Visual Abstract

Microglia being the resident macrophage of brain provides neuroprotection following diverse microbial infections. Japanese encephalitis virus (JEV) invades the CNS, resulting in neuroinflammation, which turns the neuroprotective role of microglia detrimental as characterized by increased microglial activation and neuronal death. Several host factors, including microRNAs, play vital roles in regulating virus-induced inflammation. In the current study, we demonstrate that the expression of miR-301a is increased in JEV-infected microglial cells and human brain. Overexpression of miR-301a augments the JEV-induced inflammatory response, whereas inhibition of miR-301a completely reverses the effects. Mechanistically, NF-κB–repressing factor (NKRF) functioning as inhibitor of NF-κB activation is identified as a potential target of miR-301a in JEV infection. Consequently, miR-301a–mediated inhibition of NKRF enhances nuclear translocation of NF-κB, which, in turn, resulted in amplified inflammatory response. Conversely, NKRF overexpression in miR-301a–inhibited condition restores nuclear accumulation of NF-κB to a basal level. We also observed that JEV infection induces classical activation (M1) of microglia that drives the production of proinflammatory cytokines while suppressing alternative activation (M2) that could serve to dampen the inflammatory response. Furthermore, in vivo neutralization of miR-301a in mouse brain restores NKRF expression, thereby reducing inflammatory response, microglial activation, and neuronal apoptosis. Thus, our study suggests that the JEV-induced expression of miR-301a positively regulates inflammatory response by suppressing NKRF production, which might be targeted to manage viral-induced neuroinflammation.

Inflammatory response triggered by the activation of innate arm of the immune system provides the first line of defense against host invasion by microbial pathogens (1). Although this protective response elicited by the body operates to ensure clearance of detrimental stimuli, an excessive inflammatory response against pathogens can give rise to pathological conditions (2, 3). However, neuronal death as a result of excessive microglial inflammation is a profound characteristic in most of the neurotropic flaviviral infections, including that of Japanese encephalitis virus (JEV) (4). JEV is a mosquito-borne ssRNA virus that belongs to the Flaviviridae family, which also includes dengue, Zika, and West Nile. After entering the body, JEV invades the CNS, resulting into development of signs and symptoms such as fever, headache, and vomiting. About one-third of patients die, and almost half of the survivors suffer from permanent cognitive impairment (5). Albeit JEV-induced encephalitis is considered to be the most prevalent viral encephalitis in the Asia–Pacific region, incidences of the same have been reported nowadays across areas where the threat was previously unknown and has become the cause of worldwide pandemics (6).

During the course of infection, JEV entry in the CNS culminates into massive inflammatory response in the cerebrospinal fluid (7). Although this response appears to play a defensive role against virus, uncontrolled inflammatory response upon virus infection plays a major role in triggering the death of neurons as a bystander effect (4, 8). Being a resident macrophage, microglia is considered to be the main effector of CNS inflammation, and production of various proinflammatory mediators in JEV infection has been implicated in the process of microglial activation (912).

MicroRNAs (miRNAs) are small RNA molecules of 21–22-nt length that act as important regulators of gene expression (13). They act at the posttranscriptional level by targeting the 3ʹ untranslated region (UTR) of mRNAs, resulting in translational repression or degradation of the target. In addition to diverse physiological processes, studies demonstrate miRNAs playing a vital role in the development of various pathological conditions (14, 15). Accumulating evidence suggests a decisive role for miRNAs in various neuroinflammatory diseases (16, 17), including viral encephalitis (18, 19). Recently, two miRNAs, miR-15b and miR-19b-3p, have been reported to involve in astrocyte mediated neuroinflammation in JEV infection (20, 21). Previously, our group evaluated the effect of JEV infection on the profile of microglial miRNAs, which are reported to be playing important role in regulating the inflammatory response (19). Among the miRNAs whose expression were modulated upon JEV infection, we already reported the regulatory mechanism of two host miRNAs, miR-29b and miR-155, in JEV-induced microglial inflammation (18, 19). In the current study, miR-301a, which was found to be increased in previous miRNA profiling data, was subjected to further investigation to decipher its role in JEV-triggered neuroinflammation. It has been reported that miR-301a regulates Th cells, Th17 differentiation in autoimmune demyelination (22). In pancreatic cancer, miR-301a is found to induce NF-κB activation by repressing NF-κB–repressing factor (NKRF) (23). We also identified a crucial role of miR-301a in regulating antiviral IFN-β response in JEV infection by suppressing IFN regulatory factor 1 (IRF1) and suppressor of cytokine signaling 5 (SOCS5) productions (24). In this study, we demonstrate that enhanced expression of miR-301a in JEV-infected microglia augments the inflammatory response via targeting NKRF, a negative regulator of NF-κB activity. Furthermore, in vivo inhibition of miR-301a in JEV-infected mice reduces overall neuroinflammation and neuronal cell death.

BALB/c mice of either sex were kept together with their respective mothers under a 12 h dark/12 h light cycle at a constant temperature and humidity. All experiments were performed after getting approval from the Institutional Animal Ethics Committee of the National Brain Research Centre (NBRC) (approval no. NBRC/IAEC/2014/96 and NBRC/IAEC/2018/139). The animals were maintained in strict accordance with good animal practice as per the guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals, Ministry of Environment and Forestry, Government of India.

The human cell line of fetal microglial origin CHME3 and the mouse microglial cell line BV2 are gifts from S. Levison (Rutgers University Cancer Research Center, Newark, NJ), and porcine stable kidney cells, a gift from G. R. Medigeshi (Translational Health Science and Technology Institute, Faridabad, India), were cultured at 37°C in DMEM supplemented with 10% FBS, penicillin (100 U/ml), and streptomycin (100 μg/ml). All cell culture reagents were obtained from Sigma-Aldrich, unless otherwise specified.

Primary microglial cells were isolated from postnatal days 0–2 (P0–P2) BALB/c mouse pups according to a previously described method (10). The whole-brain cerebral cortex was dissected from BALB/c mouse pups, followed by the removal of meninges from the cortex under dissecting microscope. The tissue was then converted into single-cell suspension by the means of trypsin/DNase-I treatment at 37°C along with mechanical dissociation. The single-cell suspension was passed through 130-μm cell strainer, followed by the centrifugation of the filtrate at 800 rpm for 10 min. The cell pellet formed was used for cell seeding in 75 cm2 cell culture flask at a density of 2 × 105 cells/cm2 in complete MEM (supplemented with 10% FBS, 100 U/ml penicillin, 100 μg/ml streptomycin, 0.6% glucose, and 2 mM glutamine). Exhausted media was changed every 2 d until the cell culture flask containing mixed glial population achieved full confluency. After completion of 12–14 d, the cell culture flasks were subjected to horizontal shaking on an Excella E25 Orbital Shaker (New Brunswick Scientific, Edison, NJ) at 250 rpm for 90 min at 37°C for dislodging the microglial cells. Unattached cells obtained were plated in bacteriological petri dishes for 90 min to allow the microglial cells to adhere to it. Followed by that, the unattached cells were discarded, and the microglial cells were scraped off, centrifuged, and plated on chamber slides at a density of 8 × 104 cells/cm2. The cells were then incubated at 37°C and used for further experiments.

The GP78 strain of JEV was propagated in suckling BALB/c mice (postnatal day 2) of either sex. Following the onset of symptoms, the mice were sacrificed to collect the infected brains. Viral suspension was prepared as reported earlier (18) and stored at −80°C until needed for use. Viral titers in culture medium of cell lines and brain samples were assessed by plaque assay. Plaque formation was performed on monolayers of porcine stable kidney cells as previously mentioned (24).

All cells were seeded at the desired density in culture plates as per the requirements for different experiments. After the cells reached 80% confluence, they were further incubated for 2 h in serum-free medium and infected with JEV (strain GP78) at an multiplicity of infection (MOI) of 5. Cells were harvested at different times for the time course study. For the dosage-dependent study, the cells were infected for 24 h separately with JEV at MOIs of 1, 5, or 10. Mock infection (MI) consisted of adding the same amount of medium as that containing the JEV inoculum but without virus.

Formalin-fixed, paraffin embedded (FFPE) sections of uninfected (MI) and JEV-infected human brains were deparaffinized with xylene, hydrated using series of alcohol, and were processed for in situ hybridization (ISH) with the miRCURY LNA microRNA ISH Optimization Kit (Exiqon), as described previously (24). FFPE sections of hippocampus region of JEV-infected autopsied human brains (CSF positive for JEV-IgM) and uninfected human brains (subjects who met with road traffic accidents with minimal trauma to brain) were obtained from the archives of Human Brain Bank, National Institute of Mental Health and Neurosciences, Bangalore, according to institutional ethics and confidentiality of the subjects. Brain sections from two uninfected brains (28- and 25-y-old male) and two JEV-infected patient’s brain (14- and 10-y-old male) were used for the study. All the tissues are collected with written informed consent of close relatives of the deceased. The uninfected brain tissues are taken from relatively normal zones, far away from the site of injury. Briefly, the sections were hybridized with 60 nM double digoxigenin (DIG)–labeled locked nucleic acid (LNA) miR-301a probe (5ʹ-GCTTTGACAATACTATTGCACTG-3ʹ; Exiqon) or 5 nM 5ʹ-DIG–labeled LNA U6 small nuclear RNA (snRNA) probe (5ʹ-CACGAATTTGCGTGTCATCCTT-3ʹ; Exiqon), followed by 1 h incubation with sheep anti-DIG/alkaline phosphatase Ab (1:400 dilution; Roche Life Science). BCIP/NBT chromogen (Roche Life Science) was then added to develop blue color. Following stringent washing with water, blocking solution (5% BSA in PBS) was added to these sections for 20 min before being incubated overnight with rabbit derived anti-TMEM119 (microglia specific) (1:100; Abcam) Ab at 4 °C. After extensive washing with PBS, the sample slides were incubated with biotinylated anti-rabbit Ig G (1:200; Vector Laboratories) and then it was made to interact with HRP-conjugated streptavidin (1:250; Vector Laboratories), thus developing a gray-black reaction product upon action of DAB Substrate Kit (SK-4100; Vector Laboratories). Slides were mounted with DPX (Qualigens Fine Chemicals) and observed with Nikon Eclipse Ti-S Inverted Microscope under appropriate magnification.

To overexpress or inhibit miR-301a, transfection of cells were performed with mimics of human or mouse miR-301a (dsRNAs that mimic mature endogenous miR-301a) or with miR-301a inhibitors (modified ssRNAs that specifically inhibit endogenous miR-301a activity) (Qiagen), respectively, using HiPerFect Transfection Reagent (Qiagen) according to the manufacturer’s instructions. Twenty-four hours following transfection, the cells were harvested or infected with JEV for specific times, and then, the abundances of the miRNAs, mRNAs, and proteins were analyzed. Negative controls of the mimic or inhibitor (Ambion) were used in the transfections as the matched controls. An equal volume of HiPerFect reagent without any nucleic acid was treated to mock transfection cells.

The 1015-bp segment of cDNA encoding the 3ʹ UTR of human NKRF containing the putative miR-301a binding site were amplified by PCR from CHME3 cDNA with the NKRF Luc primers (forward and reverse) (Supplemental Table I). The DNA fragment was cloned into the Spe I and Mlu I sites downstream of the firefly luciferase gene in the pMIR-REPORT plasmid. Site-directed mutagenesis at the miR-301a binding site was generated with the NKRF Luc mutant primers (forward and reverse; Supplemental Table I), as mentioned before (24). The NKRF cds primers (forward and reverse; Supplemental Table I) were used to amplify the 2084-bp coding region for NKRF from human cDNA. This PCR product was digested with Hind III and BamHI, and then cloned into the pcDNA 3.1 (+) plasmid (which was provided by D. Chattopadhyay, Amity University, Kolkata, India). However, all of the constructs were commercially sequenced at Invitrogen BioServices India, Gurgaon, India.

Endoribonuclease-prepared small interferring RNA (esiRNA) specific for human NKRF (EHU132691) as well as negative esiRNA control (Con-esiRNA) (sense, 5ʹ-GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTG GA-3ʹ) were purchased from Sigma-Aldrich. CHME3 cells were transfected with either esiRNAs or plasmids encoding NKRF with Lipofectamine 2000 (Invitrogen), as described earlier (24). Twenty-four hours later, the cells were infected with JEV (MOI, 5) for 24 h, and the cells or cell culture medium were then subjected to mRNA or protein analysis. Transfection efficiency was assessed by measuring the amounts of the proteins of interest.

