Thioredoxin-interacting protein (TXNIP) is a multifunctional protein that functions in tumor suppression, oxidative stress, and inflammatory responses. However, how TXNIP functions during microbial infections is rarely reported. In this study, we demonstrate that Brucella infection decreased TXNIP expression to promote its intracellular growth in macrophages by decreasing the production of NO and reactive oxygen species (ROS). Following Brucella abortus infection, TXNIP knockout RAW264.7 cells produced significantly lower levels of NO and ROS, compared with wild-type RAW264.7 cells. Inducible NO synthase (iNOS) inhibitor treatment reduced NO levels, which resulted in a dose-dependent restoration of TXNIP expression, demonstrating that the expression of TXNIP is regulated by NO. In addition, the expression of iNOS and the production of NO were dependent on the type IV secretion system of Brucella. Moreover, Brucella infection reduced TXNIP expression in bone marrow–derived macrophages and mouse lung and spleen. Knocked down of the TXNIP expression in bone marrow–derived macrophages increased intracellular survival of Brucella. These findings revealed the following: 1) TXNIP is a novel molecule to promote Brucella intracellular survival by reducing the production of NO and ROS; 2) a negative feedback–regulation system of NO confers protection against iNOS-mediated antibacterial effects. The elucidation of this mechanism may reveal a novel host surveillance pathway for bacterial intracellular survival.

Brucellosis is a serious zoonotic infectious disease caused by Brucella, a facultatively intracellular bacterial pathogen. Brucella has remarkable strategies enabling avoidance of the host immune response and facilitating the establishment of chronic infections (1). The adaptation of Brucella to survive inside macrophages is due to its ability to block receptors for innate immunity, inhibit phagolysosome fusion and apoptosis, and to downregulate Ag presentation (2, 3), which collectively lead to their escape from effector immune responses (4, 5). Additional immune evasion strategies in Brucella remain to be identified. Most immune escape mechanisms of Brucella are concentrated on immune receptors, apoptosis, and autophagy (68). However, evasive strategies involving nitrosative and oxidative stress are rarely reported. An in depth understanding of the evasive strategies of Brucella will facilitate the development of novel, effective therapeutic approaches to treat brucellosis.

Thioredoxin-interacting protein (TXNIP), also known as vitamin D3 upregulated protein 1, is a natural antagonist of thioredoxin (TRX), which are ubiquitous antioxidant oxidase–reductase enzymes localized to the cytosol and mitochondria (9). TXNIP is a multifunctional protein in metabolic diseases (10, 11). It is associated with oxidative stress and plays an important role in inducing mitochondrial Nox4, which in turn contributes to reactive oxygen species (ROS) production (12, 13). In addition, TXNIP can bind directly to and inhibit TRX function, leading to the activation of apoptosis signal-regulating kinase 1 and initiation of the apoptotic cascade (14, 15). Recent research has shown that TXNIP is the pivotal link between nod-like receptor protein 3 (NLRP3) inflammasome activation and oxidative stress (1618). Thus, TXNIP plays a pivotal role in metabolic diseases (19, 20). However, how TXNIP functions during microbial infections is rarely reported. Studies suggest that TXNIP may function on microbial infection (10, 20).

NO is an important cellular signaling molecule involved in tumors, infectious diseases, and the killing of intracellular pathogens (21). NO and other reactive nitrogen species react with structural elements, components of the replication machinery, nucleic acids, and infectious pathogens, which is the basis for their direct antiviral or antimicrobial effects (22, 23). NO also has an indirect antimicrobial effect, inhibiting the assembly of the NLRP3 inflammasome via thiol nitrosylation. It has been shown that NO is indispensable in Mycobacterium tuberculosis infection (24) and plays an antimicrobial effect in innate immunity (25, 26). Therefore, NO plays a critical role during microbial infection.

It has been shown that TXNIP has a relationship with inducible NO synthase (iNOS) and NO in metabolic diseases. Endogenously and exogenously synthesized NO can repress the expression of TXNIP, thereby facilitating TRX-mediated denitrosylation (27). TXNIP can also influence the expression of iNOS and NO (27, 28). However, little is known about the regulatory mechanism between TXNIP and NO or the functions of TXNIP during microbial infections. In this study, we illustrate the relationship and functions between TXNIP and NO during Brucella abortus infection. We found that B. abortus infections reduce TXNIP expression in macrophages. Decreased TXNIP expression promoted B. abortus intracellular growth in macrophages by decreasing the production of NO and ROS. We further show that the expressions of TXNIP and iNOS/NO are dependent on the type IV secretion system (T4SS) of Brucella. Thus, we identified a novel host pathway involved in the Brucella T4SS-induced iNOS/NO–TXNIP–iNOS/NO signaling pathway, indicating a negative feedback–regulated system of NO in B. abortus–infected macrophages.

This study was performed in strict accordance with the guidelines of the Care and Use of Laboratory Animals of Shanghai Veterinary Research Institute, the Chinese Academy of Agricultural Sciences. Mice (Shanghai Laboratory Animal Center Experimental Animals, Shanghai, China) were housed in cages with ad libitum access to food and water under biosafety conditions. All animal handling procedures were approved by the Committee on the Ethics of Animal Experiments of Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences (permit no. SHVRI-SD-2019-088).

GAPDH, TXNIP, NF-κB p65, pNF-κB p65, iNOS, and α-tubulin Abs were purchased from Cell Signaling Technology (Danvers, MA). HRP-conjugated IgG (H+L) secondary Abs and CellROX Green Reagent were purchased from Thermo Fisher Scientific (Waltham, MA). The anti-pIRE1α Ab was obtained from Abcam (Cambridge, MA). The CytoTox 96 Non-Radioactive Cytotoxicity Assay Kit and Griess Reagent System were purchased from Promega (Fitchburg, WI). Tunicamycin (Tm), aminoguanidine (AG), and puromycin were obtained from Sigma-Aldrich (Shanghai, China). The miRcute kit and miRcute Plus miRNA kit were purchased from TIANGEN (Beijing, China). N-acetyl-l-cysteine (NAC) was purchased from MedChemExpress (Monmouth Junction, NJ). M-CSF was purchased from BioLegend. All other chemicals, if not otherwise indicated, were from Sigma-Aldrich. All drug concentrations are expressed as the final molar concentration in working buffer.

The virulent B. abortus S2308 strain was purchased from American Type Culture Collection, and B. abortus S2308ΔvirB123 was constructed in our laboratory. B. abortus were cultured in tryptic soy broth (BD Difco) or tryptic soy agar at 37°C with 5% CO2. Escherichia coli DH5α–competent cells and Stbl3-competent cells (Quanshijing, Nanjing, China) were cultured in Luria-Bertani media at 37°C. RAW264.7 murine macrophages were purchased from American Type Culture Collection and cultured in DMEM (HyClone Laboratories) with 10% FBS (Life Technologies, Thermo Fisher Scientific) at 37°C with 5% CO2. BALB/c mice were purchased from the Shanghai Laboratory Animals Center Experimental Animals.

For primary macrophage cultures, bone marrow–derived macrophages (BMDMs) were derived from flushed bone marrow from mouse leg bones, as previously described (29). After 3 d of culture, nonadherent BMDMs were removed. Adherent BMDMs were maintained in DMEM supplemented with 10% FBS, M-CSF (10 ng/ml), penicillin, and streptomycin. Following 3 d of additional culture, BMDMs were used for further culture and experimentation.

Cells were seeded on six-well plates at 2 × 106 cells per well 24 h prior to infection. Cells were infected with B. abortus S2308 in triplicate wells of the six-well plates at a multiplicity of infection of 50, 200, or 1000 by centrifuging bacteria onto cells at 400 × g for 5 min at room temperature. Following 1 h of incubation at 37°C in an atmosphere containing 5% CO2, the cells were washed two times with PBS to remove extracellular bacteria and incubated for an additional 1 h in medium supplemented with 100 μg/ml gentamicin to kill extracellular bacteria. To monitor B. abortus intracellular survival, infected cells were lysed with 0.25% Triton X-100 in PBS at specific time points, and serial dilutions of lysates were rapidly plated onto tryptic soy agar to enumerate CFUs.

At the indicated times, macrophages were lysed in 2× loading buffer. Cytosolic extracts were separated by polyacrylamide gel, transferred to nitrocellulose membranes (Millipore). Following transfer, membranes were blocked for 1 h in TBST solution containing 0.1% Tween-20 and 5% nonfat milk and incubated overnight at 4°C with primary Abs (1:1000 dilution). Following overnight incubation, membranes were washed with TBST and incubated with HRP-conjugated IgG (H+L) secondary Abs (1:10,000 dilution) at room temperature for 1 h and washed again thrice with TBST. The protein bands were developed using ECL reagent, visualized using a Tanon 5200 automatic chemiluminescence image analysis system (Tanon, Shanghai, China), and quantified using ImageJ software (National Institutes of Health, Bethesda, MD).

HEK293T cells were grown in DMEM with 10% FBS. Lentivirus particles were produced by transfecting cells with lentiCRISPRv2 along with the packaging plasmids (pMD2G, pSPAX2), which were purchased from Thermo Fisher Scientific. The medium was changed after 6 h, and virus particles were collected at 48 and 72 h. Virus-containing medium was concentrated using a 30-kDa ultrafiltration device (Millipore).

