Functional peptides encoded by short open reading frames are emerging as important mediators of fundamental biological processes. In this study, we identified a micropeptide produced from a putative long noncoding RNA (lncRNAs) that is important in controlling innate immunity. By studying lncRNAs in mice macrophages, we identified lncRNA 1810058I24Rik, which was downregulated in both human and murine myeloid cells exposed to LPS as well as other TLR ligands and inflammatory cytokines. Analysis of lncRNA 1810058I24Rik subcellular localization revealed that this transcript was localized in the cytosol, prompting us to evaluate its coding potential. In vitro translation with 35S-labeled methionine resulted in translation of a 47 aa micropeptide. Microscopy and subcellular fractionation studies in macrophages demonstrated endogenous expression of this peptide on the mitochondrion. We thus named this gene mitochondrial micropeptide-47 (Mm47). Crispr–Cas9–mediated deletion of Mm47, as well as small interfering RNA studies in mice primary macrophages, showed that the transcriptional response downstream of TLR4 was intact in cells lacking Mm47. In contrast, Mm47-deficient or knockdown cells were compromised for Nlrp3 inflammasome responses. Activation of Nlrc4 or Aim2 inflammasomes were intact in cells lacking Mm47. This study therefore identifies, to our knowledge, a novel mitochondrial micropeptide Mm47 that is required for the activation of the Nlrp3 inflammasome. This work further highlights the functional activity of short open reading frame–encoded peptides and underscores their importance in innate immunity.

This article is featured in In This Issue, p.241

Ribonucleic acid molecules can be divided into two categories: mRNAs and noncoding RNAs. A large proportion of the mammalian genome is transcribed as long noncoding RNAs (lncRNAs) (1). Recent studies have demonstrated diverse physiological functions for lncRNAs, including a growing appreciation for the role of these molecules in the immune system, in which they control the differentiation and/or activation of immune cells (25). In the innate immune system, our group and others have found that lncRNAs act as positive or negative regulators of inflammatory gene expression in a variety of immune cells, including macrophages (4, 5). However, many annotated lncRNAs have short open reading frames (sORFs) that may encode for functional proteins or small peptides (68). These sORF-encoded peptides (SEPs) or micropeptides are now being recognized for their functions in development, differentiation, transport, and other fundamental biological processes (7, 9). Indeed, a recent study has revealed that a large number of transcripts currently annotated as lncRNAs are associated with ribosomes and, in some cases, are translated (8). Among these, one such transcript, Aw112010, was found to be encoded from a noncanonical open reading frame (ORF) and found to play a role in Salmonella typhimurium infection and intestinal inflammation (8). Similarly, humanin, an antiapoptotic 24 aa SEP localized on the mitochondria, prevents Bax translocation from the cytosol to the mitochondria (10). Other SEPs, such as Dworf and Myoregulin, have also been shown to regulate calcium transport in the endoplasmic reticulum (ER) (11). Collectively, these studies highlight important roles for SEPs in fundamental biological processes, including cell death and innate immunity.

Macrophages represent the first line of defense against infection by detecting pathogens through germline-encoded pattern recognition receptors. These pattern recognition receptors recognize specific pathogen-associated molecular patterns (PAMPs) such as LPS and trigger the expression of proinflammatory cytokines and type I IFNs through the activation of the transcription factors NF-κB and IRF3 (12, 13). Macrophages also upregulate the expression of Nlrp3 and IL-1β, both of which are critical for mounting rapid immune responses during infection (14). Nlrp3 forms a multiprotein complex known as the inflammasome. Inflammasomes are cytoplasmic supramolecular complexes that form in response to microbial as well as endogenous damage or danger signals (13, 1517). Inflammasomes activate inflammatory caspases such as caspase-1, which in turn controls the protolytic maturation of the proinflammatory cytokines IL-1β and IL-18. Caspase-1 also cleaves gasdermin D (Gsdmd) to generate an N-terminal pore-forming fragment that facilitates cytokine release and pyroptotic cell death (1820). The Nlrp3 inflammasome is activated in response to a wide variety of microbial and endogenous danger signals, including nigericin, uric acid crystals, amyloid-β fibrils, and extracellular ATP. The precise mechanisms leading to the formation of the Nlrp3 inflammasome in response to these diverse ligands are still unclear, although K+ efflux and, in some cases, mitochondria are important (15, 21, 22).

In this study, we have identified a SEP encoded from an annotated intergenic lncRNA (lincRNA) transcript that is regulated in macrophages exposed to LPS. Loss of function studies identify a key role for this mitochondrial micropeptide-47 (Mm47) in controlling activation of the Nlrp3 inflammasome. CRISPR–Cas9 knockout (KO) of Mm47 or small interfering RNA (siRNA)–mediated suppression of Mm47 expression in primary cells resulted in impaired Nlrp3 inflammasome activation, leading to reduced activation of caspase-1 and compromised IL-1β secretion. The levels of Mm47 decrease following LPS stimulation, suggesting that inflammasomes could be turned off by eliminating this peptide. Given its mitochondrial localization and the functional link to the Nlrp3 inflammasome, we posit that Mm47 represents a novel signaling node in the emerging cross-talk between mitochondria and the Nlrp3 inflammasome.

Primary bone marrow–derived macrophages (BMDM) were generated from C57/Bl6N mice or B6 mice expressing Cas9–GFP (no. 024858; The Jackson Laboratory) and used or immortalized for later. Briefly, bone marrow cells were cultured in DMEM supplemented with 10% FCS, 1% penicillin/streptomycin, and 20% L929 conditioned media for 7 d to differentiate into BMDM cells. Immortalized BMDM were generated using J2 transforming retroviruses expressing Raf and Myc as described (23).

Knock down of Mm47 was performed using Silencer Select small inhibitory RNAs purchased from Thermo Fisher Scientific. Two nontargeting control (NTC) siRNAs (catalog no. 4390843, catalog no. 4390846; Thermo Fisher Scientific) and three siRNAs targeting Mm47 (catalog no. 4390771; Thermo Fisher Scientific) were used. Lipofectamine and RNAiMAX (13778030) were used to transfect 30 pmol siRNA in 1 × 106 BMDM cells. The cells were used for experiments at 72 h posttransfection.

CRISPR–cas9–mediated KO of Mm47 was performed using single-guide RNAs (sgRNAs). Nontargeting sgRNAs used were NTC forward (Fwd) 5′-GGCGAGGTATTCGGCTCCGC-3′ and NTC reverse (Rev) 5′-CGCGGAGCCGAATACCTCGC-3′. The sgRNAs targeting Mm47 genomic region were sgRNA1 Fwd 5′-CAACGTGGTTGGAATGTATC-3′, sgRNA1 Rev 5′-GATACATTCCAACCACGTTG-3′, sgRNA2 Fwd 5′-TGAAGAGATTAAGAAGGACC-3′, and sgRNA2 Rev 5′-GGTCCTTCTTAATCTCTTCA-3′. Lentivirus packaging the sgRNAs was used to transduce immortalized BMDM expressing cas9–GFP. The cells were selected using 5 μg/ml puromycin and used for their respective experiments. To rescue Mm47 expression, we created a new construct in which the Pam sites were altered on the Mm47 DNA sequence to be resistant to cas9-mediated cleavage. Retrovirus was created using the empty vector or CRISPR–cas9–resistant Mm47 and used to transduce KO cells, which were selected for stable lines using 2 μg/ml blasticidin.

