Monocytes and macrophages (MΦs) play a central role in the pathogenesis of chronic hepatitis C virus (HCV) infection. The tissue microenvironment triggers monocyte differentiation into MΦs, with polarization ranging within the spectrum of M1 (classical) to M2 (alternative) activation. Recently, we demonstrated that HCV infection leads to monocyte differentiation into polarized MΦs that mediate stellate cell activation via TGF-β. In this study, we aimed to identify the viral factor(s) that mediate monocyte-to-MΦ differentiation. We performed coculture experiments using healthy monocytes with exosome-packaged HCV, cell-free HCV, or HCV ssRNA. Coculture of monocytes with exosome-packaged HCV, cell-free HCV, or HCV ssRNA induced differentiation into MΦs with high M2 surface marker expression and production of pro- and anti-inflammatory cytokines. The HCV ssRNA–induced monocyte activation and differentiation into MΦs could be prevented by TLR7 or TLR8 knockdown. Furthermore, TLR7 or TLR8 stimulation, independent of HCV, caused monocyte differentiation and M2 MΦ polarization. In vivo, in chronic HCV–infected patients, we found increased expression of TLR7/8 in circulating monocytes that was associated with increased intracellular expression of procollagen. Furthermore, knockdown of TLR8 completely attenuated collagen expression in monocytes exposed to HCV, and knockdown of TLR7 partially attenuated this expression, suggesting roles for TLR7/8 in induction of fibrocytes in HCV infection. We identified TLR7/8 as mediators of monocyte differentiation and M2 MΦ polarization during HCV infection. Further, we demonstrated that HCV ssRNA and other TLR7/8 ligands promote MΦ polarization and generation of circulating fibrocytes.

According to recent estimates by the World Health Organization, ∼185 million people are chronically infected with hepatitis C virus (HCV), and >350,000 people die annually from HCV-related liver diseases (1, 2). HCV establishes chronicity in 50–80% of infected individuals, leading to liver inflammation and fibrosis. Recent advances in HCV treatment has led to the development of new drugs that can achieve a sustained virological response in >95% of patients (3, 4). During its lifecycle, HCV generates ssRNA and dsRNA that are ligands for pattern recognition receptors, TLRs, and RNA helicase receptors that are expressed by innate immune cells (5, 6). Monocytes and macrophages (MΦs) sense ssRNA by TLR7/8, whereas dsRNA is recognized by TLR3 and RIG-I localized in endosomes and cytosol (711).

Monocytes and MΦs are the primary mediators of the inflammatory response during HCV infection, in which overproduction of TNF-α and abnormal levels of IL-1, IL-10, and TGF-β influence the natural history of HCV infection (5, 12, 13). MΦs possess functional plasticity that is mediated by microenvironment signals and can exist in any combinatorial spectrum of classically activated (M1) and alternatively activated (M2) populations (1416). M1 MΦs have the role of effector cells in Th1 cellular immune responses. LPS and IFN-γ (Th1 cytokine) polarize MΦs toward the M1 phenotype, which induces the MΦ to produce large amounts of TNF, IL-12, and IL-23, which drive Ag-specific Th1 and Th17 cell inflammatory responses (17). M1 MΦs express CD86, MHC class II, CD40, and CD16 molecules as surface markers (18, 19). M2 MΦs are involved in tissue repair and immunosuppression. MΦs exposed to the Th2 cytokine IL-4 differentiate into an M2 phenotype, with production of high levels of IL-10 and IL-1RA and low expression of IL-12. M2 MΦs also express high levels of scavenger (CD163), mannose (CD206), and galactose receptors and help with parasite clearance, reduce inflammation, and serve as immunoregulators by promoting tissue remodeling and tumor progression (14, 1719). Little is known about the role of MΦ polarization in HCV infection.

During HCV infection, TLR2 and TLR6–10 are upregulated in monocytes (20, 21). HCV core and NS proteins are important pathogen-associated molecular patterns (PAMPs) for TLR2 and TLR4, whereas TLR7/8 sense HCV ssRNA, and TLR3 senses HCV dsRNA. HCV core and NS3 proteins stimulate TLR2 when associated with TLR1 and TLR6 in PBMCs, particularly monocytes and MΦs (22, 23). There is also increased TLR7/8 expression on monocytes during HCV infection, thus underscoring the importance of TLR expression in monocytes/MΦs in HCV-mediated pathogenesis (23, 24).

In the current study, we investigated the viral factors responsible for monocyte differentiation and MΦ polarization in HCV infection in vitro and in vivo. We evaluated changes in the phenotype and function of healthy monocytes cultured in the presence of cell-free HCV, exosome-packaged HCV, or single-stranded viral RNA. We show that exosome-packaged HCV or single-stranded viral RNA can mediate changes in the monocytes similar to that of cell-free HCV. We also demonstrate that TLR7/8 ligands, independent of HCV, can program monocytes to differentiate into M2-polarized MΦs with features of fibrocytes. Our results also indicate a role for TLR7/8 in chronic HCV infection in the generation of polarized MΦs, as well as fibrocytes.

Huh7.5 cells (a gift from Dr. Charles M. Rice, Rockefeller University, New York, NY) were maintained in low-glucose DMEM containing 10% FBS (HyClone, Logan, UT) and 10 μg/ml ciprofloxacin and supplemented with nonessential amino acids (Life Technologies, Grand Island, NY). Dr. Takaji Wakita (National Institute of Infectious Diseases, Tokyo, Japan) provided the Japanese fulminant hepatitis 1 (JFH-1) (HCV) construct. HCV supernatants were collected from Huh7.5 cells highly infected with JFH-1 HCV cell-culture–derived and determined by flow cytometry, as previously described (25). The supernatant was passed through 0.22-μm filters and concentrated 20–30 times using an Amicon Ultra-15 100 K centrifugal filter unit (Millipore, Billerica, MA), and virus stock was preserved at −80°C (25). HCV JFH-1 virus concentration in culture supernatants was determined using NanoSight LM10 (multiplicity of infection of infectious viral particles or infectious exosomes) and by quantitative real-time PCR, as previously described (26). Uninfected Huh7.5 cell supernatant concentrate was used as control. For exosome isolation from the cell culture supernatant, the cells were cultured using exosome-depleted FBS (System Bioscience, Mountain View, CA). Primary human hepatocytes (PHHs) were obtained from the National Institutes of Health Liver Tissue Cell Distribution System (Minneapolis, MN; Pittsburgh, PA; Richmond, VA) and were maintained in hepatocyte maintenance medium (Lonza, Allendale, NJ). PHHs were infected with concentrated JFH-1 virions, and half of the medium was changed every 24 h during the experiment. Cells were harvested at different time points, and HCV RNA levels were determined. PHHs infected with HCV had detectable viral RNA (Supplemental Fig. 2A). Human peripheral blood was collected, with written informed consent, from healthy donors and chronic HCV–infected patients (Table I) with approval from the Institutional Review Board for Protection of Human Subjects in Research at the University of Massachusetts Medical School.

Table I.
Clinical characteristics of the HCV-infected patients
Sample No.GenotypeViral Load (IU/ml)Fibrosis Stage
1a 23,683 NA 
193,056 Grade 4/4 
1a 3,295,884 Grade 3/4 
1a NA Grade 4/4 
1a 492,468 Grade 3/4 
1a 505,346 NA 
1a 2,508,472 Grade 2/4 
1a 275,850 Grade 1/4 
Sample No.GenotypeViral Load (IU/ml)Fibrosis Stage
1a 23,683 NA 
193,056 Grade 4/4 
1a 3,295,884 Grade 3/4 
1a NA Grade 4/4 
1a 492,468 Grade 3/4 
1a 505,346 NA 
1a 2,508,472 Grade 2/4 
1a 275,850 Grade 1/4 

NA, not available.

Polyinosinic-polycytidylic acid (PolyI:C), Gardiquimod, ssRNA40, PolyI:C/LyoVec, and LyoVec (vehicle control) were purchased from InvivoGen (San Diego, CA). The following human Abs were purchased from eBioscience (San Diego, CA): CD16-allophycocyanin, CD16-FITC, CD14-FITC, CD40-FITC, and CD86-FITC. Abs CD14-allophycocyanin, CD14-PE, CD40 PE-Cy7, CD163-PE, CD11c-allophycocyanin, CD68-PE, CD206-allophycocyanin, and DC-SIGN–FITC and isotype-control Abs were purchased from BD Pharmingen (Franklin Lakes, NJ). Human Abs CD40–Alexa Fluor 700, CD68 PE-Cy7, Brilliant Violet LAP (TGF-β), CD206-PE, and CD16–Alexa Fluor 700 were purchased from BioLegend (San Diego, CA). A Transwell-6 system with a 0.4-μm porous membrane was purchased from BD Biosciences (Franklin Lakes, NJ). TLR3 and TLR7/8 small interfering RNA (siRNA) and scrambled siRNA were purchased from Ambion Life Technologies (Carlsbad, CA).