Concentrated virus was used to transduce RAW264.7 cells cultured in 24-well plates. The medium was changed 24 h post transduction, and cells were left to grow for an additional 24 h. Transduced cells were selected with puromycin (4 μg/ml). Positive clones were subcloned to obtain monoclonal TXNIP knockout (TXNIP−/−) RAW264.7 cell lines by limited dilution, repeated three times. Silencing efficiency was assessed via immunoblotting. Single guide RNAs were listed in Table I.

Immortalized BMDM were transfected with specific TXNIP small interfering RNA (siRNA), or nontargeted siRNA (NC siRNA) using Lipofectamine RNAiMAX Transfection Reagent according to the manufacturer’s protocol. Silencing efficiency was assessed via immunoblot, using anti-TXNIP Ab. The siRNA are listed in Table I.

RAW264.7 cells were plated in a six-well plate. At designated time points, RAW264.7 cells were resuspended and incubated with CellROX Green in DMEM at a final concentration of 5 μM. Cells were incubated for 30 min at 37°C, inactivated in 4% (w/v) formaldehyde for 15 min at 37°C, and resuspended in PBS. ROS were detected using a Becton Dickinson LSR II flow cytometer.

The supernatants of cells were collected and filtered at specific time points following B. abortus infection. NO content was measured by the analysis of its stable end product, nitrite, using a Griess reagent, as previously described (30). Each sample was tested in triplicate. Data are expressed as micromoles of nitrite.

Total RNA was isolated from RAW 264.7 cells (uninfected or infected with B. abortus) at different time points using TRIzol reagent (Ambion, Carlsbad, CA). Genomic contamination was removed with the TURBO DNA-free kit (Ambion, Foster, CA). The resulting RNA was reverse transcribed with the PrimeScript RT reagent Kit (Takara Biotechnology, Dalian, China) to produce the cDNA template. GoTaq qPCR Master Mix (Promega) was used for quantitative real-time PCR, according to manufacturer’s instructions. A total of 1 μl of cDNA, 0.5 μl of forward or reverse primer (10 μM), 8 μl of nuclease-free water, and 10 μl 2× GoTaq qPCR Master Mix was added and mixed. The reaction was carried on a Mastercycler ep Realplex system (Eppendorf, Hamburg, Germany). The cycling parameters were as follows: 95°C for 2 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min. Each gene was tested in triplicate, and the β-actin gene was used as the internal control. The relative transcription level of each gene was calculated using the 2ΔCT(calibrator)−ΔCT(test) method. The primers were listed in Table I.

RAW264.7 cells were cultured on 15-mm diameter glass coverslips (Thermo Fisher Scientific) in a 24-well plate and infected with S2308 at a multiplicity of infection of 50, as described above. At the designated time points, cells were washed twice with PBS and fixed overnight in 4% (w/v) paraformaldehyde at 4°C. After washing three times with PBS, cells were incubated with PBS containing 0.25% (v/v) Triton X-100 at room temperature for 10 min and blocked with 1% (w/v) BSA for 30 min at 37°C. Cells were incubated with primary Ab for 2 h at room temperature. After washing three times with PBS, cells were incubated with secondary Ab for 45 min at 37°C. After washing with PBS, the coverslips were incubated with 0.2 mg/ml DAPI at room temperature to stain DNA. Finally, the coverslips were mounted on glass slides with Eukitt Quick-hardening mounting medium (Sigma-Aldrich) and observed under laser scanning confocal microscopy (Nikon D-Eclipse C1; Nikon). The assay was performed in triplicate.

BALB/c mice (6–8 wk old; n = 5 per group) were infected with B. abortus S2308 at a dose of 5 × 105 CFU per mouse in 0.1 ml volume by i.p. injection. The mock mice were injected with the same volume of PBS. At 1, 3, 7, 14, and 28 d post infection, the lung, spleen, liver, and kidney of the mice were collected and homogenized for protein and RNA extractions.

All data were imported into GraphPad Prism 6 (GraphPad Software) for analysis. The differences in data were compared using unpaired two-tailed t tests or two-way ANOVAs with the Sidak multiple comparisons test. Data represent the means ± SD of three independent experiments. Significance is defined as follows: *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

TXNIP is a stress-induced protein with roles in a variety of metabolic diseases. However, the function of TXNIP in Brucella infection is unclear. In this study, we investigated TXNIP expression in B. abortus–infected RAW264.7 cells. The results revealed that B. abortus infection significantly reduced TXNIP mRNA (Fig. 1A) and protein expression (Fig. 1B, 1C) at 1 h and from 12 h thereafter of the infection. Mock RAW264.7 cells were used as the controls.

FIGURE 1.

Determination of TXNIP expression and intracellular bacterial numbers in TXNIP−/− RAW264.7 cells and RAW264.7 cells infected with B. abortus. (A) Real-time PCR analysis of TXNIP mRNA expression in mock-treated RAW264.7 cells or RAW264.7 cells infected with B. abortus S2308. The raw data for each sample were normalized to those of β-actin. (B) Immunoblot analysis of TXNIP protein levels in mock-treated RAW264.7 cells or RAW264.7 cells infected with B. abortus S2308. The same blots were stripped and reprobed with an anti-GAPDH Ab as the loading controls. (C) The intensity and ratios of TXNIP/GAPDH at different time points post infection. (D) Intracellular bacterial numbers of B. abortus in TXNIP−/− RAW264.7 cells and RAW264.7 cells. (E) Indirect immunofluorescence staining of B. abortus in TXNIP−/− RAW264.7 cells and wild-type RAW264.7 cells. Blue represents the nucleus; green fluorescence represents B. abortus that were stained with fluorescent Abs. Data are means ± SD of three independent experiments. Data points and error bars represent the mean and SD of triplicate CFU determinations. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 1.

Determination of TXNIP expression and intracellular bacterial numbers in TXNIP−/− RAW264.7 cells and RAW264.7 cells infected with B. abortus. (A) Real-time PCR analysis of TXNIP mRNA expression in mock-treated RAW264.7 cells or RAW264.7 cells infected with B. abortus S2308. The raw data for each sample were normalized to those of β-actin. (B) Immunoblot analysis of TXNIP protein levels in mock-treated RAW264.7 cells or RAW264.7 cells infected with B. abortus S2308. The same blots were stripped and reprobed with an anti-GAPDH Ab as the loading controls. (C) The intensity and ratios of TXNIP/GAPDH at different time points post infection. (D) Intracellular bacterial numbers of B. abortus in TXNIP−/− RAW264.7 cells and RAW264.7 cells. (E) Indirect immunofluorescence staining of B. abortus in TXNIP−/− RAW264.7 cells and wild-type RAW264.7 cells. Blue represents the nucleus; green fluorescence represents B. abortus that were stained with fluorescent Abs. Data are means ± SD of three independent experiments. Data points and error bars represent the mean and SD of triplicate CFU determinations. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal
Table I.
Primers, sgRNAs, and siRNA used in this study
PrimersSequences
TXNIP F 5′-GGCTGTTCTAAGACCCACCTG-3′ 
TXNIP R 5′-GGAGCCGAACCTTGCCTTC-3′ 
iNOS F 5′-CAGCTGGGCTGTACAAACCTT-3′ 
iNOS R 5′-CATTGGAAGTGAAGCGTTTCG-3′ 
β-actin F 5′-GGCTGTATTCCCCTCCATCG-3′ 
β-actin R 5′-CCAGTTGGTAACAATGCCATGT-3′ 
TXNIP sg1 F 5′-CACCGa GGTGGCCGGACGGGTAATAG TGGb-3′ 
TXNIP sg1 R 5′-AAACc CTATTACCCGTCCGGCCACC Cd-3′ 
TXNIP sg2 F 5′-CACCGa CACTTCCACTATTACCCGTC AGGe-3′ 
TXNIP sg2 R 5′-AAACc GACGGGTAATAGTGGAAGTG Cd-3′ 
TXNIP sg3 F 5′-CACCGa CAGGATCCTGGCTTGCGGCG AGGf-3′ 
TXNIP sg3 R 5′-AAACc CGCCGCAAGCCAGGATCCTG Cd-3′ 
TXNIP siRNA F 5′-CGUGCGUCCUUAACAACAATT–3′  
TXNIP siRNA R 5′–UUGUUGUUAAGGACGCACGTT-3′ 
NC siRNA F 5′-UUCUCCGAACGUGUCACGUTT-3′ 
NC siRNA R 5′-ACGUGACACGUUCGGAGAATT-3′ 
PrimersSequences
TXNIP F 5′-GGCTGTTCTAAGACCCACCTG-3′ 
TXNIP R 5′-GGAGCCGAACCTTGCCTTC-3′ 
iNOS F 5′-CAGCTGGGCTGTACAAACCTT-3′ 
iNOS R 5′-CATTGGAAGTGAAGCGTTTCG-3′ 
β-actin F 5′-GGCTGTATTCCCCTCCATCG-3′ 
β-actin R 5′-CCAGTTGGTAACAATGCCATGT-3′ 
TXNIP sg1 F 5′-CACCGa GGTGGCCGGACGGGTAATAG TGGb-3′ 
TXNIP sg1 R 5′-AAACc CTATTACCCGTCCGGCCACC Cd-3′ 
TXNIP sg2 F 5′-CACCGa CACTTCCACTATTACCCGTC AGGe-3′ 
TXNIP sg2 R 5′-AAACc GACGGGTAATAGTGGAAGTG Cd-3′ 
TXNIP sg3 F 5′-CACCGa CAGGATCCTGGCTTGCGGCG AGGf-3′ 
TXNIP sg3 R 5′-AAACc CGCCGCAAGCCAGGATCCTG Cd-3′ 
TXNIP siRNA F 5′-CGUGCGUCCUUAACAACAATT–3′  
TXNIP siRNA R 5′–UUGUUGUUAAGGACGCACGTT-3′ 
NC siRNA F 5′-UUCUCCGAACGUGUCACGUTT-3′ 
NC siRNA R 5′-ACGUGACACGUUCGGAGAATT-3′ 
a

Adhesive end of annealing CACCG.

b

PAM site TGG.

c

Adhesive end of annealing AAAC.

d

Adhesive end of annealing C.

e

PAM site AGG.

f

PAM site AGG.