CHME3 cells (2 × 104) were seeded in a 24-well plate for 16–18 h and then were transiently transfected with firefly luciferase reporter constructs together with either an miR-301a mimic (Mimic–miR-301a) or inhibitor and their respective controls using Lipofectamine 2000. The cells were also cotransfected with a Renilla luciferase vector (pRL-TK, a gift from E. Sen, NBRC) for normalization of transfection efficiency. Twenty-four hours later, the cells were harvested, and luciferase activity of each sample was measured as illustrated previously (24). In another set of experiments, the cells were cotransfected with the inhibitor and reporter constructs. Twenty-four hours later, the cells were infected with JEV, and luminescence was measured after 24 h of infection. For NF-κB activity analysis, CHME3 cells were cotransfected with different combinations of NF-κB luciferase reporter construct (a kind gift from E. Sen, NBRC), miR-301a inhibitor, esiRNA specific for NKRF (NKRF esiRNA), and plasmid encoding NKRF. Following 24 h of transfection, cell were infected with JEV for 24 h, and luminescence was measured.

Nitrite, a stable oxidized product of NO, was measured by using Griess reagent (Sigma-Aldrich) as described earlier (12). Cell culture media of uninfected and treated cells was collected and centrifuged at 2000 rpm for 5 min to remove cellular debris. The media (50 μl) was then reacted with equal volume of Griess reagent for 15 min at room temperature in dark, and absorbance was taken at 540 nm using microplate reader (Bio-Rad Laboratories). Nitrite concentrations were determined using standard solutions of sodium nitrite prepared in same medium used to grow cells.

The expression of cytokines in culture medium obtained from control and treated CHME3 cells was measured using human inflammatory cytokine cytometric bead array (CBA) kit (BD Biosciences, San Diego, CA), whereas mouse inflammation CBA kit was used to analyze the abundances of cytokines in BV2 cell culture medium and mouse brain lysate as per manufacturer instructions. Briefly, 30 μl of bead mixture of cytokines was mixed with test samples or standards, to which fluorescent dye was added. Following 2 h of incubation in dark, the beads were washed and resuspended in 300 μl of wash buffer, and acquired using BD FACSuite software in FACSVerse System (Becton Dickinson, San Diego, CA). Data were analyzed using FCAP Array v3.0 Software (Becton Dickinson) and concentrations of different cytokines were expressed as picograms per milliliter.

To determine the viral RNA expression, total RNA was isolated from JEV-infected CHME3 and BV2 cells by using Tri Reagent (Sigma-Aldrich), and 250 ng of RNA was reverse transcribed with the Verso cDNA Synthesis Kit (Thermo Fisher Scientific). Then, 5 μl of cDNA reaction mixture was subjected to PCR amplification (95°C 30 s, 54°C 45 s, and 68°C 1 min for 35 cycles) by using JEV- and GAPDH-specific primer pairs (Supplemental Table I). The PCR products were visualized after electrophoresis on a 1% agarose gel containing ethidium bromide. For quantitative determination of mature mRNA and miRNA abundances, quantitative RT-PCR (qRT-PCR) analysis was performed. Isolation of total RNA from treated cells and mouse brain followed by cDNA synthesis was performed as mentioned above. mRNA from human brain sections was isolated according to a previously said protocol (9). qRT-PCR analysis of human and mouse genes were performed using Power SYBR Green PCR Master Mix (Applied Biosystems) along with gene-specific primers (Supplemental Table I). The relative abundance of an mRNA of interest was determined by normalization to that of GAPDH mRNA through the 2−∆∆Ct method (Ct refers to the threshold value). The isolation of miRNA and cDNA preparation was performed as described earlier (24). The primers of human miR-301a, 5ʹ-CAGUGCAAUAGUAUUGUCAAAGC-3ʹ and mouse miR-301a, 5ʹ-CAGUGCAAUAGUAUUGUCAAAGC-3ʹ were used as forward primers in qRT-PCR analysis as stated previously (24). The procedure of tissue preparation for miRNA isolation from human brain sections was similar as that of mRNA. The snRNA SNORD68 was used as a normalization control. The thermal cycler ViiA 7 Real-Time PCR (Applied Biosystems) was used for qRT-PCR, and the data were analyzed with the iCycler Thermal Cycler software (Applied Biosystems).

Protein was isolated from cells and mouse tissue as previously described (24), and concentration of each sample was estimated using the BCA reagent (Sigma-Aldrich). Equal amounts of proteins were resolved by SDS-PAGE and transferred onto a nitrocellulose membrane and incubated with primary Abs specific for NKRF (1:1000; OriGene), inducible NO synthase (iNOS) (1:1000; Abcam), cyclooxygenase-2 (COX-2) (1:1000; MilliporeSigma), NF-κB/p65 (1:10,000; Cell Signaling Technology), p–NF-κB/p65 (1:1000; Cell Signaling Technology), SOCS5 (1:1000; Abcam), IRF1 (1:1000; Cell Signaling Technology), NeuN (1:1000; MilliporeSigma), Iba1 (1:1000; Wako Chemicals), proliferating cell nuclear Ag (PCNA) (1:2000; Cell Signaling Technology), or β-actin (1:10,000; Sigma-Aldrich). β-actin was used as internal control except for samples containing nuclear proteins for which PCNA acted as the internal control. The secondary Abs used for detection were HRP-conjugated goat anti-mouse and goat anti-rabbit IgG (1:5000; Vector Laboratories). The blots were developed by exposure in UVITEC Chemiluminescence System (Cleaver Scientific) with NineAlliance software.

Mouse brain sections were permeabilized with 0.1% Triton X-100 in PBS and then incubated with blocking buffer for 1 h at room temperature, which was followed by overnight incubation with either anti-TMEM119 (1:100; Abcam) and anti-NKRF (1:100; OriGene) Abs, or anti-TMEM119 and anti-CD68 (1:150; Abcam), or anti-TMEM119 and anti-CD86 (1:200; BD Pharmingen), or anti-TMEM119 and anti-CD206 (1:400; Abcam) at 4°C. After extensive washing, the sections were incubated with Alexa Fluor 488– or Alexa Fluor 594– (1:1500; Molecular Probes) or fluorescein (1:250; Vector Laboratories)–conjugated secondary Abs for 1 h. Finally, the sections were mounted with DAPI (Vector Laboratories) and observed using a Zeiss ApoTome microscope at the specified magnification. FFPE brain sections were deparaffinized by putting in xylene thrice, each for 15 min. These sections were then dehydrated in ethanol and following PBS wash subjected to the immunofluorescence analysis using anti-TMEM119 (1:100; Abcam) and anti-NKRF (1:100; OriGene) Abs. Neuronal apoptosis was assessed by TUNEL assay using In Situ Cell Death Detection Kit (Roche Life Science). Mouse brain sections were incubated with TMR red–conjugated TUNEL mixture followed by anti-NeuN (1:250; MilliporeSigma) staining using Alexa Fluor 488–conjugated secondary Ab, and rest of the procedure being same as mentioned above.

For in vivo experiments, P10 mice of either sex were randomly assigned to three groups. Among them, group 1 was the MI group and received only PBS, whereas mice from the other two groups were injected i.p. with JEV (3 × 105 PFU). After 24 h of infection, mice in groups 2 and 3 were treated intracranially with the single dosage of Vivo-Morpholino (Gene Tools), Vivo-Morpholino negative control (VM-NC; 18 mg/kg), and miR-301a Vivo-Morpholino (miR-301a–VM; 18 mg/kg), respectively. After 3 and 7 d of infection, the mice were euthanized and brain samples were collected for qRT-PCR, CBA, and Western blotting analyses. Brain samples collected following 7 d of infection were used for immunofluorescence analysis.

All experiments were performed in triplicate unless otherwise indicated. Student two-tailed unpaired t test was performed to analyze statistical difference between two groups. Comparisons involving multiple groups were evaluated by one-way ANOVA followed by Bonferroni post hoc test, whereas two-way ANOVA followed by the Holm–Sidak method was used in assessing differences between multiple groups influenced by two factors. Any value of p < 0.05 was considered statistically significant. The results are expressed as means ± SD, and graphs were prepared with KyPlot (version 2.0 β 13) and SigmaPlot 11.0.

Earlier work using miRNA PCR-based array to determine the miRNA expression profile upon JEV infection reported abundance of a group of miRNAs with respect to uninfected cells (19). In this study, we performed qRT-PCR to analyze the time-dependent expression profile of miR-301a in CHME3, a microglial cell line of human origin. The significant increase in miR-301a abundance was found up to 48 h, whereas a moderately declined pattern was observed beyond 24 h (Fig. 1A). Furthermore, CHME3 cells also displayed a dosage-dependent increase in miR-301a upon infection with varying concentration of viruses for 24 h (Fig. 1B). JEV-infected autopsy brain samples also exhibited enhanced abundance of miR-301a by qRT-PCR analysis (Fig. 1C). To evaluate miR-301a expression in human brain microglia, we performed both ISH analysis for miR-301a or U6 snRNA (as a positive control) and immunohistochemical analysis of microglia specific marker TMEM119 (25) from uninfected and JEV-infected brain sections. Although the expression of U6 snRNA was found to be similar in both the cases, increased miR-301a expression was observed in JEV-infected human brain sections with respect to uninfected sections (Fig. 1D). Expression of miR-301a was further validated in JEV-infected BV2 cells, and qRT-PCR analysis showed both time- and dosage-dependent increase in its abundance upon JEV infection (Fig. 1E, 1F). Similar time-dependent increased expression of miR-301a was observed in JEV-infected primary microglial cells (Fig. 1G). Together, these results indicate that miR-301a expression in microglia is enhanced in JEV infection.

FIGURE 1.

miR-301a expression is induced in JEV-infected microglia. (A and B) CHME3 cells were infected with JEV at an MOI of 5 for the indicated times (A) or infected with indicated MOIs for 24 h (B). The relative abundances of miR-301a compared with uninfected (MI) were determined by qRT-PCR analysis and normalized to that of SNORD68 snRNA. RT-PCR was performed to determine JEV infection (lower panels). GAPDH expression was verified as loading control. *p < 0.05, ***p < 0.001. (C) miRNA was isolated from uninfected (MI) and JEV-infected human brain sections, and miR-301a expression was determined by qRT-PCR. Data are representative of two different brains per group. *p < 0.05 by Student t test, compared with uninfected human brain. (D) ISH of miR-301a (purple chromogen) in microglial cells (gray black chromogen) from human brain. Uninfected (MI) and JEV-infected brain sections were hybridized with the miRCURY LNA miR-301a probe or the LNA U6 snRNA probe, which was followed by immunohistochemistry analysis of microglia with 3,3ʹ-diaminobenzidine (DAB). Scale bar, 20 μm; original magnification ×40. The ubiquitously expressed U6 snRNA (purple chromogen) was used as a positive control. Quantification was performed by calculating the percentage of ISH+ to total TMEM119+ (microglial marker) cells (right panel). Data are mean ± SD from five fields per section (two sections per human brain of each group). **p < 0.01 by Student t test, compared with uninfected human brain (MI). (E and F) BV2 cells were exposed to JEV for the indicated times (E) or were infected with indicated MOIs of JEV for 24 h (F), and the abundance of miR-301a was evaluated by qRT-PCR analysis. JEV infection was assessed by RT-PCR (lower panels), and GAPDH was used as internal control. *p < 0.05, **p < 0.01, ***p < 0.001, compared with uninfected cells (MI). (G) Primary microglial cells were isolated from postnatal day 0 (P0) to P2 BALB/c mouse pups, cultured for 12–14 d, and infected with JEV for the indicated times. miR-301a abundance was quantified by qRT-PCR analysis, and the results are expressed as the fold change compared with that in uninfected cells (MI). All data in bar graphs are means ± SD of three biological replicates. p values are calculated by ANOVA, followed by Bonferroni post hoc test. *p < 0.05, ***p < 0.001. h.p.i., hours postinfection.