The cells were treated with LPS (100 ng/ml), polyinosinic-polycytidilic acid [Poly(I:C)] (25 μg/ml), Pam3Csk4 (100 nM), CLO97 (200 ng/ml), TNF-α (10 ng/ml), and IFN-α (500 U/ml) purchased from Sigma-Aldrich. Cell lysate and supernatant were collected for RNA analysis and ELISA, respectively. ELISA was performed for IL-1β, TNF-α, and IL-6 using kits available from R&D Systems. RNA was extracted from cells using the Aurum Kit (7326820; Bio-Rad Laboratories).

Total RNA was extracted from cells using Aurum Total RNA Mini Kit (7326820; Bio-Rad Laboratories) or TRIzol (15596026; Invitrogen), according to the product manual. The cDNA was synthesized using iScript Reverse Transcription Supermix (1708840; Bio-Rad Laboratories). Quantitative PCR on the cDNA was performed in Bio-Rad CFX96 Touch Real-time PCR using gene-specific primers. The genes were normalized to the housekeeping gene Gapdh. Mouse primers used are GAPDH Fwd 5′-TGGCAAAGTGGAGATTGTTGC-3′, GAPDH Rev 5′-AAGATGGTGATGGGCTTCCCG-3′, MALAT1 Fwd 5′-TTGGGACAGTGGACGTGTGG-3′, MALAT1 Rev 5′-TCAAGTGCCAGCAGACAGCA-3′, Mm47 Fwd 5′-GCTCAGAACTATGAAATGCCAAAC-3′, Mm47 Rev 5′-GGTCTCAGAAGCAGGTGGAC-3′, IL-1 β Fwd 5′-GCCACCTTTTGACAGTGATGAG-3′, IL-1 β Rev 5′-GTTTGGAAGCAGCCCTTCATC-3′, Nlrp3 Fwd 5′-CATGTTGCCTGTTCTTCCAGAC-3′, and Nlrp3 Rev 5′-CGGTTGGTGCTTAGACTTGAGA-3′. Human primers used were GAPDH Fwd 5′-TGCAACAACCAACTGCTTA-3′, GAPDH Rev 5′-AGAGGCAGGGATGATGTTC-3′, Mm47 Fwd 5′-CACCGACATCATGCTCGAGT-3′, and Mm47 Rev 5′-GCCAGATACATTCCAACCACGT-3′.

BMDMs stimulated as per the experiment were lysed in buffer containing 20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, and 5 mM EDTA with fresh 1× Halt Protease Inhibitor mixture (no. 1861279; Promega). Homogenized lysates were resolved on 14% SDS-PAGE and transferred to 0.2 μM PVDF membrane. Membranes were blocked with 5% nonfat dry milk (w/v) and probed with Abs diluted in 1× PBS and 0.05% Tween-20 (v/v). The Abs used were pro–IL-1β (AF-401-NA; R&D Systems), caspase-1 (sc-514; Santa Cruz Biotechnology), Gsdmd (AB209845; Abcam), β-actin (Sigma), Nlrp3 (clone cryo-2; Enzo Life Sciences), Gapdh (G9295; Sigma), Flag (A8592; Sigma), KDEL (10C3; Enzo Life Sciences), Tom20 (AB186734; Abcam), VDAC (4866S; Cell Signaling Technology), and HSP60 (13115; Santa Cruz Biotechnology). The Mm47 Ab was custom made by Thermo Fisher Scientific against the immunogenic residue 22–47 of Mm47. Membranes were probed with HRP-conjugated anti-mouse (172-1011; Bio-Rad Laboratories) and anti-rabbit (170-6515; Bio-Rad Laboratories) or anti-goat (172-1034; Bio-Rad Laboratories) and developed using ECL Chemiluminescent Substrate (Pierce Biotechnology).

MitoTracker Deep Red (M22426; Thermo Fisher Scientific) dye for mitochondrial staining was added to live cells as per the manual. Cells were fixed on eight-well chambered slides (155411; Lab-Tek) using ice-cold 4% paraformaldehyde for 15 min and washed with 1× PBS. The cells were permeabilized using 0.2% Triton X-100 in 1× PBS for 15 min and blocked using 5% Normal Goat Serum (005-000-121; Jackson ImmunoResearch Laboratories) in 1× PBS and 0.2% Triton X-100. Cells were incubated with Abs against Flag–Alexa Fluor 488 (5407S; Cell Signaling Technology) or Mm47 (custom made; Thermo Fisher Scientific) and anti-rabbit Alexa Fluor 488 (A11008; Thermo Fisher Scientific) was used as a secondary Ab. The cells were washed with PBS and incubated with DAPI at room temperature for 10 min and washed again, followed by imaging using Leica SP8 Lightning Confocal Microscope.

The 5′- and 3′-ends of Mm47 transcript were determined using FirstChoice RLM-RACE Kit (AM1700; Ambion), according to the manufacturer’s instructions. The 1810058I24Rik gene-specific primers used were Fwd 5′-GATAGCTGCTGGGGACTCAC-3′ and Rev 5′-CGTGGTTGGAATGTATCTGGCT-3′.

Primary BMDM cells were suspended in resuspension buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, and 10 mM MgCl2). To the cell suspension, 10% Nonidet P-40 (v/v) was added, mixed, incubated on ice for 10 min, and centrifuged at 13,000 rpm × g for 30 s. The supernatant was used for cytosolic RNA, and the pellets were washed a few times and used to extract nuclear RNA using QIAGEN RNAeasy Kit. GAPDH and MALAT1 were used as cytoplasmic and nuclear controls, respectively.

Optimized real-time PCR primers were bound to 96-well plate by QIAGEN (330171) specific for 72 annotated lincRNA genes, eight housekeeping genes, six protein-coding inflammatory genes, and quantitative RT-PCR (qRT-PCR) positive and negative controls. The 2ΔCT value for each gene was calculated against the average of β-actin and B2M for each treatment condition.

Mouse embryonic fibroblasts (MEFs) were used to perform sucrose discontinuous gradient centrifugation to separate cytosolic, ER, and mitochondrial fractions as described before (24). Briefly, MEFs were lysed in MTE buffer (270 mM Mannitol plus 10 mM Tris plus 0.1 mM EDTA) and spun at 1400 rpm × g for 10 min. The supernatant was spun at 15,000 rpm × g for 10 min to separate crude ER fraction in the supernatant and mitochondrial fraction in the pellet. The crude ER fraction was further spun on a sucrose gradient of 1.3, 1.5, and 2 M at 152,000 rpm × g for 74 min followed by collection, washing, and drying of the pure ER band. Similarly, the crude mitochondrial fraction in the pellet was loaded to a sucrose gradient of 1 and 1.7 M and spun at 40,000 rpm × g for 30 min followed by collection, washing, and drying of the pure mitochondrial band. All the high-speed centrifugation was performed in Beckman Coulter SW40-Ti.

Plasmids with full wild type sequence and frame-shifted mutant sequence of Mm47 with T7 promoter tag were prepared. The PCR primers used for cloning are Mm47 XhoI Flag Fwd 5′-ATCCTCGAG ATGGACTACAAGGACGACGATGACAAGCTCCAGTTCCTGCTTGGATTTACTT-3′, Mm47 XhoI Fwd 5′-ATCCTCGAGATGCTCCAGTTCCTGCTTGGATTTACTT-3′, Mm47 BglII Rev 5′-CATAGATCTTCAGGAACTAGGGGGCTTCTT-3′, Mm47 BglII Flag Rev 5′-CATAGTCTTCACTTGTCATCGTCGTCCTTGTAGTCGGAACTAGGGGGCTTCTT-3′, Mm47 XhoI T7 FS Fwd 5′-ATCCTCGAGTAATACGACTCACTATAGATGACTCCAGTTCCTGCTTGGATTTACTT-3′, and Mm47 XhoI T7 promoter Fwd 5′-CTCGAGTAATACGACTCACTATAGGGACCTCTCACACCCTCCTCG-3′. MEGAscript Transcription kit (AM1334) was used to produce RNA. Retic Lysate Kit (AM1200) and EasyTag Express35S Protein Labeling Mix, [35S] (catalog no. NEG772002MC) were used to generated radiolabeled Mm47 peptides.

