated TLR91–440, suggesting that they directly interact (Fig. 6A). It is important to note that this occurs in the absence of UNC93B1 and, thus, in the absence of TLR9 proteolytic cleavage to TLR9471–1032 (Fig. 6A). TLR9 signaling in response to CpG DNA was reduced significantly when TLR91–440 was coexpressed (Fig. 6B). Interestingly, we consistently observed a reduction in TLR5 response to flagellin when TLR91–440 was expressed (Fig. 6B); however, control β-galactosidase activity was unaffected, suggesting that the cells were equally transfected (Supplemental Fig. 2C). Thus, the N-terminal fragment can negatively regulate TLR9 signaling; it may also associate with flagellin and influence TLR5 signaling.

FIGURE 6.

The N-terminal fragment TLR91–470 binds directly to full-length TLR9 and inhibits signaling. (A) HEK293 cells were transfected with (1.3 μg of a total of 4 μg DNA per six-well plate) empty vector, Flag-TLR9, Flag-TLR91–440, TLR9-HA, or TLR9-HA plus Flag-TLR91–440. Cells were lysed and immunoprecipitated with Ab to HA or Flag, resolved by SDS-PAGE, and analyzed by immunoblotting for HA or Flag. Arrowheads indicate coimmunoprecipitated proteins. Because the same species Ab was used for HA IP and Flag blot, H chain bands are observed on the HA IP, Flag blot. These are not seen in the Flag IP, Flag blot because an HRP-conjugated anti-Flag was used to develop this blot. This experiment was performed three times. (B) HEK293 cells were transfected with 5 ng/well of a total of 200 ng/well of a 96-well plate, TLR9, TLR91–440, or TLR9 plus TLR91–440 for 24 h. Cells were stimulated with media, 3 μM CpG DNA, or 100 ng/ml flagellin for 18 h, lysed, and assayed for luciferase activity. This experiment was performed four times. ***p < 0.01, *p < 0.05 compared to TLR9.

FIGURE 6.

The N-terminal fragment TLR91–470 binds directly to full-length TLR9 and inhibits signaling. (A) HEK293 cells were transfected with (1.3 μg of a total of 4 μg DNA per six-well plate) empty vector, Flag-TLR9, Flag-TLR91–440, TLR9-HA, or TLR9-HA plus Flag-TLR91–440. Cells were lysed and immunoprecipitated with Ab to HA or Flag, resolved by SDS-PAGE, and analyzed by immunoblotting for HA or Flag. Arrowheads indicate coimmunoprecipitated proteins. Because the same species Ab was used for HA IP and Flag blot, H chain bands are observed on the HA IP, Flag blot. These are not seen in the Flag IP, Flag blot because an HRP-conjugated anti-Flag was used to develop this blot. This experiment was performed three times. (B) HEK293 cells were transfected with 5 ng/well of a total of 200 ng/well of a 96-well plate, TLR9, TLR91–440, or TLR9 plus TLR91–440 for 24 h. Cells were stimulated with media, 3 μM CpG DNA, or 100 ng/ml flagellin for 18 h, lysed, and assayed for luciferase activity. This experiment was performed four times. ***p < 0.01, *p < 0.05 compared to TLR9.

Close modal

The crystal structure of TLR9 shows that protein–protein interactions occur at multiple places within the LRRs from LRR2 to LRR26, as well as in the LRR C-terminal cap region (22). Because a significant number of amino acids in the mature form are involved in these associations, we asked whether TLR9471–1032 could interact with full-length TLR9. Both full-length TLR9-HA and TLR9471–1032 coimmunoprecipitated with full-length TLR9-GFP (Fig. 7A). When TLR9471–1032 was coexpressed with full-length TLR9, signaling was reduced (Fig. 7B). Interestingly, this inhibitory activity was lost if UNC93B1 (WT or 3d mutant) was coexpressed (Fig. 7B). Response to flagellin was unaffected (Fig. 7B), but we again observed an increase in control β-galactosidase activity when WT or 3d mutant of UNC93B1 was expressed (Supplemental Fig. 2D). Thus, full-length TLR9 forms dimers with TLR9471–1032, but when UNC93B1 is overexpressed, there may be preferential trafficking of full-length TLR9 and, thus, a reduced impact of TLR9471–1032 on signaling. Together, these data suggest that TLR9 must be proteolytically cleaved from the full-length form to generate a functional form of the receptor and that expression of TLR9471–1032 by itself results in improper glycosylation and trafficking that interfere with proper function of full-length TLR9.