F, forward; R, reverse; sgRNA, single guide RNA.

TXNIP has been reported to play an important role in a variety of metabolic diseases, including type 1 and type 2 diabetes (31, 32). It can affect the production of ROS and inflammatory responses, which play pivotal roles in the intracellular survival of bacteria (33). To investigate whether TXNIP affects the intracellular survival of Brucella, we knocked out TXNIP from RAW264.7 cells using CRISPR/Cas9, and confirmed loss of the protein by immunoblot analysis (Supplemental Fig. 1A). TXNIP−/− RAW264.7 cells were used for B. abortus infection, and B. abortus intracellular growth was assessed at different times by indirect immunofluorescence and CFU assays. The results showed that similar numbers of B. abortus were in TXNIP−/− RAW264.7 cells and wild-type RAW264.7 cells at 0 h post infection. At later hours of infection, the numbers of live bacteria in TXNIP−/− RAW264.7 cells were significantly higher than those in wild-type RAW264.7 cells (Fig. 1D, 1E), suggesting that deletion of TXNIP promotes B. abortus intracellular growth.

A previous study showed that TXNIP can regulate the expression of downstream iNOS and the production of NO (28). To examine whether TXNIP can regulate iNOS expression and NO production, we knocked out TXNIP from RAW264.7 cells and analyzed the expression of iNOS in both wild-type and TXNIP−/− RAW264.7 cells post B. abortus infection. Interestingly, TXNIP−/− RAW264.7 cells had significantly lower iNOS mRNA and protein expression levels (Fig. 2A, 2B). Consistent with this observation, the production of NO was also decreased in TXNIP−/− RAW264.7 cells post B. abortus infection compared with wild-type RAW264.7 cells (Fig. 2C).

FIGURE 2.

Determination of TXNIP, iNOS, and NO expression in TXNIP−/− RAW264.7 cells and RAW264.7 cells infected with B. abortus. (A) Immunoblot analysis of TXNIP, iNOS, phospho-p65, and p65 levels. The same blots were stripped and reprobed with an anti-GAPDH Ab as the loading controls. (B) qPCR analysis of iNOS mRNA levels in B. abortus–infected TXNIP−/− RAW264.7 cells and RAW264.7 cells at 4, 8, 12, and 24 h post infection. (C) TXNIP−/− RAW264.7 cells and RAW264.7 cells infected with B. abortus. The concentration of NO in the supernatants of macrophages was measured by Griess reagent. Data represent the means ± SD of three independent experiments. Data were analyzed by the two-way ANOVA method. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 2.

Determination of TXNIP, iNOS, and NO expression in TXNIP−/− RAW264.7 cells and RAW264.7 cells infected with B. abortus. (A) Immunoblot analysis of TXNIP, iNOS, phospho-p65, and p65 levels. The same blots were stripped and reprobed with an anti-GAPDH Ab as the loading controls. (B) qPCR analysis of iNOS mRNA levels in B. abortus–infected TXNIP−/− RAW264.7 cells and RAW264.7 cells at 4, 8, 12, and 24 h post infection. (C) TXNIP−/− RAW264.7 cells and RAW264.7 cells infected with B. abortus. The concentration of NO in the supernatants of macrophages was measured by Griess reagent. Data represent the means ± SD of three independent experiments. Data were analyzed by the two-way ANOVA method. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

Research showed that NO produced by iNOS is required for B. abortus elimination in infected host cells (34). To verify whether the production of NO is detrimental to the intracellular survival of Brucella, AG, a relatively selective inhibitor of iNOS, was used to reduce the production of NO. AG significantly decreased the production of NO post B. abortus infection in RAW264.7 cells (Fig. 3A), whereas simultaneously, the number of live bacteria in AG-treated RAW264.7 cells was significantly increased in a dose-dependent manner (Fig. 3B).

FIGURE 3.

Inhibition of NO production increases the intracellular survival of Brucella. (A) AG treatment reduced NO production in B. abortus–infected RAW264.7 cells. (B) AG treatment increased intracellular bacterial survival in RAW264.7 cells at 24 and 48 h post infection. Data represent the means ± SD of three independent experiments. Data points and error bars represent the mean and SD of triplicate CFU determinations. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 3.

Inhibition of NO production increases the intracellular survival of Brucella. (A) AG treatment reduced NO production in B. abortus–infected RAW264.7 cells. (B) AG treatment increased intracellular bacterial survival in RAW264.7 cells at 24 and 48 h post infection. Data represent the means ± SD of three independent experiments. Data points and error bars represent the mean and SD of triplicate CFU determinations. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

Previous studies demonstrated that NF-κB enhanced iNOS expression in multiple cell types. It was reported that TXNIP downregulated TNF-α–induced NF-κB activity by interacting with histone deacetylases 1 and 3 (35). Therefore, we hypothesized that TXNIP may function on iNOS expression via NF-κB pathway. We then examined the phosphorylation of p65 in wild-type and TXNIP−/− RAW264.7 following B. abortus infection. We found that p65 phosphorylation was dramatically decreased in TXNIP−/− RAW264.7 cells in the early stages of B. abortus infection (Fig. 2A). Those results suggest that TXNIP may regulate the expression of iNOS via the NF-κB pathway and influence intracellular Brucella survival by regulating NO production.

Previous studies showed that TXNIP has multiple biological functions, including the inhibition of tumor growth, regulation of ROS generation, and the occurrence of apoptosis in different cell types (15, 17). TXNIP promotes ROS production and apoptosis by inhibiting TRX (36). Our data showed that during the early stages of infection, only a little quantity of ROS was produced, whereas during the late stages of infection, the production of ROS was significantly increased (Fig. 4A). Additionally, we found that TXNIP−/− RAW264.7 cells treated with t-butylhydroperoxide (TBHP) (a positive control for ROS induction) produced lower levels of ROS compared with RAW264.7 cells (Fig. 4B). Therefore, we hypothesized that TXNIP may function in the production of ROS in response to Brucella infection.

FIGURE 4.

Inhibition of ROS production increases the intracellular survival of Brucella. (A) CellROX Green staining revealed that ROS production was decreased in TXNIP knockout RAW264.7 cells compared with wild-type RAW264.7 cells at 24 and 48 h post infection. (B) Flow cytometry analysis revealed that ROS production was decreased in TXNIP−/−RAW264.7 cells compared with wild-type RAW264.7 cells at 24 h post treatment with the TBHP. RAW264.7 cells treated with TBHP are shown in red, TXNIP−/− RAW264.7 cells treated with TBHP are shown in blue, and mock-treated control cells are shown in yellow. TBHP served as a positive control for ROS induction. (C) RAW264.7 cells were treated with NAC following B. abortus infection at the indicated times. The production of ROS in macrophages was measured by flow cytometry. (D) Bacterial intracellular survival in RAW264.7 cells was determined by CFU assays. Data represent the means ± SD of three independent experiments. Data points and error bars represent the mean and SD of triplicate CFU determinations. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 4.

Inhibition of ROS production increases the intracellular survival of Brucella. (A) CellROX Green staining revealed that ROS production was decreased in TXNIP knockout RAW264.7 cells compared with wild-type RAW264.7 cells at 24 and 48 h post infection. (B) Flow cytometry analysis revealed that ROS production was decreased in TXNIP−/−RAW264.7 cells compared with wild-type RAW264.7 cells at 24 h post treatment with the TBHP. RAW264.7 cells treated with TBHP are shown in red, TXNIP−/− RAW264.7 cells treated with TBHP are shown in blue, and mock-treated control cells are shown in yellow. TBHP served as a positive control for ROS induction. (C) RAW264.7 cells were treated with NAC following B. abortus infection at the indicated times. The production of ROS in macrophages was measured by flow cytometry. (D) Bacterial intracellular survival in RAW264.7 cells was determined by CFU assays. Data represent the means ± SD of three independent experiments. Data points and error bars represent the mean and SD of triplicate CFU determinations. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

As expected, our data indicated that the production of ROS was decreased in TXNIP−/− RAW264.7 cells at 24 h following B. abortus infection compared with wild-type RAW264.7 cells (Fig. 4A). Bacterial infection triggers the production of ROS, which is important for antibacterial activity (37). To verify whether the production of ROS was detrimental to the intracellular survival of Brucella, NAC, a scavenger of ROS, was used to remove ROS following B. abortus infection. NAC treatment significantly decreased the production of ROS in RAW264.7 cells at 24 h post B. abortus infection (Fig. 4C). At the same time, bacterial loads in NAC-treated macrophages were significantly increased in a dose-dependent manner compared with PBS-pretreated cells (Fig. 4D). To rule out the inhibitory effects of NAC on B. abortus or RAW264.7 cells, cells and bacteria were cultured in the presence of different concentrations of NAC and monitored for toxicity. As determined by the CytoTox 96 Non-Radioactive Cytotoxicity Assay, no toxic effects were observed on RAW264.7 cells when cultured with NAC (Supplemental Fig. 1B). NAC inhibited B. abortus growth, as determined by OD600 absorbance (Supplemental Fig. 1C); however, bacterial loads in NAC-treated macrophages were significantly elevated. Those data suggested that ROS was detrimental to intracellular Brucella survival. Collectively, those results suggest the effects of TXNIP on macrophage antimicrobial activity are dependent on oxidative stress.

