Impaired epithelial barrier function disrupts immune homeostasis and increases inflammation in intestines, leading to many intestinal diseases. Cathelicidin peptides suppress intestinal inflammation and improve intestinal epithelial barrier function independently of their antimicrobial activity. In this study, we investigated the effects of Cathelicidin-WA (CWA) on intestinal epithelial barrier function, as well as the underlying mechanism, by using enterohemorrhagic Escherichia coli (EHEC)–infected mice and intestinal epithelial cells. The results showed that CWA attenuated EHEC-induced clinical symptoms and intestinal colitis, as did enrofloxacin (Enro). CWA decreased IL-6 production in the serum, jejunum, and colon of EHEC-infected mice. Additionally, CWA alleviated the EHEC-induced disruption of mucin-2 and goblet cells in the intestine. Interestingly, CWA increased the mucus layer thickness, which was associated with increasing expression of trefoil factor 3, in the jejunum of EHEC-infected mice. CWA increased the expression of tight junction proteins in the jejunum of EHEC-infected mice. Using intestinal epithelial cells and a Rac1 inhibitor in vitro, we demonstrated that the CWA-mediated increases in the tight junction proteins might depend on the Rac1 pathway. Furthermore, CWA improved the microbiota and short-chain fatty acid concentrations in the cecum of EHEC-infected mice. Although Enro and CWA had similar effects on intestinal inflammation, CWA was superior to Enro with regard to improving intestinal epithelial barrier and microbiota in the intestine. In conclusion, CWA attenuated EHEC-induced inflammation, intestinal epithelial barrier damage, and microbiota disruption in the intestine of mice, suggesting that CWA may be an effective therapy for many intestinal diseases.

The intestinal epithelial barrier is the first line of defense against the invasion of microbes and the associated LPS and toxins (1). The integrity of the epithelial barrier depends on the presence of the epithelium and the paracellular pathway, a complex network primarily controlled by the tight junction (TJ) between adjacent epithelial cells (1, 2). These TJs create a semipermeable barrier that prevents various substances that are present in the mucosa of the intestine from crossing the epithelium (3). Additionally, the mucins and antimicrobial proteins that cover the surface of the intestinal epithelium are the primary defense against pathogen attachment to and invasion of epithelial cells. Furthermore, they play important roles in maintaining the integrity of the intestinal epithelial barrier (4, 5). Impaired epithelial barrier function disrupts immune homeostasis and increases inflammation in the intestine, and disruption of this barrier function is associated with many intestinal diseases, such as inflammatory bowel disease (IBD) and enteric pathogen infection (2, 6).

Antibiotics have been widely used to treat intestinal diseases during recent decades. However, antibiotic resistance is a growing threat to the effective treatment of bacterial infections in both humans and animals, making the treatment of patients difficult or even impossible. Moreover, few new antibacterial agents are being developed, and few have been approved by the Food and Drug Administration in the past few years, particularly those to treat Gram-negative enteric bacteria (7). Moreover, recent studies have demonstrated that antibiotic exposure early in life has long-term consequences on intestinal homeostasis and epithelial barrier function (8, 9). For instance, antibiotics disrupt the expression of TJ proteins, mucins, and antimicrobial proteins in the intestine (10). These findings make the search for effective and safe antimicrobial agents urgent.

Antimicrobial peptides are short cationic molecules (12–50 aa) with amphipathic structures, and these molecules play essential roles in host defense against microbial infection (11, 12). Bacteria do not easily develop resistance against antimicrobial peptides because of the membrane-disrupting mechanisms of these molecules (13). Cathelicidin peptides, one family of antimicrobial peptides, not only exhibit antimicrobial activities (14) but they also function as immune regulators, thereby modulating immune responses in the host (12, 15). For instance, LL-37 attracts T cells, neutrophils, mast cells, and macrophages and modulates LPS-induced inflammation by binding to LPS or directly perturbing the MyD88 signaling pathway. Recent studies have shown that cathelicidin peptides have protective effects on intestinal epithelial barrier function by increasing the expression of TJ proteins (16, 17). Cathelicidin-WA (CWA), a novel cathelicidin peptide from snakes, has been shown to exhibit strong antimicrobial activities against Gram-negative enteric bacteria (18, 19). Additionally, CWA can attenuate intestinal inflammation via immune regulation, independently of its antibacterial activity (10, 14). Furthermore, in weaned piglets, CWA improves intestinal epithelial barrier function by increasing the expression of TJ proteins (10).

Enterohemorrhagic Escherichia coli (EHEC) is an enteric pathogen that leads to nondiarrhea mediated by intestinal epithelial barrier disruptions during weaning period (2). Previous studies have shown that EHEC infection induced the perturbation of TJ proteins in C57BL/6 mice and in the colon-derived cell line T84 (20, 21). However, the effects of CWA on EHEC-induced intestinal epithelial barrier disruption and the underlying mechanisms remain unknown. Thus, this study investigated whether CWA could be an effective therapy for EHEC infection and explored the effects of CWA on epithelial barrier function in the intestine of EHEC-infected mice and the underlying mechanisms.

The CWA peptide was synthesized and purified (≥95%) by GL Biochem (Shanghai, China) as previously described (22) and dissolved in sterile saline before injection. TRIzol reagent, DMEM-F12 medium (Invitrogen, Carlsbad, CA), FBS (Life Technologies, Grand Island, NY), and SYBR Green master mix (Roche, Switzerland) were used. Rabbit polyclonal Abs for zonula occludens (ZO)-1, occludin, GAPDH, and β-actin were purchased from Abcam (Cambridge, MA). Rabbit polyclonal Abs for mucin (MUC)-1 and MUC-2 were from GeneTex (Irvine, CA). Rabbit polyclonal Ab for Rac1 was purchased from Proteintech (Rosemont, IL). The secondary Abs used for the immunostaining were goat anti-rabbit IgG conjugated with HRP, goat anti-rabbit IgG labeling with FITC, and goat anti-rabbit IgG labeling with Cy3 (Abcam). The specific Rac1 inhibitor (NSC 23766) was purchased from Selleck Chemicals (Houston, TX). EHEC O157:H7 ATCC43889 was provided by Dr. W. Fang (Zhejiang University).