FIGURE 1.

miR-301a expression is induced in JEV-infected microglia. (A and B) CHME3 cells were infected with JEV at an MOI of 5 for the indicated times (A) or infected with indicated MOIs for 24 h (B). The relative abundances of miR-301a compared with uninfected (MI) were determined by qRT-PCR analysis and normalized to that of SNORD68 snRNA. RT-PCR was performed to determine JEV infection (lower panels). GAPDH expression was verified as loading control. *p < 0.05, ***p < 0.001. (C) miRNA was isolated from uninfected (MI) and JEV-infected human brain sections, and miR-301a expression was determined by qRT-PCR. Data are representative of two different brains per group. *p < 0.05 by Student t test, compared with uninfected human brain. (D) ISH of miR-301a (purple chromogen) in microglial cells (gray black chromogen) from human brain. Uninfected (MI) and JEV-infected brain sections were hybridized with the miRCURY LNA miR-301a probe or the LNA U6 snRNA probe, which was followed by immunohistochemistry analysis of microglia with 3,3ʹ-diaminobenzidine (DAB). Scale bar, 20 μm; original magnification ×40. The ubiquitously expressed U6 snRNA (purple chromogen) was used as a positive control. Quantification was performed by calculating the percentage of ISH+ to total TMEM119+ (microglial marker) cells (right panel). Data are mean ± SD from five fields per section (two sections per human brain of each group). **p < 0.01 by Student t test, compared with uninfected human brain (MI). (E and F) BV2 cells were exposed to JEV for the indicated times (E) or were infected with indicated MOIs of JEV for 24 h (F), and the abundance of miR-301a was evaluated by qRT-PCR analysis. JEV infection was assessed by RT-PCR (lower panels), and GAPDH was used as internal control. *p < 0.05, **p < 0.01, ***p < 0.001, compared with uninfected cells (MI). (G) Primary microglial cells were isolated from postnatal day 0 (P0) to P2 BALB/c mouse pups, cultured for 12–14 d, and infected with JEV for the indicated times. miR-301a abundance was quantified by qRT-PCR analysis, and the results are expressed as the fold change compared with that in uninfected cells (MI). All data in bar graphs are means ± SD of three biological replicates. p values are calculated by ANOVA, followed by Bonferroni post hoc test. *p < 0.05, ***p < 0.001. h.p.i., hours postinfection.

Close modal

Microglial activation during JEV infection is associated with exaggerated secretion of proinflammatory cytokines. To assess the role of miR-301a in JEV-triggered inflammatory response, overexpression and silencing studies of miR-301a were performed. We transfected CHME3 and BV2 cells with either Mimic–miR-301a or inhibitor (anti–miR-301a) for 24 h before the cells were left uninfected or infected with JEV. At 24 h of infection, transfection of CHME3 and BV2 cells with Mimic–miR-301a demonstrated increased miR-301a abundance in both uninfected and JEV-infected cells with respect to control mimic. In contrast, transfection with anti–miR-301a resulted in decreased abundance of miR-301a when compared with inhibitor control (anti–miR control [anti–miR-Con]) (Fig. 2A, 2B). Enhanced expression of a plethora of proinflammatory factors including NO, iNOS, and COX-2 were observed following JEV infection in Mimic–miR-301a–transfected CHME3 and BV2 cells (Fig. 2C, 2D). In contrast, inhibition of miR-301a by anti–miR-301a led to significant decline in expression of these markers in JEV infection (Fig. 2C, 2D). We further investigated the role of miR-301a in production of JEV-induced proinflammatory cytokines. The amount of IL-1β, IL-12, TNF-α, IL-6, and IL-8 secreted by JEV-infected CHME3 (Fig. 2E) or the amount of IL-6, C-C motif CCL2, TNF-α, IL-12, and IFN-γ secreted by JEV-infected BV2 (Fig. 2F) were increased in Mimic–miR-301a transfection compared with that by control mimic–transfected cells as determined by CBA analysis. We observed a contrasting result following anti–miR-301a transfection as it reduced cytokine expression in both JEV-infected CHME3 and BV2 compared with that by anti–miR-Con–transfected cells (Fig. 2E, 2F). In addition to the secretome analysis, we measured the mRNA expression of some additional proinflammatory markers in both JEV-infected CHME3 (CCL2, CCL5, and IFN-γ) and BV2 (IL-1β and CCL5) cells transfected with either Mimic–miR-301a or anti–miR-301a. In both cases, overexpression of miR-301a increased the expression of these markers compared with negative control, whereas inhibition of miR-301a decreased their expression (Fig. 2G, 2H). This modulation of microglial inflammatory response was observed to be independent of viral propagation as demonstrated by viral titer analysis, which showed no significant differences in viral replication in Mimic–miR-301a and inhibitor-transfected CHME3 and BV2 cells when compared with negative control–transfected cells (Fig. 2I, Supplemental Fig. 1A).

FIGURE 2.

miR-301a regulates JEV-mediated microglial inflammation. (A) CHME3 and (B) BV2 cells transfected with Mimic–miR-301a or a negative control (control mimic [Mimic-Con]) and miR-301a inhibitor (anti–miR-301a) or a negative control (anti–miR-Con) were left uninfected (MI) or were infected with JEV for 24 h. Relative miR-301a abundance was then determined by qRT-PCR analysis. The p values were calculated by two-way ANOVA, followed by the Holm–Sidak method. *p < 0.05, **p < 0.01, compared with the respective negative control. (C and D) After 24 h of transfection as in (A) and (B), CHME3 cells (C) or BV2 cells (D) were infected with JEV for another 24 h before the cell culture media were subjected to spectrophotometric analysis of NO production. Immunoblot was performed to determine the protein expression of iNOS and COX2 (lower panels). β-Actin served as a loading control. Western blots are representative of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, compared with the respective negative control. (EH) Both cells were treated as in (C) and (D). Culture medium of CHME3 cells was analyzed by CBA to determine the amount of secreted IL-1β, IL-12, TNF-α, IL-6, and IL-8 (E), whereas secretary levels of IL-6, CCL2, TNF-α, IL-12, and IFN-γ were assessed by CBA in BV2 cells (F). CHME3 cells were also subjected to qRT-PCR analysis to determine the relative abundances of CCL2, CCL5, and IFN-γ mRNAs (G). The relative expression of IL-1β and CCL5 mRNAs in BV2 cells was determined by qRT-PCR analysis (H). *p < 0.05, **p < 0.01, ***p < 0.001, compared with the negative control. (I) The transfected CHME3 cells were infected with JEV for 24 h and viral titers in the culture supernatants were detected by plaque assay. All data are means ± SD of three biological replicates. The p values were calculated by one-way ANOVA followed by Bonferroni post hoc test.

FIGURE 2.

miR-301a regulates JEV-mediated microglial inflammation. (A) CHME3 and (B) BV2 cells transfected with Mimic–miR-301a or a negative control (control mimic [Mimic-Con]) and miR-301a inhibitor (anti–miR-301a) or a negative control (anti–miR-Con) were left uninfected (MI) or were infected with JEV for 24 h. Relative miR-301a abundance was then determined by qRT-PCR analysis. The p values were calculated by two-way ANOVA, followed by the Holm–Sidak method. *p < 0.05, **p < 0.01, compared with the respective negative control. (C and D) After 24 h of transfection as in (A) and (B), CHME3 cells (C) or BV2 cells (D) were infected with JEV for another 24 h before the cell culture media were subjected to spectrophotometric analysis of NO production. Immunoblot was performed to determine the protein expression of iNOS and COX2 (lower panels). β-Actin served as a loading control. Western blots are representative of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, compared with the respective negative control. (EH) Both cells were treated as in (C) and (D). Culture medium of CHME3 cells was analyzed by CBA to determine the amount of secreted IL-1β, IL-12, TNF-α, IL-6, and IL-8 (E), whereas secretary levels of IL-6, CCL2, TNF-α, IL-12, and IFN-γ were assessed by CBA in BV2 cells (F). CHME3 cells were also subjected to qRT-PCR analysis to determine the relative abundances of CCL2, CCL5, and IFN-γ mRNAs (G). The relative expression of IL-1β and CCL5 mRNAs in BV2 cells was determined by qRT-PCR analysis (H). *p < 0.05, **p < 0.01, ***p < 0.001, compared with the negative control. (I) The transfected CHME3 cells were infected with JEV for 24 h and viral titers in the culture supernatants were detected by plaque assay. All data are means ± SD of three biological replicates. The p values were calculated by one-way ANOVA followed by Bonferroni post hoc test.

Close modal

To gain insight into the underlying mechanism of miR-301a function, we analyzed the target genes that might play roles in enhancing inflammation in our model of JEV infection. Earlier reports indicate role of NKRF as a potential target gene for miR-301a (23, 26). Alignment of miR-301a sequence with that of its target site in the 3ʹ UTR region of NKRF denoted conserved sequence complementarity across different species (Fig. 3A). A number of miRNA target prediction databases, including RNAhybrid (27), Miranda (28), TargetScan (29), and Pictar (30), were used to perform the complementarity analysis. To validate the miRNA/mRNA interactions predicted by the above-mentioned softwares, we cloned the 3ʹ UTR of human NKRF into a firefly luciferase reporter vector. We then generated nine-base mutations in the seed-matching site in the 3ʹ UTR of NKRF (Fig. 3B) to further test the miRNA/target interaction. CHME3 cells were then transfected with individual reporters containing wild-type (WT) or mutant UTR together with either Mimic–miR-301a or miR-301a inhibitor along with their negative controls. The Mimic–miR-301a effectively reduced the luciferase activity of the WT UTR reporter compared with that in cells transfected with the mimic control, whereas the miR-301a–dependent reduction in luciferase activity was disrupted by mutating the 3ʹ UTR binding site in NKRF (Fig. 3C). In contrast, anti–miR-301a significantly increased the luciferase activity of the WT UTR reporter compared with that in anti–miR-Con–transfected cells and the mutation in UTR almost abolished the effect (Fig. 3C). We further analyzed effect of Mimic–miR-301a and inhibitor transfection on mRNA and protein abundance of NKRF. Transfection of CHME3 and BV2 cells with Mimic–miR-301a led to decline in both NKRF mRNA and protein abundance (Fig. 3D, 3E). In contrast, CHME3 and BV2 cells, when transfected with anti–miR-301a, exhibited increased abundance of NKRF mRNA and protein (Fig. 3F, 3G). Further transfection of primary microglia with Mimic–miR-301a substantially increased the abundance of miR-301a and subsequently attenuated the production of NKRF mRNA (Fig. 3H) and protein (Fig. 3I). Unlike reported in our previous study, expression of SOCS5 and IRF1 were demonstrated to be unchanged in response to miR-301a activity modulation, hence reinforcing the neutral effect of the miRNA upon microglial viral propagation (Supplemental Fig. 2A, 2B).

FIGURE 3.

NKRF is a functional target of miR-301a. (A) Predicted miR-301a binding site in the 3ʹ UTR of NKRF mRNA. Perfect matches in the seed regions are indicated in orange. (B) Diagram of construct containing the 3ʹ UTR of NKRF downstream of a luciferase reporter. The WT 3ʹ UTR (WT UTR) contains an intrinsic miR-301a binding site, whereas the mutant 3ʹ UTR (Mut UTR) contains mutations that eliminated the seed match with miR-301a. Mutations (magenta) in the 3ʹ UTR of NKRF were generated for reporter gene assays. (C) Dual luciferase assays of CHME3 cells transfected with WT or Mut NKRF 3ʹ UTR luciferase constructs along with either the Mimic–miR-301a or miR-301a inhibitor (anti–miR-301a), or their negative controls were performed. Firefly luciferase activity was normalized to Renilla luciferase activity. Data are shown as the relative luciferase activity of cells transfected with the Mimic–miR-301a or miR-301a inhibitor compared with that of cells transfected with their negative control. Data are means ± SD of nine experiments from three independent transfections. **p < 0.01, ***p < 0.001, by Student t test. (D and E) Following 24 h of transfection with Mimic–miR-301a or control mimic, CHME3 cells (D) and BV2 cells (E) were subjected to Western blotting and qRT-PCR analysis of the abundances of NKRF proteins (left) and mRNA (right). (F and G) CHME3 cells (F) and BV2 cells (G) were transfected with miR-301a inhibitor or its negative control. After 24 h, Western blotting and qRT-PCR analysis were performed to evaluate the abundances of NKRF proteins (left) and mRNA (right). β-Actin served as a loading control. All of the blots are a representative of three experiments with similar results. The relative abundance of miR-301a as determined by qRT-PCR analysis of each set of cells is shown below the blots to confirm effective transfection. (H) Primary microglia isolated from P2 BALB/c was transfected with Mimic–miR-301a or control mimic for 24 h and NKRF expression was evaluated by qRT-PCR analysis. The mimic transfection was evaluated by analyzing miR-301a expression by qRT-PCR (lower panels). Data are means ± SD of three independent experiments. (I) Following 24 h of transfection, primary microglial cells were further evaluated for NKRF protein expression by coimmunofluorescence study with microglial Iba1 protein. Scale bar, 50 μm; original magnification ×20. *p < 0.05, **p < 0.01, ***p < 0.001, by one-way ANOVA, followed by Bonferroni post hoc test. MT, mock transfection.