Monocytes were isolated to >95% purity from PBMCs using CD14 MicroBeads, an MS Column, and a MiniMACS Separator and confirmed by flow cytometry, as described previously (27). Cells were cultured in RPMI 1640 medium (Life Technologies) supplemented with 10% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin, and nonessential amino acids. Huh7.5 or Huh7.5/JFH-1 cells (48 h postinfection) were plated in 12-well plates (2.5 × 105 cells per well) and cocultured with monocytes (5 × 105 cells) in a 37°C, 5% CO2 incubator for 3–7 d. For Transwell experiments, Huh7.5 or Huh7.5/JFH-1 cells were cultured on Transwell inserts and monocytes were seeded on the bottom chamber of six-well plates. Monocytes were treated with HCV concentrate, Huh7.5 concentrate, or exosomes for 7 d. Monocytes were stimulated with PolyI:C (1 μg/ml), Gardiquimod (1 μg/ml), ssRNA40 (1 μg/ml), PolyI:C/LyoVec (1 μg/ml), LyoVec (1 μg/ml), or M-CSF (50 ng/ml). Supernatants, cells, and RNA were collected from all of these experiments at the indicated time points, and surface markers, cytokines, and gene expression were studied.

Exosomes were isolated and purified from cell lines and patient samples as described previously (26, 28). Huh7.5 cells and Huh7.5 cells infected with JFH-1 (HCV) (Huh7.5/JFH-1) were maintained in DMEM (low glucose) supplemented with 10% exosome-depleted FBS and 1% penicillin/streptomycin. Cell culture supernatants, following cell infection or not, or patient serum samples were collected, centrifuged at 2500 rpm for 10 min at 4°C to remove cell debris, and filtered through a 0.2-μm filter. For exosome isolation, 40 ml of filtered culture supernatant was concentrated to a final volume of 1 ml using the Amicon Ultra-15 Centrifugal Filter Unit with Ultracel-100 membrane (Millipore). Concentrated culture supernatants or filtered patient sera (500 μl) were mixed with the appropriate volume of ExoQuick-TC reagent or ExoQuick (System Bioscience), respectively, for exosome isolation. Samples were gently mixed and incubated for 1 h at 4°C, and exosomes were precipitated by centrifugation at 1400 rpm for 10 min at 4°C. The recovered exosomes were resuspended in 1× PBS. Positive selection of exosomes was done using anti-CD63 immunomagnetic capturing with primary anti-CD63 Ab (Abcam, Cambridge, MA), followed by the corresponding secondary Ab coupled to magnetic beads (Miltenyi Biotec, Cambridge, MA). A MidiMACS separator was used with LD columns for exosome isolation, as previously described (26, 28).

Monocytes (5 × 106) were resuspended in 100 μl (25°C) of Human Monocyte Nucleofector Solution (Amaxa Biosciences, Gaithersburg, MD). pmaxGFP (provided by Amaxa as a positive control), TLR3, TLR7, or TLR8 siRNA, or scrambled siRNA (20 nM) was mixed with this (100 μl) cell suspension and transferred into an Amaxa-certified cuvette. Nucleofection was performed using Y-01 program in a Nucleofector II Device (Amaxa Biosciences). Following nucleofection, the monocytes were transferred to six-well plates, incubated for 48 h, and cocultured in the presence of Huh and HCV concentrate for 5 d. The monocytes were harvested after 5 d, and RNA was extracted for real-time PCR.

Viral concentrate was permeabilized with 0.1% saponin or left untreated for 15 min on ice. Additionally, the viral concentrate was treated with 1 U/ml of RNase A for 1 h at 37°C. The viral concentrate was washed several times, and viral RNA levels were measured by quantitative real-time PCR (29).

Cytokines TNF-α and IL-1β were quantified in cell culture supernatant using commercially available ELISA kits from BD Biosciences, whereas IL-10 and TGF-β were quantified using ELISA kits from eBioscience.

RNA was extracted using an RNeasy Mini Kit (QIAGEN, Valencia, CA) and two-step real-time PCR, as described previously (25) (Table II). The level of the target gene expression was measured by Δ-Δ cycle threshold values using the ratio of the fold change in target gene expression/fold change in reference gene expression (18S).

Table II.
Primer sequences for real-time PCR
Gene SymbolForward Primer (5′–3′)Reverse Primer (5′–3′)
TLR-3 GTGCCAGAAACTTCCCATGT TCCAGCTGAACCTGAGTTCC 
TLR-7 AATGTCACAGCCGTCCCTAC GCGCATCAAAAGCATTTACA 
TLR-8 TGTGATGGTGGTGCTTCAAT ATGCCCCAGAGGCTATTTCT 
COL1A GGCGGCCAGGGCTCCGAC AATTCCTGGTCTGGGGCACC 
RIG-I GCATATTGACTGGACGTGGCA CAGTCATGGCTGCAGTTCTGTC 
IL-28A AGGGCCAAAGATGCCTTAGA TCCAGAACCTTCCAGCGTCAG 
IL-28B TAAGAGGGCCAAAGATGCCTT CTGGTCCAAGACATCCCCC 
IL-29 GCCCCCAAAAAGGAGTCCG AGGTTCCCATCGGCCACATA 
IFN-β ATGACCAACAAGTGTCTCCTCC GCTCATGGAAAGAGCTGTAGTG 
18s GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG 
Gene SymbolForward Primer (5′–3′)Reverse Primer (5′–3′)
TLR-3 GTGCCAGAAACTTCCCATGT TCCAGCTGAACCTGAGTTCC 
TLR-7 AATGTCACAGCCGTCCCTAC GCGCATCAAAAGCATTTACA 
TLR-8 TGTGATGGTGGTGCTTCAAT ATGCCCCAGAGGCTATTTCT 
COL1A GGCGGCCAGGGCTCCGAC AATTCCTGGTCTGGGGCACC 
RIG-I GCATATTGACTGGACGTGGCA CAGTCATGGCTGCAGTTCTGTC 
IL-28A AGGGCCAAAGATGCCTTAGA TCCAGAACCTTCCAGCGTCAG 
IL-28B TAAGAGGGCCAAAGATGCCTT CTGGTCCAAGACATCCCCC 
IL-29 GCCCCCAAAAAGGAGTCCG AGGTTCCCATCGGCCACATA 
IFN-β ATGACCAACAAGTGTCTCCTCC GCTCATGGAAAGAGCTGTAGTG 
18s GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG 

Plasmids pBSII-core, pBSII-E1-p7, pBSII-HCVNS-3′ untranslated region (UTR), and pCMV-NS5A, containing cDNA inserts of HCV-core, E1/E2/p7, a 6.6-kb insert spanning partial NS2 through NS5B, and the entire 3′ UTR sequences and NS5A sequences, respectively, were used (25) HCV ssRNA were synthesized in vitro from linearized vectors using T7 (for positive-strand RNAs of core, E1-P7, NS–3′ UTR, and negative strand of NS5A RNA) and T3 (for negative-strand RNAs of core, E1-P7, NS–3′ UTR, and positive strand of NS5A RNA) MEGAscript Kits (Ambion). The control RNA was generated from the pTRI-Xef control template, which is a linearized TRIPLEscript plasmid containing the 1.85-kb Xenopus elongation factor 1α gene under the transcriptional control of tandem T7 and T3 promoters. Viral ssRNA (5 μg/ml) was transfected in human monocytes using a TransIT-mRNA Transfection Kit (Mirus Bio, Madison, WI).

To analyze cell surface marker expression, monocytes were immunostained for 30 min at 4°C using the appropriate Ab or isotype control, as described previously (25). Monocytes were identified on the basis of CD14 expression, and the expression of other cell surface markers was analyzed on CD14+ cells.