FIGURE 7.

TLR9471–1032 is a dominant-negative regulator of TLR9 signaling. (A) HEK293 cells were transfected with TLR9-GFP alone (2 μg of a total of 4 μg DNA per six-well plate) or with TLR9-HA or TLR9471–1032-HA. Cells were lysed and immunoprecipitated with Ab to GFP, resolved by SDS-PAGE, and analyzed by immunoblotting for HA and GFP. Full-length TLR9, filled arrowhead; TLR9471–1032, open arrowhead. This experiment was performed two times. (B) HEK293 cells were transfected with TLR9, TLR9471–1032, or TLR9 plus TLR9471–1032 (5 ng/well of a total of 200 ng/well of a 96-well plate), with or without WT or mutant (3d) UNC93B1 (0.25 ng/well) for 24 h. Cells were stimulated with media, 3 μM CpG DNA, or 100 ng/ml flagellin for 18 h, lysed, and assayed for luciferase activity. This experiment was performed four times. ***p < 0.01 compared to TLR9.

FIGURE 7.

TLR9471–1032 is a dominant-negative regulator of TLR9 signaling. (A) HEK293 cells were transfected with TLR9-GFP alone (2 μg of a total of 4 μg DNA per six-well plate) or with TLR9-HA or TLR9471–1032-HA. Cells were lysed and immunoprecipitated with Ab to GFP, resolved by SDS-PAGE, and analyzed by immunoblotting for HA and GFP. Full-length TLR9, filled arrowhead; TLR9471–1032, open arrowhead. This experiment was performed two times. (B) HEK293 cells were transfected with TLR9, TLR9471–1032, or TLR9 plus TLR9471–1032 (5 ng/well of a total of 200 ng/well of a 96-well plate), with or without WT or mutant (3d) UNC93B1 (0.25 ng/well) for 24 h. Cells were stimulated with media, 3 μM CpG DNA, or 100 ng/ml flagellin for 18 h, lysed, and assayed for luciferase activity. This experiment was performed four times. ***p < 0.01 compared to TLR9.

Close modal

Proteolytic processing of nucleic acid–sensing TLRs was proposed to be a major regulatory mechanism that occurs in endosomes (23, 24, 26). Because microbes are phagocytosed, killed, and digested in phagosomes, the phagosome is the logical place to localize nucleic acid–sensing receptors. Forced expression of TLR9 to the cell surface by fusion with an ist2 domain or fusion to the transmembrane and cytoplasmic tail of TLR4 prevents signaling in response to viral infection, reinforcing the importance of correct localization for microbial nucleic acid recognition by TLRs (12, 23).

Proteolytic cleavage in the phagosome proceeds in a stepwise fashion and requires cathepsins and asparaginyl endopeptidase (25, 34). Addition of multiple cathepsin inhibitors in combination was required to prevent cleavage and signaling, suggesting that there may be some redundancy in the enzymes required for TLR9 processing (24). We (26) showed recently that endogenous TLR9 is proteolytically cleaved at a site near the transmembrane domain to generate a soluble negative regulator of signaling and that this proteolytic event was not dependent on low pH, unlike the other cleavage event. Thus, proteolytic processing of TLR9 is complex and involves multiple steps and multiple enzymes.