Statistical analysis was performed with an unpaired, two-tailed Student t test in GraphPad Prism software, version 7.0.

The macrophage transcriptome is dynamically regulated in response to microbial and endogenous stimuli (12, 25). LPS, which is recognized by TLR4/MD2, leads to the induction of a transcriptional program through NF-κB, IRFs, and STAT proteins. Previous work from our laboratory and others has demonstrated that TLRs also regulate the expression of lncRNAs, including both antisense lncRNAs and lincRNAs. For example, lincRNAs such as lincRNA-Cox2 (Ptgs2os2) and lincRNA-EPS are regulated in response to LPS and exhibit broad regulatory effects by controlling inflammatory gene expression (26, 27). These lncRNAs were identified following transcriptional analysis of mouse BMDM stimulated with LPS using RNA sequencing (Fig. 1A). To further examine the role of lncRNAs in macrophages, in this study, we generated a custom PCR array for an in-depth investigation of the expression of 72 lncRNAs, including genes that were TLR4 regulated (log2 fold change >2 or <−2) or abundantly expressed in BMDMs (26, 27). A heatmap showing the expression of this set of 72 lncRNAs in mouse macrophages treated with LPS (TLR4), Pam3CSK4 (TLR2), Poly I:C (TLR3), CL097 (TLR7), or the cytokines TNF-α and type I IFN is shown (Fig. 1B). Consistent with our previous studies, the expression of lincRNA-Cox2 was induced by all of these ligands, whereas lincRNA-EPS was downregulated in cells exposed to all of these stimuli. In addition, among the downregulated lncRNAs was a gene that was previously uncharacterized, called 1810058I24Rik. This transcript was downregulated in response to multiple ligands (Fig. 1B). We confirmed the downregulation of this lncRNA in response to LPS as well as other TLR ligands, as shown by qRT-PCR (Fig. 1C). The RNA virus Sendai virus did not lead to a downregulation of this RNA.

FIGURE 1.

Identification of Mm47 as a putative lincRNA regulated in the immune response. (A) Schematic detailing pipeline for identification of immune-regulated lincRNAs. (B) Quantitative profiling of candidate lincRNAs in response to various PAMPs and cytokines. Cells were treated with LPS (100 ng/ml), Poly(I:C) (25 μg/ml), Pam3Csk4 (100 nM), CLO97 (200 ng/ml), TNF-α (10 ng/ml), and IFN-α/β (500 U/ml). Upregulated genes are in red, and downregulated genes are in blue. Mm47 is highlighted in green. (C) qRT-PCR of Mm47 relative to Gapdh in response to bacterial and viral PAMPs. Cells were treated with Pam3Csk4 (100 nM), Poly(I:C) (25 μg/ml), LPS (100 ng/ml), CLO97 (200 ng/ml), CpGB (2 μg), and Sendai virus (400 hemagglutination unit). Data represent mean ± SEM from three experiments. *p < 0.03, **p < 0.002, ***p < 0.001; ns, not significant. (D) qRT-PCR showing expression level of Mm47 in wild type B6 mice tissues compared with housekeeping gene Gapdh. Data represent mean ± SEM from three mice.

FIGURE 1.

Identification of Mm47 as a putative lincRNA regulated in the immune response. (A) Schematic detailing pipeline for identification of immune-regulated lincRNAs. (B) Quantitative profiling of candidate lincRNAs in response to various PAMPs and cytokines. Cells were treated with LPS (100 ng/ml), Poly(I:C) (25 μg/ml), Pam3Csk4 (100 nM), CLO97 (200 ng/ml), TNF-α (10 ng/ml), and IFN-α/β (500 U/ml). Upregulated genes are in red, and downregulated genes are in blue. Mm47 is highlighted in green. (C) qRT-PCR of Mm47 relative to Gapdh in response to bacterial and viral PAMPs. Cells were treated with Pam3Csk4 (100 nM), Poly(I:C) (25 μg/ml), LPS (100 ng/ml), CLO97 (200 ng/ml), CpGB (2 μg), and Sendai virus (400 hemagglutination unit). Data represent mean ± SEM from three experiments. *p < 0.03, **p < 0.002, ***p < 0.001; ns, not significant. (D) qRT-PCR showing expression level of Mm47 in wild type B6 mice tissues compared with housekeeping gene Gapdh. Data represent mean ± SEM from three mice.

Close modal

1810058I24Rik is transcribed from mouse chromosome 6. The 1810058I24Rik transcript is spliced and has three exons (Supplemental Fig. 1A). Using 5′- and 3′-RACE, we determined the full-length sequence (580 nt) of the spliced 1810058I24Rik (Supplemental Fig. 1A, 1B). qRT-PCR analysis of RNA extracted from mouse organs showed a broad expression profile of this transcript in muscle, lung, spleen, liver, and kidney as well as the small and large intestine (Fig. 1D). There was limited expression in brain and heart.

We next performed copy number analysis to define the abundance of this lncRNA. lncRNA 1810058I24Rik was expressed at ∼1250 copies per cell in mouse macrophages, and these levels were reduced to ∼400 in response to LPS (Fig. 2A, 2B, Supplemental Fig. 1C). 1810058I24Rik is also conserved in humans, where we found that it was also expressed at high levels in human monocytes (∼900 copies per cell) and dendritic cells, in which it also exhibits a pattern of downregulation in response to LPS in both cell types (Supplemental Fig. 1D [monocytes] and Supplemental Fig. 1E [monocyte-derived dendritic cells]). We next sought to address the mechanism involved in the downregulation of 1810058I24Rik. In wild type BMDM, the expression of 1810058I24Rik was reduced in response to LPS stimulation. However, this downregulation was lost in cells lacking TLR4 or TRIF but was still observed in cells lacking MyD88, suggesting that the TLR4–TRIF pathway shuts down expression of this transcript (Fig. 2C).

FIGURE 2.

Mm47 transcript is downregulated in activated macrophage in Tlr4/MyD88-dependent manner. (A) qRT-PCR showing the copy number of mature transcripts of Mm47 in BMDM cells with and without LPS treatment. (B) qRT-PCR of Mm47 transcript with LPS treatment compared with Gapdh. (C) qRT-PCR showing Mm47 transcript downregulation in BMDM cells in response to 100 μg/ml LPS. (A–C) Data represent mean ± SEM of three experiments. *p < 0.03, **p < 0.002; ns, not significant.

FIGURE 2.

Mm47 transcript is downregulated in activated macrophage in Tlr4/MyD88-dependent manner. (A) qRT-PCR showing the copy number of mature transcripts of Mm47 in BMDM cells with and without LPS treatment. (B) qRT-PCR of Mm47 transcript with LPS treatment compared with Gapdh. (C) qRT-PCR showing Mm47 transcript downregulation in BMDM cells in response to 100 μg/ml LPS. (A–C) Data represent mean ± SEM of three experiments. *p < 0.03, **p < 0.002; ns, not significant.