FIGURE 3.

NKRF is a functional target of miR-301a. (A) Predicted miR-301a binding site in the 3ʹ UTR of NKRF mRNA. Perfect matches in the seed regions are indicated in orange. (B) Diagram of construct containing the 3ʹ UTR of NKRF downstream of a luciferase reporter. The WT 3ʹ UTR (WT UTR) contains an intrinsic miR-301a binding site, whereas the mutant 3ʹ UTR (Mut UTR) contains mutations that eliminated the seed match with miR-301a. Mutations (magenta) in the 3ʹ UTR of NKRF were generated for reporter gene assays. (C) Dual luciferase assays of CHME3 cells transfected with WT or Mut NKRF 3ʹ UTR luciferase constructs along with either the Mimic–miR-301a or miR-301a inhibitor (anti–miR-301a), or their negative controls were performed. Firefly luciferase activity was normalized to Renilla luciferase activity. Data are shown as the relative luciferase activity of cells transfected with the Mimic–miR-301a or miR-301a inhibitor compared with that of cells transfected with their negative control. Data are means ± SD of nine experiments from three independent transfections. **p < 0.01, ***p < 0.001, by Student t test. (D and E) Following 24 h of transfection with Mimic–miR-301a or control mimic, CHME3 cells (D) and BV2 cells (E) were subjected to Western blotting and qRT-PCR analysis of the abundances of NKRF proteins (left) and mRNA (right). (F and G) CHME3 cells (F) and BV2 cells (G) were transfected with miR-301a inhibitor or its negative control. After 24 h, Western blotting and qRT-PCR analysis were performed to evaluate the abundances of NKRF proteins (left) and mRNA (right). β-Actin served as a loading control. All of the blots are a representative of three experiments with similar results. The relative abundance of miR-301a as determined by qRT-PCR analysis of each set of cells is shown below the blots to confirm effective transfection. (H) Primary microglia isolated from P2 BALB/c was transfected with Mimic–miR-301a or control mimic for 24 h and NKRF expression was evaluated by qRT-PCR analysis. The mimic transfection was evaluated by analyzing miR-301a expression by qRT-PCR (lower panels). Data are means ± SD of three independent experiments. (I) Following 24 h of transfection, primary microglial cells were further evaluated for NKRF protein expression by coimmunofluorescence study with microglial Iba1 protein. Scale bar, 50 μm; original magnification ×20. *p < 0.05, **p < 0.01, ***p < 0.001, by one-way ANOVA, followed by Bonferroni post hoc test. MT, mock transfection.

Close modal

Because NKRF is a functional target of miR-301a, the expression of NKRF in JEV-infected CHME3 and BV2 cells was investigated. We observed that JEV infection resulted in an increase of miR-301a abundance and decline in NKRF mRNA and protein levels in both dosage- and time-dependent fashion (Fig. 4A–D). Analysis of JEV-infected primary microglia also indicated a reduction in NKRF mRNA and protein expression (Fig. 4E, 4F). We further confirmed a decrease in NKRF mRNA and protein abundance in microglia of JEV-infected human brain (Fig. 4G, 4H).

FIGURE 4.

NKRF expression is reduced in JEV infection. (A and B) CHME3 cells were infected with JEV at an MOI of 5 for the indicated times (A) or infected with indicated MOIs for 24 h (B). The relative abundances of NKRF mRNA were determined by qRT-PCR analysis. Western blot was performed to detect NKRF protein expression (lower panels). (C and D) The relative expressions of NKRF mRNA and protein in BV2 cells infected with JEV at an MOI of 5 for the indicated times (C) or infected with indicated MOIs for 24 h (D) were assessed by qRT-PCR and Western blot (lower panels) analysis respectively. β-Actin was used as a loading control. Western blots are representative of three independent experiments. The relative abundance of miR-301a in each set of cells was determined by qRT-PCR analysis and is shown below the blots. (E) Following JEV infection (MOI, 5) for the indicated times, the relative abundance of NKRF mRNA in primary microglia was determined by qRT-PCR analysis. The expression of miR-301a in each set of cells was provided (lower panel). The results are expressed as the mean ± SD of three independent experiments. The p values were obtained by one-way ANOVA followed by Bonferroni multiple comparisons. *p < 0.05, **p < 0.01, ***p < 0.001, compared with uninfected cells (MI). (F) NKRF protein expression in MI and JEV-infected (JEV) primary microglial cells as in (E) was further evaluated by coimmunofluorescence study with microglial Iba1. Scale bar, 50 μm; original magnification ×20. (G) The relative abundance of NKRF mRNA was assessed in uninfected (MI) and JEV human brain sections by qRT-PCR analysis. Data are representative of two different brains per group. *p < 0.05, by Student t test, compared with uninfected human brain. (H) Sections from uninfected (MI) and JEV human brains were evaluated for NKRF protein expression by coimmunofluorescence study with microglial TMEM119 protein. Scale bar, 50 μm; original magnification ×20. h.p.i., hours postinfection.

FIGURE 4.

NKRF expression is reduced in JEV infection. (A and B) CHME3 cells were infected with JEV at an MOI of 5 for the indicated times (A) or infected with indicated MOIs for 24 h (B). The relative abundances of NKRF mRNA were determined by qRT-PCR analysis. Western blot was performed to detect NKRF protein expression (lower panels). (C and D) The relative expressions of NKRF mRNA and protein in BV2 cells infected with JEV at an MOI of 5 for the indicated times (C) or infected with indicated MOIs for 24 h (D) were assessed by qRT-PCR and Western blot (lower panels) analysis respectively. β-Actin was used as a loading control. Western blots are representative of three independent experiments. The relative abundance of miR-301a in each set of cells was determined by qRT-PCR analysis and is shown below the blots. (E) Following JEV infection (MOI, 5) for the indicated times, the relative abundance of NKRF mRNA in primary microglia was determined by qRT-PCR analysis. The expression of miR-301a in each set of cells was provided (lower panel). The results are expressed as the mean ± SD of three independent experiments. The p values were obtained by one-way ANOVA followed by Bonferroni multiple comparisons. *p < 0.05, **p < 0.01, ***p < 0.001, compared with uninfected cells (MI). (F) NKRF protein expression in MI and JEV-infected (JEV) primary microglial cells as in (E) was further evaluated by coimmunofluorescence study with microglial Iba1. Scale bar, 50 μm; original magnification ×20. (G) The relative abundance of NKRF mRNA was assessed in uninfected (MI) and JEV human brain sections by qRT-PCR analysis. Data are representative of two different brains per group. *p < 0.05, by Student t test, compared with uninfected human brain. (H) Sections from uninfected (MI) and JEV human brains were evaluated for NKRF protein expression by coimmunofluorescence study with microglial TMEM119 protein. Scale bar, 50 μm; original magnification ×20. h.p.i., hours postinfection.

Close modal

To further validate whether JEV-induced miR-301a induction indeed targets NKRF, we cotransfected CHME3 cells with miR-301a inhibitor or the inhibitor control together with either WT or mutant NKRF 3ʹ UTR reporter constructs, followed by JEV infection for 24 h. Profound luciferase activity was observed in JEV-infected cells, which were transfected with anti–miR-301a and WT UTR construct when compared with cells cotransfected with WT UTR construct and inhibitor control (Fig. 5A). In contrast, mutating the NKRF 3ʹ UTR blocked the anti–miR-301a–mediated increase in luciferase activity in CHME3 cells (Fig. 5A). To present direct evidence that JEV-induced miR-301a suppressed the production of NKRF protein, we examined the abundance of NKRF in CHME3 cells infected with JEV for different times as well as in cells infected for a fixed time with different viral concentrations in which miR-301a was inhibited. We observed that inhibition of miR-301a reconstituted NKRF protein production in JEV-infected cells compared with that in control inhibitor transfected cells (Fig. 5B, 5C). NKRF expression of JEV-infected BV2 cells was similarly restored upon transfection with anti–miR-301a when compared with that in anti–miR-Con–transfected cells infected with JEV (Fig. 5D, 5E). To verify the efficacy of miR-301a in targeting NKRF in vivo, we knocked down the expression of miR-301a in BALB/c mice by administrating miR-301a–VM or VM-NC after 24 h of JEV infection. The substantial reduction of NKRF protein expression in VM-NC–treated mice was significantly recovered in miR-301a–VM-treated mice as analyzed by immunofluorescence study with microglia specific TMEM119 (25) (Fig. 5F).

FIGURE 5.

JEV-induced miR-301a suppresses NKRF protein production. (A) CHME3 cells were cotransfected with either the miR-301a inhibitor (anti–miR-301a) or the negative control (anti–miR-Con) together with a firefly luciferase reporter plasmid encoding the WT or mutant 3ʹ UTRs of NKRF. Twenty-four hours later, the cells were infected with JEV for 24 h before luciferase activities were measured with a dual luciferase assay kit and normalized to that of Renilla luciferase. Data are expressed as the relative luciferase activity of the anti–miR-301a–transfected cells compared with that of the anti–miR-Con–transfected cells. Data are means ± SD of nine experiments from three independent transfections. **p < 0.01, by Student t test. (B and C) CHME3 cell were transfected with either miR-301a inhibitor or negative control (anti–miR-Con) and then were either infected with JEV at an MOI of 5 for the indicated times (B) or infected for 24 h with JEV at the indicated MOIs (C). The cells were analyzed by Western blotting to determine the relative abundance of NKRF protein. (D and E) Following transfection with either miR-301a inhibitor or negative control BV2 cells were infected with JEV as in (B and C). The time- (D) and dosage-dependent (E) protein expression of NKRF was analyzed by Western blot. β-Actin was used as a loading control. Blots are representative of three independent experiments. The relative abundance of miR-301a in each set of cells was determined by qRT-PCR analysis and is shown below the blots to confirm effective transfection. Data are means ± SD of three individual experiments. (F) Postnatal day 10 (P10) BALB/c mice were treated with PBS (MI) or were infected with JEV (3 × 105 PFU) and treated with either miR-301a–VM, which targets mature miR-301a (JEV with miR-301a–VM [JEV + miR-301a–VM]), or scrambled Vivo-Morpholino that was designed as a negative control (JEV with VM-NC [JEV + VM-NC]). Brains were collected on day 7 for the evaluation of NKRF protein expression by coimmunofluorescence study with microglial TMEM119 protein. Scale bar, 50 μm; original magnification ×20. Data are representative of four mice per group. h.p.i., hours postinfection.

FIGURE 5.

JEV-induced miR-301a suppresses NKRF protein production. (A) CHME3 cells were cotransfected with either the miR-301a inhibitor (anti–miR-301a) or the negative control (anti–miR-Con) together with a firefly luciferase reporter plasmid encoding the WT or mutant 3ʹ UTRs of NKRF. Twenty-four hours later, the cells were infected with JEV for 24 h before luciferase activities were measured with a dual luciferase assay kit and normalized to that of Renilla luciferase. Data are expressed as the relative luciferase activity of the anti–miR-301a–transfected cells compared with that of the anti–miR-Con–transfected cells. Data are means ± SD of nine experiments from three independent transfections. **p < 0.01, by Student t test. (B and C) CHME3 cell were transfected with either miR-301a inhibitor or negative control (anti–miR-Con) and then were either infected with JEV at an MOI of 5 for the indicated times (B) or infected for 24 h with JEV at the indicated MOIs (C). The cells were analyzed by Western blotting to determine the relative abundance of NKRF protein. (D and E) Following transfection with either miR-301a inhibitor or negative control BV2 cells were infected with JEV as in (B and C). The time- (D) and dosage-dependent (E) protein expression of NKRF was analyzed by Western blot. β-Actin was used as a loading control. Blots are representative of three independent experiments. The relative abundance of miR-301a in each set of cells was determined by qRT-PCR analysis and is shown below the blots to confirm effective transfection. Data are means ± SD of three individual experiments. (F) Postnatal day 10 (P10) BALB/c mice were treated with PBS (MI) or were infected with JEV (3 × 105 PFU) and treated with either miR-301a–VM, which targets mature miR-301a (JEV with miR-301a–VM [JEV + miR-301a–VM]), or scrambled Vivo-Morpholino that was designed as a negative control (JEV with VM-NC [JEV + VM-NC]). Brains were collected on day 7 for the evaluation of NKRF protein expression by coimmunofluorescence study with microglial TMEM119 protein. Scale bar, 50 μm; original magnification ×20. Data are representative of four mice per group. h.p.i., hours postinfection.