It was suggested that TLR9 processing is required to permit signaling, yet there are several pieces of data that fail to support this model. Some studies, including this one, show that a fragment of TLR9 corresponding to the proteolytically cleaved form, when expressed in cells, does not support signaling in response to CpG DNA (32). Furthermore, in HEK293 cells, little to no proteolytic processing of TLR9 occurs in the absence of exogenously expressed UNC93B1, yet these cells support TLR9 signaling (Fig. 4A, 4C), suggesting that processing is not absolutely required for signaling. Even more striking is the observation that forced surface expression of TLR9 by mutation of amino acids in the transmembrane domain results in poorly cleaved TLR9 that responds well to CpG DNA and host DNA and initiates an autoinflammatory syndrome in mice (12). Thus, TLR9 appears to be capable of signaling in the absence of cleavage.

A recent structural analysis of TLR9 showed that the full-length ectodomain of TLR9 bound inhibitory and active DNA. Interestingly, when cocrystallized, TLR9 formed dimers in association with active CpG DNA but remained monomeric when in association with inhibitory DNA (22). When the mature processed form of TLR9 was generated using V8 protease and compared with the full-length ectodomain, the processed TLR9 form dimerized more than the full-length protein (22). However, mapping of protein–protein interaction domains on the crystals revealed that many amino acids involved in the interface were located throughout N-terminal LRR1–14, C-terminal LRR15–26, and LRR-CT, yet the agonist-binding DNA interface was primarily confined to the first 12 LRRs (22). Thus, it is unclear why some studies found that TLR9471–1032 associates directly with CpG DNA (23). Our studies suggest that, if TLR9471–1032 is not generated from full-length TLR9, it is not properly glycosylated and can act as a dominant-negative inhibitor of signaling (Figs. 5B, 7B). Thus, although proteolytic cleavage is likely required, we propose that cleavage must occur at the same time and in the same location as association with ligand. Furthermore, TLR91–440 remains associated with the complex (24) for signaling to occur (32). The exact biochemical processing and involvement in signaling remain unclear and require additional follow-up study.

TLR9-deficient mice express some partial mRNA species that results in production of the first 96 aa fused to the neomycin gene (35). Because there are agonist ligand–binding amino acids located in this region (22), it remains possible that a small N-terminal fragment is generated in TLR9-deficient mice that could associate at low affinity with CpG DNA. Thus, it is interesting that two studies obtained conflicting results regarding the function of the N-terminal fragment. Onji et al. (32) suggested that it is required for signaling, whereas Lee et al. (27) suggested that the N-terminal fragment associates with full-length TLR9 and is a negative regulator. We observed that our soluble TLR9 proteolytic fragment can be additionally cleaved to generate the same N-terminal fragment (data not shown) (26). Thus, it is possible that the negative-regulatory function of soluble TLR9 could be due to generation of this fragment. We, too, saw that coexpression of the N-terminal fragment with TLR9 was inhibitory for signaling and that, when expressed in cells, the N-terminal fragment bound to full-length TLR9 (Fig. 6). However, we also detected an interaction between the expressed mature proteolytic form and full-length TLR9 and found that mature TLR9 can negatively regulate signaling (Fig. 7). Thus, multiple proteolytic cleavage events generating multiple fragments of TLR9 are involved in regulating signaling. Much remains to be investigated, but it is clear that elaborate regulatory mechanisms have developed to control TLR9.

We thank Bruce Beutler for the UNC93B1 plasmids, Greg Barton for the TLR9471–1032 -HA plasmid, and Boyoun Park for the TLR9471–1032 -myc plasmid. The following reagent was obtained through Biodefense and Emerging Infections Resources, National Institute of Allergy and Infectious Diseases, National Institutes of Health: macrophage cell line derived from TLR9 knockout mice (NR-9569). We also thank E. Gruber and C. Heyward for critical reading of the manuscript and helpful suggestions.

This work was supported by National Institutes of Health Grant R03AI097671 (to C.A.L.).

The online version of this article contains supplemental material.