Close modal

Understanding the subcellular localization of a lncRNA can be informative. Frequently, these RNAs are localized in the nucleus, in which they alter the expression of protein-coding genes by controlling gene transcription. There is also evidence that lncRNAs can be localized and function in the cytosol and act as sponges for microRNAs (4, 5). Thus, we tested the subcellular location of the 1810058I24Rik transcript by generating cytosolic and nuclear extracts, purifying RNA and performing qRT-PCR. Malat1, a well-characterized lncRNA that functions in the nucleus, was detected in the nuclear fraction (28). In contrast, the 1810058I24Rik transcript was predominantly cytosolic (Fig. 3A). This was similar to the localization of the mature GAPDH mRNA, a protein-coding gene that would be translated in the cytosol. Given the cytosolic location of the 1810058I24Rik transcript, we next evaluated the potential protein-coding capacity of this putative lncRNA because many lncRNAs are misannotated and may encode functional proteins or sORFs. The National Center for Biotechnology Information ORFfinder program revealed three putative ORFs in 1810058I24Rik, which included a 47-aa ORF that shows high conservation across diverse species from Caenorhabditis elegans to humans (Fig. 3B). In light of this observation, we wanted to address the possibility that 1810058I24Rik may be a protein-coding gene. To test this, we performed in vitro translation assays using 35S-labeled methionine, which confirmed that the 1810058I24Rik RNA was indeed translated into ∼5.1 kDa peptide (Fig. 3C, Supplemental Fig. 2A). We also generated a mutant with a frameshift mutation inserted immediately after the start site and found that this mutation ablated translation. Next, we cloned the putative ORF into a cDNA expression vector with a Flag tag at either the N terminus, C terminus, or both. We could detect Flag-tagged translated 1810058I24Rik only with C-terminal tags in MEFs and 293T human cells (Fig. 3D, Supplemental Fig. 2B, 2C). SignalP protein domain prediction suggested that the N terminus of 1810058I24Rik contained a potential signal sequence. The addition of the N-terminal tag may not be tolerable, causing degradation of 1810058I24Rik SEP. Finally, to formally define the presence of this peptide in cells, we generated an Ab to detect the endogenous 1810058I24Rik SEP. Consistent with our expression data, endogenous 1810058I24Rik SEP was expressed in BMDM. The levels of this peptide decreased in response to LPS. 1810058I24Rik SEP was abundant in macrophages and was decreased after 24 h post-LPS treatment (Fig. 3E).

FIGURE 3.

Mm47 encodes for a stable micropeptide. (A) Subcellular fraction and qRT-PCR of Malat1, Gapdh, and Mm47 to test the localization of Mm47 transcript. Data represent mean ± SEM of three independent experiments. (B) Mm47 micropeptide sequence alignment across species of different phyla. “*”, fully conserved residue; “:”, highly conserved residue and >0.5 Gonnet Pam 250 matrix; “.”, weakly conserved residue and <0.5 Gonnet Pam 250 matrix. (C) In vitro translation assay using 35S-labeled methionine and SDS-PAGE electrophoresis showing 5.1-kDa band of Mm47 micropeptide in wild type (WT) sequence. Representative immunoblot of three independent experiments is shown. (D) Expression of Flag-tagged Mm47 micropeptide in MEFs and immunoblotting for Flag tag. Representative immunoblot of three independent experiments is shown. (E) Western blot of endogenous Mm47 micropeptide with LPS treatment. Representative immunoblot of three independent experiments is shown.

FIGURE 3.

Mm47 encodes for a stable micropeptide. (A) Subcellular fraction and qRT-PCR of Malat1, Gapdh, and Mm47 to test the localization of Mm47 transcript. Data represent mean ± SEM of three independent experiments. (B) Mm47 micropeptide sequence alignment across species of different phyla. “*”, fully conserved residue; “:”, highly conserved residue and >0.5 Gonnet Pam 250 matrix; “.”, weakly conserved residue and <0.5 Gonnet Pam 250 matrix. (C) In vitro translation assay using 35S-labeled methionine and SDS-PAGE electrophoresis showing 5.1-kDa band of Mm47 micropeptide in wild type (WT) sequence. Representative immunoblot of three independent experiments is shown. (D) Expression of Flag-tagged Mm47 micropeptide in MEFs and immunoblotting for Flag tag. Representative immunoblot of three independent experiments is shown. (E) Western blot of endogenous Mm47 micropeptide with LPS treatment. Representative immunoblot of three independent experiments is shown.

Close modal

We next aimed to further understand where the 1810058I24Rik SEP was localized in cells. The SignalP program suggested that 1810058I24Rik may be localized to the mitochondria, despite the absence of a canonical mitochondrial targeting signal (29). A partial protein sequence of 1810058I24Rik had previously been reported in bovine heart and zebrafish mitochondria (30, 31). To determine if the 1810058I24Rik peptide localized at the mitochondria, we performed immunostaining on FLAG-tagged 1810058I24Rik SEP ectopically expressed in MEFs. This analysis revealed that the 1810058I24Rik peptide colocalized with the mitochondrial marker MitoTracker Deep Red (Fig. 4A). Given this localization, we propose to rename 1810058I24Rik SEP as mitochondrial Mm47. We next confirmed the localization of endogenous Mm47 in macrophages. Abs against the endogenous Mm47 again revealed mitochondrial localization in mouse BMDMs (Fig. 4B). The ER and mitochondria are known to intimately associate, which may affect the immunofluorescence imaging (32). Therefore, we employed sucrose gradient ultracentrifugation to separate pure cytosolic, ER, and mitochondrial fractions (33). Using the mitochondrial membrane protein Tom20 as a positive control, Western blot analysis confirmed that the Mm47 peptide is predominantly localized on the mitochondria (Fig. 4C). Further subfractionation of the mitochondrial fraction revealed that Mm47 is highly enriched on the outer membrane and intermembrane fraction of the mitochondrion, as indicated by the corresponding localization of VDAC, an outer membrane protein (Fig. 4D). Overall, these studies indicate that the 1810058I24Rik transcript encodes a peptide that is localized to the mitochondrion.

FIGURE 4.

Mm47 micropeptide is localized on the mitochondria. (A) Ectopic expression of Flag-tagged Mm47 in MEF followed by immunofluorescence imaging of Flag-Mm47 (green), MitoTracker Deep Red (red) for mitochondria, and DAPI (blue) for nucleus. Representative images from three independent experiments are shown. (B) Immunofluorescence imaging of endogenous Mm47, MitoTracker Deep Red for mitochondria, and DAPI for nucleus. Representative images from three independent experiments are shown. (C) Subcellular fraction of the cytosolic, ER, and mitochondrial fraction followed by immunoblot for endogenous Mm47, mitochondrial outer membrane protein Tom20, ER membrane protein KDEL, and cytosolic protein Gapdh. Representative immunoblot of three independent experiments is shown. (D) Suborganelle fractionation of the outer and inner mitochondrial compartment followed by immunoblot for endogenous Mm47, outer mitochondrial membrane protein VDAC, and mitochondrial matrix protein HSp60.

FIGURE 4.

Mm47 micropeptide is localized on the mitochondria. (A) Ectopic expression of Flag-tagged Mm47 in MEF followed by immunofluorescence imaging of Flag-Mm47 (green), MitoTracker Deep Red (red) for mitochondria, and DAPI (blue) for nucleus. Representative images from three independent experiments are shown. (B) Immunofluorescence imaging of endogenous Mm47, MitoTracker Deep Red for mitochondria, and DAPI for nucleus. Representative images from three independent experiments are shown. (C) Subcellular fraction of the cytosolic, ER, and mitochondrial fraction followed by immunoblot for endogenous Mm47, mitochondrial outer membrane protein Tom20, ER membrane protein KDEL, and cytosolic protein Gapdh. Representative immunoblot of three independent experiments is shown. (D) Suborganelle fractionation of the outer and inner mitochondrial compartment followed by immunoblot for endogenous Mm47, outer mitochondrial membrane protein VDAC, and mitochondrial matrix protein HSp60.