Exogenous and endogenous NO can suppress TXNIP expression, which facilitates nitrosative stress (27, 38). Our data showed that B. abortus infections induced the expression of the iNOS protein and the production of NO during the late stages of infection (Fig. 5A, 5B). At the same time, the expression of TXNIP was significantly decreased during the late stages of infection (Fig. 1B). Thus, the dramatic enhancement of the iNOS and NO production in the late stages of infection suggested that NO may be involved in regulating TXNIP expression. To test this hypothesis, AG was used to reduce the production of NO post B. abortus infection. With the decrease in NO (Fig. 5C), the expression of TXNIP was restored in a dose-dependent manner (Fig. 5D, 5E). To rule out any inhibitory effects of AG on B. abortus or RAW264.7 cells, cells and bacteria were cultured in the presence of different concentrations of AG and monitored for toxicity. As shown in Supplemental Fig. 1B and 1C, no toxic effects were observed on either the RAW264.7 cells or on the bacteria when cultured with AG, as determined by the CytoTox 96 Non-Radioactive Cytotoxicity Assay and OD600nm absorbance. Collectively, those results demonstrate that the expression of TXNIP is regulated by NO.

FIGURE 5.

NO produced by macrophages acts as a negative regulator of TXNIP expression. (A) The levels of iNOS in RAW264.7 cells infected with B. abortus were determined by immunoblot analysis. The same blots were stripped and reprobed with an anti–α-tubulin Ab as the loading control. (B) The levels of NO in supernatants of B. abortus–infected RAW264.7 cells were measured at the indicated times. (C) The concentration of NO in the supernatant of macrophages was measured by Griess reagent. (D) The levels of TXNIP in RAW264.7 cells pretreated with different concentrations of AG for 3 h, followed by B. abortus infection, were determined by immunoblot analysis. (E) The intensity and ratios of TXNIP/GAPDH at different time points post infection. Data are represented as the means ± SD of three independent experiments. Data were analyzed by the two-way ANOVA method. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 5.

NO produced by macrophages acts as a negative regulator of TXNIP expression. (A) The levels of iNOS in RAW264.7 cells infected with B. abortus were determined by immunoblot analysis. The same blots were stripped and reprobed with an anti–α-tubulin Ab as the loading control. (B) The levels of NO in supernatants of B. abortus–infected RAW264.7 cells were measured at the indicated times. (C) The concentration of NO in the supernatant of macrophages was measured by Griess reagent. (D) The levels of TXNIP in RAW264.7 cells pretreated with different concentrations of AG for 3 h, followed by B. abortus infection, were determined by immunoblot analysis. (E) The intensity and ratios of TXNIP/GAPDH at different time points post infection. Data are represented as the means ± SD of three independent experiments. Data were analyzed by the two-way ANOVA method. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

The T4SS is involved in many aspects of host–pathogen interactions, including Brucella intracellular replication and maintaining infection in both mice and goats (39). In vivo, the T4SS induced inflammatory responses during early infection (40). In addition to survival in macrophages, the T4SS of B. abortus and B. melitensis were also found to play a pivotal role in inducing the expression of cytokines and chemokines in the spleens of infected mice (41). To determine whether live bacteria and T4SS are required for regulating the expression of TXNIP, we infected RAW264.7 cells with the B. abortus S2308, the T4SS-deficient mutant strain, S2308ΔvirB123, and heat-inactivated B. abortus S2308. B. abortus S2308 downregulated TXNIP expression in the later stages of infection (Fig. 1B), whereas the T4SS-deficient mutant strain (S2308ΔvirB123) and heat-inactivated B. abortus S2308 did not downregulate TXNIP expression during the later stages of infection (Fig. 6A, 6B). Our data showed that the expression of TXNIP was regulated by NO, and therefore, we hypothesized that the expression of iNOS and the induction of NO was triggered by the Brucella T4SS.

FIGURE 6.

The expression of TXNIP and iNOS/NO is dependent on the Brucella T4SS. (A) S2308ΔvirB123 and S2308 heat-inactivated–infected RAW264.7 cells. The levels of TXNIP were determined by immunoblot analysis. (B) The intensity and ratios of TXNIP/GAPDH at different time points post infection. S-hi represents heat-inactivated S2308; S virB123 represents S2308ΔvirB123. (C) S2308ΔvirB123- and S2308-infected RAW264.7 cells. The levels of iNOS were determined by immunoblot analysis. (D) The supernatants of macrophages were used to measure NO from S2308- and S2308ΔvirB123-infected RAW264.7 cells at the indicated times. Data are represented as the means ± SD of three independent experiments. Data were analyzed by the two-way ANOVA method. **p < 0.01, ***p < 0.001.

FIGURE 6.

The expression of TXNIP and iNOS/NO is dependent on the Brucella T4SS. (A) S2308ΔvirB123 and S2308 heat-inactivated–infected RAW264.7 cells. The levels of TXNIP were determined by immunoblot analysis. (B) The intensity and ratios of TXNIP/GAPDH at different time points post infection. S-hi represents heat-inactivated S2308; S virB123 represents S2308ΔvirB123. (C) S2308ΔvirB123- and S2308-infected RAW264.7 cells. The levels of iNOS were determined by immunoblot analysis. (D) The supernatants of macrophages were used to measure NO from S2308- and S2308ΔvirB123-infected RAW264.7 cells at the indicated times. Data are represented as the means ± SD of three independent experiments. Data were analyzed by the two-way ANOVA method. **p < 0.01, ***p < 0.001.

Close modal

To test this hypothesis in RAW264.7 cells infected with B. abortus S2308 or the T4SS-deficient mutant strain (S2308ΔvirB123), the expression of iNOS was measured by immunoblot analysis, and the supernatant of macrophages were collected to measure the concentration of NO. Interestingly, iNOS expression levels in macrophages infected with S2308ΔvirB123 were low, whereas macrophages infected with B. abortus S2308 had much higher expression (Fig. 6C). Consistent with the immunoblot analyses, very low quantities of NO were detected in the supernatants of macrophages infected with S2308ΔvirB123 compared with those infected with B. abortus S2308 (Fig. 6D). These findings suggest that the expression of iNOS protein and the production of NO are dependent on the Brucella T4SS.

Previous studies also showed that IRE1 of endoplasmic reticulum (ER) stress uses a microRNA intermediate to control the induction of TXNIP. miR-17, the target of IRE1 endonuclease, is a negative regulator of TXNIP translation in metabolic disease, including diabetes and neonatal hypoxic-ischemia (20, 42, 43). To determine whether the expression of TXNIP is regulated by IRE1–miR-17, the phosphorylation of IRE1α was detected by immunoblot analysis and the expression of miR-17 was detected by real-time PCR. Additionally, the positive inducer of ER stress, Tm, was added to RAW264.7 cells to upregulate the expression of TXNIP. At the same time, the expression of miR-17 was detected. We found that B. abortus infection significantly increased the phosphorylation of IRE1α in a time-dependent manner (Fig. 7A), whereas the expression of miR-17 was reduced at 24 h post infection (Fig. 7B). Tm treatment increased the expression of TXNIP and decreased miR-17 expression in RAW264.7 cells (Fig. 7B, 7C), whereas it did not influence the expression of miR-17 in B. abortus–infected RAW264.7 cells (Fig. 7B). Collectively, those results suggested that the expression of TXNIP is independent of the IRE1–miR-17 pathway of ER stress.

FIGURE 7.

The reduction of TXNIP expression is independent on the IRE1­–mir-17 pathway of ER stress. S2308-infected RAW264.7 cells treated with or without Tm (5 μg/ml, a positive control for ER stress activation). (A) S2308-infected RAW264.7 cells. The phosphorylation of IRE1α was determined by immunoblot analysis. (B) S2308-infected RAW264.7 cells treated with or without Tm. Real-time PCR analysis of miR-17 levels. (C) S2308-infected RAW264.7 cells treated with Tm at 24 h. The levels of TXNIP were determined by immunoblot analysis. Data are the means ± SD of three independent experiments. Data were analyzed using the one-way ANOVA method. *p < 0.05, **p < 0.01.

FIGURE 7.

The reduction of TXNIP expression is independent on the IRE1­–mir-17 pathway of ER stress. S2308-infected RAW264.7 cells treated with or without Tm (5 μg/ml, a positive control for ER stress activation). (A) S2308-infected RAW264.7 cells. The phosphorylation of IRE1α was determined by immunoblot analysis. (B) S2308-infected RAW264.7 cells treated with or without Tm. Real-time PCR analysis of miR-17 levels. (C) S2308-infected RAW264.7 cells treated with Tm at 24 h. The levels of TXNIP were determined by immunoblot analysis. Data are the means ± SD of three independent experiments. Data were analyzed using the one-way ANOVA method. *p < 0.05, **p < 0.01.