For fibrocyte detection, monocytes from healthy controls and HCV-infected patients’ peripheral blood were immune stained with anti-CD206–allophycocyanin and anti-CD14–FITC. The cells were washed, fixed, and permeabilized with a Cytofix/Cytoperm Kit (BD Pharmingen). Cells were incubated with rat anti-human procollagen-Iα or isotype control, washed, and stained with PE-conjugated secondary Ab. The samples were acquired on a BD LSR II (BD Biosciences, San Jose, CA), and data were analyzed with FlowJo software (TreeStar, Ashland, OR).

All values are expressed as mean ± SEM obtained from three or more independent experiments. The Student t test and one-way or two-way ANOVA were used to compare means of multiple groups. A p value < 0.05 was considered statistically significant. GraphPad Prism software (GraphPad, La Jolla, CA) was used for statistical analyses.

The liver tissue environment provides a close interaction between infected hepatocytes and immune cells. We evaluated the effect of coculture of HCV-infected primary hepatocytes on healthy monocytes and found a significant increase in the expression of the MΦ activation markers CD14, CD68, and CD11c (Fig. 1A, Supplemental Fig. 1A). Furthermore, these MΦs have increased expression of the M2 MΦ markers CD206, CD163, and DC-SIGN (Fig. 1C, Supplemental Fig. 1C) but not a significant change in the M1 MΦ markers CD16, CD40, and CD86 (Fig. 1B, Supplemental Fig. 1B) (18, 19). As shown in Supplemental Fig. 1, there was no significant increase in M1 surface markers at earlier time points when cocultured with infected hepatocytes compared with uninfected hepatocytes. This indicated that HCV-infected primary hepatocytes programmed monocytes to differentiate into MΦs with predominantly M2 polarization (Fig. 1A–C). To demonstrate that the monocytes isolated from healthy controls are capable of differentiating into M1 or M2 MΦs, we treated the monocytes with M1- or M2-differentiating agents. As shown in Supplemental Fig. 1D, we observed increased expression of the M1 markers CD16 and CD40 with LPS and IFN-γ treatment. Increased expression of CD14 and CD68 was observed with IFN-γ plus LPS and IL-4 stimulation. IL-4 stimulation led to increased expression of the M2 markers CD206 and CD163. Previous studies indicate that M2 MΦs produce TGF-β and promote tissue repair and fibrosis that are characteristics of liver pathology in chronic HCV infection (14, 16, 27). Thus, we investigated the cytokine production profile of HCV-exposed MΦs.

FIGURE 1.

Monocytes cocultured with HCV-infected PHHs differentiated into polarized MΦs. Monocytes were isolated from healthy donors and cocultured with HCV-infected or uninfected PHHs. Cells were harvested and immunophenotyped for MΦ markers by flow cytometry. Expression of MΦ markers CD14, CD68, and CD11c (A), M1 MΦ markers CD16, CD40, and CD86 (B), and M2 MΦ markers CD206, CD163, and DC-SIGN (C). (D and E) The cell culture supernatant was measured for the various cytokines. Levels of TNF-α, IL-1β, IL-10, and TGF-β in the cell culture supernatants of infected or uninfected PHHs with the healthy monocytes. (F) Levels of TNF-α, IL-1β, IL-10, and TGF-β in the HCV-infected or uninfected PHHs. The data are representative of three independent experiments. *p ≤ 0.05.

FIGURE 1.

Monocytes cocultured with HCV-infected PHHs differentiated into polarized MΦs. Monocytes were isolated from healthy donors and cocultured with HCV-infected or uninfected PHHs. Cells were harvested and immunophenotyped for MΦ markers by flow cytometry. Expression of MΦ markers CD14, CD68, and CD11c (A), M1 MΦ markers CD16, CD40, and CD86 (B), and M2 MΦ markers CD206, CD163, and DC-SIGN (C). (D and E) The cell culture supernatant was measured for the various cytokines. Levels of TNF-α, IL-1β, IL-10, and TGF-β in the cell culture supernatants of infected or uninfected PHHs with the healthy monocytes. (F) Levels of TNF-α, IL-1β, IL-10, and TGF-β in the HCV-infected or uninfected PHHs. The data are representative of three independent experiments. *p ≤ 0.05.

Close modal

Monocytes produced increased levels of TNF-α and IL-1β when cocultured with HCV-infected hepatocytes (Fig. 1D). IL-10 and TGF-β levels were also significantly elevated (Fig. 1E). Thus, cytokine secretion by monocytes cocultured in the presence of HCV-infected hepatocytes revealed M1/M2 cytokine-secretion patterns, supporting a mixed M1/M2 cytokine profile with an M2 surface marker expression phenotype.

We isolated RNA from the PHHs that were infected or not and studied the expression of type I IFN (IFN-β) and type III IFNs (IFN-λ [IL-29], IFN-λ2 [IL-28A], and IFN-λ3 [IL-28B]). Consistent with previous studies, we observed an increased expression of type I and type III IFNs in the PHHs infected with HCV (Supplemental Fig. 2B). However, in the absence of monocytes, primary hepatocyte supernatants had low levels of M1/M2 cytokines (Fig. 1F).

Next, we used the Huh/JFH-1 system to explore the mechanism of MΦ polarization. To evaluate potential mechanisms by which HCV-infected hepatoma cells activate monocytes to differentiate into MΦs, we evaluated whether cell–cell contact was necessary. Separation of Huh7.5/JFH-1 cells from monocytes with a Transwell failed to inhibit HCV-induced MΦ differentiation and the surface marker expression or cytokine-secretion profiles of MΦs, indicating that Huh7.5/JFH-1 culture supernatant was sufficient for triggering monocyte-to-MΦ differentiation (Fig. 2A).

FIGURE 2.

Exosome-packaged HCV RNA induce monocyte differentiation and MΦ polarization. Monocytes were cocultured with Huh7.5 or Huh7.5/JFH-1 cells, with or without a Transwell, for 7 d. (A) Expression levels of CD14, CD68, CD206, and CD163 were determined by flow cytometry. TNF-α, IL-1β, IL-10, and TGF-β levels were measured in the culture supernatant. (B and C) Exosomes were isolated from Huh7.5 or Huh7.5/JFH-1 culture supernatant or from serum from control or naive HCV–infected patients. Viral RNA levels were determined by quantitative real-time PCR. (D) Monocytes were cultured in the presence of exosomes isolated from Huh7.5 or Huh7.5/JFH-1 culture supernatant or from serum from control or naive HCV–infected patients. Cells were harvested after 7 d, and CD14, CD68, CD206, and CD163 levels were measured by flow cytometry. (E) IL-1β and TGF-β levels were measured in the culture supernatant. (F) Monocytes were cultured in the presence of Huh7.5 culture supernatant concentrate or HCV concentrate for 7 d and immunostained for CD14, CD68, CD206, and CD163. TNF-α, IL-1β, IL-10, and TGF-β levels were measured by ELISA from culture supernatant. Data are mean ± SEM (n = 4–6). *p ≤ 0.05.

FIGURE 2.

Exosome-packaged HCV RNA induce monocyte differentiation and MΦ polarization. Monocytes were cocultured with Huh7.5 or Huh7.5/JFH-1 cells, with or without a Transwell, for 7 d. (A) Expression levels of CD14, CD68, CD206, and CD163 were determined by flow cytometry. TNF-α, IL-1β, IL-10, and TGF-β levels were measured in the culture supernatant. (B and C) Exosomes were isolated from Huh7.5 or Huh7.5/JFH-1 culture supernatant or from serum from control or naive HCV–infected patients. Viral RNA levels were determined by quantitative real-time PCR. (D) Monocytes were cultured in the presence of exosomes isolated from Huh7.5 or Huh7.5/JFH-1 culture supernatant or from serum from control or naive HCV–infected patients. Cells were harvested after 7 d, and CD14, CD68, CD206, and CD163 levels were measured by flow cytometry. (E) IL-1β and TGF-β levels were measured in the culture supernatant. (F) Monocytes were cultured in the presence of Huh7.5 culture supernatant concentrate or HCV concentrate for 7 d and immunostained for CD14, CD68, CD206, and CD163. TNF-α, IL-1β, IL-10, and TGF-β levels were measured by ELISA from culture supernatant. Data are mean ± SEM (n = 4–6). *p ≤ 0.05.