Close modal

To validate the role of NKRF in the induction of a proinflammatory state upon miR-301a upregulation, we conducted experiments in which NKRF expression was subjected to knockdown and overexpression. We cotransfected CHME3 cells with Con-esiRNA or NKRF esiRNA and anti–miR-301a or control inhibitor for 24 h prior to being infected with JEV for 24 h. NO production, abundance of iNOS, COX-2, and several proinflammatory cytokines (IL-1β, IL-12, TNF-α, IL-6, IL-8, CCL2, CCL5, and IFN-γ) in JEV infection were found to be increased in NKRF silencing (Fig. 6A–C). Additionally, the reduction in the expression of these proinflammatory markers by miR-301a inhibitor was disrupted by the knockdown of NKRF (Fig. 6A–C). In contrast, NKRF overexpression decreased the NO production, iNOS and COX-2 protein abundance, and the expression of proinflammatory cytokines in JEV-infected CHME3 (Fig. 6D–F). Transfection of miR-301a inhibitor–treated CHME3 cells with NKRF construct followed by JEV infection reduced the expression of these proinflammatory markers compared with cells cotransfected with the control vector (Fig. 6D–F).

FIGURE 6.

miR-301a induces JEV-triggered inflammation by repressing NKRF. (AC) CHME3 cells were transfected with either anti–miR-Con or anti–miR-301a, together with Con-esiRNA or NKRF esiRNA for 24 h before being infected with JEV at an MOI of 5. Twenty-four hours postinfection, (A) NO production was assessed by spectrophotometric analysis. Western blot of cellular extracts was performed to analyze NKRF, iNOS, and COX2 protein abundances (lower panels). β-Actin served as a loading control. Culture medium was also subjected to CBA analysis to determine the amount of secreted IL-1β, IL-12, TNF-α, IL-6, and IL-8 (B). The relative abundances of CCL2, CCL5, and IFN-γ mRNAs were quantified by qRT-PCR analysis (C). Data are means ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, as analyzed by one-way ANOVA followed by Bonferroni multiple comparisons. (DF) CHME3 cells were transfected with either anti–miR-Con or anti–miR-301a, together with the indicated combinations of plasmid constructs. Twenty-four hours later, the cells were infected with JEV at an MOI of 5. At 24 h of infection, NO production in culture medium and protein expression of NKRF, iNOS, and COX2 in cells (lower panels) were evaluated by spectrophotometric and immunoblot analysis, respectively (D). β-Actin used as a loading control. All blots are representative of three independent experiments. Culture medium was also analyzed by CBA to determine the amount of secreted IL-1β, IL-12, TNF-α, IL-6, and IL-8 (E). qRT-PCR analysis was performed to measure the relative abundances of CCL2, CCL5, and IFN-γ mRNAs (F). Data are means ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, as calculated by one-way ANOVA followed by Bonferroni post hoc test. h.p.i., hours postinfection; ns, not significant.

FIGURE 6.

miR-301a induces JEV-triggered inflammation by repressing NKRF. (AC) CHME3 cells were transfected with either anti–miR-Con or anti–miR-301a, together with Con-esiRNA or NKRF esiRNA for 24 h before being infected with JEV at an MOI of 5. Twenty-four hours postinfection, (A) NO production was assessed by spectrophotometric analysis. Western blot of cellular extracts was performed to analyze NKRF, iNOS, and COX2 protein abundances (lower panels). β-Actin served as a loading control. Culture medium was also subjected to CBA analysis to determine the amount of secreted IL-1β, IL-12, TNF-α, IL-6, and IL-8 (B). The relative abundances of CCL2, CCL5, and IFN-γ mRNAs were quantified by qRT-PCR analysis (C). Data are means ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, as analyzed by one-way ANOVA followed by Bonferroni multiple comparisons. (DF) CHME3 cells were transfected with either anti–miR-Con or anti–miR-301a, together with the indicated combinations of plasmid constructs. Twenty-four hours later, the cells were infected with JEV at an MOI of 5. At 24 h of infection, NO production in culture medium and protein expression of NKRF, iNOS, and COX2 in cells (lower panels) were evaluated by spectrophotometric and immunoblot analysis, respectively (D). β-Actin used as a loading control. All blots are representative of three independent experiments. Culture medium was also analyzed by CBA to determine the amount of secreted IL-1β, IL-12, TNF-α, IL-6, and IL-8 (E). qRT-PCR analysis was performed to measure the relative abundances of CCL2, CCL5, and IFN-γ mRNAs (F). Data are means ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, as calculated by one-way ANOVA followed by Bonferroni post hoc test. h.p.i., hours postinfection; ns, not significant.

Close modal

NKRF, which was previously demonstrated to interact with specific negative regulatory elements to inhibit NF-κB transcriptional activity, is also reported to interact directly with p65 subunit of NF-κB and, in turn, negatively regulates NF-κB transactivational activities (31, 32). First, we examined the time-dependent activation of NF-κB and found that JEV infection increased the amount of the phosphorylated form of p65 (p-p65) in both CHME3 and BV2 cells (Fig. 7A, 7B). Consistent with time-dependent NF-κB activation, miR-301a expression in both these cells was found to increase significantly upon JEV infection (Fig. 7A, 7B). For further validation, CHME3 cells were either left untransfected or transfected with either of Mimic–miR-301a and inhibitor before being infected with JEV for 24 h. Translocation of p-p65 into the nucleus was observed to increase upon transfection with Mimic–miR-301a when compared with that in control mimic transfection (Fig. 7C). In contrast, anti–miR-301a transfection reduced the nuclear accumulation of p-p65 in comparison with JEV-infected CHME3 cells transfected with control inhibitor (Fig. 7D). However, abundance of p65 in total cellular protein was found to be unchanged in response to mimic or inhibitor transfection (Fig. 7C, 7D). To validate that miR-301a is involved in the regulation of NF-κB signaling through NKRF, CHME3 cells were transfected with miR-301a inhibitor or NKRF esiRNA or in combination before being infected with JEV for 24 h. The inhibition of nuclear translocation of p-p65 by miR-301a inhibitor was rescued by the knockdown of NKRF (Fig. 7E). In contrast, cotransfection of CHME3 cells with miR-301a inhibitor and NKRF coding plasmid prior to JEV infection for 24 h decreased the nuclear translocation of p-p65 when compared with JEV-infected cells treated with anti–miR-301a alone (Fig. 7F). Both NKRF esiRNA and NKRF expressing plasmid had no effect on the abundances of total p65 (Fig. 7E, 7F). To provide direct evidence of NF-κB inhibition by NKRF, we performed NF-κB luciferase reporter assay in response to transfection of NKRF esiRNA and NKRF coding plasmid. The decrease in NF-κB activity by miR-301a inhibitor observed in JEV-infected CHME3 cells was enhanced by the knockdown of NKRF (Fig. 7G). In contrast, miR-301a inhibitor transfected cells with plasmid encoding NKRF reduced NF-κB activity in JEV infection compared with cells cotransfected with control vector (Fig. 7G). Hence, our results clearly indicate that JEV-induced miR-301a upregulation promotes NF-κB activity via downregulation of NKRF.

FIGURE 7.

JEV-induced miR-301a activates NF-κB signaling via targeting NKRF. (A and B) Cells were left uninfected (MI) or were infected with JEV at an MOI of 5 for indicated times. Nuclear extracts were isolated to evaluate p65 protein expression in CHME3 (A) and BV2 (B) cells by Western blotting analysis. PCNA was used as loading control. The relative abundance of miR-301a in each set of cells was determined by qRT-PCR analysis and is shown below the blots. (C and D) Transfection of CHME3 cells was performed with Mimic–miR-301a, inhibitor, or their negative controls for 24 h, followed by JEV infection at 5 MOI for 24 h. Untransfected CHME3 cells were left uninfected as control studies. Nuclear and cytoplasmic fractions of the cells were then isolated and analyzed by Western blotting with Abs specific for the indicated proteins. In another set of cells with similar treatment, total cellular protein was isolated and checked the p65 protein expression by immunoblotting. In nuclear extracts PCNA served as loading control, whereas same was served by β-actin in cytoplasmic and total protein extracts. (E and F) Transfections of either NKRF esiRNA or NKRF plasmid construct with indicated combinations of miR-301a inhibitor were performed for 24 h before being infected with JEV at an MOI of 5 for 24 h. Nuclear and cytoplasmic fractions of the cells were then isolated and analyzed by Western blotting with Abs specific for the indicated proteins. In another set of experiments with parallel transfection condition p65 expression in total cellular extracts was evaluated by immunoblotting. Whereas β-actin served as loading controls for cytoplasmic and total cellular extracts, PCNA used as internal control for nuclear extracts. All of the blots are a representative of three independent experiments with similar results. (G) CHME3 cells were transfected with NF-κB luciferase reporter construct alone (MI, JEV) and together with indicated combinations of esiRNAs/anti–miR-301a or plasmids/anti–miR-301a. Twenty-four hours later, cells were left uninfected or were infected with JEV at an MOI of 5 for 24 h and luciferase activities were measured with a dual luciferase assay kit and normalized to that of Renilla luciferase. Data are means ± SD of nine experiments from three independent transfections. *p < 0.05, **p < 0.01, by one-way ANOVA followed by Bonferroni post hoc test. h.p.i., hours postinfection.

FIGURE 7.

JEV-induced miR-301a activates NF-κB signaling via targeting NKRF. (A and B) Cells were left uninfected (MI) or were infected with JEV at an MOI of 5 for indicated times. Nuclear extracts were isolated to evaluate p65 protein expression in CHME3 (A) and BV2 (B) cells by Western blotting analysis. PCNA was used as loading control. The relative abundance of miR-301a in each set of cells was determined by qRT-PCR analysis and is shown below the blots. (C and D) Transfection of CHME3 cells was performed with Mimic–miR-301a, inhibitor, or their negative controls for 24 h, followed by JEV infection at 5 MOI for 24 h. Untransfected CHME3 cells were left uninfected as control studies. Nuclear and cytoplasmic fractions of the cells were then isolated and analyzed by Western blotting with Abs specific for the indicated proteins. In another set of cells with similar treatment, total cellular protein was isolated and checked the p65 protein expression by immunoblotting. In nuclear extracts PCNA served as loading control, whereas same was served by β-actin in cytoplasmic and total protein extracts. (E and F) Transfections of either NKRF esiRNA or NKRF plasmid construct with indicated combinations of miR-301a inhibitor were performed for 24 h before being infected with JEV at an MOI of 5 for 24 h. Nuclear and cytoplasmic fractions of the cells were then isolated and analyzed by Western blotting with Abs specific for the indicated proteins. In another set of experiments with parallel transfection condition p65 expression in total cellular extracts was evaluated by immunoblotting. Whereas β-actin served as loading controls for cytoplasmic and total cellular extracts, PCNA used as internal control for nuclear extracts. All of the blots are a representative of three independent experiments with similar results. (G) CHME3 cells were transfected with NF-κB luciferase reporter construct alone (MI, JEV) and together with indicated combinations of esiRNAs/anti–miR-301a or plasmids/anti–miR-301a. Twenty-four hours later, cells were left uninfected or were infected with JEV at an MOI of 5 for 24 h and luciferase activities were measured with a dual luciferase assay kit and normalized to that of Renilla luciferase. Data are means ± SD of nine experiments from three independent transfections. *p < 0.05, **p < 0.01, by one-way ANOVA followed by Bonferroni post hoc test. h.p.i., hours postinfection.