Close modal

To further verify whether Brucella can downregulate the expression of TXNIP protein in primary cells, mouse BMDMs were isolated for the experiment. Results revealed that Brucella infection reduced TXNIP expression in BMDMs in the later stages of infection, which was consistent with Brucella infection in RAW264.7 cells (Fig. 8A, 8B). Next, we knocked down TXNIP in BMDM cells to detect the intracellular survival of Brucella. Consistent with the results in RAW264.7 cells, knock down of the TXNIP expression in BMDM cells increased intracellular survival of Brucella (Fig. 8C, 8D), suggesting that Brucella can reduce TXNIP expression to promote its intracellular survival in primary cells.

FIGURE 8.

Determination of TXNIP expression in primary cells infected with Brucella. (A) The protein levels of TXNIP in BMDM cells infected with Brucella were determined by immunoblot analysis. (B) The intensity and ratios of TXNIP/GAPDH at different time points post infection. (C) The protein levels of TXNIP in Brucella-infected BMDM transfected with NC siRNA or TXNIP siRNA were determined by immunoblot analysis. (D) Intracellular bacterial numbers of B. abortus in BMDM cells transfected with NC siRNA or TXNIP siRNA. *p < 0.05, **p < 0.01.

FIGURE 8.

Determination of TXNIP expression in primary cells infected with Brucella. (A) The protein levels of TXNIP in BMDM cells infected with Brucella were determined by immunoblot analysis. (B) The intensity and ratios of TXNIP/GAPDH at different time points post infection. (C) The protein levels of TXNIP in Brucella-infected BMDM transfected with NC siRNA or TXNIP siRNA were determined by immunoblot analysis. (D) Intracellular bacterial numbers of B. abortus in BMDM cells transfected with NC siRNA or TXNIP siRNA. *p < 0.05, **p < 0.01.

Close modal

To further confirm whether Brucella infection can downregulate the expression of TXNIP in vivo, animal infection experiments were performed with mice. The results showed that TXNIP expression was decreased in lungs at both mRNA and protein levels at all the detected time points post Brucella infection (Fig. 9A–C). Accordingly, bacterial loads in the lungs were gradually increased post infection (Fig. 9D). The TXNIP expression in the spleen was decreased at 3 and 7 d post Brucella infection, as determined by quantitative real-time PCR (qPCR), which is less difference significant compared with those in lungs (Fig. 9E). The TXNIP levels in the liver and kidney of the mock mice were very low; therefore, downregulation of TXNIP was not detectable (data not shown). Thus, our data indicated that Brucella may promote its intracellular survival in vivo by regulating the expression of TXNIP.

FIGURE 9.

Determination of TXNIP expression in lungs and spleens of Brucella-infected mouse. (A) The mRNA levels of TXNIP in lungs were determined by qPCR. (B) The protein levels of TXNIP in lungs were determined by immunoblot analysis. (C) The intensity and ratios of TXNIP/GAPDH expression in lungs. (D) Bacterial loads in lungs were determined on 1, 3, 7, 14, and 28 d post infection. (E) The mRNA levels of TXNIP in spleens were determined by qPCR. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

FIGURE 9.

Determination of TXNIP expression in lungs and spleens of Brucella-infected mouse. (A) The mRNA levels of TXNIP in lungs were determined by qPCR. (B) The protein levels of TXNIP in lungs were determined by immunoblot analysis. (C) The intensity and ratios of TXNIP/GAPDH expression in lungs. (D) Bacterial loads in lungs were determined on 1, 3, 7, 14, and 28 d post infection. (E) The mRNA levels of TXNIP in spleens were determined by qPCR. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Close modal

TXNIP has multiple biological functions that are related to the expression of iNOS protein and the production of NO in metabolic diseases (28). However, little is known about the regulatory mechanisms and functions between TXNIP and NO during microbial infections. In this study, we elucidated the relationship and functions between TXNIP expression and NO production during Brucella infection.

Previous studies demonstrated that decreased expression of TXNIP likely provides favorable conditions for iNOS induction by LPS (28). However, the direct effects of TXNIP on iNOS and NO production during Brucella infection were not investigated. Contrary to previous reports, the current study found that TXNIP−/− RAW264.7 cells infected with Brucella had reduced expression of iNOS and NO levels in macrophages compared with wild-type RAW264.7 cells (Fig. 2A, 2C). The reason for such a finding may be because Brucella is an intracellular bacterium and its LPS structure is different from others. Thus, we believe that TXNIP is involved in upstream regulatory pathways of iNOS/NO during the Brucella infection.

Previous studies (44, 45) have demonstrated that TXNIP interacts with the antioxidant TRX to inhibit its reducing activity and reduce the production of ROS. Our data also demonstrated that ROS generation decreased in TXNIP−/− RAW264.7 cells relative to RAW264.7 cells in late stages of B. abortus infection (Fig. 4A). Oxidative and nitrosative stresses play pivotal roles in macrophage killing of microorganisms. NO has direct and indirect antimicrobial effects, including reactions with structural elements, nucleic acids, metabolic enzymes (22), and the inhibition of the expression of bacterial secretion systems, effector molecules, toxins, etc. (4649). Phagocytes generate ROS that are deleterious to the majority of pathogens. The different chemical formulae of ROS can target different substances such as proteins, DNA, and Fe-S clusters (33, 50).

ROS and NO are important effector molecules involved in the killing of a number of intracellular bacteria, including Leishmania spp, Salmonella, and M. tuberculosis (26, 5153). Recent studies have shown that knockout of the mouse gp91phox or Nos2 genes, which are responsible for the production of ROS and NO, respectively, increase susceptibility to Brucella infection (54). However, pathogenic bacteria have developed various constitutive or inducible mechanisms to resist oxidative and nitrosative stress and also to evade killing by activated phagocytes. For example, M. tuberculosis can exclude iNOS from the phagosome to prevent acidification and express oxidase to reduce ROS production to facilitate intracellular survival (5557). Brucella also uses multiple strategies to circumvent macrophage defense mechanisms. The adaptation of Brucella to live inside macrophages is managed by its ability to block receptors for innate immunity (2), inhibit phagolysosome fusion, inhibit apoptosis, and downregulate Ag presentation (3), which collectively lead to their escape from effector immune responses (4, 5). Brucella resistance to oxidative and nitrosative stress produced by macrophages is also an important mechanism to escape effector immune responses. For example, previous research demonstrated that the expression of TREM-2 in macrophages and dendritic cells facilitates Brucella intracellular growth through the inhibition of NO production (58). Brucella infection induced IRE1-dependent activation of AMP-activated protein kinase, which inhibited the production of ROS (59). Therefore, we hypothesized that knockout of TXNIP would be beneficial to the intracellular survival of Brucella. Indeed, our data demonstrated that the deletion of TXNIP promotes B. abortus intracellular growth (Fig. 1D, 1E). Collectively, B. abortus decreased the expression of TXNIP, which promoted intracellular growth in macrophages by decreasing the production of NO and ROS.

Previous studies showed that IRE1 of ER stress used the miR-17 intermediate to control the expression of TXNIP (20, 60, 61). In addition, IRE1 pathway was reported to be activated by Brucella T4SS (3), and our results showed that the expression of TXNIP is dependent on T4SS of Brucella. Therefore, we hypothesized that Brucella may use T4SS to activate the IRE1–mir-17 pathway and then regulate the expression of TXNIP. Unexpectedly, the phosphorylation of IRE1α was increased, whereas the expression of miR-17 was reduced at 24 h post infection (Fig. 7A, 7B). Additionally, Tm was added to uninfected RAW264.7 cell culture to upregulate TXNIP expression, and at the same time, the miR-17 expression was decreased. In Brucella-infected RAW264.7 cells, Tm treatment increased the TXNIP expression, whereas miR-17 expression remained unchanged. Thus, the expression of TXNIP is independent of the IRE1–miR-17 pathway of ER stress. It has been demonstrated that exogenous and endogenous NO can suppress TXNIP expression and that TXNIP facilitates nitrosative stress (27, 38). In the current study, we used the NO synthase inhibitor AG to determine that NO regulated the expression of TXNIP. The result showed that with the decrease of NO (Fig. 5C), the expression of TXNIP was restored in a dose-dependent manner (Fig. 5D, 5E). Thus, we believe that iNOS/NO is involved in an upstream regulatory pathway of TXNIP during Brucella infection. However, NO only regulated the expression of TXNIP in the later stage of infection, although the expression of TXNIP also decreased at 1 h post infection in RAW264.7 cells but is independent of the T4SS of the Brucella and NO. In addition, Brucella infection did not significantly reduce the TXNIP expression at 1 h in BMDMs. The specific mechanism still needs further studies. The collective data suggest the formation of the iNOS/NO–TXNIP–iNOS/NO pathway, a negative feedback­–regulation mechanism of NO during the later stage of Brucella infection.