Close modal

The Transwell system that we used was with a 0.4-μm porous membrane (BD Biosciences) that prevented the transfer of vesicles larger than exosomes, as well as direct cell contact. Thus, we were interested in evaluating the contribution of HCV containing exosomes in monocyte differentiation. Recently, we demonstrated that exosomes derived from HCV-infected hepatocytes contain HCV RNA and can transfer HCV infection into naive hepatocytes (26). In this study, we found that exosomes isolated from the culture supernatant of Huh7.5/JFH-1 cells or from serum of HCV-infected patients contained HCV RNA (Fig. 2B, 2C). Thus, we tested whether exosomes isolated from the sera of HCV-infected patients and normal controls or from Huh7.5/JFH-1 cell supernatant could mediate monocyte-to-MΦ differentiation. Exosomes isolated from HCV-infected patient serum or from Huh7.5/JFH-1 cell supernatants led to increased expression of MΦ (CD14, CD68) and M2 (CD206, CD163) markers (Fig. 2D). We also observed significant IL-1β and TGF-β secretion from monocytes treated with the HCV RNA–containing exosomes (Fig. 2E). These results suggested that exosomes carrying viral RNA can induce monocyte differentiation and MΦ polarization during HCV infection.

In addition to exosome-packaged HCV, monocytes might be exposed to free HCV particles in the circulation and liver. We found that HCV concentrate isolated from culture supernatants of infected hepatoma cells directly induced the differentiation of monocytes into MΦs with increased expression of the MΦ markers CD14 and CD68. Further, surface expression of the M2 MΦ markers CD206 and CD163 was also significantly higher compared with the control (Fig. 2F). Cell-free HCV induced M1/M2 mixed cytokine production, as indicated by the increased secretion of proinflammatory (TNF-α and IL-1β) and anti-inflammatory (IL-10 and TGF-β) cytokines from the HCV-exposed MΦs (Fig. 2F). These results demonstrated that HCV isolates or hepatocyte-derived exosomes are mediators of monocyte differentiation and do not require cell–cell contact with HCV-infected hepatocytes.

HCV is an RNA virus; thus, we hypothesized that HCV RNA, as a PAMP, can provide signals for monocyte-to-MΦ differentiation as ssRNA via TLR7/8 or as a dsRNA via TLR3 or RIG-I. Monocytes were treated with LyoVec (control), PolyI:C (TLR3 ligand), Gardiquimod (TLR7), ssRNA40/LyoVec (TLR8 ligand), or PolyI:C/LyoVec (RIG-I ligand) for 7 d to assess the effect of direct PAMP stimulation on monocyte differentiation. TLR7/8 activation with Gardiquimod and ssRNA40/LyoVec, respectively, increased the expression of CD14 and CD68 on monocytes along with the M2 markers CD206 and CD163 (Fig. 3A, 3B). PolyI:C/LyoVec also increased the expression of CD68 and CD206 on monocytes, whereas PolyI:C increased the expression of CD206 (Fig. 3A, 3B).

FIGURE 3.

TLR7/8 ligand mimics the effect of HCV on monocyte differentiation Monocytes were treated with M-CSF, LyoVec, PolyI:C, Gardiquimod, ssRNA 40/LyoVec, or PolyI:C/LyoVec for 7 d. Differentiated monocytes were immunophenotyped for CD14 and CD68 (A) and CD206 and CD163 (B). TNF-α and IL-1β (C) and IL-10 and TGF-β levels (D) were measured in culture supernatants by ELISA. Data are mean ± SEM (n = 3–5). *p ≤ 0.05 versus medium control, δp ≤ 0.05 versus LyoVec (vehicle control).

FIGURE 3.

TLR7/8 ligand mimics the effect of HCV on monocyte differentiation Monocytes were treated with M-CSF, LyoVec, PolyI:C, Gardiquimod, ssRNA 40/LyoVec, or PolyI:C/LyoVec for 7 d. Differentiated monocytes were immunophenotyped for CD14 and CD68 (A) and CD206 and CD163 (B). TNF-α and IL-1β (C) and IL-10 and TGF-β levels (D) were measured in culture supernatants by ELISA. Data are mean ± SEM (n = 3–5). *p ≤ 0.05 versus medium control, δp ≤ 0.05 versus LyoVec (vehicle control).

Close modal

Secretion of TNF-α and IL-1β was increased significantly with ssRNA40/LyoVec treatment, as well as with Gardiquimod (not significantly, but it showed an increasing trend), but not with other TLR stimulations (Fig. 3C). IL-10 and TGF-β secretion was significantly elevated in the presence of Gardiquimod or ssRNA40/LyoVec (Fig. 3D). TGF-β levels were also induced with PolyI:C stimulation, but the levels were not significant. These results indicated that sustained and long-term TLR7/8 ligand activation leads to generation of MΦs, independent of HCV.

Chattergoon et al. (30) demonstrated the role of TLR7 in inflammasome activation in monocytes during HCV infection. Another study showed the role of TLR8 in recognizing HIV ssRNA by MΦs (31). Thus, we evaluated the functional role of TLR7/8 in HCV-mediated monocyte differentiation. We studied the expression of TLR3 and TLR7/8 mRNA levels in the monocytes cultured in the presence of HCV concentrate and observed increased expression of all three TLRs (Fig. 4A). Next, we tested whether inhibiting TLR3, TLR7, or TLR8 could prevent the effect of HCV on monocyte differentiation. Knockdown of a particular TLR did not significantly affect the levels of other TLRs, and transfection of TLR3-, TLR7-, or TLR8-specific siRNA knocked down their expression in monocytes (Supplemental Fig. 3). We found that TLR8, but not TLR3 or TLR7, siRNA transfection decreased the expression of CD68 and CD206 (Fig. 4B). Monocyte transfection with TLR8 siRNA prevented HCV-induced increases in TNF-α, IL-1β, IL-10, and TGF-β production (Fig. 4C, 4D). TLR7 siRNA transfection led to partial, but significant, reduction in the cytokine secretion compared with TLR8 knockdown (Fig. 4C, 4D). However, TLR3 siRNA transfection had no significant effect on the HCV-induced cytokine secretion (Fig. 4C, 4D). These data suggested that TLR7/8 activation is a central mechanism by which HCV triggers differentiation of monocytes into MΦs and that TLR7/8 activation triggers monocytes to differentiate into a M2 MΦ surface phenotype with a mixed M1/M2 cytokine-secretion profile.

FIGURE 4.

Knockdown of TLR7/8 affects HCV-mediated monocyte differentiation and MΦ polarization. Monocytes were treated with Huh7.5 or Huh7.5/JFH-1 concentrate or were left untreated. After 7 d, the total RNA was isolated, and cDNA were synthesized. PCR was performed for TLR3 and TLR7/8. (A) Bar graphs show the mRNA levels of TLR3 and TLR7/8. (BD) Monocytes were transfected with scrambled siRNA or with TLR3, TLR7, or TLR8 siRNA for 48 h, and the transfected monocytes were stimulated for 5 d with Huh7.5 or Huh7.5/JFH-1 concentrate. (B) Cell surface expression of CD68, CD16, and CD206 were assessed by flow cytometry. (C and D) Cell culture supernatant was assayed for TNF-α, IL-1β, IL-10, and TGF-β by ELISA. Data are mean ± SEM (n = 3–5). *p ≤ 0.05.

FIGURE 4.

Knockdown of TLR7/8 affects HCV-mediated monocyte differentiation and MΦ polarization. Monocytes were treated with Huh7.5 or Huh7.5/JFH-1 concentrate or were left untreated. After 7 d, the total RNA was isolated, and cDNA were synthesized. PCR was performed for TLR3 and TLR7/8. (A) Bar graphs show the mRNA levels of TLR3 and TLR7/8. (BD) Monocytes were transfected with scrambled siRNA or with TLR3, TLR7, or TLR8 siRNA for 48 h, and the transfected monocytes were stimulated for 5 d with Huh7.5 or Huh7.5/JFH-1 concentrate. (B) Cell surface expression of CD68, CD16, and CD206 were assessed by flow cytometry. (C and D) Cell culture supernatant was assayed for TNF-α, IL-1β, IL-10, and TGF-β by ELISA. Data are mean ± SEM (n = 3–5). *p ≤ 0.05.

Close modal

Because ssRNA40, a synthetic TLR8 ligand, mediated monocyte differentiation, we reasoned that HCV ssRNA would have the same effect. To test this hypothesis, we generated HCV ssRNA of various lengths and transfected those into healthy monocytes (Supplemental Fig. 4A). We studied the expression level of TLR7/8 and RIG-I in response to transfection of in vitro–generated ssRNA. As shown in Supplemental Fig. 4B, we observed the increased expression of TLR-7 and TLR-8, but not RIG-I, in the presence of HCV RNA and not control RNA. siRNA knockdown of TLR8 prevented HCV-induced phenotypic changes in monocytes (Fig. 4B). Although this experiment does not rule out an additional potential role for RIG-I, it supports our observations on the role of TLR8-mediated modulation of monocytes by HCV.