Female 3-wk-old C57BL/6 mice were obtained from the Laboratory Animal Center of the Chinese Academy of Sciences (Shanghai, China). All mice were maintained in plastic cages and housed in the same temperature- and humidity-controlled room on a 12 h light/dark cycle with free access to feed and water throughout the experimental period (Laboratory Animal Center of Zhejiang University, Hangzhou, China). The mice were orally administered 0.1 ml of PBS (control) or 0.1 ml of PBS containing 1 × 108 CFU of EHEC O157:H7 after the 3-d equilibration period. The EHEC O157:H7–infected mice were then treated by i.p. injection with sterile saline (EHEC), 5.46 mg/kg CWA (EHEC plus CWA), or 22.75 mg/kg enrofloxacin (Enro; EHEC plus Enro) once a day for 3 d. The doses of CWA and Enro were calculated based on our previous study (10). After 3 d, the mice were euthanized or reinfected, and the tissues were collected. The Animal Care and Use Committee of Zhejiang University approved all experiments, which were conducted in accordance with the Guidelines for the Care and Use of Animals for Research and Teaching at Zhejiang University.

The levels of the cytokine IL-6 in the serum, jejunum, and colon were determined using a mouse ELISA kit (Raybiotech, Norcross, GA), according to the manufacturer’s instructions. Total protein was extracted from the jejunum and colon with a lysis buffer (KeyGEN BioTECH, Nanjing, China), and the protein content in the supernatant was determined using a BCA protein assay kit (KeyGEN BioTECH), according to the manufacturer’s instructions.

The middle jejunum and middle colon of the mice were harvested and fixed in 4% paraformaldehyde and embedded in paraffin. Sections of 5-μm thickness were deparaffinized in xylene and stained with H&E. Images were obtained using a DM3000 microscope (Leica Microsystems, Wetzlar, Germany). The villous height and crypt depth of the jejunum were measured with Image-Pro software (Media Cybernetics, Rockville, MD).

Periodic acid–Schiff (PAS) staining was used to detect goblet cells and mucus layer thickness in the intestine (9). Sections of the middle jejunum and middle colon were collected and immediately fixed in methanol–Carnoy’s fixative at 4°C for 2 h and then transferred to 100% ethanol. Fixed intestinal tissues were embedded in paraffin. Sections of 5-μm thickness were deparaffinized and then stained with PAS. Images were captured using an Eclipse Ti-SR microscope with a DS-U3 Image-Pro system (Nikon, Tokyo, Japan).

Paraformaldehyde-fixed and paraffin-embedded sections of the jejunum and colon were used for immunofluorescence. Briefly, sections of 5-μm thickness were deparaffinized and rehydrated and then processed for Ag retrieval. The sections were then incubated in 3% hydrogen dioxide for 20 min in the dark. Then, the sections were incubated with primary Abs (1:200 dilution) specific for ZO-1, MUC-1, and MUC-2. Fluorescently labeled Abs were used as secondary Abs (1:50 dilution). Nuclei were stained with DAPI. Images of immunofluorescent sections were captured using an Eclipse Ti-SR microscope with a DS-U3 Image-Pro system (Nikon).

Total RNA was extracted from intestinal tissues using TRIzol reagent. The purity and yield of the RNA were evaluated using NanoDrop 2000 (Thermo Fisher Scientific). RNA (2 μg) was used to generate cDNA in a volume of 20 μl. Real-time PCR was performed with SYBR Green master mix using a StepOnePlus real-time PCR system (Applied Biosystems) as previously described (23). The primers for the real-time PCR are listed in Table I. GAPDH and β-actin were used as housekeeping genes in this study. The relative mRNA expression of the target genes was determined using the 2−ΔΔCt method.

Table I.
Primers for gene expression using real-time PCR
GeneSequence (5′→3′)Size (bp)GenBank No.
Relmβ F: CTGATAGTCCCAGGGAACGC 124 NM_023881.4 
R: GTCTGCCAGAAGACGTGACA 
TFF3 F: CCTGGTTGCTGGGTCCTCTG 133 NM_011575.2 
R: GCCACGGTTGTTACACTGCTC 
GAPDH F: GAGAAACCTGCCAAGTATGATGAC 212 NM_008084.3 
R: TAGCCGTATTCATTGTCATACCAG 
β-Actin F: GTGACGTTGACATCCGTAAAGA 245 NM_007393.5 
 R: GCCGGACTCATCGTACTCC 245  
GeneSequence (5′→3′)Size (bp)GenBank No.
Relmβ F: CTGATAGTCCCAGGGAACGC 124 NM_023881.4 
R: GTCTGCCAGAAGACGTGACA 
TFF3 F: CCTGGTTGCTGGGTCCTCTG 133 NM_011575.2 
R: GCCACGGTTGTTACACTGCTC 
GAPDH F: GAGAAACCTGCCAAGTATGATGAC 212 NM_008084.3 
R: TAGCCGTATTCATTGTCATACCAG 
β-Actin F: GTGACGTTGACATCCGTAAAGA 245 NM_007393.5 
 R: GCCGGACTCATCGTACTCC 245  

F, forward; R, reverse.

Approximately 30 μg of protein was separated using 10% SDS-PAGE and then transferred onto nitrocellulose membranes. The membranes were incubated with primary Abs overnight at 4°C after blocking with 5% skimmed milk powder, and then incubated with secondary Abs for 1 h at room temperature. Primary Abs specific for β-actin, GAPDH, ZO-1, occludin, MUC-1, MUC-2, and Rac-1 were used in this study. Ab binding to blots was detected using ECL (CliNX, Shanghai, China). Intensity was quantified using ImageJ software.

Genomic DNA was extracted from the cecal contents of mice using a fecal DNA kit (SimGEN, Hangzhou, China), and the purity and yield of the DNA were quantified using a NanoDrop 2000 spectrophotometer as previously described (24). The V4 region of the 16S rRNA gene was amplified with 515F and 806R primers. Twenty-four samples (n = 6) were sequenced on an Illumina HiSeq PE250 platform provided by Novogene (Beijing, China). Paired-end reads from the original DNA fragments were merged using FLASH. Clustering was performed using the UPARSE pipeline, and sequences were assigned to operational taxonomic units at 97% similarity. The diversity and composition of the bacterial communities were determined by α diversity and β diversity according to Novogene’s recommendations.

Concentrations of short-chain fatty acids (SCFAs) in the cecal contents of mice were determined using GC-8A gas chromatography (Shimadzu, Kyoto, Japan). Briefly, the cecal contents were weighed and mixed with 1 ml of double distilled H2O. After centrifuging at 12,000 × g at 4°C for 15 min, the supernatant was collected and mixed with 85% orthophosphoric acid (20 μl/ml) for 1 h at 4°C. After centrifuging at 12,000 × g at 4°C for 15 min, the supernatant was collected and transferred into a gas chromatography vial to detect SCFA concentrations by GC-8A as previously described (25). SCFA concentrations were normalized to the weight of the cecal contents.