The T4SS of the Brucella is essential for persistent infection in cultured macrophages and in mammals (62). Research has shown that the T4SS regulates Brucella intracellular trafficking, and organisms that lack this system fail to establish an intracellular replicative niche in vitro (63). The T4SS of Brucella is thought to secrete effector molecules that control the intracellular and stealthy lifestyle of the pathogen (64, 65). Moreover, B. abortus detection by NLRs, led to apoptosis-associated speck-like protein containing CARD (ASC) inflammasome-mediated production of IL-1β and IL-18 that was also dependent on the T4SS (66). Thus, the T4SS of Brucella plays a critical role in infection. Our data also showed that macrophages infected with the S2308ΔvirB123 rarely expressed iNOS and NO (Fig. 6C, 6D). We observed that the expression of TXNIP in macrophages infected with the S2308ΔvirB123 was similar to the uninfected group (Fig. 6A, 6B). Collectively, those data suggest that the expression of TXNIP and iNOS/NO are dependent on Brucella T4SS.

The expression of TXNIP in BMDMs and mouse organs were further detected to confirm whether the TXNIP is downregulated in the primary cells and in vivo. Our results indicate that Brucella infection did induce TXNIP downregulation in BMDMs. Moreover, knock down of TXNIP expression in BMDMs increased the intracellular survival of Brucella. The results suggest that Brucella can regulate the expression of TXNIP to promote its intracellular survival in both macrophage cell lines and primary macrophage cells. Besides, TXNIP downregulation was detected in the lungs and spleens of the Brucella-infected mice at different time points post Brucella infection (Fig. 9). Accordingly, bacterial loads in lungs were gradually increased post infection (Fig. 9D). The TXNIP expression in the liver and kidney of the mock mice was very low; therefore, downregulation of the TXNIP was not detectable. These results suggest that TXNIP expression has different tropisms in different tissues and organs that may facilitate Brucella infection in vivo to promote its intracellular survival.

In transcriptome analyses of M. bovis Bacille Calmette–Guerin– and Trypanosoma cruzi–infected human THP-1 macrophages, both downregulated the expression of TXNIP (67). Mice infected with live Pseudomonas aeruginosa also exhibited significantly decreased TXNIP expression (68). Those studies showed that TXNIP may play a pivotal role in pathogenic bacterial infection. Thus, our results may provide a novel mechanism for intracellular bacterium to escape host immunity.

In summary, our results demonstrated that B. abortus infection decreased TXNIP expression, which promoted intracellular growth in macrophages by decreasing the production of NO and ROS. TXNIP expression is regulated by intracellular iNOS/NO, the production of which is dependent on the T4SS of Brucella. Overall, we elucidated the Brucella T4SS-induced iNOS/NO–TXNIP–iNOS/NO pathway, a negative feedback–regulation mechanism of NO (Fig. 10). This pathway may be a novel host surveillance pathway for bacterial intracellular survival. An in depth understanding of the evasive strategies used by Brucella will enable the development of novel effective therapeutic approaches to treat brucellosis.

FIGURE 10.

A schematic model showing TXNIP- and NO-mediated regulatory pathways in B. abortus intracellular survival. B. abortus–infected macrophages can induce iNOS expression, which can lead to NO release. Deletion of the B. abortus T4SS nearly abolished the expression of iNOS and NO. The production of NO has an antibacterial effect in macrophages. Therefore, the production of NO is an immunoreaction of the host cells. However, during this process, B. abortus can use NO to reduce TXNIP expression, which can lead decreased expression of iNOS and the production of NO. Thus, forming a negative feedback–regulated system of NO confers protection against iNOS-mediated antibacterial effects.

FIGURE 10.

A schematic model showing TXNIP- and NO-mediated regulatory pathways in B. abortus intracellular survival. B. abortus–infected macrophages can induce iNOS expression, which can lead to NO release. Deletion of the B. abortus T4SS nearly abolished the expression of iNOS and NO. The production of NO has an antibacterial effect in macrophages. Therefore, the production of NO is an immunoreaction of the host cells. However, during this process, B. abortus can use NO to reduce TXNIP expression, which can lead decreased expression of iNOS and the production of NO. Thus, forming a negative feedback–regulated system of NO confers protection against iNOS-mediated antibacterial effects.

Close modal

This work was supported by funds from the National Natural Science Foundation of China (31972723).

The online version of this article contains supplemental material.

Abbreviations used in this article:

AG

aminoguanidine

BMDM

bone marrow–derived macrophage

ER

endoplasmic reticulum

iNOS

inducible NO synthase

NAC

N-acetyl-l-cysteine

NC siRNA

nontargeted siRNA

NLRP3

nod-like receptor protein 3

qPCR

quantitative real-time PCR

ROS

reactive oxygen species

siRNA

small interfering RNA

TBHP

t-butylhydroperoxide

Tm

tunicamycin

TRX

thioredoxin

T4SS

type IV secretion system

TXNIP

thioredoxin-interacting protein.