We also observed that HCV ssRNA induced the expression of CD14 and CD68 (Fig. 5A). We also observed an increased expression of the M2 markers CD206 and CD163 (Fig. 5A). Further, monocytes responded to HCV ssRNA by producing increased levels of TNF-α, IL-1β, and TGF-β (Fig. 5B). As shown in Fig. 5A and 5B, we did not observe a significant change in the phenotype and cytokine secretion of monocytes transfected with control RNA compared with unstimulated nontransfected (medium) cells. These observations identified HCV ssRNA as the PAMP that leads to TLR7/8 activation and monocyte-to-MΦ differentiation.

FIGURE 5.

HCV ssRNA mediates monocyte differentiation. Healthy monocytes were transfected with 5 μg/ml of different regions of HCV ssRNA or control RNA and cultured for 7 d. (A) Cell surface expression of CD14, CD68, CD206, and CD163 was measured by flow cytometry. (B) TNF-α, IL-1β, IL-10, and TGF-β levels were measured in culture supernatants by ELISA. (C) Viral concentrate consists of free HCV, single-stranded HCV RNA, and exosome-containing HCV. RNase treatment can degrade the single-stranded viral RNA, but not the enveloped HCV RNA, in a dose-dependent manner. Permeabilization and RNase treatment of viral concentrate degrades enveloped and nonenveloped viral RNA. (D) Viral concentrate was treated with 1 U/ml of RNase in the presence or absence of permeabilization buffer. The viral RNA levels were determined by quantitative real-time PCR. (E) Monocytes were cultured in the presence of viral concentrate with or without treatment. Cell surface expression of CD14, CD68, CD206, and CD163 was measured by flow cytometry. (F) TNF-α, IL-1β, IL-10, and TGF-β levels were measured in culture supernatants by ELISA. Data are mean ± SEM (n = 3).

FIGURE 5.

HCV ssRNA mediates monocyte differentiation. Healthy monocytes were transfected with 5 μg/ml of different regions of HCV ssRNA or control RNA and cultured for 7 d. (A) Cell surface expression of CD14, CD68, CD206, and CD163 was measured by flow cytometry. (B) TNF-α, IL-1β, IL-10, and TGF-β levels were measured in culture supernatants by ELISA. (C) Viral concentrate consists of free HCV, single-stranded HCV RNA, and exosome-containing HCV. RNase treatment can degrade the single-stranded viral RNA, but not the enveloped HCV RNA, in a dose-dependent manner. Permeabilization and RNase treatment of viral concentrate degrades enveloped and nonenveloped viral RNA. (D) Viral concentrate was treated with 1 U/ml of RNase in the presence or absence of permeabilization buffer. The viral RNA levels were determined by quantitative real-time PCR. (E) Monocytes were cultured in the presence of viral concentrate with or without treatment. Cell surface expression of CD14, CD68, CD206, and CD163 was measured by flow cytometry. (F) TNF-α, IL-1β, IL-10, and TGF-β levels were measured in culture supernatants by ELISA. Data are mean ± SEM (n = 3).

Close modal

To ascertain that the RNA from the viral concentrate was responsible for the monocyte differentiation and polarization, we cocultured monocytes with viral concentrate that was treated with RNase in the presence or absence of permeabilization buffer. RNase treatment destroys free RNA in the cell-free virus concentrate and isolates exosomes from HCV-infected Huh7.5 cells, but RNase along with permeabilization leads to RNA degradation of exosome-packaged and HCV-packaged RNA (Fig. 5C). Permeabilization of the virus along with RNase treatment resulted in undetectable levels of viral RNA (Fig. 5D) (26, 29). We evaluated MΦ marker expression in the coculture experiments and observed a significant reduction in the expression of CD14 and CD68 and the M2 markers CD163 and CD206 in the RNase-treated and permeabilized viral concentrate compared with untreated HCV concentrate (Fig. 5E). We also found a reduction in the proinflammatory (TNF-α, IL-1β) and anti-inflammatory (IL-10, TGF-β) secretion from MΦs that were cultured in the presence of RNase-treated and permeabilized viral concentrate compared with HCV concentrate alone (Fig. 5F). These results demonstrate that HCV ssRNA is the trigger for monocyte-to-MΦ differentiation and polarization.

Our in vitro results demonstrated the role of HCV ssRNA as a PAMP that mediated monocyte-to-MΦ differentiation and M2 marker expression via TLR7/8. Thus, we were interested in investigating whether TLR expression and M2 polarization also correlated with fibrocyte expression during HCV infection. We observed significant increases in the expression levels of TLR7/8 (and TLR3, to a lesser extent) in HCV patient monocytes compared with those from healthy controls (Table I) (Fig. 6A–C).

FIGURE 6.

TLR7/8 expression associated with collagen expression in monocytes during chronic HCV infection (AC) CD14+ monocytes from controls and HCV-infected patients were isolated, and the levels of TLR3 and TLR7/8 were determined by PCR. The data are representative of n = 5 (Controls) and n = 8 (HCV). (D) Monocytes were transfected with scrambled siRNA or with TLR3, TLR7, or TLR8 siRNA for 48 h and stimulated for 5 d with Huh7.5 or Huh7.5/JFH-1 concentrate. The levels of collagen mRNA were measured in the monocytes. (E) PBMCs isolated from controls and HCV-infected patients were immunophenotyped for the presence of fibrocytes (CD14+ procollagenIα+). The data are representative of n = 5 (Controls) and n = 8 (HCV). (F) Correlation of TLR7/8 expression with circulating fibrocyte levels of HCV-infected patients. (G) Working model of HCV-mediated monocyte differentiation and polarization. HCV-infected hepatocytes release virus that interacts with monocytes to induce differentiation into MΦs. These M2-like MΦs secrete pro- and anti-inflammatory cytokines. Early secretion of IL-1β facilitates the secretion of TGF-β, which leads to HSC activation. In vivo data reveal the presence of M2 marker–expressing monocytes in circulation of HCV-infected patients and collagen-expressing fibrocytes. *p ≤ 0.05.

FIGURE 6.

TLR7/8 expression associated with collagen expression in monocytes during chronic HCV infection (AC) CD14+ monocytes from controls and HCV-infected patients were isolated, and the levels of TLR3 and TLR7/8 were determined by PCR. The data are representative of n = 5 (Controls) and n = 8 (HCV). (D) Monocytes were transfected with scrambled siRNA or with TLR3, TLR7, or TLR8 siRNA for 48 h and stimulated for 5 d with Huh7.5 or Huh7.5/JFH-1 concentrate. The levels of collagen mRNA were measured in the monocytes. (E) PBMCs isolated from controls and HCV-infected patients were immunophenotyped for the presence of fibrocytes (CD14+ procollagenIα+). The data are representative of n = 5 (Controls) and n = 8 (HCV). (F) Correlation of TLR7/8 expression with circulating fibrocyte levels of HCV-infected patients. (G) Working model of HCV-mediated monocyte differentiation and polarization. HCV-infected hepatocytes release virus that interacts with monocytes to induce differentiation into MΦs. These M2-like MΦs secrete pro- and anti-inflammatory cytokines. Early secretion of IL-1β facilitates the secretion of TGF-β, which leads to HSC activation. In vivo data reveal the presence of M2 marker–expressing monocytes in circulation of HCV-infected patients and collagen-expressing fibrocytes. *p ≤ 0.05.

Close modal

To investigate whether TLR activation plays a role in the generation of fibrocytes, we evaluated the levels of collagen-Iα in monocytes that were knocked down for TLR3, TLR7, or TLR8 and cocultured with HCV or Huh concentrate. We observed that TLR7 knockdown partially abrogated the expression of collagen in the monocytes that were exposed to HCV, whereas TLR8 knockdown completely abrogated it (Fig. 6D). This suggested that TLR7/8 activation plays a role in the generation of fibrocytes during HCV infection. Furthermore, we observed a significant increase in the percentage of fibrocytes in HCV-infected patients that had increased TLR7/8 expression (Fig. 6E). TLR7/8 expression did not correlate with fibrocyte levels in chronic HCV patients (Fig. 6F). Together, these results demonstrate that, during HCV infection, viral RNA induces the generation of polarized MΦs and fibrocytes via TLR8.