After the mice had been treated as described in the “Animals” section above, six mice from the control, EHEC plus Enro, and EHEC plus CWA groups were randomly selected. After 3 d of treatment, all of the selected mice were orally reinfected with 1 × 108 CFU of EHEC O157:H7. After 24 h, the mice were euthanized, and their livers and spleens were collected and homogenized in cold PBS. The numbers of CFUs were determined by plating serial dilutions on Luria–Bertani agar plates.

Intestinal porcine epithelial cells from the jejunum (IPEC-J2) were cultured in DMEM-F12 medium supplemented with 10% FBS (Life Technologies). Cells were incubated at 37°C in a humidified 5% CO2 incubator. The monolayers were grown and the cells were passaged by digestion, and 1 × 107 cells were cultured in each well of six-well plates. After incubation for 24 h, the IPEC-J2 cells were treated with PBS, 20 μg/ml CWA, 50 μM NSC 23766 (specific Rac1 inhibitor), or 20 μg/ml CWA with 50 μM NSC 23766 for 12 h. A proportion of the cells was then collected and treated with lysis buffer to extract the total protein for Western blotting. The remainder of the cells were washed three times with D-Hanks’ solution and then infected with 1 × 106 CFU of EHEC O157:H7 in each well for 1 h. After washing three times with PBS, the cells were collected for colony counting as described previously (26). Human intestinal epithelial cells (NCM460 cell line) were used to perform experiments as above. The toxic activity of CWA on NCM460 cells was determined by kits of MTT and lactate dehydrogenase.

Statistical analyses were performed via a one-way ANOVA followed by a Duncan multiple range test or a Fisher least significant difference test with SPSS 16.0 (SPSS, Chicago, IL). All data were expressed as the mean ± SEM. The differences were considered to be significant at p < 0.05.

We found that CWA effectively attenuated the morbidity and weight loss caused by EHEC O157:H7 infection, as did Enro (Fig. 1A, 1B). Then, we investigated the effects of CWA and Enro on EHEC-induced intestinal colitis in mice and found that CWA and Enro attenuated EHEC-induced villous atrophy and crypt hyperplasia in the jejunum (Fig. 1C). Compared with the EHEC group, the EHEC plus CWA group had an increased villous height and a decreased crypt depth in the jejunum, whereas the EHEC plus Enro group had only a decreased crypt depth (Fig. 1D, 1E). Additionally, we found that CWA and Enro attenuated the colonic colitis caused by EHEC infection (Fig. 1F). Furthermore, CWA and Enro significantly decreased EHEC-induced IL-6 production in the serum, jejunum, and colon (Fig. 1G, 1I). However, no significant differences were observed between the EHEC plus CWA and EHEC plus Enro groups with regard to intestinal morphology or IL-6 production. Taken together, these data indicate that CWA might be an effective alternative to antibiotics for the treatment of EHEC O157:H7 infection.

FIGURE 1.

CWA attenuated clinical symptoms and intestinal inflammation during the pathological process of EHEC-induced colitis. Percentage survival (A) and body weight changes (B) of mice (n = 12/group) up to day 4 after EHEC infection. (C) Representative images of the jejunum stained with H&E (scale bar, 500 μm). The villous height (D) and crypt depth (E) of the jejunum were measured. (F) Representative images of the colon stained with H&E (scale bar, 100 μm). The levels of the proinflammatory cytokine IL-6 in the serum (G), jejunum (H), and colon (I) determined via ELISA. All of the data are expressed as the mean ± SEM (n = 6), representative of three independent experiments. Differences were determined via a one-way ANOVA followed by a Duncan multiple range test. *p < 0.05, #p < 0.05 compared with control.

FIGURE 1.

CWA attenuated clinical symptoms and intestinal inflammation during the pathological process of EHEC-induced colitis. Percentage survival (A) and body weight changes (B) of mice (n = 12/group) up to day 4 after EHEC infection. (C) Representative images of the jejunum stained with H&E (scale bar, 500 μm). The villous height (D) and crypt depth (E) of the jejunum were measured. (F) Representative images of the colon stained with H&E (scale bar, 100 μm). The levels of the proinflammatory cytokine IL-6 in the serum (G), jejunum (H), and colon (I) determined via ELISA. All of the data are expressed as the mean ± SEM (n = 6), representative of three independent experiments. Differences were determined via a one-way ANOVA followed by a Duncan multiple range test. *p < 0.05, #p < 0.05 compared with control.

Close modal

The protein expression of MUC-1 and MUC-2 in the intestine of mice was detected via Western blotting. The results showed that the protein expression of MUC-1 was not influenced by the different treatments either in the jejunum or in the colon (Fig. 2A, 2B). However, the protein expression of MUC-2 was decreased in the jejunum but increased in the colon of the EHEC group compared with the control group. Functionally, CWA and Enro effectively attenuated the EHEC-induced changes to MUC-2 expression in the jejunum and colon. Additionally, CWA was superior to Enro regarding increased protein expression of MUC-2 in the jejunum of EHEC-infected mice. Furthermore, the immunofluorescence results confirmed the effect of CWA on the EHEC-induced disruption of MUC-2 expression in the intestine (Fig. 2C).

FIGURE 2.

CWA regulated the MUC-2 expression in the intestine of EHEC-infected mice. (A and B) The protein expression of MUC-1 and MUC-2 in the jejunum (A) and colon (B) were detected via Western blot, and the intensity of the bands was determined using ImageJ. (C) Representative immunostaining for MUC-2 in the jejunum and colon (original magnification ×200). All of the data are expressed as the mean ± SEM (n = 6), representative of three independent experiments. Differences were determined via a one-way ANOVA followed by a Duncan multiple range test. *p < 0.05, #p < 0.05 compared with control.

FIGURE 2.

CWA regulated the MUC-2 expression in the intestine of EHEC-infected mice. (A and B) The protein expression of MUC-1 and MUC-2 in the jejunum (A) and colon (B) were detected via Western blot, and the intensity of the bands was determined using ImageJ. (C) Representative immunostaining for MUC-2 in the jejunum and colon (original magnification ×200). All of the data are expressed as the mean ± SEM (n = 6), representative of three independent experiments. Differences were determined via a one-way ANOVA followed by a Duncan multiple range test. *p < 0.05, #p < 0.05 compared with control.