Close modal

We next examined the possibility that Mm47 played a role in regulating the magnitude or duration of the LPS response in macrophages. Using CRISPR–Cas9, we created Mm47 KO immortalized mouse macrophages. Western blot analysis of BMDMs expressing an NTC guide RNA and three guide RNAs targeting Mm47 confirmed KO of Mm47 in the three cell lines examined (Fig. 5A). We then monitored LPS-dependent transcriptional responses in these cells using NanoString technology to simultaneously detect the expression of 100 immune system–related genes. As shown in Fig. 5B, LPS treatment led to an increase in the expression of a broad panel of immune genes in the control lines after 2 and 6 h of LPS. These responses were largely intact in macrophages lacking Mm47. These results suggest that Mm47 does not impact the transcriptional response induced in macrophages following LPS stimulation.

FIGURE 5.

Mm47-deficient immortalized BMDM have impaired Nlrp3 pathway. (A) Western blot for endogenous Mm47 after CRISPR–Cas9–mediated KO. (B) Heatmap of inflammatory genes tested using NanoString code set to compare the response of NTC cells and Mm47 KO cells to 100 ng/ml LPS treatment for 2 and 6 h. Transcription change shown as log2 fold change compared with NTC. (C) ELISA for secreted IL-1β in nontargeted and CRISPR–cas9–mediated KO of Mm47 in BMDM after priming with 100 ng/ml LPS and stimulation with 5 μM nigericin. (D) ELISA for secreted IL-1β in nontargeted and CRISPR–cas9–mediated KO of Mm47 in BMDM after priming with 100 ng/ml LPS and stimulation with 5 μM ATP. (E) ELISA to test AIM2 receptor–mediated secretion of IL-1β in BMDM with or without Mm47 KO upon 100 ng/ml LPS priming and 2 μg Poly(dA:dT) transfection. (F) ELISA to test NLRC4 receptor–mediated IL-1β secretion in primary BMDM with or without Mm47 KO upon S. typhimurium infection for 6 h. (G) Western blot of Mm47 to test restoration of CRISPR–cas9–resistant Mm47 expression using lentiviral transduction. The control cells were transduced with empty vector (EV), and rescued cells (R) were transduced with CRISPR–cas9–resistant Mm47. (H) ELISA testing secreted IL-1β expression in control and CRISPR–cas9–resistant Mm47-reconstituted cells upon priming with 100 ng/ml LPS and stimulation with 5 μM nigericin. (A–F) Data represent mean ± SEM of three experiments. **p < 0.002, ***p < 0.001; ns, not significant.

FIGURE 5.

Mm47-deficient immortalized BMDM have impaired Nlrp3 pathway. (A) Western blot for endogenous Mm47 after CRISPR–Cas9–mediated KO. (B) Heatmap of inflammatory genes tested using NanoString code set to compare the response of NTC cells and Mm47 KO cells to 100 ng/ml LPS treatment for 2 and 6 h. Transcription change shown as log2 fold change compared with NTC. (C) ELISA for secreted IL-1β in nontargeted and CRISPR–cas9–mediated KO of Mm47 in BMDM after priming with 100 ng/ml LPS and stimulation with 5 μM nigericin. (D) ELISA for secreted IL-1β in nontargeted and CRISPR–cas9–mediated KO of Mm47 in BMDM after priming with 100 ng/ml LPS and stimulation with 5 μM ATP. (E) ELISA to test AIM2 receptor–mediated secretion of IL-1β in BMDM with or without Mm47 KO upon 100 ng/ml LPS priming and 2 μg Poly(dA:dT) transfection. (F) ELISA to test NLRC4 receptor–mediated IL-1β secretion in primary BMDM with or without Mm47 KO upon S. typhimurium infection for 6 h. (G) Western blot of Mm47 to test restoration of CRISPR–cas9–resistant Mm47 expression using lentiviral transduction. The control cells were transduced with empty vector (EV), and rescued cells (R) were transduced with CRISPR–cas9–resistant Mm47. (H) ELISA testing secreted IL-1β expression in control and CRISPR–cas9–resistant Mm47-reconstituted cells upon priming with 100 ng/ml LPS and stimulation with 5 μM nigericin. (A–F) Data represent mean ± SEM of three experiments. **p < 0.002, ***p < 0.001; ns, not significant.

Close modal

Given the localization of Mm47 on the mitochondria and the literature that reveals how damaged or defective mitochondria contribute to the activation of inflammation through the engagement of Nlrp3, we next examined the possibility that Mm47 played a role in controlling the activation of the Nlrp3 inflammasome. Immortalized BMDM were primed with LPS for 3 h to upregulate IL-1β and Nlrp3 itself, followed by stimulation with nigericin, a potassium ionophore and bacterial pore-forming toxin that leads to the formation of the Nlrp3 inflammasome complex. LPS priming and nigericin stimulation led to robust secretion of IL-1β as measured by ELISA. This response was significantly abrogated in cells lacking Mm47 (Fig. 5C). This Mm47-dependent release of IL-1β was also abrogated in cells stimulated with another Nlrp3 activator, ATP (Fig. 5D). Indeed, this effect of Mm47 was specific for the Nlrp3 inflammasome as Mm47-deficient cells had comparable IL-1β release when cells were stimulated with poly(deoxyadenylic-deoxythymidylic) [Poly(dA:dT)], a dsDNA mimetic that activates the Aim2 inflammasome (Fig. 5E) or when cells were infected with S. typhimurium, a bacterial pathogen that activates the Nlrc4 inflammasome (Fig. 5F). We also performed rescue experiments by restoring Mm47 levels in the KO cells. This was achieved by ectopically expressing Mm47 in a form that was resistant to Cas9-directed cleavage. This approach led to restoration of Mm47 at levels observed in wild type cells (Fig. 5G). These restored cells were fully competent for LPS/nigericin-induced secretion of IL-1β (Fig. 5H, Supplemental Fig. 3A). Together, these observations indicate that Mm47 controls the activation of the Nlrp3 inflammasome in a highly specific manner.

Because mitochondrial reactive oxygen species (mtROS) contributes to the priming of macrophages via Hif1α-mediated transcription of pro–IL-1β as well as activation of the Nlrp3 inflammasome, we tested the levels of mtROS in cells (3436). We did not observe a significant increase in mtROS in LPS-treated cells, and there was no difference between Mm47-deficient and wild type cells (Supplemental Fig. 3B). Similarly, alteration in mitochondrial electron transport chain (ETC) function affects ATP levels, which in turn alter Nlrp3 activation (37). Therefore, we tested the mitochondrial oxygen consumption rate (OCR) as a proxy for mitochondrial ATP. We notice that the Mm47-deficient cells had reduced basal OCR. However, after the addition of chemical inhibitors of ETC, we observed similar levels of OCR in both wild type and Mm47 KO cells with reduced maximal OCR in LPS-exposed cells (Supplemental Fig. 3C). We conclude from these studies that Mm47 does not contribute to the generation of ATP during mitochondrial ETC stress.

To further corroborate the finding that Mm47 impacts Nlrp3 inflammasome-mediated IL-1β production, we employed an independent siRNA approach in primary BMDM. BMDM were transfected with two nontargeting siRNAs or with three Mm47-targeting siRNAs. Analysis of LPS and nigericin responses in these cells showed that siRNAs targeting Mm47 led to a significant reduction in IL-1β in response to nigericin treatment (Fig. 6A). Meanwhile, release of IL-1β was comparable between nontargeting siRNA and Mm47-targeting siRNA-transfected cells when cells were stimulated with dsDNA (poly (dA:dT)) or infected with S. typhimurium (Fig. 6B, 6C). Immunoblotting of cell lysates and supernatants revealed that Mm47-targeting siRNAs led to reduced processing of caspase-1 p20 and mature IL-1β (p17) (Fig. 6D). We also measured mRNA levels of pro–IL-1β or Nlrp3 itself in Mm47–siRNA–targeted cells, and in both cases, the responses were intact (Fig. 6E, Supplemental Fig. 4A). Furthermore, the Mm47–siRNA–targeted cells displayed reduced levels of processed Gsdmd compared with controls. This effect on Gsdmd, however, did not have a significant impact on cell death (Supplemental Fig. 4B, 4C). Collectively, these findings reveal that expression of Mm47 is essential to facilitate the activation of the Nlrp3 inflammasome and the release of IL-1β and Gsdmd processing with a modest impact on cell death.