1
Ahmed
,
W.
,
K.
Zheng
,
Z. F.
Liu
.
2016
.
Establishment of chronic infection: Brucella’s stealth strategy.
Front. Cell. Infect. Microbiol.
6
:
30
.
2
Campos
,
P. C.
,
M. T.
Gomes
,
G.
Guimarães
,
M. M.
Costa Franco
,
F. M.
Marim
,
S. C.
Oliveira
.
2014
.
Brucella abortus DNA is a major bacterial agonist to activate the host innate immune system.
Microbes Infect.
16
:
979
984
.
3
Skendros
,
P.
,
G.
Pappas
,
P.
Boura
.
2011
.
Cell-mediated immunity in human brucellosis.
Microbes Infect.
13
:
134
142
.
4
Martirosyan
,
A.
,
J. P.
Gorvel
.
2013
.
Brucella evasion of adaptive immunity.
Future Microbiol.
8
:
147
154
.
5
Paik
,
S.
,
S.
Choi
,
K. I.
Lee
,
Y. W.
Back
,
Y. J.
Son
,
E. K.
Jo
,
H. J.
Kim
.
2019
.
Mycobacterium tuberculosis acyl carrier protein inhibits macrophage apoptotic death by modulating the reactive oxygen species/c-Jun N-terminal kinase pathway.
Microbes Infect.
21
:
40
49
6
Byndloss
,
M. X.
,
R. M.
Tsolis
.
2016
.
Brucella spp. virulence factors and immunity.
Annu. Rev. Anim. Biosci.
4
:
111
127
.
7
Barquero-Calvo
,
E.
,
E.
Chaves-Olarte
,
D. S.
Weiss
,
C.
Guzmán-Verri
,
C.
Chacón-Díaz
,
A.
Rucavado
,
I.
Moriyón
,
E.
Moreno
.
2007
.
Brucella abortus uses a stealthy strategy to avoid activation of the innate immune system during the onset of infection.
PLoS One
2
: e631.
8
Oliveira
,
S. C.
,
F. S.
de Oliveira
,
G. C.
Macedo
,
L. A.
de Almeida
,
N. B.
Carvalho
.
2008
.
The role of innate immune receptors in the control of Brucella abortus infection: toll-like receptors and beyond.
Microbes Infect.
10
:
1005
1009
.
9
Patwari
,
P.
,
L. J.
Higgins
,
W. A.
Chutkow
,
J.
Yoshioka
,
R. T.
Lee
.
2006
.
The interaction of thioredoxin with Txnip. Evidence for formation of a mixed disulfide by disulfide exchange.
J. Biol. Chem.
281
:
21884
21891
.
10
Jung
,
H.
,
M. J.
Kim
,
D. O.
Kim
,
W. S.
Kim
,
S. J.
Yoon
,
Y. J.
Park
,
S. R.
Yoon
,
T. D.
Kim
,
H. W.
Suh
,
S.
Yun
, et al
.
2013
.
TXNIP maintains the hematopoietic cell pool by switching the function of p53 under oxidative stress.
Cell Metab.
18
:
75
85
.
11
Oslowski
,
C. M.
,
T.
Hara
,
B.
O’Sullivan-Murphy
,
K.
Kanekura
,
S.
Lu
,
M.
Hara
,
S.
Ishigaki
,
L. J.
Zhu
,
E.
Hayashi
,
S. T.
Hui
, et al
.
2012
.
Thioredoxin-interacting protein mediates ER stress-induced β cell death through initiation of the inflammasome.
Cell Metab.
16
:
265
273
.
12
Shah
,
A.
,
L.
Xia
,
H.
Goldberg
,
K. W.
Lee
,
S. E.
Quaggin
,
I. G.
Fantus
.
2013
.
Thioredoxin-interacting protein mediates high glucose-induced reactive oxygen species generation by mitochondria and the NADPH oxidase, Nox4, in mesangial cells.
J. Biol. Chem.
288
:
6835
6848
.
13
Han
,
Y.
,
X.
Xu
,
C.
Tang
,
P.
Gao
,
X.
Chen
,
X.
Xiong
,
M.
Yang
,
S.
Yang
,
X.
Zhu
,
S.
Yuan
, et al
.
2018
.
Reactive oxygen species promote tubular injury in diabetic nephropathy: the role of the mitochondrial ros-txnip-nlrp3 biological axis. [Published erratum appears in 2019 Redox Biol. 24: 101216.]
Redox Biol.
16
:
32
46
.
14
Hwang
,
J.
,
H. W.
Suh
,
Y. H.
Jeon
,
E.
Hwang
,
L. T.
Nguyen
,
J.
Yeom
,
S. G.
Lee
,
C.
Lee
,
K. J.
Kim
,
B. S.
Kang
, et al
.
2014
.
The structural basis for the negative regulation of thioredoxin by thioredoxin-interacting protein.
Nat. Commun.
5
:
2958
.
15
Saxena
,
G.
,
J.
Chen
,
A.
Shalev
.
2010
.
Intracellular shuttling and mitochondrial function of thioredoxin-interacting protein.
J. Biol. Chem.
285
:
3997
4005
.
16
Zhou
,
R.
,
A.
Tardivel
,
B.
Thorens
,
I.
Choi
,
J.
Tschopp
.
2010
.
Thioredoxin-interacting protein links oxidative stress to inflammasome activation.
Nat. Immunol.
11
:
136
140
.
17
Gao
,
P.
,
F. F.
He
,
H.
Tang
,
C. T.
Lei
,
S.
Chen
,
X. F.
Meng
,
H.
Su
,
C.
Zhang
.
2015
.
NADPH oxidase-induced NALP3 inflammasome activation is driven by thioredoxin-interacting protein which contributes to podocyte injury in hyperglycemia. [Published erratum appears in 2016 J. Diabetes Res. 2016: 1213892.]
J. Diabetes Res.
2015
: 504761.
18
Hou
,
Y.
,
Y.
Wang
,
Q.
He
,
L.
Li
,
H.
Xie
,
Y.
Zhao
,
J.
Zhao
.
2018
.
Nrf2 inhibits NLRP3 inflammasome activation through regulating Trx1/TXNIP complex in cerebral ischemia reperfusion injury.
Behav. Brain Res.
336
:
32
39
.
19
Hui
,
S. T.
,
A. M.
Andres
,
A. K.
Miller
,
N. J.
Spann
,
D. W.
Potter
,
N. M.
Post
,
A. Z.
Chen
,
S.
Sachithanantham
,
D. Y.
Jung
,
J. K.
Kim
,
R. A.
Davis
.
2008
.
Txnip balances metabolic and growth signaling via PTEN disulfide reduction.
Proc. Natl. Acad. Sci. USA
105
:
3921
3926
.
20
Lerner
,
A. G.
,
J. P.
Upton
,
P. V.
Praveen
,
R.
Ghosh
,
Y.
Nakagawa
,
A.
Igbaria
,
S.
Shen
,
V.
Nguyen
,
B. J.
Backes
,
M.
Heiman
, et al
.
2012
.
IRE1α induces thioredoxin-interacting protein to activate the NLRP3 inflammasome and promote programmed cell death under irremediable ER stress.
Cell Metab.
16
:
250
264
.
21
Bogdan
,
C.
2001
.
Nitric oxide and the immune response.
Nat. Immunol.
2
:
907
916
.
22
Fang
,
F. C.
2004
.
Antimicrobial reactive oxygen and nitrogen species: concepts and controversies.
Nat. Rev. Microbiol.
2
:
820
832
.
23
Jones-Carson
,
J.
,
J.
Laughlin
,
M. A.
Hamad
,
A. L.
Stewart
,
M. I.
Voskuil
,
A.
Vázquez-Torres
.
2008
.
Inactivation of [Fe-S] metalloproteins mediates nitric oxide-dependent killing of Burkholderia mallei.
PLoS One
3
: e1976.
24
Mishra
,
B. B.
,
V. A.
Rathinam
,
G. W.
Martens
,
A. J.
Martinot
,
H.
Kornfeld
,
K. A.
Fitzgerald
,
C. M.
Sassetti
.
2013
.
Nitric oxide controls the immunopathology of tuberculosis by inhibiting NLRP3 inflammasome-dependent processing of IL-1β.
Nat. Immunol.
14
:
52
60
.
25
Urbano
,
R.
,
J. E.
Karlinsey
,
S. J.
Libby
,
P. T.
Doulias
,
H.
Ischiropoulos
,
H. I.
Warheit-Niemi
,
D. H.
Liggitt
,
A. R.
Horswill
,
F. C.
Fang
.
2018
.
Host nitric oxide disrupts microbial cell-to-cell communication to inhibit staphylococcal virulence.
Cell Host Microbe
23
:
594
606.e7
.
26
Lima-Junior
,
D. S.
,
D. L.
Costa
,
V.
Carregaro
,
L. D.
Cunha
,
A. L.
Silva
,
T. W.
Mineo
,
F. R.
Gutierrez
,
M.
Bellio
,
K. R.
Bortoluci
,
R. A.
Flavell
, et al
.
2013
.
Inflammasome-derived IL-1β production induces nitric oxide-mediated resistance to Leishmania.
Nat. Med.
19
:
909
915
.
27
Forrester
,
M. T.
,
D.
Seth
,
A.
Hausladen
,
C. E.
Eyler
,
M. W.
Foster
,
A.
Matsumoto
,
M.
Benhar
,
H. E.
Marshall
,
J. S.
Stamler
.
2009
.
Thioredoxin-interacting protein (Txnip) is a feedback regulator of S-nitrosylation.
J. Biol. Chem.
284
:
36160
36166
.
28
Park
,
Y. J.
,
S. J.
Yoon
,
H. W.
Suh
,
D. O.
Kim
,
J. R.
Park
,
H.
Jung
,
T. D.
Kim
,
S. R.
Yoon
,
J. K.
Min
,
H. J.
Na
, et al
.
2013
.
TXNIP deficiency exacerbates endotoxic shock via the induction of excessive nitric oxide synthesis.
PLoS Pathog.
9
: e1003646.
29
Weischenfeldt
,
J.
,
B.
Porse
.
2008
.
Bone marrow-derived macrophages (BMM): isolation and applications.
CSH Protoc.
2008
:
pdb.prot5080
.
30
Feng
,
D.
,
W. H.
Ling
,
R. D.
Duan
.
2010
.
Lycopene suppresses LPS-induced NO and IL-6 production by inhibiting the activation of ERK, p38MAPK, and NF-kappaB in macrophages.
Inflamm. Res.
59
:
115
121
.
31
Szpigel
,
A.
,
I.
Hainault
,
A.
Carlier
,
N.
Venteclef
,
A. F.
Batto
,
E.
Hajduch
,
C.
Bernard
,
A.
Ktorza
,
J. F.
Gautier
,
P.
Ferré
, et al
.
2018
.
Lipid environment induces ER stress, TXNIP expression and inflammation in immune cells of individuals with type 2 diabetes.
Diabetologia
61
:
399
412
.
32
Monteiro
,
M. B.
,
D. P.
Santos-Bezerra
,
K.
Thieme
,
S. N.
Admoni
,
R. V.
Perez
,
C. G.
Machado
,
M. S.
Queiroz
,
M.
Nery
,
M.
Oliveira-Souza
,
V.
Woronik
, et al
.
2016
.
Thioredoxin interacting protein expression in the urinary sediment associates with renal function decline in type 1 diabetes.
Free Radic. Res.
50
:
101
110
.
33
Dharmaraja
,
A. T.
2017
.
Role of reactive oxygen species (ROS) in therapeutics and drug resistance in cancer and bacteria.
J. Med. Chem.
60
:
3221
3240
.
34
Gross