Close modal

To verify the effects of CWA on MUC-2, we investigated the effects of CWA on the goblet cells and mucus layer in the intestine using PAS staining. The results showed that CWA and Enro significantly attenuated EHEC-induced increases in goblet cells in the colon (Fig. 3A, 3B). However, the goblet cells were significantly decreased in number in the jejunum in the EHEC group compared with that in the control group, and CWA significantly increased the number of goblet cells in the jejunum of the EHEC-infected mice (Fig. 3C, 3D). Interestingly, CWA effectively attenuated the EHEC-induced decreases in mucus layer thickness in the jejunum (Fig. 3C, 3E). Furthermore, we investigated the effects of CWA on the goblet cell–specific proteins resistin-like molecule β (Relmβ) and trefoil factor 3 (TFF3), which play important roles in organizing and repairing the mucus layer in the intestine (Table I). We found that CWA significantly increased the mRNA expression of Relmβ and TFF3 in the jejunum of EHEC-infected mice (Fig. 3F, 3G). However, EHEC infection or EHEC infection followed by Enro treatment did not affect the Relmβ and TFF3 expression in the jejunum of mice. These data suggest that CWA regulates mucus layer function, and is therefore associated with modulating the goblet cells, in the intestine during EHEC infection.

FIGURE 3.

CWA modulated the goblet cells and mucus layer function in the intestine of EHEC-infected mice. (A) Representative images of the colon stained with PAS. (B) The number of goblet cells per microscopic field original magnification ×200) in the colon of mice was determined. (C) Representative images of the jejunum stained with PAS. Arrow points to goblet cell; white bars indicate mucus layer thickness. Scale bars, 20 μm. (D) The number of goblet cells per microscopic field (original magnification ×200) and (E) the mucus layer thickness in the jejunum of mice were determined. (F and G) The relative mRNA expression of Relmβ (F) and TFF3 (G) in the jejunum of mice, detected using quantitative PCR. All of the data are expressed as the mean ± SEM (n = 6), representative of three independent experiments. Differences were determined via a one-way ANOVA followed by a Duncan multiple range test. *p < 0.05, #p < 0.05 compared with control.

FIGURE 3.

CWA modulated the goblet cells and mucus layer function in the intestine of EHEC-infected mice. (A) Representative images of the colon stained with PAS. (B) The number of goblet cells per microscopic field original magnification ×200) in the colon of mice was determined. (C) Representative images of the jejunum stained with PAS. Arrow points to goblet cell; white bars indicate mucus layer thickness. Scale bars, 20 μm. (D) The number of goblet cells per microscopic field (original magnification ×200) and (E) the mucus layer thickness in the jejunum of mice were determined. (F and G) The relative mRNA expression of Relmβ (F) and TFF3 (G) in the jejunum of mice, detected using quantitative PCR. All of the data are expressed as the mean ± SEM (n = 6), representative of three independent experiments. Differences were determined via a one-way ANOVA followed by a Duncan multiple range test. *p < 0.05, #p < 0.05 compared with control.

Close modal

We also evaluated the effects of CWA on epithelial barrier function in the jejunum by detecting TJ protein expression. The Western blot results showed that EHEC infection decreased the protein expression of ZO-1 and occludin in the jejunum (Fig. 4A). Compared with the EHEC group, the EHEC plus CWA group had increased protein expression of ZO-1 and occludin in the jejunum, whereas the EHEC plus Enro group had increased protein expression of only ZO-1. Additionally, the protein expression of occludin in the jejunum of the EHEC plus CWA group was higher than that in the jejunum of the EHEC plus Enro group. The immunofluorescence results confirmed that CWA attenuated the EHEC-induced decreases in ZO-1 protein expression in the jejunum (Fig. 4B). Furthermore, we investigated the effects of CWA on the TJ expression in intestinal epithelial cells in vitro and the underlying mechanism. We found that CWA increased the protein expression of ZO-1 and occludin in IPEC-J2 cells (Fig. 4C). In the presence of a selective Rac1 inhibitor (NSC 23766), the increase in TJ protein expressions mediated by CWA was suppressed. Consequently, the Rac1 inhibitor also suppressed the CWA-mediated improvements to the defense of IPEC-J2 cells against EHEC adhesion and invasion (Fig. 4D). These results were confirmed in the NCM460 cells (Supplemental Fig. 1). We found that CWA had little effect on the survival rate and lactate dehydrogenase release rate of the NCM460 cells, suggesting that CWA has low toxicity on human intestinal cells (Supplemental Fig. 1A, 1B). These data indicate that the regulation of TJ proteins by CWA might be mediated by the Rac1 pathway in intestinal epithelial cells.

FIGURE 4.

CWA increased the expression of tight junction proteins in the intestine. (A) The expression of the tight junction proteins ZO-1 and occludin in the jejunum of mice was determined via Western blot, and the intensity of the bands was detected using ImageJ. (B) Representative immunostaining for ZO-1 in the jejunum (original magnification ×200). (C and D) IPEC-J2 cells were treated with PBS, 20 μg/ml CWA, 50 μM NSC 23766 (specific Rac1 inhibitor), or 20 μg/ml CWA with 50 μM NSC 23766 for 12 h. (C) Then, the IPEC-J2 cells were collected for Western blot analysis. (D) Alternatively, after washing with D-Hanks’ solution, the IPEC-J2 cells were infected with 1 × 106 CFU of EHEC O157:H7 for 1 h and then washed with PBS. The cells were then collected for colony counting. All of the data are expressed as the mean ± SEM (n = 6), representative of at least three independent experiments. Differences were determined via a one-way ANOVA followed by a Duncan multiple range test. #p < 0.05 compared with control, *p < 0.05.

FIGURE 4.

CWA increased the expression of tight junction proteins in the intestine. (A) The expression of the tight junction proteins ZO-1 and occludin in the jejunum of mice was determined via Western blot, and the intensity of the bands was detected using ImageJ. (B) Representative immunostaining for ZO-1 in the jejunum (original magnification ×200). (C and D) IPEC-J2 cells were treated with PBS, 20 μg/ml CWA, 50 μM NSC 23766 (specific Rac1 inhibitor), or 20 μg/ml CWA with 50 μM NSC 23766 for 12 h. (C) Then, the IPEC-J2 cells were collected for Western blot analysis. (D) Alternatively, after washing with D-Hanks’ solution, the IPEC-J2 cells were infected with 1 × 106 CFU of EHEC O157:H7 for 1 h and then washed with PBS. The cells were then collected for colony counting. All of the data are expressed as the mean ± SEM (n = 6), representative of at least three independent experiments. Differences were determined via a one-way ANOVA followed by a Duncan multiple range test. #p < 0.05 compared with control, *p < 0.05.