FIGURE 6.

Mm47-deficient BMDM have impaired Nlrp3 pathway. (A) ELISA testing the secreted IL-1β levels upon priming with 100 ng/ml LPS and treatment with 5 μM nigericin in nontargeted or siRNA-mediated knock down of Mm47 in primary BMDM. Two nontargeting lines (NT1 and NT2) were used as a control, and three independent siRNAs targeting Mm47 were used. (B) ELISA testing AIM2 receptor–mediated secretion of IL-1β in primary BMDM with or without Mm47 knock down upon LPS priming followed by 2 μg Poly(dA:dT) transfection. (C) ELISA testing NLRC4 receptor–mediated IL-1β secretion in primary BMDM with or without Mm47 knock down upon S. typhimurium infection for 6 h. (D) Mm47 was knocked down using siRNA or nontargeting siRNA in primary BMDM cells. Cells were challenged as indicated, and Western bot was performed to procaspase-1, cleaved caspase-1, pro–IL-1β, and cleaved IL-1β. Representative images from three independent experiments are shown. (E) qRT-PCR showing mRNA levels of IL-1β and Nlrp3 after priming primary BMDM with 100 ng/ml LPS for 2 h with or without Mm47 knock down. (A–D) Data represent mean ± SEM of three experiments. *p < 0.03, ***p < 0.001; ns, not significant.

FIGURE 6.

Mm47-deficient BMDM have impaired Nlrp3 pathway. (A) ELISA testing the secreted IL-1β levels upon priming with 100 ng/ml LPS and treatment with 5 μM nigericin in nontargeted or siRNA-mediated knock down of Mm47 in primary BMDM. Two nontargeting lines (NT1 and NT2) were used as a control, and three independent siRNAs targeting Mm47 were used. (B) ELISA testing AIM2 receptor–mediated secretion of IL-1β in primary BMDM with or without Mm47 knock down upon LPS priming followed by 2 μg Poly(dA:dT) transfection. (C) ELISA testing NLRC4 receptor–mediated IL-1β secretion in primary BMDM with or without Mm47 knock down upon S. typhimurium infection for 6 h. (D) Mm47 was knocked down using siRNA or nontargeting siRNA in primary BMDM cells. Cells were challenged as indicated, and Western bot was performed to procaspase-1, cleaved caspase-1, pro–IL-1β, and cleaved IL-1β. Representative images from three independent experiments are shown. (E) qRT-PCR showing mRNA levels of IL-1β and Nlrp3 after priming primary BMDM with 100 ng/ml LPS for 2 h with or without Mm47 knock down. (A–D) Data represent mean ± SEM of three experiments. *p < 0.03, ***p < 0.001; ns, not significant.

Close modal

An accumulating body of evidence indicates that a large number of genes are misannotated as lncRNAs, many of which produce small proteins with important biological functions (38). Studies on the functions of these SEPs are currently limited because in-depth experimental investigation of individual genes is required to uncover their functions. Recent computational and genomic advances have allowed the identification and mapping of SEPs (7). Several recent studies using ribosome profiling and mass spectrometry–based detection of peptides have revealed that many genes currently annotated as lncRNAs produce small proteins (7, 38). These include ORFs that are translated from canonical AUG or noncanonical start sites (6, 7, 9). In macrophages, a novel gene AW112010 was recently identified as a SEP translated from a noncanonical start site of an annotated lncRNA gene. AW112010 was shown to be regulated in innate cells such as macrophages following microbial infection, and genetic loss of function models in mice showed this SEP was important in mucosal immunity by controlling S. typhimurium infection and altering the susceptibility to colitis in mice. The same study also identified three ORFs of the 1810058I24Rik gene in their ribosome profiling studies, two of which were predicted to be translated from non-AUG start sites (8). This study, among others, underscores the need for independently authenticating the coding potential of cytosolic lncRNAs and determining to what extent these RNAs produce peptides.

In a surprising twist on our initial focus on lncRNAs, in this study, we have identified Mm47, a highly conserved 47 aa–long mitochondrial micropeptide, which is produced from an annotated lncRNA. Further, we provide clear genetic evidence demonstrating that Mm47 regulates Nlrp3 inflammasome function in macrophages. Mitochondria provide a signaling hub to integrate metabolic and inflammatory capability of immune cells. Such integration is provided through innate immune receptors, including TLRs and the Nlrp3 inflammasome, which respond to altered mitochondrial function and/or mitochondrial-derived molecules released from damaged organelles. In response to stress, mitochondria release molecules, such as cardiolipin and mitochondrial DNA, both of which are sensed by the Nlrp3 inflammasome as well as by other innate sensors such as cyclic GMP–AMP synthase (22, 39, 40). Mm47-deficient cells exhibit impaired Nlrp3-mediated inflammasome responses. This defect was remarkably specific for Nlrp3, as neither Aim2 nor Nlrc4 inflammasomes were impacted by the loss of Mm47. Importantly, genetic complementation of the Mm47 coding DNA sequence in Mm47 KO cells restored Nlrp3-mediated inflammasome responses. This indicates that the loss of Nlrp3 activity in the KOs is truly due to Mm47 and not an additional impairment in these cells. Further, the ability of the micropeptide ORF to rescue inflammasome defects also supports the importance of the peptide product in this biological context.

Exactly how Mm47 on the mitochondrion impacts the activation of the Nlrp3 inflammasome is still an open question. Our results indicate that Mm47 does not act at the level of inflammasome priming because LPS-driven expression of pro–IL-1β and of Nlrp3 were intact in Mm47-deficient cells as was the broader transcriptional program activated downstream of TLR4. Mm47 appears to act at the level of inflammasome licensing or activation, although how this occurs is not clear from our work. Activation of caspase-1 as measured by monitoring the formation of the p20 fragment and generation of the IL-1β p17 was reduced in cell lacking Mm47. Caspase-1 cleaves pro–IL-1β and Gsdmd in canonical inflammasome activation (18). The levels of IL-1β p17 and Gsdmd p30 were both reduced in Mm47-targeted cells; however, the kinetics of cell death was similar to nontargeted cells. Despite the reduction in Gsdmd processing, Mm47-targeted cells still underwent pyroptosis. Previous studies have shown that although Gsdmd is a major executioner of cell death in the Nlrp3 pathway, Gsdmd-independent cell death pathways are also involved (18). It is possible in Mm47-targeted cells that caspase-8 activation leads to the cell death observed (41, 42). Although there has been considerable progress in understanding inflammasome biology, particularly the importance of Nlrp3 in a diverse range of cellular processes and diseases, the precise mechanisms that coordinate Nlrp3 inflammasome complex formation are very poorly understood. A unifying mechanism of how Nlrp3 is activated is not known, and therefore, it is difficult to mechanistically define how Mm47 alters these processes. We also do not understand the impact of Mm47 deficiency on normal mitochondrial function. When we overexpress Mm47 in murine embryonic fibroblasts, the morphology of the mitochondria was altered. This could indicate that Mm47 has a role in mitochondrial fission during stress that may directly or indirectly impact leakage of mitochondrial DNA or cardiolipins into the cytosol.