Abbreviations used in this article:

BM-DC

BM-derived dendritic cell

BMM

bone marrow–derived macrophage

endoH

endoglycosidase H

ER

endoplasmic reticulum

HA

hemagglutinin

IP

immunoprecipitation

LRR

leucine-rich repeat

m

murine

PNGaseF

peptide N glycosidase F

WT

wild-type.

1
Hornung
V.
2014
.
SnapShot: nucleic acid immune sensors, part 2.
Immunity
41
:
1066
1066.e1
.
2
Hornung
V.
2014
.
SnapShot: nucleic acid immune sensors, part 1.
Immunity
41
:
868
,
868.e1
.
3
Chockalingam
A.
,
Brooks
J. C.
,
Cameron
J. L.
,
Blum
L. K.
,
Leifer
C. A.
.
2009
.
TLR9 traffics through the Golgi complex to localize to endolysosomes and respond to CpG DNA.
Immunol. Cell Biol.
87
:
209
217
.
4
Chockalingam
A.
,
Rose
W. A.
 II
,
Hasan
M.
,
Ju
C. H.
,
Leifer
C. A.
.
2012
.
Cutting edge: a TLR9 cytoplasmic tyrosine motif is selectively required for proinflammatory cytokine production.
J. Immunol.
188
:
527
530
.
5
Latz
E.
,
Schoenemeyer
A.
,
Visintin
A.
,
Fitzgerald
K. A.
,
Monks
B. G.
,
Knetter
C. F.
,
Lien
E.
,
Nilsen
N. J.
,
Espevik
T.
,
Golenbock
D. T.
.
2004
.
TLR9 signals after translocating from the ER to CpG DNA in the lysosome.
Nat. Immunol.
5
:
190
198
.
6
Leifer
C. A.
,
Brooks
J. C.
,
Hoelzer
K.
,
Lopez
J.
,
Kennedy
M. N.
,
Mazzoni
A.
,
Segal
D. M.
.
2006
.
Cytoplasmic targeting motifs control localization of toll-like receptor 9.
J. Biol. Chem.
281
:
35585
35592
.
7
Leifer
C. A.
,
Kennedy
M. N.
,
Mazzoni
A.
,
Lee
C.
,
Kruhlak
M. J.
,
Segal
D. M.
.
2004
.
TLR9 is localized in the endoplasmic reticulum prior to stimulation.
J. Immunol.
173
:
1179
1183
.
8
Itoh
H.
,
Tatematsu
M.
,
Watanabe
A.
,
Iwano
K.
,
Funami
K.
,
Seya
T.
,
Matsumoto
M.
.
2011
.
UNC93B1 physically associates with human TLR8 and regulates TLR8-mediated signaling.
PLoS One
6
:
e28500
.
9
Ishii
N.
,
Funami
K.
,
Tatematsu
M.
,
Seya
T.
,
Matsumoto
M.
.
2014
.
Endosomal localization of TLR8 confers distinctive proteolytic processing on human myeloid cells.
J. Immunol.
193
:
5118
5128
.
10
Iavarone
C.
,
Ramsauer
K.
,
Kubarenko
A. V.
,
Debasitis
J. C.
,
Leykin
I.
,
Weber
A. N.
,
Siggs
O. M.
,
Beutler
B.
,
Zhang
P.
,
Otten
G.
, et al
.
2011
.
A point mutation in the amino terminus of TLR7 abolishes signaling without affecting ligand binding.
J. Immunol.
186
:
4213
4222
.
11
Barton
G. M.
,
Kagan
J. C.
,
Medzhitov
R.
.
2006
.
Intracellular localization of Toll-like receptor 9 prevents recognition of self DNA but facilitates access to viral DNA.
Nat. Immunol.
7
:
49
56
.
12
Mouchess
M. L.
,
Arpaia
N.
,
Souza
G.
,
Barbalat
R.
,
Ewald
S. E.
,
Lau
L.
,
Barton
G. M.
.
2011
.