Close modal

Microglia tend to polarize either into M1 or M2 phenotype, depending upon combinations of different stimuli (33). M1 phenotype is reported to promote proinflammatory state by secreting a plethora of inflammatory cytokines and chemokines. In contrast, M2 microglia has been observed to induce an anti-inflammatory response by releasing numerous protective factors. To analyze the role of miR-301a in M1/M2 microglial polarization, CHEM3 and BV2 cells were subjected to anti–miR-301a transfection before being infected with JEV for 24 h, followed by the evaluation of M1/M2 marker expressions by qRT-PCR analysis. JEV-induced increase in abundance of M1 microglial markers in control inhibitor–transfected CHME3 (CD68, CD86, IL-1β, and TNF-α) and BV2 (CD68, IL-1β, and TNF-α) was found to be significantly impaired in miR-301a inhibitor–transfected cells (Fig. 8A, 8B). On the contrary, abundance of M2 microglial markers in CHME3 (IL-4, IL-10, arginase-1, and CD206) and BV2 (IL-4, IL-10, and arginase-1) cells in miR-301a–inhibited condition was observed to be upregulated in comparison with inhibitor control transfection (Fig. 8C, 8D). To further validate the role of miR-301a in M1/M2 marker polarization in vivo, we knocked down miR-301a expression in BALB/c mice by administrating miR-301a–VM or VM-NC following 24 h of JEV infection. JEV-induced expression of M1 microglial markers like CD68 and CD86 were reduced upon miR-301a–VM treatment in comparison with VM-NC administration (Fig. 8E, 8F). Concomitantly, miR-301a inhibition in JEV-infected mice increased the abundance of M2 marker CD206 compared with that of VM-NC–treated mice as evaluated by immunofluorescence analysis (Fig. 8G).

FIGURE 8.

Inhibition of miR-301a induces M1 to M2 polarization in JEV-infected microglia. (A and B) CHME3 (A) and BV2 (B) cells were left uninfected (MI) or infected for 24 h following 24 h of transfection with anti–miR-Con or anti–miR-301a, and the mRNA expression of M1 markers were determined by qRT-PCR analysis. (C and D) In the same treatment, the mRNA expression of M2 markers were analyzed by qRT-PCR study in CHME3 (C) and BV2 cells (D). All data are mean ± SD of three experiments. *p < 0.05, **p < 0.01, ***p < 0.001, one-way ANOVA followed by Bonferroni post hoc test. (EG) BALB/c mice were infected with JEV (3 × 105 PFU) and treated with either miR-301a–VM, which targets mature miR-301a (JEV with miR-301a–VM [JEV + miR-301a–VM]), or JEV with VM-NC (JEV + VM-NC). Brains were collected on day 7 to assess the expression of M1 marker CD68 (E) and CD86 (F) as well as M2 marker CD206 (G) by coimmunofluorescence study with microglial TMEM119 protein. Scale bar, 50 μm; original magnification ×20. Data are representative of four mice per group.

FIGURE 8.

Inhibition of miR-301a induces M1 to M2 polarization in JEV-infected microglia. (A and B) CHME3 (A) and BV2 (B) cells were left uninfected (MI) or infected for 24 h following 24 h of transfection with anti–miR-Con or anti–miR-301a, and the mRNA expression of M1 markers were determined by qRT-PCR analysis. (C and D) In the same treatment, the mRNA expression of M2 markers were analyzed by qRT-PCR study in CHME3 (C) and BV2 cells (D). All data are mean ± SD of three experiments. *p < 0.05, **p < 0.01, ***p < 0.001, one-way ANOVA followed by Bonferroni post hoc test. (EG) BALB/c mice were infected with JEV (3 × 105 PFU) and treated with either miR-301a–VM, which targets mature miR-301a (JEV with miR-301a–VM [JEV + miR-301a–VM]), or JEV with VM-NC (JEV + VM-NC). Brains were collected on day 7 to assess the expression of M1 marker CD68 (E) and CD86 (F) as well as M2 marker CD206 (G) by coimmunofluorescence study with microglial TMEM119 protein. Scale bar, 50 μm; original magnification ×20. Data are representative of four mice per group.

Close modal

Pathological changes like microglia activation, increased expression of proinflammatory cytokines, and neuronal death are considered to be the cardinal features of in vivo JEV infection. To evaluate the effect of miR-301a inhibition on the neuroinflammation in vivo, we used Vivo-Morpholino–mediated delivery of anti–miR-301a in mouse brain. The Vivo-Morpholino system has already been reported to result in very efficient delivery of antisense oligomers into a diverse range of tissues in experimental mice (34). As mentioned in our previous study (24), Vivo-Morpholino–packaged anti–miR-301a specifically targeting the seed sequence of miR-301a (miR-301a–VM) and an appropriate negative control (VM-NC) possessing 5-nt mutation in the seed sequence were used for further investigations. BALB/c mice were left uninfected or were infected with JEV and treated with VM-NC or miR-301a–VM at 24 h postinfection (Fig. 9A). Mice brain samples were collected at 3 and 7 d postinfection. Although JEV-infected mice administered with VM-NC exhibited increase in miR-301a abundance with respect to uninfected brain sample, treatment with miR-301a–VM resulted in disruption of the miR-301a upregulation (Fig. 9B). The degree of body weight loss was significantly reduced in the mice treated with miR-301a–VM compared with those of mice treated with VM-NC (Supplemental Fig. 3A). Decreased NKRF protein and mRNA abundances in the VM-NC–treated, JEV-infected mice were significantly restored in the JEV-infected mice treated with miR-301a–VM (Fig. 9C, 9D). Additionally, miR-301a–VM-treated mice exhibited reduced expression of Iba1 and increased abundance of NeuN protein compared with VM-NC–treated, JEV-infected mice (Fig. 9C). To determine whether the rescue of NKRF imparts any effect upon concentration of proinflammatory cytokines, we evaluated the expression of IL-6, TNF-α, IL-12, IFN-γ, and CCL2 by CBA analysis. All of these cytokines were observed to be substantially decreased in the mice treated with miR-301a–VM when compared with VM-NC–treated one (Fig. 9E). Furthermore, neuronal apoptosis was analyzed by TUNEL assay coupled with immunofluorescence study of neuronal marker, NeuN. TUNEL assay is characterized by detection of DNA fragmentation by labeling the 3ʹ hydroxyl termini in the dsDNA breaks generated during apoptosis. Substantial numbers of neuronal cells were observed undergoing apoptosis in JEV infection, as reflected by increased number of NeuN- and TUNEL-positive cells in VM-NC–treated mice, whereas knockdown of miR-301a significantly reduced neuronal death in JEV-infected mice (Fig. 9F). Although the increased abundance of viral RNA and viral titer in JEV with VM-NC–treated mice brain was found to be reduced upon miR-301a inhibition (Supplemental Fig. 3B, 3C), the miR-301a–VM treatment had no effect on viral load in microglia (Fig. 9G).

FIGURE 9.

Inhibition of miR-301a in vivo attenuates microglial inflammation and inhibits neuronal death. (A) BALB/c mice were treated with PBS (MI) or were infected with JEV (3 × 105 PFU) and treated intracranially with either miR-301a–VM which targets mature miR-301a (JEV with miR-301a–VM [JEV + miR-301a–VM]) or JEV with VM-NC (JEV + VM-NC). Brain samples were collected on day 3 and 7 of JEV infection. (B) The abundance of miR-301a in brain samples was quantified by qRT-PCR analysis. Data are means ± SD of four mice from each group. (C and D) Brain samples from the mice described in (A) were analyzed by Western blotting (C) with Ab specific for NKRF, NeuN, and Iba1. β-Actin served as loading control. Blots are representative of four mice from each group. The relative abundance of NKRF mRNA was also assessed by qRT-PCR analysis (D). (E) Brain samples were also subjected to CBA analysis to determine the protein abundance of IL-6, TNF-α, IL-12, IFN-γ, and CCL2. Data are means ± SD of four mice from each group. (F and G) BALB/c mice were treated as in (A), and brain samples were collected on day 7 for the evaluation of TUNEL expression by coimmunofluorescence study with neuronal NeuN protein. Scale bar, 50 μm; original magnification ×20. (G) The coimmunofluorescence of JEV NS3 protein with microglial marker TMEM119 was also performed in collected brain samples. Scale bar, 50 μm; original magnification ×20. Data are representative of four mice in each group. *p < 0.05, **p < 0.01, ***p < 0.001, as calculated by one-way ANOVA followed by Bonferroni multiple comparisons. d.p.i., days postinfection.

FIGURE 9.

Inhibition of miR-301a in vivo attenuates microglial inflammation and inhibits neuronal death. (A) BALB/c mice were treated with PBS (MI) or were infected with JEV (3 × 105 PFU) and treated intracranially with either miR-301a–VM which targets mature miR-301a (JEV with miR-301a–VM [JEV + miR-301a–VM]) or JEV with VM-NC (JEV + VM-NC). Brain samples were collected on day 3 and 7 of JEV infection. (B) The abundance of miR-301a in brain samples was quantified by qRT-PCR analysis. Data are means ± SD of four mice from each group. (C and D) Brain samples from the mice described in (A) were analyzed by Western blotting (C) with Ab specific for NKRF, NeuN, and Iba1. β-Actin served as loading control. Blots are representative of four mice from each group. The relative abundance of NKRF mRNA was also assessed by qRT-PCR analysis (D). (E) Brain samples were also subjected to CBA analysis to determine the protein abundance of IL-6, TNF-α, IL-12, IFN-γ, and CCL2. Data are means ± SD of four mice from each group. (F and G) BALB/c mice were treated as in (A), and brain samples were collected on day 7 for the evaluation of TUNEL expression by coimmunofluorescence study with neuronal NeuN protein. Scale bar, 50 μm; original magnification ×20. (G) The coimmunofluorescence of JEV NS3 protein with microglial marker TMEM119 was also performed in collected brain samples. Scale bar, 50 μm; original magnification ×20. Data are representative of four mice in each group. *p < 0.05, **p < 0.01, ***p < 0.001, as calculated by one-way ANOVA followed by Bonferroni multiple comparisons. d.p.i., days postinfection.

Close modal

Microglia acts as a key player in initiating both innate and adaptive immune responses of CNS upon pathogenic invasion (35). The activation of microglia is considered to be the cardinal hallmark of neuroinflammation, and is characterized by its morphological change to M1 phenotype, as well as secretion of a series of proinflammatory mediators. M1 activation of microglia followed by neuroinflammation is a common feature of Japanese encephalitis (36). Following JEV invasion, glial cells elicit immune response against pathogens; however, viral replication within microglia results in bystander neuronal death by secretion of inflammatory mediators (4). In addition to JEV, neurotropic viruses, such as dengue (37), Zika (38), Chandipura (8), influenza (39), HIV-1 (40), HSV (41), and vesicular stomatitis virus (42), have been reported to infect microglia, thus contributing to neuropathogenesis.

miRNAs have emerged as a key player of posttranscriptional gene regulation in virus-induced inflammation, thus shaping the host antiviral immune response. Several miRNAs that are enriched in the brain play crucial roles in microglial inflammation. miR-155 is elevated in M1-polarized microglia and regulates their proinflammatory responses (43). Recently, miR-9 was demonstrated to promote microglial activation by targeting monocyte chemotactic protein-induced protein-1 (44). However, altered abundance of cellular miRNAs in viral infection may reshape cellular gene expression and that could be detrimental to the host. Several inflammatory pathway–related genes including TNF-α–induced protein 3 (TNFAIP3) (19), SH-2 containing inositol 5ʹ polyphosphatase 1 (SHIP1) (18), Ring Finger Protein 125 (RNF125) (21), and Ring Finger Protein 11 (RNF11) (20) were reported to be targeted by different miRNAs, thus regulating neuroinflammatory response during JEV infection. In this study, we observed substantial enhancement of microglial miR-301a expression following JEV infection, which led us to investigate its modulatory action in JEV-induced inflammatory response. To date, no such reports demonstrate the role of miR-301a in the context of any virus-mediated inflammatory response. Although miR-301a expression has not been detected in a recent study involving the miRNA array of JEV-infected human microglial cells (45), in the current study, we found that miR-301a is upregulated in JEV-infected human and mouse microglial cells, thus culminating into the production of different proinflammatory mediators and cytokines.

Because miR-301a is found to be overexpressed during JEV infection, and miR-301a acts as a positive regulator of the inflammatory response, we hypothesized that miR-301a might be inhibiting important suppressors of inflammatory signaling. Consistent with a previous report (23), we found that miR-301a directly targets NKRF, which is a negative regulator of NF-κB activation. JEV-infected microglial cells and human brain exhibited decline in expression of NKRF. Furthermore, overexpression of miR-301a into microglial cells resulted in decreased NKRF protein and mRNA abundances, whereas knockdown of miR-301a in JEV-infected microglial cells substantially rescued the NKRF expression, demonstrating the role of JEV-induced miR-301a in suppressing NKRF.