Although we do not understand how Mm47 interfaces with the inflammasome, we did find that after exposure to LPS, both the 1810058I24Rik gene and the Mm47 polypeptide are reduced. At the protein level, the decrease in expression of Mm47 was observed after prolonged exposure (24–48 h) of cells to LPS. It is possible that this temporal downregulation of Mm47 protein removes this essential factor on the mitochondrion and could represent a mechanism to curb inflammasome activation to resolve inflammation.

We thank the members of the Fitzgerald laboratory for suggestions and comments, especially Fiachra Humphries and Shiuli Agarwal. We thank Cole Haynes (University of Massachusetts Medical School, Worcester, MA) for guidance on mitochondrial biology. We also thank Richard Kandasamy (Norwegian University of Science and Technology, Trondheim, Norway) for helping with manuscript editing.

This work was supported by grants from the National Institutes of Health (AI067497 to K.A.F.) and a T32 Training Grant (T32 AI095213 to A.B.).

The online version of this article contains supplemental material.

Abbreviations used in this article:

     
  • BMDM

    bone marrow–derived macrophage

  •  
  • ER

    endoplasmic reticulum

  •  
  • ETC

    electron transport chain

  •  
  • Fwd

    forward

  •  
  • Gsdmd

    gasdermin D

  •  
  • KO

    knockout

  •  
  • lincRNA

    intergenic lncRNA

  •  
  • lncRNA

    long noncoding RNA

  •  
  • MEF

    mouse embryonic fibroblast

  •  
  • Mm47

    mitochondrial micropeptide-47

  •  
  • mtROS

    mitochondrial reactive oxygen species

  •  
  • NTC

    nontargeting control

  •  
  • OCR

    oxygen consumption rate

  •  
  • ORF

    open reading frame

  •  
  • PAMP

    pathogen-associated molecular pattern

  •  
  • Poly(dA:dT)

    poly(deoxyadenylic-deoxythymidylic)

  •  
  • Poly(I:C)

    polyinosinic-polycytidilic acid

  •  
  • qRT-PCR

    quantitative RT-PCR

  •  
  • Rev

    reverse

  •  
  • SEP

    sORF-encoded peptide

  •  
  • sgRNA

    single-guide RNA

  •  
  • siRNA

    small interfering RNA

  •  
  • sORF

    short open reading frame.