Transmembrane mutations in Toll-like receptor 9 bypass the requirement for ectodomain proteolysis and induce fatal inflammation.
Immunity
35
:
721
732
.
13
Brooks
J. C.
,
Sun
W.
,
Chiosis
G.
,
Leifer
C. A.
.
2012
.
Heat shock protein gp96 regulates Toll-like receptor 9 proteolytic processing and conformational stability.
Biochem. Biophys. Res. Commun.
421
:
780
784
.
14
Hasan
M.
,
Gruber
E.
,
Cameron
J.
,
Leifer
C. A.
.
2016
.
TLR9 stability and signaling are regulated by phosphorylation and cell stress.
J. Leukoc. Biol.
DOI: 10.1189/jlb.2A0815-337R.
15
Blasius
A. L.
,
Arnold
C. N.
,
Georgel
P.
,
Rutschmann
S.
,
Xia
Y.
,
Lin
P.
,
Ross
C.
,
Li
X.
,
Smart
N. G.
,
Beutler
B.
.
2010
.
Slc15a4, AP-3, and Hermansky-Pudlak syndrome proteins are required for Toll-like receptor signaling in plasmacytoid dendritic cells.
Proc. Natl. Acad. Sci. U S A
107
:
19973
19978
.
16
Kim
Y. M.
,
Brinkmann
M. M.
,
Paquet
M. E.
,
Ploegh
H. L.
.
2008
.
UNC93B1 delivers nucleotide-sensing toll-like receptors to endolysosomes.
Nature
452
:
234
238
.
17
Takahashi
K.
,
Shibata
T.
,
Akashi-Takamura
S.
,
Kiyokawa
T.
,
Wakabayashi
Y.
,
Tanimura
N.
,
Kobayashi
T.
,
Matsumoto
F.
,
Fukui
R.
,
Kouro
T.
, et al
.
2007
.
A protein associated with Toll-like receptor (TLR) 4 (PRAT4A) is required for TLR-dependent immune responses.
J. Exp. Med.
204
:
2963
2976
.
18
Sasai
M.
,
Linehan
M. M.
,
Iwasaki
A.
.
2010
.
Bifurcation of Toll-like receptor 9 signaling by adaptor protein 3.
Science
329
:
1530
1534
.
19
Liu
B.
,
Li
Z.
.
2008
.
Endoplasmic reticulum HSP90b1 (gp96, grp94) optimizes B-cell function via chaperoning integrin and TLR but not immunoglobulin.
Blood
112
:
1223
1230
.
20
Liu
B.
,
Yang
Y.
,
Qiu
Z.
,
Staron
M.
,
Hong
F.
,
Li
Y.
,
Wu
S.
,
Li
Y.
,
Hao
B.
,
Bona
R.
, et al
.
2010
.
Folding of Toll-like receptors by the HSP90 paralogue gp96 requires a substrate-specific cochaperone.
Nat. Commun.
1
:
79
.
21
Randow
F.
,
Seed
B.
.
2001
.
Endoplasmic reticulum chaperone gp96 is required for innate immunity but not cell viability.
Nat. Cell Biol.
3
:
891
896
.
22
Ohto
U.
,
Shibata
T.
,
Tanji
H.
,
Ishida
H.
,
Krayukhina
E.
,
Uchiyama
S.
,
Miyake
K.
,
Shimizu
T.
.
2015
.
Structural basis of CpG and inhibitory DNA recognition by Toll-like receptor 9.
Nature
520
:
702
705
.
23
Ewald
S. E.
,
Lee
B. L.
,
Lau
L.
,
Wickliffe
K. E.
,
Shi
G. P.
,
Chapman
H. A.
,
Barton
G. M.
.
2008
.
The ectodomain of Toll-like receptor 9 is cleaved to generate a functional receptor.
Nature
456
:
658
662
.
24
Park
B.
,
Brinkmann
M. M.
,
Spooner
E.
,
Lee
C. C.
,
Kim
Y. M.
,
Ploegh
H. L.
.
2008
.