NKRF acts as transcriptional repressor that counteracts the basal activity of several NF-κB-driven inflammatory molecules. NKRF exerts its effect either by binding with negative regulatory elements in the respective promoters (IL-8, IFN-β, and iNOS) (46, 47) or by direct interaction with NF-κB/p65 protein, which can bind with the promoter of some genes (matrix metalloproteinase 2 [MMP-2] and COX-2) (23). Furthermore, NKRF inhibits NF-κB activation by a direct protein/protein interaction with NF-κB subunit (31). Recently, a study demonstrates that suppression of NKRF is associated to systemic inflammation in patients suffering from chronic obstructive pulmonary disease (48). Knockdown of NKRF in JEV-infected microglia in our present study significantly enhanced proinflammatory cytokine production. Furthermore, silencing of NKRF rescued the inhibitory effect of miR-301a inhibitor on the abundance of JEV-induced proinflammatory molecules. Conversely, ectopic expression of NKRF in JEV-infected microglia was shown to suppress the expression of proinflammatory cytokines along with further enhancement of the inhibitory effect of miR-301a inhibitor on the production of JEV-induced proinflammatory molecules. Together, these observations point toward the role of miR-301a in contributing to the uncontrolled inflammation via its effects on NKRF. In our previous study (24), the role of miR-301a to promote viral replication in neuron by targeting SOCS5 and IRF1 further prompted us to check whether the contribution of microglial miR-301a in regulating inflammatory response is mediated via effect on viral replication. We measured virus titer in supernatant of microglial cells treated with Mimic–miR-301a or inhibitor, followed by JEV infection. No change in viral titer with either Mimic–miR-301a or inhibitor suggests the view that miR-301a is responsible for enhanced microglial inflammatory response in a virus replication-independent fashion. Conversely, the significant reduction in viral replication in miR-301a–VM-treated mice brain further prompted us to check the viral load in mice brain microglia. Unaltered expression of viral protein in microglia of miR-301a–VM-treated mice compared with VM-NC–treated mice puts forward the fact that the observed reduction in viral load might be due to the decreased viral replication in neuronal cells. No change in SOCS5 and IRF1 abundance in response to microglial mir-301a overexpression further strengthen the lack of relationship between microglial viral propagation and miR-301a–regulated inflammatory response. Probable reasons for the unaltered viral titer in response to changes in cytokine production may be due to the fact that the expression level of the cytokines and chemokines might not be sufficient enough to suppress JEV replication in microglia. In addition to that, JEV might be modulating the downstream signaling effectors of the cytokines, resulting in dampening of anticipated immune response and perturbation of viral propagation.

Because optimal NF-κB activity is considered to be indispensable for peripheral immune cell survival, appropriate regulation of NF-κB signaling remains critical for management of a normal immune process (49). Persistent activation of NF-κB signaling is known to promote inflammation in different cells including microglia (50). Bystander killing of neuronal cells by microglial inflammation is also mediated by NF-κB activation (51). Additional evidences suggest the role of a number of miRNAs including miR-301a in regulation of NF-κB signaling (23, 52). Therefore, it was of interest to evaluate the effect of miR-301a in regulating JEV-induced NF-κB activity in microglia. We observed that treatment of cells with Mimic–miR-301a enhances NF-κB activation, whereas inhibitor interferes with the nuclear accumulation of phosphorylated NF-κB in JEV infection. In addition, silencing of NKRF disrupts the inhibitory effect of miR-301a inhibitor on nuclear accumulation of NF-κB in JEV-infected microglia. In contrast, the miR-301a inhibitor–mediated decline in nuclear NF-κB translocation from cytoplasm is amplified by the ectopic expression of NKRF. Furthermore, the effect of miR-301a inhibition on NF-κB activity in JEV-infected microglia was found to be substantially regulated by NKRF expression. Thus, these findings illustrate the role of JEV-induced miR-301a in potentiating NF-κB signaling through NKRF suppression.

Microglia polarization is sometimes categorized into classical (M1) and alternative (M2) activation in response to various stimuli. The M1 phenotype is characterized by secretion of various proinflammatory mediators and induces neuropathology, whereas M2 microglia tends to reduce inflammation and that could have a neuroprotective role (53). JEV infection results in microglial polarization to M1 phenotype that secretes increased amount of proinflammatory cytokines. Evidences demonstrate crucial roles played by miRNAs in M1/M2 polarization of microglia. Whereas several promote M2 phenotype, some other miRNAs, including miR-125b, miR-155, and miR-29b, target negative regulators’ NF-κB activation and thereby promote M1 macrophage polarization (19, 43, 54). We found that knockdown of miR-301a in JEV infection inhibited the expression of cell surface markers of M1 microglia (CD86 and CD68) as well as the production of proinflammatory cytokines in vivo and in vitro. Furthermore, the expression of M2 microglia surface marker (CD206) and anti-inflammatory cytokine production increased in miR-301a silencing, thus suggesting that JEV-induced miR-301a positively regulates M1 polarization of microglia.

We further investigated the in vivo effect of miR-301a in a JEV-infected mouse model with miR-301a–VM. Previously, we reported that miR-301a–VM offers a neuroprotective role and blocks viral replication in mice brain by inducing antiviral IFN-β response (24). In this study, we administered miR-301a–VM into mice to demonstrate its potential application against JEV-induced inflammatory response. Inhibition of miR-301a restored the abundances of mRNA and protein of NKRF and effectively resulted in substantial reduction in expression of proinflammatory cytokines. Further, in vivo knockdown of miR-301a inhibited microglia activation and reduced neuronal death. Evaluation of viral RNA load revealed a significant reduction in miR-301a–VM-treated mice brain but unchanged expression of viral protein in brain microglia, corroborating the outcome of our previous study (24) and suggesting that miR-301a–VM mediated impairment of JEV propagation in neurons might thus account for the reduction in viral burden.

In summary, we have identified a microglia specific host/virus interplay, demonstrating the role of miR-301a in promoting JEV-mediated neuroinflammation. Augmentation of miR-301a expression exerts its effect by suppressing NKRF expression, resulting in NF-κB activation–mediated increased production of proinflammatory cytokines. Inhibition of JEV-induced miR-301a expression conversely impaired this molecular pathway, thereby reducing M1 polarization of microglia and subsequent inflammatory response. Extensive gliosis is a hallmark of JEV infection, which results in the abrupt production of inflammatory cytokines and subsequently leads to neuronal cell damage (4). Therefore, suppression of an excessive inflammatory response can potentially terminate the progression of events leading to neuronal death and seems to be a promising remedy against JEV infection. In previous study, we found that increased expression of miR-301a in JEV-infected neuron repressed type I IFN by targeting IRF1 and SOCS5. Neutralization of JEV-induced miR-301a reinforced host innate immunity by restoring IFN-β expression and restricted viral propagation. miR-301a inhibition thus holds the potential to act as a double-edged sword by reinforcing type I IFN–mediated innate immunity as well as by preventing bystander damage of neurons via reduction of microglial overactivation. Thus targeting miR-301a could truly provide a new insight to develop an effective antiviral strategy in combating JEV infection.

We are grateful to S. Levison (Rutgers University), G. R. Medigeshi (Translational Health Science and Technology Institute), E. Sen (NBRC), and D. Chattopadhyay (Amity University) for providing cell lines and plasmids. We also acknowledge the help of Distributed Information Centre of NBRC for computer related technical and infrastructural support. We are thankful to K. L. Kumawat for helping to perform all animal experiments. We also thank M. Dogra for technical assistance.

This work was supported by research grants from the Department of Biotechnology (BT/PR22341/MED/122/55/2016) and the Tata Innovation Fellowship (BT/HRD/35/01/02/2014) to A.B.

The online version of this article contains supplemental material.

Abbreviations used in this article:

anti–miR-Con

anti–miR control

CBA

cytometric bead array

Con-esiRNA

esiRNA control

COX-2

cyclooxygenase-2

DIG

digoxigenin

esiRNA

endoribonuclease-prepared small interfering RNA

FFPE

formalin-fixed, paraffin embedded

iNOS

inducible NO synthase

IRF1

IFN regulatory factor 1

ISH

in situ hybridization

JEV

Japanese encephalitis virus

LNA

locked nucleic acid

MI

mock infection, mock-infected

miR-301a–VM

miR-301a Vivo-Morpholino

miRNA

microRNA

MOI

multiplicity of infection

NBRC

National Brain Research Centre

NKRF

NF-κB–repressing factor

NKRF esiRNA

esiRNA specific for NKRF

PCNA

proliferating cell nuclear Ag

qRT-PCR

quantitative RT-PCR

snRNA

small nuclear RNA

SOCS5

suppressor of cytokine signaling 5

UTR

untranslated region

VM-NC

Vivo-Morpholino negative control

WT

wild-type.