1
Derrien
,
T.
,
R.
Johnson
,
G.
Bussotti
,
A.
Tanzer
,
S.
Djebali
,
H.
Tilgner
,
G.
Guernec
,
D.
Martin
,
A.
Merkel
,
D. G.
Knowles
, et al
.
2012
.
The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression.
Genome Res.
22
:
1775
1789
.
2
Wang
,
K. C.
,
H. Y.
Chang
.
2011
.
Molecular mechanisms of long noncoding RNAs.
Mol. Cell
43
:
904
914
.
3
Geisler
,
S.
,
J.
Coller
.
2013
.
RNA in unexpected places: long non-coding RNA functions in diverse cellular contexts.
Nat. Rev. Mol. Cell Biol.
14
:
699
712
.
4
Atianand
,
M. K.
,
D. R.
Caffrey
,
K. A.
Fitzgerald
.
2017
.
Immunobiology of long noncoding RNAs.
Annu. Rev. Immunol.
35
:
177
198
.
5
Agliano
,
F.
,
V. A.
Rathinam
,
A. E.
Medvedev
,
S. K.
Vanaja
,
A. T.
Vella
.
2019
.
Long noncoding RNAs in host-pathogen interactions.
Trends Immunol.
40
:
492
510
.
6
Ingolia
,
N. T.
,
L. F.
Lareau
,
J. S.
Weissman
.
2011
.
Ribosome profiling of mouse embryonic stem cells reveals the complexity and dynamics of mammalian proteomes.
Cell
147
:
789
802
.
7
Makarewich
,
C. A.
,
E. N.
Olson
.
2017
.
Mining for micropeptides.
Trends Cell Biol.
27
:
685
696
.
8
Jackson
,
R.
,
L.
Kroehling
,
A.
Khitun
,
W.
Bailis
,
A.
Jarret
,
A. G.
York
,
O. M.
Khan
,
J. R.
Brewer
,
M. H.
Skadow
,
C.
Duizer
, et al
.
2018
.
The translation of non-canonical open reading frames controls mucosal immunity.
Nature
564
:
434
438
.
9
Andrews
,
S. J.
,
J. A.
Rothnagel
.
2014
.
Emerging evidence for functional peptides encoded by short open reading frames. [Published erratum appears in 2014 Nat. Rev. Genet. 15: 286.]
Nat. Rev. Genet.
15
:
193
204
.
10
Guo
,
B.
,
D.
Zhai
,
E.
Cabezas
,
K.
Welsh
,
S.
Nouraini
,
A. C.
Satterthwait
,
J. C.
Reed
.
2003
.
Humanin peptide suppresses apoptosis by interfering with Bax activation.
Nature
423
:
456
461
.
11
Nelson
,
B. R.
,
C. A.
Makarewich
,
D. M.
Anderson
,
B. R.
Winders
,
C. D.
Troupes
,
F.
Wu
,
A. L.
Reese
,
J. R.
McAnally
,
X.
Chen
,
E. T.
Kavalali
, et al
.
2016
.
A peptide encoded by a transcript annotated as long noncoding RNA enhances SERCA activity in muscle.
Science
351
:
271
275
.
12
Satoh
,
T.
,
S.
Akira
.
2016
.
Toll-like receptor signaling and its inducible proteins.
Microbiol. Spectr.
4: DOI: 10.1128/microbiolspec.MCHD-0040-2016.
13
Takeda
,
K.
,
S.
Akira
.
2015
.
Toll-like receptors.
Curr. Protoc. Immunol.
109
:
14.12.1
14.12.10
.
14
Bauernfeind
,
F. G.
,
G.
Horvath
,
A.
Stutz
,
E. S.
Alnemri
,
K.
MacDonald
,
D.
Speert
,
T.
Fernandes-Alnemri
,
J.
Wu
,
B. G.
Monks
,
K. A.
Fitzgerald
, et al
.
2009
.
Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression.
J. Immunol.
183
:
787
791
.
15
Rathinam
,
V. A.
,
K. A.
Fitzgerald
.
2016
.
Inflammasome complexes: emerging mechanisms and effector functions.
Cell
165
:
792
800
.
16
Broz
,
P.
,
V. M.
Dixit
.
2016
.
Inflammasomes: mechanism of assembly, regulation and signalling.
Nat. Rev. Immunol.
16
:
407
420
.
17
Lamkanfi
,
M.
,
V. M.
Dixit
.
2014
.
Mechanisms and functions of inflammasomes.
Cell
157
:
1013
1022
.
18
Kayagaki
,
N.
,
I. B.
Stowe
,
B. L.
Lee
,
K.
O’Rourke
,
K.
Anderson
,
S.
Warming
,
T.
Cuellar
,
B.
Haley
,
M.
Roose-Girma
,
Q. T.
Phung
, et al
.
2015
.
Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling.
Nature
526
:
666
671
.
19
Shi
,
J.
,
W.
Gao
,
F.
Shao
.
2017
.
Pyroptosis: gasdermin-mediated programmed necrotic cell death.
Trends Biochem. Sci.
42
:
245
254
.
20
Shi
,
J.
,
Y.
Zhao
,
K.
Wang
,
X.
Shi
,
Y.
Wang
,
H.
Huang
,
Y.
Zhuang
,
T.
Cai
,
F.
Wang
,
F.
Shao
.
2015
.
Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death.
Nature
526
:
660
665
.
21
Latz
,
E.
,
T. S.
Xiao
,
A.
Stutz
.
2013
.
Activation and regulation of the inflammasomes.
Nat. Rev. Immunol.
13
:
397
411
.
22
Rongvaux
,
A.
2018
.
Innate immunity and tolerance toward mitochondria.
Mitochondrion
41
:
14
20
.
23
Roberson
,
S. M.
,
W. S.
Walker
.
1988
.
Immortalization of cloned mouse splenic macrophages with a retrovirus containing the v-raf/mil and v-myc oncogenes.
Cell. Immunol.
116
:
341
351
.
24
Bozidis
,
P.
,
C. D.
Williamson
,
A. M.
Colberg-Poley
.
2007
.
Isolation of endoplasmic reticulum, mitochondria, and mitochondria-associated membrane fractions from transfected cells and from human cytomegalovirus-infected primary fibroblasts.
Curr. Protoc. Cell Biol.
Chapter 3
:
Unit 3.27
.
25
Medzhitov
,
R.
,
T.
Horng
.
2009
.
Transcriptional control of the inflammatory response.
Nat. Rev. Immunol.
9
:
692
703
.
26
Carpenter
,
S.
,
D.
Aiello
,
M. K.
Atianand
,
E. P.
Ricci
,
P.
Gandhi
,
L. L.
Hall
,
M.
Byron
,
B.
Monks
,
M.
Henry-Bezy
,
J. B.
Lawrence
, et al
.
2013
.
A long noncoding RNA mediates both activation and repression of immune response genes.
Science
341
:
789
792
.
27
Atianand
,
M. K.
,
W.
Hu
,
A. T.
Satpathy
,
Y.
Shen
,
E. P.
Ricci
,
J. R.
Alvarez-Dominguez
,
A.
Bhatta
,
S. A.
Schattgen
,
J. D.
McGowan
,
J.
Blin
, et al
.
2016
.
A long noncoding RNA lincRNA-EPS acts as a transcriptional brake to restrain inflammation.
Cell
165
:
1672
1685
.
28
Tripathi
,
V.
,
J. D.
Ellis
,
Z.
Shen
,
D. Y.
Song
,
Q.
Pan
,
A. T.
Watt
,
S. M.
Freier
,
C. F.
Bennett
,
A.
Sharma
,
P. A.
Bubulya
, et al
.
2010
.
The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation.
Mol. Cell
39
:
925
938
.
29
Fukasawa
,
Y.
,
J.
Tsuji
,
S. C.
Fu
,
K.
Tomii
,
P.
Horton
,
K.
Imai
.
2015
.
MitoFates: improved prediction of mitochondrial targeting sequences and their cleavage sites.
Mol. Cell. Proteomics
14
:
1113
1126
.
30
Zhang
,
D.
,
Y.
Xi
,
M. L.
Coccimiglio
,
J. A.
Mennigen
,
M. G.
Jonz
,
M.
Ekker
,
V. L.
Trudeau
.
2012
.
Functional prediction and physiological characterization of a novel short trans-membrane protein 1 as a subunit of mitochondrial respiratory complexes.
Physiol. Genomics
44
:
1133
1140
.
31
Carroll
,
J.
,
M. C.
Altman
,
I. M.
Fearnley
,
J. E.
Walker
.
2007
.
Identification of membrane proteins by tandem mass spectrometry of protein ions.
Proc. Natl. Acad. Sci. USA
104
:
14330
14335
.
32
Rowland
,
A. A.
,
G. K.
Voeltz
.
2012
.
Endoplasmic reticulum-mitochondria contacts: function of the junction.
Nat. Rev. Mol. Cell Biol.
13
:
607
625
.
33
Williamson
,
C. D.
,
D. S.
Wong
,
P.
Bozidis
,
A.
Zhang
,
A. M.
Colberg-Poley
.
2015
.
Isolation of endoplasmic reticulum, mitochondria, and mitochondria-associated membrane and detergent resistant membrane fractions from transfected cells and from human cytomegalovirus-infected primary fibroblasts.
Curr. Protoc. Cell Biol.
68
:
3.27.1
3.27.33
.
34
Zhou
,
R.
,
A. S.
Yazdi
,
P.
Menu
,
J.
Tschopp
.
2011
.
A role for mitochondria in NLRP3 inflammasome activation. [Published erratum appears in 2011 Nature 475: 122.]
Nature
469
:
221
225
.
35
Mills
,
E. L.
,
B.
Kelly
,
A.
Logan
,
A. S. H.
Costa
,
M.
Varma
,
C. E.
Bryant
,
P.
Tourlomousis
,
J. H. M.
Däbritz
,
E.
Gottlieb
,
I.
Latorre
, et al
.
2016
.
Succinate dehydrogenase supports metabolic repurposing of mitochondria to drive inflammatory macrophages.
Cell
167
:
457
470.e13
.
36
Herb
,
M.
,
A.
Gluschko
,
K.
Wiegmann
,
A.
Farid
,
A.
Wolf
,
O.
Utermöhlen
,
O.
Krut
,
M.
Krönke
,
M.
Schramm
.
2019
.
Mitochondrial reactive oxygen species enable proinflammatory signaling through disulfide linkage of NEMO.
Sci. Signal.
12
: eaar5926.
37
Garaude
,
J.
,
R.
Acín-Pérez
,
S.
Martínez-Cano
,
M.
Enamorado
,
M.
Ugolini
,
E.
Nistal-Villán
,
S.
Hervás-Stubbs
,
P.
Pelegrín
,
L. E.
Sander
,
J. A.
Enríquez
,
D.
Sancho
.
2016
.
Mitochondrial respiratory-chain adaptations in macrophages contribute to antibacterial host defense.
Nat. Immunol.
17
:
1037
1045
.
38
Pueyo
,
J. I.
,
E. G.
Magny
,
J. P.
Couso
.
2016
.
New peptides under the s(ORF)ace of the genome.
Trends Biochem. Sci.
41
:
665
678
.
39
Zhong
,
Z.
,
S.
Liang
,
E.
Sanchez-Lopez
,
F.
He
,
S.
Shalapour
,
X. J.
Lin
,
J.
Wong
,
S.
Ding
,
E.
Seki
,
B.
Schnabl
, et al
.
2018
.
New mitochondrial DNA synthesis enables NLRP3 inflammasome activation.
Nature
560
:
198
203
.
40
Iyer
,
S. S.
,
Q.
He
,
J. R.
Janczy
,
E. I.
Elliott
,
Z.
Zhong
,
A. K.
Olivier
,
J. J.
Sadler
,
V.
Knepper-Adrian
,
R.
Han
,
L.
Qiao
, et al
.
2013
.
Mitochondrial cardiolipin is required for Nlrp3 inflammasome activation.
Immunity
39
:
311
323
.
41
Lee
,
B. L.
,
K. M.
Mirrashidi
,
I. B.
Stowe
,
S. K.
Kummerfeld
,
C.
Watanabe
,
B.
Haley
,
T. L.
Cuellar
,
M.
Reichelt
,
N.
Kayagaki
.
2018
.
ASC- and caspase-8-dependent apoptotic pathway diverges from the NLRC4 inflammasome in macrophages.
Sci. Rep.
8
:
3788
.
42
Schneider
,
K. S.
,
C. J.
Groß
,
R. F.
Dreier
,
B. S.
Saller
,
R.
Mishra
,
O.
Gorka
,
R.
Heilig
,
E.
Meunier
,
M. S.
Dick
,
T.
Ćiković
, et al
.
2017
.
The inflammasome drives GSDMD-independent secondary pyroptosis and IL-1 release in the absence of caspase-1 protease activity.
Cell Rep.
21
:
3846
3859
.

The authors have no financial conflicts of interest.

Supplementary data