Close modal

Next, we evaluated the effects of CWA and Enro on the microbiota composition in the cecum of mice using Illumina sequencing of the 16S rRNA V4 region. Firmicutes, Bacteroidetes, and Proteobacteria were the three most abundance bacterial phyla in all samples, and both CWA and Enro decreased the EHEC-induced increases of Bacteroidetes (Fig. 5A). The genera Aeromonas, Ruminococcaceae_UCG-014, and Roseburia were more prevalent in the EHEC plus CWA group, but the genera Coprococcus_1, Anaerotruncus, Oscillibacter, Intestinimonas, Desulfovibrio, Marvinbryantia, unidentified_Ruminococcaceae, and Tyzzerella were more prevalent in the EHEC plus Enro group (Fig. 5B). Additionally, using nonmetric multidimensional scaling analysis, we found that samples of the EHEC plus Enro group formed a unique cluster and separated from the other groups (Fig. 5C), suggesting that Enro may have adverse effects on shaping microbial composition. Least discriminant analysis effect size analysis was used to search for statistically different bacteria between the EHEC plus CWA group and the EHEC plus Enro group. We found that the relative abundance of Rikenellaceae, Alistipes, Bacilli, Lactobacillales, Lactobacillus, Prevotellaceae, and Alloprevotella in the EHEC plus CWA group were significantly higher than those of the EHEC plus Enro group (Fig. 5D). Furthermore, in terms of SCFAs, EHEC infection significantly decreased acetate, propionate, and butyrate concentrations (Fig. 5E). The concentrations of acetate and propionate in the cecum of the EHEC plus CWA group recovered to that of the control group. Collectively, these data suggest that CWA and Enro have different effects on bacterial community and SCFAs in the cecum of EHEC-infected mice.

FIGURE 5.

CWA and Enro exhibited different effects on bacterial community and the SCFA levels in the cecum. The bacterial communities of the cecum of mice were investigated using Illumina sequencing of the 16S rRNA gene (n = 6). (A) Relative abundance of the most abundant bacterial phyla. (B) Heat map constructed with the top 35 genera. (C) Nonmetric multidimensional scaling (NMDS) based on operational taxonomic unit levels. (D) Significantly different biomarkers of EHEC.CWA group compared with EHEC.Enro group using the least discriminant analysis effect size. (E) The concentrations of acetate, propionate, and butyrate in the cecal contents were determined using gas chromatography, and the data were normalized as micromoles per gram cecal content weight (mean ± SEM; n = 6; representative of three independent experiments). #p < 0.05 compared with control by a one-way ANOVA followed by a Duncan multiple range test. EHEC.CWA, EHEC plus CWA; EHEC.Enro, EHEC plus Enro.

FIGURE 5.

CWA and Enro exhibited different effects on bacterial community and the SCFA levels in the cecum. The bacterial communities of the cecum of mice were investigated using Illumina sequencing of the 16S rRNA gene (n = 6). (A) Relative abundance of the most abundant bacterial phyla. (B) Heat map constructed with the top 35 genera. (C) Nonmetric multidimensional scaling (NMDS) based on operational taxonomic unit levels. (D) Significantly different biomarkers of EHEC.CWA group compared with EHEC.Enro group using the least discriminant analysis effect size. (E) The concentrations of acetate, propionate, and butyrate in the cecal contents were determined using gas chromatography, and the data were normalized as micromoles per gram cecal content weight (mean ± SEM; n = 6; representative of three independent experiments). #p < 0.05 compared with control by a one-way ANOVA followed by a Duncan multiple range test. EHEC.CWA, EHEC plus CWA; EHEC.Enro, EHEC plus Enro.

Close modal

Both CWA and Enro effectively attenuated EHEC-induced increased bacteria transfer to the liver and spleen at 3 d after first infection (Fig. 6A). To further compare the intestinal barrier function of the mice treated with CWA and Enro, we selected mice from the control, EHEC plus Enro, and EHEC plus CWA groups to reinfect with EHEC O157:H7. We found that after a second infection, more bacteria were present in the spleen and liver of Enro-treated mice than those of untreated mice or CWA-treated mice (Fig. 6B). However, no significant differences were found between the CWA-treated mice and the untreated mice during the second EHEC O157:H7 infection. These data indicate that the CWA-treated mice might have had a better defense against bacterial infection than did antibiotic-treated mice.

FIGURE 6.

CWA improved host defense against a second EHEC infection. (A) The number of CFU of the bacteria transfer to the liver and spleen at 3 d after first infection. (B) Six mice per group were randomly selected from the control, EHEC plus Enro, and EHEC plus CWA groups and orally challenged by second EHEC infection. The liver and spleen tissues were collected for colony counting. All of the data are expressed as the mean ± SEM (n = 6), representative of three independent experiments. Differences were determined via a one-way ANOVA followed by a Fisher least significance different test. **p < 0.01, ***p < 0.001.

FIGURE 6.

CWA improved host defense against a second EHEC infection. (A) The number of CFU of the bacteria transfer to the liver and spleen at 3 d after first infection. (B) Six mice per group were randomly selected from the control, EHEC plus Enro, and EHEC plus CWA groups and orally challenged by second EHEC infection. The liver and spleen tissues were collected for colony counting. All of the data are expressed as the mean ± SEM (n = 6), representative of three independent experiments. Differences were determined via a one-way ANOVA followed by a Fisher least significance different test. **p < 0.01, ***p < 0.001.

Close modal

Intestinal mucositis usually occurs during pathogen infection. This study showed that CWA attenuates EHEC-induced intestinal inflammation, epithelial barrier damage, and microbiota disruption in the intestine of mice. We found that CWA improves intestinal epithelial barrier function through the modulation of goblet cells, mucus layer thickness, Muc-2 production, and TJ protein expression. We also demonstrated that CWA increased TJ protein expression via a Rac1-dependent pathway in intestinal epithelial cells. Our results suggest that CWA is a potential therapy for EHEC infection or other intestinal diseases.