1
Cook
,
D. N.
,
D. S.
Pisetsky
,
D. A.
Schwartz
.
2004
.
Toll-like receptors in the pathogenesis of human disease.
Nat. Immunol.
5
:
975
979
.
2
Chen
,
C. J.
,
S. L.
Liao
,
M. D.
Kuo
,
Y. M.
Wang
.
2000
.
Astrocytic alteration induced by Japanese encephalitis virus infection.
Neuroreport
11
:
1933
1937
.
3
Sochocka
,
M.
,
B. S.
Diniz
,
J.
Leszek
.
2017
.
Inflammatory response in the CNS: friend or foe?
Mol. Neurobiol.
54
:
8071
8089
.
4
Ghoshal
,
A.
,
S.
Das
,
S.
Ghosh
,
M. K.
Mishra
,
V.
Sharma
,
P.
Koli
,
E.
Sen
,
A.
Basu
.
2007
.
Proinflammatory mediators released by activated microglia induces neuronal death in Japanese encephalitis.
Glia
55
:
483
496
.
5
Solomon
,
T.
,
N. M.
Dung
,
R.
Kneen
,
M.
Gainsborough
,
D. W.
Vaughn
,
V. T.
Khanh
.
2000
.
Japanese encephalitis.
J. Neurol. Neurosurg. Psychiatry
68
:
405
415
.
6
Solomon
,
T.
2006
.
Control of Japanese encephalitis--within our grasp?
N. Engl. J. Med.
355
:
869
871
.
7
Chen
,
C.-J.
,
J.-H.
Chen
,
S.-Y.
Chen
,
S.-L.
Liao
,
S.-L.
Raung
.
2004
.
Upregulation of RANTES gene expression in neuroglia by Japanese encephalitis virus infection.
J. Virol.
78
:
12107
12119
.
8
Verma
,
A. K.
,
S.
Ghosh
,
S.
Pradhan
,
A.
Basu
.
2016
.
Microglial activation induces neuronal death in Chandipura virus infection.
Sci. Rep.
6
:
22544
.
9
Nazmi
,
A.
,
S.
Mukherjee
,
K.
Kundu
,
K.
Dutta
,
A.
Mahadevan
,
S. K.
Shankar
,
A.
Basu
.
2014
.
TLR7 is a key regulator of innate immunity against Japanese encephalitis virus infection.
Neurobiol. Dis.
69
:
235
247
.
10
Kaushik
,
D. K.
,
R.
Mukhopadhyay
,
K. L.
Kumawat
,
M.
Gupta
,
A.
Basu
.
2012
.
Therapeutic targeting of Krüppel-like factor 4 abrogates microglial activation.
J. Neuroinflammation
9
:
57
.
11
Kaushik
,
D. K.
,
M.
Gupta
,
K. L.
Kumawat
,
A.
Basu
.
2012
.
NLRP3 inflammasome: key mediator of neuroinflammation in murine Japanese encephalitis.
PLoS One
7
: e32270.
12
Kaushik
,
D. K.
,
M.
Gupta
,
S.
Das
,
A.
Basu
.
2010
.
Krüppel-like factor 4, a novel transcription factor regulates microglial activation and subsequent neuroinflammation.
J. Neuroinflammation
7
:
68
.
13
Ambros
,
V.
2004
.
The functions of animal microRNAs.
Nature
431
:
350
355
.
14
Ardekani
,
A. M.
,
M. M.
Naeini
.
2010
.
The role of microRNAs in human diseases.
Avicenna J. Med. Biotechnol.
2
:
161
179
.
15
Ha
,
T.-Y.
2011
.
MicroRNAs in human diseases: from cancer to cardiovascular disease.
Immune Netw.
11
:
135
154
.
16
Cardoso
,
A. L.
,
J. R.
Guedes
,
M. C. P.
de Lima
.
2016
.
Role of microRNAs in the regulation of innate immune cells under neuroinflammatory conditions.
Curr. Opin. Pharmacol.
26
:
1
9
.
17
Brites
,
D.
,
A.
Fernandes
.
2015
.
Neuroinflammation and depression: microglia activation, extracellular microvesicles and microRNA dysregulation.
Front. Cell. Neurosci.
9
:
476
.
18
Thounaojam
,
M. C.
,
K.
Kundu
,
D. K.
Kaushik
,
S.
Swaroop
,
A.
Mahadevan
,
S. K.
Shankar
,
A.
Basu
.
2014
.
MicroRNA 155 regulates Japanese encephalitis virus-induced inflammatory response by targeting Src homology 2-containing inositol phosphatase 1.
J. Virol.
88
:
4798
4810
.
19
Thounaojam
,
M. C.
,
D. K.
Kaushik
,
K.
Kundu
,
A.
Basu
.
2014
.
MicroRNA-29b modulates Japanese encephalitis virus-induced microglia activation by targeting tumor necrosis factor alpha-induced protein 3.
J. Neurochem.
129
:
143
154
.
20
Ashraf
,
U.
,
B.
Zhu
,
J.
Ye
,
S.
Wan
,
Y.
Nie
,
Z.
Chen
,
M.
Cui
,
C.
Wang
,
X.
Duan
,
H.
Zhang
, et al
.
2016
.
MicroRNA-19b-3p modulates Japanese encephalitis virus-mediated inflammation via targeting RNF11.
J. Virol.
90
:
4780
4795
.
21
Zhu
,
B.
,
J.
Ye
,
Y.
Nie
,
U.
Ashraf
,
A.
Zohaib
,
X.
Duan
,
Z. F.
Fu
,
Y.
Song
,
H.
Chen
,
S.
Cao
.
2015
.
MicroRNA-15b modulates Japanese encephalitis virus-mediated inflammation via targeting RNF125.
J. Immunol.
195
:
2251
2262
.
22
Mycko
,
M. P.
,
M.
Cichalewska
,
A.
Machlanska
,
H.
Cwiklinska
,
M.
Mariasiewicz
,
K. W.
Selmaj
.
2012
.
MicroRNA-301a regulation of a T-helper 17 immune response controls autoimmune demyelination.
Proc. Natl. Acad. Sci. USA
109
:
E1248
E1257
.
23
Lu
,
Z.
,
Y.
Li
,
A.
Takwi
,
B.
Li
,
J.
Zhang
,
D. J.
Conklin
,
K. H.
Young
,
R.
Martin
,
Y.
Li
.
2011
.
miR-301a as an NF-κB activator in pancreatic cancer cells.
EMBO J.
30
:
57
67
.
24
Hazra
,
B.
,
K. L.
Kumawat
,
A.
Basu
.
2017
.
The host microRNA miR-301a blocks the IRF1-mediated neuronal innate immune response to Japanese encephalitis virus infection.
Sci. Signal.
10
: eaaf5185.
25
Bennett
,
M. L.
,
F. C.
Bennett
,
S. A.
Liddelow
,
B.
Ajami
,
J. L.
Zamanian
,
N. B.
Fernhoff
,
S. B.
Mulinyawe
,
C. J.
Bohlen
,
A.
Adil
,
A.
Tucker
, et al
.
2016
.
New tools for studying microglia in the mouse and human CNS.
Proc. Natl. Acad. Sci. USA
113
:
E1738
E1746
.
26
Huang
,
L.
,
Y.
Liu
,
L.
Wang
,
R.
Chen
,
W.
Ge
,
Z.
Lin
,
Y.
Zhang
,
S.
Liu
,
Y.
Shan
,
Q.
Lin
,
M.
Jiang
.
2013
.
Down-regulation of miR-301a suppresses pro-inflammatory cytokines in toll-like receptor-triggered macrophages.
Immunology
140
:
314
322
.
27
Rehmsmeier
,
M.
,
P.
Steffen
,
M.
Hochsmann
,
R.
Giegerich
.
2004
.
Fast and effective prediction of microRNA/target duplexes.
RNA
10
:
1507
1517
.
28
John
,
B.
,
A. J.
Enright
,
A.
Aravin
,
T.
Tuschl
,
C.
Sander
,
D. S.
Marks
.
2004
.
Human microRNA targets. [Published erratum appears in 2005 PLoS Biol. 3: e264.]
PLoS Biol.
2
: e363.
29
Lewis
,
B. P.
,
C. B.
Burge
,
D. P.
Bartel
.
2005
.
Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets.
Cell
120
:
15
20
.
30
Krek
,
A.
,
D.
Grün
,
M. N.
Poy
,
R.
Wolf
,
L.
Rosenberg
,
E. J.
Epstein
,
P.
MacMenamin
,
I.
da Piedade
,
K. C.
Gunsalus
,
M.
Stoffel
,
N.
Rajewsky
.
2005
.
Combinatorial microRNA target predictions.
Nat. Genet.
37
:
495
500
.
31
Reboll
,
M. R.
,
A. T.
Schweda
,
M.
Bartels
,
R.
Franke
,
R.
Frank
,
M.
Nourbakhsh
.
2011
.
Mapping of NRF binding motifs of NF-kappaB p65 subunit.
J. Biochem.
150
:
553
562
.
32
Nourbakhsh
,
M.
,
H.
Hauser
.
1999
.
Constitutive silencing of IFN-beta promoter is mediated by NRF (NF-kappaB-repressing factor), a nuclear inhibitor of NF-kappaB.
EMBO J.
18
:
6415
6425
.
33
Orihuela
,
R.
,
C. A.
McPherson
,
G. J.
Harry
.
2016
.
Microglial M1/M2 polarization and metabolic states.
Br. J. Pharmacol.
173
:
649
665
.
34
Morcos
,
P. A.
,
Y.
Li
,
S.
Jiang
.
2008
.
Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues.
Biotechniques
45
:
613
623
.
35
Olson
,
J. K.
,
S. D.
Miller
.
2004
.
Microglia initiate central nervous system innate and adaptive immune responses through multiple TLRs.
J. Immunol.
173
:
3916
3924
.
36
Bian
,
P.
,
C.
Ye
,
X.
Zheng
,
J.
Yang
,
W.
Ye
,
Y.
Wang
,
Y.
Zhou
,
H.
Ma
,
P.
Han
,
H.
Zhang
, et al
.
2017
.
Mesenchymal stem cells alleviate Japanese encephalitis virus-induced neuroinflammation and mortality.
Stem Cell Res. Ther.
8
:
38
.
37
Jhan
,
M.-K.
,
T.-T.
Tsai
,
C.-L.
Chen
,
C.-C.
Tsai
,
Y.-L.
Cheng
,
Y.-C.
Lee
,
C.-Y.
Ko
,
Y.-S.
Lin
,
C.-P.
Chang
,
L.-T.
Lin
,
C.-F.
Lin
.
2017
.
Dengue virus infection increases microglial cell migration.
Sci. Rep.
7
:
91
.
38
Lum
,
F.-M.
,
D. K. S.
Low
,
Y.
Fan
,
J. J. L.
Tan
,
B.
Lee
,
J. K. Y.
Chan
,
L.
Rénia
,
F.
Ginhoux
,
L. F. P.
Ng
.
2017
.
Zika virus infects human fetal brain microglia and induces inflammation.
Clin. Infect. Dis.
64
:
914
920
.
39
Sadasivan
,
S.
,
M.
Zanin
,
K.
O’Brien
,
S.
Schultz-Cherry
,
R. J.
Smeyne
.
2015
.
Induction of microglia activation after infection with the non-neurotropic A/CA/04/2009 H1N1 influenza virus.
PLoS One
10
: e0124047.
40
Garden
,
G. A.
2002
.
Microglia in human immunodeficiency virus-associated neurodegeneration.
Glia
40
:
240
251
.
41
Schachtele
,
S. J.
,
S.
Hu
,
M. R.
Little
,
J. R.
Lokensgard
.
2010
.
Herpes simplex virus induces neural oxidative damage via microglial cell toll-like receptor-2.
J. Neuroinflammation
7
:
35
.
42
Chauhan
,
V. S.
,
S. R.
Furr
,
D. G.
Sterka
Jr.
,
D. A.
Nelson
,
M.
Moerdyk-Schauwecker
,
I.
Marriott
,
V. Z.
Grdzelishvili
.
2010
.
Vesicular stomatitis virus infects resident cells of the central nervous system and induces replication-dependent inflammatory responses.
Virology
400
:
187
196
.
43
Cardoso
,
A. L.
,
J. R.
Guedes
,
L.
Pereira de Almeida
,
M. C.
Pedroso de Lima
.
2012
.
miR-155 modulates microglia-mediated immune response by down-regulating SOCS-1 and promoting cytokine and nitric oxide production.
Immunology
135
:
73
88
.
44
Yao
,
H.
,
R.
Ma
,
L.
Yang
,
G.
Hu
,
X.
Chen
,
M.
Duan
,
Y.
Kook
,
F.
Niu
,
K.
Liao
,
M.
Fu
, et al
.
2014
.
MiR-9 promotes microglial activation by targeting MCPIP1.
Nat. Commun.
5
:
4386
.
45
Kumari
,
B.
,
P.
Jain
,
S.
Das
,
S.
Ghosal
,
B.
Hazra
,
A. C.
Trivedi
,
A.
Basu
,
J.
Chakrabarti
,
S.
Vrati
,
A.
Banerjee
.
2016
.
Dynamic changes in global microRNAome and transcriptome reveal complex miRNA-mRNA regulated host response to Japanese Encephalitis Virus in microglial cells.
Sci. Rep.
6
:
20263
.
46
Feng
,
X.
,
Z.
Guo
,
M.
Nourbakhsh
,
H.
Hauser
,
R.
Ganster
,
L.
Shao
,
D. A.
Geller
.
2002
.
Identification of a negative response element in the human inducible nitric-oxide synthase (hiNOS) promoter: the role of NF-kappa B-repressing factor (NRF) in basal repression of the hiNOS gene.
Proc. Natl. Acad. Sci. USA
99
:
14212
14217
.
47
Nourbakhsh
,
M.
,
S.
Kalble
,
A.
Dorrie
,
H.
Hauser
,
K.
Resch
,
M.
Kracht
.
2001
.
The NF-kappa b repressing factor is involved in basal repression and interleukin (IL)-1-induced activation of IL-8 transcription by binding to a conserved NF-kappa b-flanking sequence element.
J. Biol. Chem.
276
:
4501
4508
.
48
Lee
,
K.-Y.
,
S.-C.
Ho
,
Y.-F.
Chan
,
C.-H.
Wang
,
C.-D.
Huang
,
W.-T.
Liu
,
S.-M.
Lin
,
Y.-L.
Lo
,
Y.-L.
Chang
,
L.-W.
Kuo
,
H.-P.
Kuo
.
2012
.
Reduced nuclear factor-κB repressing factor: a link toward systemic inflammation in COPD.
Eur. Respir. J.
40
:
863
873
.
49
Li
,
Q.
,
I. M.
Verma
.
2002
.
NF-kappaB regulation in the immune system. [Published erratum appears in 2002 Nat. Rev. Immunol. 2: 975.]
Nat. Rev. Immunol.
2
:
725
734
.
50
Karin
,
M.
,
F. R.
Greten
.
2005
.
NF-kappaB: linking inflammation and immunity to cancer development and progression.
Nat. Rev. Immunol.
5
:
749
759
.
51
Von Bernhardi
,
R.
,
L.
Eugenín-von Bernhardi
,
J.
Eugenín
.
2015
.
Microglial cell dysregulation in brain aging and neurodegeneration.
Front. Aging Neurosci.
7
:
124
.
52
Ma
,
X.
,
L. E.
Becker Buscaglia
,
J. R.
Barker
,
Y.
Li
.
2011
.
MicroRNAs in NF-kappaB signaling.
J. Mol. Cell Biol.
3
:
159
166
.
53
Tang
,
Y.
,
W.
Le
.
2016
.
Differential roles of M1 and M2 microglia in neurodegenerative diseases.
Mol. Neurobiol.
53
:
1181
1194
.
54
Parisi
,
C.
,
G.
Napoli
,
S.
Amadio
,
A.
Spalloni
,
S.
Apolloni
,
P.
Longone
,
C.
Volonté
.
2016
.
MicroRNA-125b regulates microglia activation and motor neuron death in ALS.
Cell Death Differ.
23
:
531
541
.

The authors have no financial conflicts of interest.

Supplementary data