Proteolytic cleavage in an endolysosomal compartment is required for activation of Toll-like receptor 9.
Nat. Immunol.
9
:
1407
1414
.
25
Sepulveda
F. E.
,
Maschalidi
S.
,
Colisson
R.
,
Heslop
L.
,
Ghirelli
C.
,
Sakka
E.
,
Lennon-Duménil
A. M.
,
Amigorena
S.
,
Cabanie
L.
,
Manoury
B.
.
2009
.
Critical role for asparagine endopeptidase in endocytic Toll-like receptor signaling in dendritic cells.
Immunity
31
:
737
748
.
26
Chockalingam
A.
,
Cameron
J. L.
,
Brooks
J. C.
,
Leifer
C. A.
.
2011
.
Negative regulation of signaling by a soluble form of toll-like receptor 9.
Eur. J. Immunol.
41
:
2176
2184
.
27
Lee
S.
,
Kang
D.
,
Ra
E. A.
,
Lee
T. A.
,
Ploegh
H. L.
,
Park
B.
.
2014
.
Negative self-regulation of TLR9 signaling by its N-terminal proteolytic cleavage product.
J. Immunol.
193
:
3726
3735
.
28
Hasan
M.
,
Ruksnis
C.
,
Wang
Y.
,
Leifer
C. A.
.
2011
.
Negative regulation of TLR3 signaling by an antimicrobial peptide.
J. Immunol.
187
:
5653
5659
.
29
Ju
C. H.
,
Chockalingam
A.
,
Leifer
C. A.
.
2009
.
Early response of mucosal epithelial cells during Toxoplasma gondii infection.
J. Immunol.
183
:
7420
7427
.
30
Brinkmann
M. M.
,
Spooner
E.
,
Hoebe
K.
,
Beutler
B.
,
Ploegh
H. L.
,
Kim
Y. M.
.
2007
.
The interaction between the ER membrane protein UNC93B and TLR3, 7, and 9 is crucial for TLR signaling.
J. Cell Biol.
177
:
265
275
.
31
Tabeta
K.
,
Hoebe
K.
,
Janssen
E. M.
,
Du
X.
,
Georgel
P.
,
Crozat
K.
,
Mudd
S.
,
Mann
N.
,
Sovath
S.
,
Goode
J.
, et al
.
2006
.
The Unc93b1 mutation 3d disrupts exogenous antigen presentation and signaling via Toll-like receptors 3, 7 and 9.
Nat. Immunol.
7
:
156
164
.
32
Onji
M.
,
Kanno
A.
,
Saitoh
S.
,
Fukui
R.
,
Motoi
Y.
,
Shibata
T.
,
Matsumoto
F.
,
Lamichhane
A.
,
Sato
S.
,
Kiyono
H.
, et al
.
2013
.
An essential role for the N-terminal fragment of Toll-like receptor 9 in DNA sensing.
Nat. Commun.
4
:
1949
.
33
Kasperkovitz
P. V.
,
Cardenas
M. L.
,
Vyas
J. M.
.
2010
.
TLR9 is actively recruited to Aspergillus fumigatus phagosomes and requires the N-terminal proteolytic cleavage domain for proper intracellular trafficking.
J. Immunol.
185
:
7614
7622
.
34
Ewald
S. E.
,
Engel
A.
,
Lee
J.
,
Wang
M.
,
Bogyo
M.
,
Barton
G. M.
.
2011
.
Nucleic acid recognition by Toll-like receptors is coupled to stepwise processing by cathepsins and asparagine endopeptidase.
J. Exp. Med.
208
:
643
651
.
35
Hemmi
H.
,
Takeuchi
O.
,
Kawai
T.
,
Kaisho
T.
,
Sato
S.
,
Sanjo
H.
,
Matsumoto
M.
,
Hoshino
K.
,
Wagner
H.
,
Takeda
K.
,
Akira
S.
.
2000
.
A Toll-like receptor recognizes bacterial DNA.
Nature
408
:
740
745
.

The authors have no financial conflicts of interest.

Supplementary data