The major function of intestinal goblet cells and mucins is the formation of the mucus layers that cover the surface of the intestinal epithelium and play an important role in protecting the integrity of the intestinal epithelial barrier (5). This study found that CWA significantly attenuates the EHEC-induced disruption of MUC-2 and mucus layer thickness in the intestine of mice. The mucus layer is permeable to bacteria and not firmly attached to the epithelial cells in the jejunum (27). EHEC administered orally can perturb the mucus layer replenished by the goblet cells in the jejunum. Similarly, the mucus layer is disrupted in patients with IBD (28). The mucus of both the small intestine and colon is primarily formed by MUC-2 (29). Decreases in the mucus layer in patients with ulcerative colitis are related to decreases in MUC-2 production (30). MUC-2 production is decreased in the colon of mice with dextran sodium sulfate (DSS)–induced colitis (31). In this study, EHEC infection increased MUC-2 production and was associated with an increase in goblet cells in the colon. However, CWA effectively attenuated the EHEC-induced disruption of MUC-2 production in the jejunum and colon. Consistent with this finding, previous studies have shown that antimicrobial peptides such as porcine β defensin 2 and Cathelicidin-BF attenuate the DSS-induced disruption of mucin expression in the intestine of mice (3, 14). These data suggest that CWA modulates goblet cell function and MUC-2 production in the intestine. Given that Relmβ and TFF3 play important roles in organizing the mucin layer and in mucosa repair (32, 33), we also investigated the effects of CWA on the expression of Relmβ and TFF3 in the intestine. Interestingly, we found that CWA increased the mRNA levels of Relmβ and TFF3 in the jejunum of EHEC-infected mice. Collectively, these data suggest that CWA improves mucus layer function by modulating Muc-2 production in the intestine.

TJs are the most apical intercellular structures in the mucosa of the intestine and create semipermeable barriers that restrict the invasion of harmful substances (3). ZO-1 and occludin are important TJ proteins in intestinal epithelial cells. Previous studies have shown that EHEC infection altered TJ protein expression and increased intestinal permeability in the intestine of mice (21). Consistent with this finding, we found that EHEC infection decreased the protein expression of ZO-1 and occludin in the jejunum of mice in this study. However, CWA attenuated the EHEC-induced disruption of ZO-1 and occludin expression in the jejunum of mice. A previous study showed that CWA increased TJ protein expressions and improved intestinal barrier function in the jejunum of weaned piglets with clinical diarrhea (10). Additionally, other cathelicidin peptides such as Cathelicidin-BF increased the expression of ZO-1 and occludin in the intestine of mice with DSS-induced colitis (14). Furthermore, defensins, another major family of antimicrobial peptides, also increased TJ protein expression and intestinal epithelial barrier function in the intestine of mice (3). Taken together, these data suggest that CWA increases TJ protein expression and improves epithelial barrier function in the intestine.

The mechanisms of TJ protein regulation are complex and involve many signaling pathways. Recent studies have suggested that the Rho signaling pathway plays important roles in the antimicrobial peptide–mediated regulation of TJ proteins (3436). Rho is a member of the small G protein superfamily, serving as a molecular switch controlling numerous biological functions. More than 20 Rho family members are known, including RhoA, Racl, and Cdc42. Many studies have shown that Rac1 activation enhances epithelial barrier function (34, 3739). For instance, human β-defensin-3 promotes Rac1 activation and increases TJ protein expression (35). Moreover, LL-37 can enhance epithelial barrier function by regulating Rac1 activation (36). Consistent with this finding, this study demonstrated that CWA increases TJ protein expression and enhances intestinal epithelial barrier function via a Rac1-dependent pathway. These data suggest that CWA increases TJ protein expression via the Rac1 signaling pathway, thereby enhancing epithelial barrier function in the intestine.

Epithelial barrier damage and immune-mediated disorders are usually related to disruptions in the microbial composition of the host’s intestine that occur during pathogen infection. With Illumina sequencing of the 16S rRNA gene, we found that Enro treatment formed a unique cluster and separated from the other groups in the bacterial communities of the cecum, suggesting that antibiotics treatment may have distinct effects on microbial composition. Previous studies also showed that antibiotic treatments can alter the intestinal microbial composition, intestinal mucus layer, and intestinal TJ protein expression, as well as host susceptibility to pathogen infection (9, 4042). Given the differential effects of CWA and Enro on the function of the intestinal epithelial barrier and microbiota, we also investigated the defense of CWA- or Enro-treated mice against a second EHEC infection. We consistently found that in Enro-treated mice more bacteria were present in the spleen and liver during the second EHEC infection than was the case in CWA-treated mice, suggesting that CWA-treated mice might have a better defense against the second bacterial infection than do antibiotic-treated mice. Although antibiotics have been widely and effectively used to treat diseases during past decades, antibiotic resistance is a growing threat to the effective treatment of bacterial infections in both humans and animals. Previous studies also showed that antibiotic exposure may disrupt the balance of intestinal microbial and intestinal barrier function in the host (41, 42). In this study, CWA and Enro were equally effective in saving life and preventing body weight loss, but we found that CWA had better improvements of intestinal epithelial barrier function and microbial composition. Although much work is still needed, these data indicate that CWA may be an effective and safe alternative to antibiotics.

In conclusion, CWA effectively attenuated inflammation, epithelial barrier damage, and microbial composition disruption in the intestine of EHEC O157:H7–infected mice. Given its effects on inflammation, the epithelial barrier, and the microbiota, CWA might be an effective and safe therapy for many intestinal diseases such as pathogen infection and IBD.

We thank Caihua Yu and Zhenshun Gan for assistance with feeding mice.

This work was supported by National Science Fund for Distinguished Young Scholars of China Grant 31025027 and by Modern Agro-Industry Technology Research System of China Grant CARS-36.

The online version of this article contains supplemental material.

Abbreviations used in this article:

CWA

Cathelicidin-WA

DSS

dextran sodium sulfate

EHEC

enterohemorrhagic Escherichia coli

Enro

enrofloxacin

IBD

inflammatory bowel disease

IPEC-J2

intestinal porcine epithelial cell from the jejunum

MUC

mucin

PAS

periodic acid–Schiff

Relmβ

resistin-like molecule β

SCFA

short-chain fatty acid

TFF3

trefoil factor 3

TJ

tight junction

ZO

zonula occludens.