Innate immune responses are important in the control and resolution of acute HCV infection and contribute to chronic inflammation (5, 32). In this study, we show that cocultures of human monocytes and HCV-infected hepatoma cells or cell-free HCV can differentiate monocytes to MΦs with mixed M1/M2 cytokine production and M2-polarized surface marker expression. We demonstrate that cell-free HCV and HCV containing exosomes induce MΦs that are characterized by high pro- and anti-inflammatory cytokine production and surface expression of M2 phenotypic markers. In our previous work, we showed that the M2 MΦ–derived TGF-β acts as a mediator of hepatic stellate cell activation that leads to liver fibrosis (27). In the current study, we identified HCV ssRNA and TLR7/8 activation as triggers for the differentiation of monocytes to polarized MΦs. Based on results from the monocyte-stimulation experiments with HCV and TLR7/8 agonist, we conclude that the mixed M1/M2 phenotype may be due to activation of TLR7/8 by HCV. We showed that the absence of TLR7 or TLR8 is associated with inhibition of collagen expression in HCV-exposed monocytes. Further, in chronic HCV–infected patients, high levels of TLR7/8 expression in monocytes were associated with the high percentage of collagen-expressing fibrocytes, suggesting that TLR7/8 may be involved in the generation of fibrocytes (Fig. 6F).

It is known that peripheral blood monocytes constantly enter the liver and interact with HCV-infected hepatocytes and also replenish liver MΦs (33). We performed coculture experiments to reveal the mechanism by which HCV-infected hepatocytes interact with monocytes. We reasoned that this would mimic the in vivo environment, whereby monocytes entering the liver come in contact with the HCV-infected hepatocytes, cell-free virus, or virus containing exosomes. Consistent with previous studies, we showed that, in the presence of HCV, monocytes differentiate into M2-polarized MΦs with a mixed M1/M2 cytokine profile (12, 27, 34). Our present study using PHHs infected with HCV and cocultured with healthy monocytes also showed similar effects on monocyte phenotype and function, demonstrating that this is an HCV-specific effect. It is also unlikely that IFNs or cytokines produced by HCV-infected hepatocytes mediate the effects on monocytes, because we observed minimal secretion of these factors from the infected hepatocytes. Further, isolated HCV, exosome-packaged HCV, and HCV ssRNA independently had similar phenotypic and functional effects on monocyte differentiation and MΦ polarization.

Pathogens, such as HCV, are recognized by innate immunity via their PAMPs. Given that cell–cell contact was not necessary for HCV to induce monocyte differentiation, we investigated the role of RNA-sensing pattern recognition receptors. We show that the TLR7 or TLR8 agonist Gardiquimod or ssRNA40 induced monocyte differentiation to MΦs. This suggests that TLR7/8 ligands other than HCV can induce monocyte differentiation. The role of TLR7/8 was supported by the observation that the monocyte-to-MΦ differentiation by HCV was blocked by TLR7 or TLR8 knockdown and not by TLR3 knockdown in monocytes, indicating that TLR7/8 mediates the effect of HCV. We also demonstrated that HCV ssRNA induced monocyte differentiation, suggesting that HCV ssRNA play an important signaling role in changing the monocyte/MΦ phenotype. This is important in HCV–host interactions, because TLR-induced differentiation of monocytes into MΦs or dendritic cells was shown to crucially influence effective host defenses (35). Our in vivo results show that there is a significant increase in the expression levels of TLR7/8 in monocytes, as well as high expression of procollagen during HCV infection. Knockdown of TLR7/8 also abrogated the increased expression of collagen in the monocytes exposed to HCV, demonstrating the role of TLR7/8 in fibrocyte generation.

Exosomes from HCV patients contain HCV ssRNA that can transfer HCV infection (26, 36). Exosomal transfer of HCV RNA from infected hepatoma cells can stimulate plasmacytoid dendritic cells (pDCs) to secrete IFN-α (37). In this study, we show that exosomes derived from infected hepatocytes can also modulate monocyte differentiation. Thus, the current study describes a new role for HCV containing exosomes in mediating immune effects during HCV infection. In a recent study, we evaluated changes in the phenotype and function of healthy human monocytes cultured in the presence of HCV-infected hepatoma cells and cell-free HCV (27). We demonstrated that HCV induces circulating monocytes to differentiate into MΦs with a M2 surface phenotype and mixed M1/M2 cytokine production. We further showed that the chronic presence of HCV programs monocytes that induce hepatic stellate cell activation via TGF-β in HCV infection (27). The present study and the previous study underscore that, during human diseases, rather than distinct M1 and M2 MΦ populations, MΦs often coexist, and the resultant mixed phenotype depends on the balance of activatory and inhibitory factors and the tissue environment.

Studies showed that CD14+ human monocytes can patrol blood vessels and exert specific effector functions in response to viruses and nucleic acids; this is mediated by TLR7/8 (11). The difference between pDC activation and monocyte activation with viral infection also was demonstrated in a study by Chattergoon et al. (30). They reported that innate sensing of virus/viral particles leads to type I IFN production in pDCs and inflammasome activation in monocytes during HCV and HIV infection. This study shows that, although pDCs and monocyte sense virus through TLRs, the TLRs involved are different, and the responses are elicited by HCV in different cell types. Studies from our group demonstrate that exosomes secreted by HCV-infected hepatocytes contain HCV RNA that is associated with miR-122 and Ago-2, and these exosomes are taken up by uninfected cells (26). We also showed that the exosomes from hepatocytes are taken up by monocytes, as demonstrated by the presence of miR-122 in monocytes upon exosome uptake of hepatocyte-derived exosomes (38). Thus, our study shows that, in the presence of HCV and HCV containing exosomes, monocytes differentiate into M2 MΦs.

Studies showed that CD14+ peripheral blood monocytes can differentiate into cells that express collagen (fibrocytes), which are attracted to the sites of tissue injury and mediate tissue repair and fibrosis (39, 40). Fibrocytes have features of MΦs and fibroblasts and express markers of hematopoietic cells and collagen I and III (39, 41). Increased numbers of fibrocytes are reported in diseases that are characterized by chronic inflammation and were reported in animal models of liver, kidney, and lung fibrosis (40, 42). Collagen-producing monocytes are detected in the blood of the patients with systemic sclerosis and are important in the progression of lung fibrosis (43). In our previous study, we showed collagen expression in the monocytes cocultured with HCV-infected hepatocytes. In addition to the presence of circulating fibrocytes in chronic HCV–infected patients (27), we identified a unique population of circulating monocytes with M2 marker and collagen expression that correlated with the presence of liver fibrosis in chronic HCV–infected patients (27). In the current study, we show the role of TLR7/8 in induction of fibrocytes in HCV infection. Our study suggests that HCV infection can stimulate the generation of fibrocytes, which, in turn, can be important in the process of liver fibrosis. However, further work needs to be done to directly link fibrocytes and liver fibrosis during HCV infection.

Inflammation is a major component of the pathogenesis during chronic HCV infection, and MΦs are the prominent inflammatory cells in the liver. Increased TNF-α and IL-1β expression is observed in Kupffer cells in the liver during chronic HCV infection (6, 7, 12, 13). Proinflammatory cytokines were implicated in the process of liver fibrosis (44, 45). We showed that IL-1β promotes TGF-β secretion during chronic HCV infection, leading to MΦ polarization to the M2 phenotype. IL-6 and TNF-α play significant roles in chronic HCV infection, as demonstrated by studies in HCV-transgenic mice (46, 47). Further studies in HCV-transgenic mice showed that M2 MΦs increase in the liver and these M2 MΦs secrete proinflammatory cytokines (IL-6 and TNF-α) that lead to chronic inflammation in the liver (48). Based on our results, it can be speculated that an increase in the M2 MΦs secreting proinflammatory cytokines will increase inflammation in the liver, and secretion of cytokines like TGF-β will lead to fibrosis.

In summary, our data illustrate the role of TLR7/8 activation in monocytes during HCV infection, which leads to monocyte differentiation and MΦ polarization. These results identified a novel role for TLR7/8 in fibrocyte generation during HCV infection and underscore the importance of TLR8 activation in liver fibrosis in chronic hepatitis C infection.