1
Farhadi
A.
,
Banan
A.
,
Fields
J.
,
Keshavarzian
A.
.
2003
.
Intestinal barrier: an interface between health and disease.
J. Gastroenterol. Hepatol.
18
:
479
497
.
2
Lu
R. Y.
,
Yang
W. X.
,
Hu
Y. J.
.
2014
.
The role of epithelial tight junctions involved in pathogen infections.
Mol. Biol. Rep.
41
:
6591
6610
.
3
Han
F.
,
Zhang
H.
,
Xia
X.
,
Xiong
H.
,
Song
D.
,
Zong
X.
,
Wang
Y.
.
2015
.
Porcine β-defensin 2 attenuates inflammation and mucosal lesions in dextran sodium sulfate-induced colitis.
J. Immunol.
194
:
1882
1893
.
4
Gallo
R. L.
,
Hooper
L. V.
.
2012
.
Epithelial antimicrobial defence of the skin and intestine.
Nat. Rev. Immunol.
12
:
503
516
.
5
Johansson
M. E. V.
,
Hansson
G. C.
.
2011
.
Keeping bacteria at a distance.
Science
334
:
182
183
.
6
Landy
J.
,
Ronde
E.
,
English
N.
,
Clark
S. K.
,
Hart
A. L.
,
Knight
S. C.
,
Ciclitira
P. J.
,
Al-Hassi
H. O.
.
2016
.
Tight junctions in inflammatory bowel diseases and inflammatory bowel disease associated colorectal cancer.
World J. Gastroenterol.
22
:
3117
3126
.
7
Rabanal
F.
,
Grau-Campistany
A.
,
Vila-Farres
X.
,
Gonzalez-Linares
J.
,
Borras
M.
,
Vila
J.
,
Manresa
A.
,
Cajal
Y.
.
2015
.
A bioinspired peptide scaffold with high antibiotic activity and low in vivo toxicity.
Sci. Rep.
5
:
10558
.
8
Cho
I.
,
Yamanishi
S.
,
Cox
L.
,
Methé
B. A.
,
Zavadil
J.
,
Li
K.
,
Gao
Z.
,
Mahana
D.
,
Raju
K.
,
Teitler
I.
, et al
.
2012
.
Antibiotics in early life alter the murine colonic microbiome and adiposity.
Nature
488
:
621
626
.
9
Wlodarska
M.
,
Willing
B.
,
Keeney
K. M.
,
Menendez
A.
,
Bergstrom
K. S.
,
Gill
N.
,
Russell
S. L.
,
Vallance
B. A.
,
Finlay
B. B.
.
2011
.
Antibiotic treatment alters the colonic mucus layer and predisposes the host to exacerbated Citrobacter rodentium-induced colitis.
Infect. Immun.
79
:
1536
1545
.
10
Yi
H.
,
Zhang
L.
,
Gan
Z.
,
Xiong
H.
,
Yu
C.
,
Du
H.
,
Wang
Y.
.
2016
.
High therapeutic efficacy of Cathelicidin-WA against postweaning diarrhea via inhibiting inflammation and enhancing epithelial barrier in the intestine.
Sci. Rep.
6
:
25679
.
11
Pasupuleti
M.
,
Schmidtchen
A.
,
Malmsten
M.
.
2012
.
Antimicrobial peptides: key components of the innate immune system.
Crit. Rev. Biotechnol.
32
:
143
171
.
12
Brogden
K. A.
,
Ackermann
M.
,
McCray
P. B.
 Jr.
,
Tack
B. F.
.
2003
.
Antimicrobial peptides in animals and their role in host defences.
Int. J. Antimicrob. Agents
22
:
465
478
.
13
Giuliani
A.
,
Pirri
G.
,
Nicoletto
S. F.
.
2007
.
Antimicrobial peptides: an overview of a promising class of therapeutics.
Cent. Eur. J. Biol.
2
:
1
33
.
14
Zhang
H.
,
Xia
X.
,
Han
F.
,
Jiang
Q.
,
Rong
Y.
,
Song
D.
,
Wang
Y.
.
2015
.
Cathelicidin-BF, a novel antimicrobial peptide from Bungarus fasciatus, attenuates disease in a dextran sulfate sodium model of colitis.
Mol. Pharm.
12
:
1648
1661
.
15
Gill
E. E.
,
Franco
O. L.
,
Hancock
R. E. W.
.
2015
.
Antibiotic adjuvants: diverse strategies for controlling drug-resistant pathogens.
Chem. Biol. Drug Des.
85
:
56
78
.
16
Tai
E. K. K.
,
Wu
W. K. K.
,
Wang
X. J.
,
Wong
H. P. S.
,
Yu
L.
,
Li
Z. J.
,
Lee
C. W.
,
Wong
C. C. M.
,
Yu
J.
,
Sung
J. J. Y.
, et al
.
2013
.
Intrarectal administration of mCRAMP-encoding plasmid reverses exacerbated colitis in Cnlp−/− mice.
Gene Ther.
20
:
187
193
.
17
Otte
J. M.
,
Zdebik
A. E.
,
Brand
S.
,
Chromik
A. M.
,
Strauss
S.
,
Schmitz
F.
,
Steinstraesser
L.
,
Schmidt
W. E.
.
2009
.
Effects of the cathelicidin LL-37 on intestinal epithelial barrier integrity.
Regul. Pept.
156
:
104
117
.
18
Wang
Y.
,
Hong
J.
,
Liu
X.
,
Yang
H.
,
Liu
R.
,
Wu
J.
,
Wang
A.
,
Lin
D.
,
Lai
R.
.
2008
.
Snake cathelicidin from Bungarus fasciatus is a potent peptide antibiotics.
PLoS One
3
:
e3217
.
19
Liu
Y.
,
Luan
C.
,
Xia
X.
,
An
S.
,
Wang
Y.
.
2011
.
Antibacterial activity, cytotoxicity and mechanisms of action of cathelicidin peptides against enteric pathogens in weaning piglets.
Int. J. Pept. Res. Ther.
17
:
175
184
.
20
Howe
K. L.
,
Reardon
C.
,
Wang
A.
,
Nazli
A.
,
McKay
D. M.
.
2005
.
Transforming growth factor-β regulation of epithelial tight junction proteins enhances barrier function and blocks enterohemorrhagic Escherichia coli O157:H7-induced increased permeability.
Am. J. Pathol.
167
:
1587
1597
.
21
Roxas
J. L.
,
Koutsouris
A.
,
Bellmeyer
A.
,
Tesfay
S.
,
Royan
S.
,
Falzari
K.
,
Harris
A.
,
Cheng
H.
,
Rhee
K. J.
,
Hecht
G.
.
2010
.
Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner.
Lab. Invest.
90
:
1152
1168
.
22
Song
D.
,
Zong
X.
,
Zhang
H.
,
Wang
T.
,
Yi
H.
,
Luan
C.
,
Wang
Y.
.
2015
.
Antimicrobial peptide Cathelicidin-BF prevents intestinal barrier dysfunction in a mouse model of endotoxemia.
Int. Immunopharmacol.
25
:
141
147
.
23
Yi
H.
,
Jiang
D.
,
Zhang
L.
,
Xiong
H.
,
Han
F.
,
Wang
Y.
.
2016
.
Developmental expression of STATs, nuclear factor-κB and inflammatory genes in the jejunum of piglets during weaning.
Int. Immunopharmacol.
36
:
199
204
.
24
Gao
Y.
,
Han
F.
,
Huang
X.
,
Rong
Y.
,
Yi
H.
,
Wang
Y.
.
2013
.
Changes in gut microbial populations, intestinal morphology, expression of tight junction proteins, and cytokine production between two pig breeds after challenge with Escherichia coli K88: a comparative study.
J. Anim. Sci.
91
:
5614
5625
.
25
Wang
B.
,
Mao
S. Y.
,
Yang
H. J.
,
Wu
Y. M.
,
Wang
J. K.
,
Li
S. L.
,
Shen
Z. M.
,
Liu
J. X.
.
2014
.
Effects of alfalfa and cereal straw as a forage source on nutrient digestibility and lactation performance in lactating dairy cows.
J. Dairy Sci.
97
:
7706
7715
.
26
Iimura
M.
,
Gallo
R. L.
,
Hase
K.
,
Miyamoto
Y.
,
Eckmann
L.
,
Kagnoff
M. F.
.
2005
.
Cathelicidin mediates innate intestinal defense against colonization with epithelial adherent bacterial pathogens.
J. Immunol.
174
:
4901
4907
.
27
Atuma
C.
,
Strugala
V.
,
Allen
A.
,
Holm
L.
.
2001
.
The adherent gastrointestinal mucus gel layer: thickness and physical state in vivo.
Am. J. Physiol. Gastrointest. Liver Physiol.
280
:
G922
G929
.
28
Hoebler
C.
,
Gaudier
E.
,
De Coppet
P.
,
Rival
M.
,
Cherbut
C.
.
2006
.
MUC genes are differently expressed during onset and maintenance of inflammation in dextran sodium sulfate-treated mice.
Dig. Dis. Sci.
51
:
381
389
.
29
Corfield
A. P.
,
Myerscough
N.
,
Longman
R.
,
Sylvester
P.
,
Arul
S.
,
Pignatelli
M.
.
2000
.
Mucins and mucosal protection in the gastrointestinal tract: new prospects for mucins in the pathology of gastrointestinal disease.
Gut
47
:
589
594
.
30
Myerscough
N.
,
Warren
B.
,
Gough
M.
,
Corfield
A.
.
1995
.
Expression of mucin genes in ulcerative colitis.
Biochem. Soc. Trans.
23
:
536S
.
31
Faure
M.
,
Moënnoz
D.
,
Montigon
F.
,
Mettraux
C.
,
Mercier
S.
,
Schiffrin
E. J.
,
Obled
C.
,
Breuillé
D.
,
Boza
J.
.
2003
.
Mucin production and composition is altered in dextran sulfate sodium-induced colitis in rats.
Dig. Dis. Sci.
48
:
1366
1373
.
32
Artis
D.
,
Wang
M. L.
,
Keilbaugh
S. A.
,
He
W.
,
Brenes
M.
,
Swain
G. P.
,
Knight
P. A.
,
Donaldson
D. D.
,
Lazar
M. A.
,
Miller
H. R. P.
, et al
.
2004
.
RELMβ/FIZZ2 is a goblet cell-specific immune-effector molecule in the gastrointestinal tract.
Proc. Natl. Acad. Sci. USA
101
:
13596
13600
.
33
Ge
H.
,
Gardner
J.
,
Wu
X.
,
Rulifson
I.
,
Wang
J.
,
Xiong
Y.
,
Ye
J.
,
Belouski
E.
,
Cao
P.
,
Tang
J.
, et al
.
2015
.
Trefoil factor 3 (TFF3) is regulated by food intake, improves glucose tolerance and induces mucinous metaplasia.
PLoS One
10
:
e0126924
.
34
Schlegel
N.
,
Meir
M.
,
Spindler
V.
,
Germer
C. T.
,
Waschke
J.
.
2011
.
Differential role of Rho GTPases in intestinal epithelial barrier regulation in vitro.
J. Cell. Physiol.
226
:
1196
1203
.
35
Kiatsurayanon
C.
,
Niyonsaba
F.
,
Smithrithee
R.
,
Akiyama
T.
,
Ushio
H.
,
Hara
M.
,
Okumura
K.
,
Ikeda
S.
,
Ogawa
H.
.
2014
.
Host defense (antimicrobial) peptide, human β-defensin-3, improves the function of the epithelial tight-junction barrier in human keratinocytes.
J. Invest. Dermatol.
134
:
2163
2173
.
36
Akiyama
T.
,
Niyonsaba
F.
,
Kiatsurayanon
C.
,
Nguyen
T. T.
,
Ushio
H.
,
Fujimura
T.
,
Ueno
T.
,
Okumura
K.
,
Ogawa
H.
,
Ikeda
S.
.
2014
.
The human cathelicidin LL-37 host defense peptide upregulates tight junction-related proteins and increases human epidermal keratinocyte barrier function.
J. Innate Immun.
6
:
739
753
.
37
Wojciak-Stothard
B.
,
Ridley
A. J.
.
2002
.
Rho GTPases and the regulation of endothelial permeability.
Vascul. Pharmacol.
39
:
187
199
.
38
Wojciak-Stothard
B.
,
Tsang
L. Y.
,
Haworth
S. G.
.
2005
.
Rac and Rho play opposing roles in the regulation of hypoxia/reoxygenation-induced permeability changes in pulmonary artery endothelial cells.
Am. J. Physiol. Lung Cell. Mol. Physiol.
288
:
L749
L760
.
39
Halbleib
J. M.
,
Sääf
A. M.
,
Brown
P. O.
,
Nelson
W. J.
.
2007
.
Transcriptional modulation of genes encoding structural characteristics of differentiating enterocytes during development of a polarized epithelium in vitro.
Mol. Biol. Cell
18
:
4261
4278
.
40
Sekirov
I.
,
Tam
N. M.
,
Jogova
M.
,
Robertson
M. L.
,
Li
Y.
,
Lupp
C.
,
Finlay
B. B.
.
2008
.
Antibiotic-induced perturbations of the intestinal microbiota alter host susceptibility to enteric infection.
Infect. Immun.
76
:
4726
4736
.
41
Wlodarska
M.
,
Finlay
B. B.
.
2010
.
Host immune response to antibiotic perturbation of the microbiota.
Mucosal Immunol.
3
:
100
103
.
42
Brandl
K.
,
Plitas
G.
,
Mihu
C. N.
,
Ubeda
C.
,
Jia
T.
,
Fleisher
M.
,
Schnabl
B.
,
DeMatteo
R. P.
,
Pamer
E. G.
.
2008
.
Vancomycin-resistant enterococci exploit antibiotic-induced innate immune deficits.
Nature
455
:
804
807
.

The authors have no financial conflicts of interest.

Supplementary data