We thank Dr. Takaji Wakita and Dr. Charles M. Rice for kindly providing the infectious JFH-1 molecular clone and Huh7.5 cells. We thank Dr. Kui Li (University of Tennessee Health Science Center, Memphis, TN) for providing the HCV genome containing plasmids. We thank Donna Giansiracusa and Trang Vo from the Gastroenterology research office for assistance with the clinical samples. The authors greatly appreciate the participation of patients and volunteers for this study. PHHs were obtained from the National Institutes of Health Liver Tissue Cell Distribution System (Pittsburgh, PA; Richmond, VA).

This work was supported by National Institutes of Health Grant R37 AA014372 (to G.S.). The National Institutes of Health Liver Tissue Cell Distribution System (Minneapolis, MN; Pittsburgh, PA; Richmond, VA) was funded by National Institutes of Health Contract N01-DK-7-004/HHSN2670070004C.

The online version of this article contains supplemental material.

Abbreviations used in this article:

HCV

hepatitis C virus

Huh7.5/JFH-1

Huh7.5 cell infected with JFH-1 (HCV)

JFH-1

Japanese fulminant hepatitis 1

macrophage

M1

classically activated

M2

alternatively activated

PAMP

pathogen-associated molecular pattern

pDC

plasmacytoid dendritic cell

PHH

primary human hepatocyte

PolyI:C

polyinosinic-polycytidylic acid

siRNA

small interfering RNA

UTR

untranslated region.

1
Mohd Hanafiah
K.
,
Groeger
J.
,
Flaxman
A. D.
,
Wiersma
S. T.
.
2013
.
Global epidemiology of hepatitis C virus infection: new estimates of age-specific antibody to HCV seroprevalence.
Hepatology
57
:
1333
1342
.
2
Messina
J. P.
,
Humphreys
I.
,
Flaxman
A.
,
Brown
A.
,
Cooke
G. S.
,
Pybus
O. G.
,
Barnes
E.
.
2015
.
Global distribution and prevalence of hepatitis C virus genotypes.
Hepatology
61
:
77
87
.
3
Webster
D. P.
,
Klenerman
P.
,
Dusheiko
G. M.
.
2015
.
Hepatitis C.
Lancet
385
:
1124
1135
.
4
Rein
D. B.
,
Wittenborn
J. S.
,
Smith
B. D.
,
Liffmann
D. K.
,
Ward
J. W.
.
2015
.
The cost-effectiveness, health benefits, and financial costs of new antiviral treatments for hepatitis C virus.
Clin. Infect. Dis.
61
:
157
168
.
5
Szabo
G.
,
Dolganiuc
A.
.
2008
.
Hepatitis C and innate immunity: recent advances.
Clin. Liver Dis.
12
:
675
692
, x.
6
Kawai
T.
,
Akira
S.
.
2011
.
Toll-like receptors and their crosstalk with other innate receptors in infection and immunity.
Immunity
34
:
637
650
.
7
Bekeredjian-Ding
I.
,
Roth
S. I.
,
Gilles
S.
,
Giese
T.
,
Ablasser
A.
,
Hornung
V.
,
Endres
S.
,
Hartmann
G.
.
2006
.
T cell-independent, TLR-induced IL-12p70 production in primary human monocytes.
J. Immunol.
176
:
7438
7446
.
8
Medzhitov
R.
,
Janeway
C. A.
 Jr.
2002
.
Decoding the patterns of self and nonself by the innate immune system.
Science
296
:
298
300
.
9
Wilkins
C.
,
Gale
M.
 Jr.
2010
.
Recognition of viruses by cytoplasmic sensors.
Curr. Opin. Immunol.
22
:
41
47
.
10
Liu
B. S.
,
Groothuismink
Z. M.
,
Janssen
H. L.
,
Boonstra
A.
.
2011
.
Role for IL-10 in inducing functional impairment of monocytes upon TLR4 ligation in patients with chronic HCV infections.
J. Leukoc. Biol.
89
:
981
988
.
11
Cros
J.
,
Cagnard
N.
,
Woollard
K.
,
Patey
N.
,
Zhang
S. Y.
,
Senechal
B.
,
Puel
A.
,
Biswas
S. K.
,
Moshous
D.
,
Picard
C.
, et al
.
2010
.
Human CD14dim monocytes patrol and sense nucleic acids and viruses via TLR7 and TLR8 receptors.
Immunity
33
:
375
386
.
12
Dolganiuc
A.
,
Norkina
O.
,
Kodys
K.
,
Catalano
D.
,
Bakis
G.
,
Marshall
C.
,
Mandrekar
P.
,
Szabo
G.
.
2007
.
Viral and host factors induce macrophage activation and loss of toll-like receptor tolerance in chronic HCV infection.
Gastroenterology
133
:
1627
1636
.
13
Negash
A. A.
,
Ramos
H. J.
,
Crochet
N.
,
Lau
D. T.
,
Doehle
B.
,
Papic
N.
,
Delker
D. A.
,
Jo
J.
,
Bertoletti
A.
,
Hagedorn
C. H.
,
Gale
M.
 Jr.
2013
.
IL-1β production through the NLRP3 inflammasome by hepatic macrophages links hepatitis C virus infection with liver inflammation and disease.
PLoS Pathog.
9
:
e1003330
.
14
Rőszer
T.
2015
.
Understanding the mysterious M2 macrophage through activation markers and effector mechanisms.
Mediators Inflamm.
2015
:
816460
.
15
Chávez-Galán
L.
,
Olleros
M. L.
,
Vesin
D.
,
Garcia
I.
.
2015
.
Much more than M1 and M2 macrophages, there are also CD169(+) and TCR(+) macrophages.
Front. Immunol.
6
:
263
.
16
Martinez
F. O.
,
Gordon
S.
.
2014
.
The M1 and M2 paradigm of macrophage activation: time for reassessment.
F1000Prime Rep.
6
:
13
.
17
Mantovani
A.
,
Sica
A.
,
Sozzani
S.
,
Allavena
P.
,
Vecchi
A.
,
Locati
M.
.
2004
.
The chemokine system in diverse forms of macrophage activation and polarization.
Trends Immunol.
25
:
677
686
.
18
Rey-Giraud
F.
,
Hafner
M.
,
Ries
C. H.
.
2012
.
In vitro generation of monocyte-derived macrophages under serum-free conditions improves their tumor promoting functions.
PLoS One
7
:
e42656
.
19
Lolmede
K.
,
Campana
L.
,
Vezzoli
M.
,
Bosurgi
L.
,
Tonlorenzi
R.
,
Clementi
E.
,
Bianchi
M. E.
,
Cossu
G.
,
Manfredi
A. A.
,
Brunelli
S.
,
Rovere-Querini
P.
.
2009
.
Inflammatory and alternatively activated human macrophages attract vessel-associated stem cells, relying on separate HMGB1- and MMP-9-dependent pathways.
J. Leukoc. Biol.
85
:
779
787
.
20
Szabo
G.
,
Dolganiuc
A.
.
2008
.
Hepatitis C core protein - the “core” of immune deception?
J. Hepatol.
48
:
8
11
.
21
Sato
K.
,
Ishikawa
T.
,
Okumura
A.
,
Yamauchi
T.
,
Sato
S.
,
Ayada
M.
,
Matsumoto
E.
,
Hotta
N.
,
Oohashi
T.
,
Fukuzawa
Y.
,
Kakumu
S.
.
2007
.
Expression of Toll-like receptors in chronic hepatitis C virus infection.
J. Gastroenterol. Hepatol.
22
:
1627
1632
.
22
Zhang
Y. L.
,
Guo
Y. J.
,
Li
B.
,
Sun
S. H.
.
2009
.
Hepatitis C virus single-stranded RNA induces innate immunity via Toll-like receptor 7.
J. Hepatol.
51
:
29
38
.
23
Saha
B.
,
Szabo
G.
.
2014
.
Innate immune cell networking in hepatitis C virus infection.
J. Leukoc. Biol.
96
:
757
766
.
24
Dolganiuc
A.
,
Garcia
C.
,
Kodys
K.
,
Szabo
G.
.
2006
.
Distinct Toll-like receptor expression in monocytes and T cells in chronic HCV infection.
World J. Gastroenterol.
12
:
1198
1204
.
25
Zhang
S.
,
Kodys
K.
,
Li
K.
,
Szabo
G.
.
2013
.
Human type 2 myeloid dendritic cells produce interferon-λ and amplify interferon-α in response to hepatitis C virus infection.
Gastroenterology
144
:
414
425.e7
.
26
Bukong
T. N.
,
Momen-Heravi
F.
,
Kodys
K.
,
Bala
S.
,
Szabo
G.
.
2014
.
Exosomes from hepatitis C infected patients transmit HCV infection and contain replication competent viral RNA in complex with Ago2-miR122-HSP90.
PLoS Pathog.
10
:
e1004424
.
27
Saha
B.
,
Kodys
K.
,
Szabo
G.
.
2016
.
HCV-induced monocyte differentiation into polarized M2 macrophages promotes stellate cell activation via TGFβ.
Cell. Mol. Gastroenterol. Hepatol.
2
:
302
316.e8
.
28
Momen-Heravi
F.
,
Bala
S.
,
Bukong
T.
,
Szabo
G.
.
2014
.
Exosome-mediated delivery of functionally active miRNA-155 inhibitor to macrophages.
Nanomedicine
10
:
1517
1527
.
29
Wakita
T.
,
Pietschmann
T.
,
Kato
T.
,
Date
T.
,
Miyamoto
M.
,
Zhao
Z.
,
Murthy
K.
,
Habermann
A.
,
Kräusslich
H. G.
,
Mizokami
M.
, et al
.
2005
.
Production of infectious hepatitis C virus in tissue culture from a cloned viral genome.
Nat. Med.
11
:
791
796
.
30
Chattergoon
M. A.
,
Latanich
R.
,
Quinn
J.
,
Winter
M. E.
,
Buckheit
R. W.
 III
,
Blankson
J. N.
,
Pardoll
D.
,
Cox
A. L.
.
2014
.
HIV and HCV activate the inflammasome in monocytes and macrophages via endosomal Toll-like receptors without induction of type 1 interferon.
PLoS Pathog.
10
:
e1004082
.
31
Han
X.
,
Li
X.
,
Yue
S. C.
,
Anandaiah
A.
,
Hashem
F.
,
Reinach
P. S.
,
Koziel
H.
,
Tachado
S. D.
.
2012
.
Epigenetic regulation of tumor necrosis factor α (TNFα) release in human macrophages by HIV-1 single-stranded RNA (ssRNA) is dependent on TLR8 signaling.
J. Biol. Chem.
287
:
13778
13786
.
32
Barth
H.
,
Rybczynska
J.
,
Patient
R.
,
Choi
Y.
,
Sapp
R. K.
,
Baumert
T. F.
,
Krawczynski
K.
,
Liang
T. J.
.
2011
.
Both innate and adaptive immunity mediate protective immunity against hepatitis C virus infection in chimpanzees.
Hepatology
54
:
1135
1148
.
33
Heydtmann
M.
2009
.
Macrophages in hepatitis B and hepatitis C virus infections.
J. Virol.
83
:
2796
2802
.
34
Hosomura
N.
,
Kono
H.
,
Tsuchiya
M.
,
Ishii
K.
,
Ogiku
M.
,
Matsuda
M.
,
Fujii
H.
.
2011
.
HCV-related proteins activate Kupffer cells isolated from human liver tissues.
Dig. Dis. Sci.
56
:
1057
1064
.
35
Krutzik
S. R.
,
Tan
B.
,
Li
H.
,
Ochoa
M. T.
,
Liu
P. T.
,
Sharfstein
S. E.
,
Graeber
T. G.
,
Sieling
P. A.
,
Liu
Y. J.
,
Rea
T. H.
, et al
.
2005
.
TLR activation triggers the rapid differentiation of monocytes into macrophages and dendritic cells.
Nat. Med.
11
:
653
660
.
36
Ramakrishnaiah
V.
,
Thumann
C.
,
Fofana
I.
,
Habersetzer
F.
,
Pan
Q.
,
de Ruiter
P. E.
,
Willemsen
R.
,
Demmers
J. A.
,
Stalin Raj
V.
,
Jenster
G.
, et al
.
2013
.
Exosome-mediated transmission of hepatitis C virus between human hepatoma Huh7.5 cells.
Proc. Natl. Acad. Sci. USA
110
:
13109
13113
.
37
Dreux
M.
,
Garaigorta
U.
,
Boyd
B.
,
Décembre
E.
,
Chung
J.
,
Whitten-Bauer
C.
,
Wieland
S.
,
Chisari
F. V.
.
2012
.
Short-range exosomal transfer of viral RNA from infected cells to plasmacytoid dendritic cells triggers innate immunity.
Cell Host Microbe
12
:
558
570
.
38
Momen-Heravi
F.
,
Bala
S.
,
Kodys
K.
,
Szabo
G.
.
2015
.
Exosomes derived from alcohol-treated hepatocytes horizontally transfer liver specific miRNA-122 and sensitize monocytes to LPS.
Sci. Rep.
5
:
9991
.
39
Pilling
D.
,
Fan
T.
,
Huang
D.
,
Kaul
B.
,
Gomer
R. H.
.
2009
.
Identification of markers that distinguish monocyte-derived fibrocytes from monocytes, macrophages, and fibroblasts.
PLoS One
4
:
e7475
.
40
Reilkoff
R. A.
,
Bucala
R.
,
Herzog
E. L.
.
2011
.
Fibrocytes: emerging effector cells in chronic inflammation.
Nat. Rev. Immunol.
11
:
427
435
.
41
Yang
L.
,
Scott
P. G.
,
Giuffre
J.
,
Shankowsky
H. A.
,
Ghahary
A.
,
Tredget
E. E.
.
2002
.
Peripheral blood fibrocytes from burn patients: identification and quantification of fibrocytes in adherent cells cultured from peripheral blood mononuclear cells.
Lab. Invest.
82
:
1183
1192
.
42
Kisseleva
T.
,
Uchinami
H.
,
Feirt
N.
,
Quintana-Bustamante
O.
,
Segovia
J. C.
,
Schwabe
R. F.
,
Brenner
D. A.
.
2006
.
Bone marrow-derived fibrocytes participate in pathogenesis of liver fibrosis.
J. Hepatol.
45
:
429
438
.
43
Tourkina
E.
,
Bonner
M.
,
Oates
J.
,
Hofbauer
A.
,
Richard
M.
,
Znoyko
S.
,
Visconti
R. P.
,
Zhang
J.
,
Hatfield
C. M.
,
Silver
R. M.
,
Hoffman
S.
.
2011
.
Altered monocyte and fibrocyte phenotype and function in scleroderma interstitial lung disease: reversal by caveolin-1 scaffolding domain peptide.
Fibrogenesis Tissue Repair
4
:
15
.
44
Kolb
M.
,
Margetts
P. J.
,
Anthony
D. C.
,
Pitossi
F.
,
Gauldie
J.
.
2001
.
Transient expression of IL-1beta induces acute lung injury and chronic repair leading to pulmonary fibrosis.
J. Clin. Invest.
107
:
1529
1536
.
45
Oikonomou
N.
,
Harokopos
V.
,
Zalevsky
J.
,
Valavanis
C.
,
Kotanidou
A.
,
Szymkowski
D. E.
,
Kollias
G.
,
Aidinis
V.
.
2006
.
Soluble TNF mediates the transition from pulmonary inflammation to fibrosis.
PLoS One
1
:
e108
.
46
Sekiguchi
S.
,
Kimura
K.
,
Chiyo
T.
,
Ohtsuki
T.
,
Tobita
Y.
,
Tokunaga
Y.
,
Yasui
F.
,
Tsukiyama-Kohara
K.
,
Wakita
T.
,
Tanaka
T.
, et al
.
2012
.
Immunization with a recombinant vaccinia virus that encodes nonstructural proteins of the hepatitis C virus suppresses viral protein levels in mouse liver.
PLoS One
7
:
e51656
.
47
Takahashi
T.
,
Burguiere-Slezak
G.
,
Van der Kemp
P. A.
,
Boiteux
S.
.
2011
.
Topoisomerase 1 provokes the formation of short deletions in repeated sequences upon high transcription in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
108
:
692
697
.
48
Ohtsuki
T.
,
Kimura
K.
,
Tokunaga
Y.
,
Tsukiyama-Kohara
K.
,
Tateno
C.
,
Hayashi
Y.
,
Hishima
T.
,
Kohara
M.
.
2015
.
M2 macrophages play critical roles in progression of inflammatory liver disease in hepatitis C virus transgenic mice.
J. Virol.
90
:
300
307
.

The authors have no financial conflicts of interest.

Supplementary data