,
A.
,
S.
Bertholet
,
J.
Mauel
,
J.
Dornand
.
2004
.
Impairment of Brucella growth in human macrophagic cells that produce nitric oxide.
Microb. Pathog.
36
:
75
82
.
35
Kwon
,
H. J.
,
Y. S.
Won
,
H. W.
Suh
,
J. H.
Jeon
,
Y.
Shao
,
S. R.
Yoon
,
J. W.
Chung
,
T. D.
Kim
,
H. M.
Kim
,
K. H.
Nam
, et al
.
2010
.
Vitamin D3 upregulated protein 1 suppresses TNF-α-induced NF-κB activation in hepatocarcinogenesis.
J. Immunol.
185
:
3980
3989
.
36
He
,
X.
,
Q.
Ma
.
2012
.
Redox regulation by nuclear factor erythroid 2-related factor 2: gatekeeping for the basal and diabetes-induced expression of thioredoxin-interacting protein.
Mol. Pharmacol.
82
:
887
897
.
37
Kennedy
,
A. D.
,
F. R.
DeLeo
.
2008
.
PI3K and NADPH oxidase: a class act.
Blood
112
:
4788
4789
.
38
Schulze
,
P. C.
,
H.
Liu
,
E.
Choe
,
J.
Yoshioka
,
A.
Shalev
,
K. D.
Bloch
,
R. T.
Lee
.
2006
.
Nitric oxide-dependent suppression of thioredoxin-interacting protein expression enhances thioredoxin activity.
Arterioscler. Thromb. Vasc. Biol.
26
:
2666
2672
.
39
O’Callaghan
,
D.
,
C.
Cazevieille
,
A.
Allardet-Servent
,
M. L.
Boschiroli
,
G.
Bourg
,
V.
Foulongne
,
P.
Frutos
,
Y.
Kulakov
,
M.
Ramuz
.
1999
.
A homologue of the Agrobacterium tumefaciens VirB and Bordetella pertussis Ptl type IV secretion systems is essential for intracellular survival of Brucella suis.
Mol. Microbiol.
33
:
1210
1220
.
40
Rolán
,
H. G.
,
R. M.
Tsolis
.
2008
.
Inactivation of the type IV secretion system reduces the Th1 polarization of the immune response to Brucella abortus infection.
Infect. Immun.
76
:
3207
3213
.
41
Roux
,
C. M.
,
H. G.
Rolán
,
R. L.
Santos
,
P. D.
Beremand
,
T. L.
Thomas
,
L. G.
Adams
,
R. M.
Tsolis
.
2007
.
Brucella requires a functional type IV secretion system to elicit innate immune responses in mice.
Cell. Microbiol.
9
:
1851
1869
.
42
Anthony
,
T. G.
,
R. C.
Wek
.
2012
.
TXNIP switches tracks toward a terminal UPR.
Cell Metab.
16
:
135
137
.
43
Gamdzyk
,
M.
,
D. M.
Doycheva
,
J.
Malaguit
,
B.
Enkhjargal
,
J.
Tang
,
J. H.
Zhang
.
2018
.
Role of PPAR-β/δ/miR-17/TXNIP pathway in neuronal apoptosis after neonatal hypoxic-ischemic injury in rats.
Neuropharmacology
140
:
150
161
.
44
Xu
,
W.
,
L.
Wang
,
J.
Li
,
Y.
Cai
,
Y.
Xue
.
2018
.
TXNIP mediated the oxidative stress response in glomerular mesangial cells partially through AMPK pathway.
Biomed. Pharmacother.
107
:
785
792
.
45
Mahmood
,
D. F.
,
A.
Abderrazak
,
K.
El Hadri
,
T.
Simmet
,
M.
Rouis
.
2013
.
The thioredoxin system as a therapeutic target in human health and disease.
Antioxid. Redox Signal.
19
:
1266
1303
.
46
Vareille
,
M.
,
T.
de Sablet
,
T.
Hindré
,
C.
Martin
,
A. P.
Gobert
.
2007
.
Nitric oxide inhibits Shiga-toxin synthesis by enterohemorrhagic Escherichia coli.
Proc. Natl. Acad. Sci. USA
104
:
10199
10204
.
47
Branchu
,
P.
,
S.
Matrat
,
M.
Vareille
,
A.
Garrivier
,
A.
Durand
,
S.
Crépin
,
J.
Harel
,
G.
Jubelin
,
A. P.
Gobert
.
2014
.
NsrR, GadE, and GadX interplay in repressing expression of the Escherichia coli O157:H7 LEE pathogenicity island in response to nitric oxide.
PLoS Pathog.
10
: e1003874.
48
Barraud
,
N.
,
M. J.
Kelso
,
S. A.
Rice
,
S.
Kjelleberg
.
2015
.
Nitric oxide: a key mediator of biofilm dispersal with applications in infectious diseases.
Curr. Pharm. Des.
21
:
31
42
.
49
Axelrod
,
S.
,
H.
Oschkinat
,
J.
Enders
,
B.
Schlegel
,
V.
Brinkmann
,
S. H.
Kaufmann
,
A.
Haas
,
U. E.
Schaible
.
2008
.
Delay of phagosome maturation by a mycobacterial lipid is reversed by nitric oxide.
Cell. Microbiol.
10
:
1530
1545
.
50
Reniere
,
M. L.
2018
.
Reduce, induce, thrive: bacterial redox sensing during pathogenesis.
J. Bacteriol.
DOI: 10.1128/jb.00128-18.
51
Deffert
,
C.
,
J.
Cachat
,
K. H.
Krause
.
2014
.
Phagocyte NADPH oxidase, chronic granulomatous disease and mycobacterial infections.
Cell. Microbiol.
16
:
1168
1178
.
52
Herbst
,
S.
,
U. E.
Schaible
,
B. E.
Schneider
.
2011
.
Interferon gamma activated macrophages kill mycobacteria by nitric oxide induced apoptosis.
PLoS One
6
: e19105.
53
Gammella
,
E.
,
P.
Buratti
,
G.
Cairo
,
S.
Recalcati
.
2014
.
Macrophages: central regulators of iron balance.
Metallomics
6
:
1336
1345
.
54
Ko
,
J.
,
A.
Gendron-Fitzpatrick
,
G. A.
Splitter
.
2002
.
Susceptibility of IFN regulatory factor-1 and IFN consensus sequence binding protein-deficient mice to brucellosis.
J. Immunol.
168
:
2433
2440
.
55
Davis
,
A. S.
,
I.
Vergne
,
S. S.
Master
,
G. B.
Kyei
,
J.
Chua
,
V.
Deretic
.
2007
.
Mechanism of inducible nitric oxide synthase exclusion from mycobacterial phagosomes.
PLoS Pathog.
3
: e186.
56
Deghmane
,
A. E.
,
H.
Soualhine
,
H.
Bach
,
K.
Sendide
,
S.
Itoh
,
A.
Tam
,
S.
Noubir
,
A.
Talal
,
R.
Lo
,
S.
Toyoshima
, et al
.
2007
.
Lipoamide dehydrogenase mediates retention of coronin-1 on BCG vacuoles, leading to arrest in phagosome maturation. [Published erratum appears in 2007 J. Cell Sci. 120: 3489.]
J. Cell Sci.
120
:
2796
2806
.
57
Abdalla
,
M. Y.
,
I. M.
Ahmad
,
B.
Switzer
,
B. E.
Britigan
.
2015
.
Induction of heme oxygenase-1 contributes to survival of Mycobacterium abscessus in human macrophages-like THP-1 cells.
Redox Biol.
4
:
328
339
.
58
Wei
,
P.
,
Q.
Lu
,
G.
Cui
,
Z.
Guan
,
L.
Yang
,
C.
Sun
,
W.
Sun
,
Q.
Peng
.
2015
.
The role of TREM-2 in internalization and intracellular survival of Brucella abortus in murine macrophages.
Vet. Immunol. Immunopathol.
163
:
194
201
.
59
Liu
,
N.
,
Y.
Li
,
C.
Dong
,
X.
Xu
,
P.
Wei
,
W.
Sun
,
Q.
Peng
.
2016
.
Inositol-requiring enzyme 1-dependent activation of AMPK promotes Brucella abortus intracellular growth.
J. Bacteriol.
198
:
986
993
.
60
Chen
,
D.
,
B. J.
Dixon
,
D. M.
Doycheva
,
B.
Li
,
Y.
Zhang
,
Q.
Hu
,
Y.
He
,
Z.
Guo
,
D.
Nowrangi
,
J.
Flores
, et al
.
2018
.
IRE1α inhibition decreased TXNIP/NLRP3 inflammasome activation through miR-17-5p after neonatal hypoxic-ischemic brain injury in rats.
J. Neuroinflammation
15
:
32
.
61
Liu
,
Y.
,
G.
Lou
,
A.
Li
,
T.
Zhang
,
J.
Qi
,
D.
Ye
,
M.
Zheng
,
Z.
Chen
.
2018
.
AMSC-derived exosomes alleviate lipopolysaccharide/d-galactosamine-induced acute liver failure by miR-17-mediated reduction of TXNIP/NLRP3 inflammasome activation in macrophages.
EBioMedicine
36
:
140
150
.
62
de Jong
,
M. F.
,
T.
Starr
,
M. G.
Winter
,
A. B.
den Hartigh
,
R.
Child
,
L. A.
Knodler
,
J. M.
van Dijl
,
J.
Celli
,
R. M.
Tsolis
.
2013
.
Sensing of bacterial type IV secretion via the unfolded protein response.
MBio
4
: e00418-12.
63
Comerci
,
D. J.
,
M. J.
Martínez-Lorenzo
,
R.
Sieira
,
J. P.
Gorvel
,
R. A.
Ugalde
.
2001
.
Essential role of the VirB machinery in the maturation of the Brucella abortus-containing vacuole.
Cell. Microbiol.
3
:
159
168
.
64
Salcedo
,
S. P.
,
M. I.
Marchesini
,
C.
Degos
,
M.
Terwagne
,
K.
Von Bargen
,
H.
Lepidi
,
C. K.
Herrmann
,
T. L.
Santos Lacerda
,
P. R.
Imbert
,
P.
Pierre
, et al
.
2013
.
BtpB, a novel Brucella TIR-containing effector protein with immune modulatory functions.
Front. Cell. Infect. Microbiol.
3
:
28
.
65
Döhmer
,
P. H.
,
E.
Valguarnera
,
C.
Czibener
,
J. E.
Ugalde
.
2014
.
Identification of a type IV secretion substrate of Brucella abortus that participates in the early stages of intracellular survival.
Cell. Microbiol.
16
:
396
410
.
66
Gomes
,
M. T.
,
P. C.
Campos
,
F. S.
Oliveira
,
P. P.
Corsetti
,
K. R.
Bortoluci
,
L. D.
Cunha
,
D. S.
Zamboni
,
S. C.
Oliveira
.
2013
.
Critical role of ASC inflammasomes and bacterial type IV secretion system in caspase-1 activation and host innate resistance to Brucella abortus infection.
J. Immunol.
190
:
3629
3638
.
67
Huante
,
M. B.
,
S.
Gupta
,
V. C.
Calderon
,
S. J.
Koo
,
M.
Sinha
,
B. A.
Luxon
,
N. J.
Garg
,
J. J.
Endsley
.
2016
.
Differential inflammasome activation signatures following intracellular infection of human macrophages with Mycobacterium bovis BCG or Trypanosoma cruzi.
Tuberculosis (Edinb.)
101S
:
S35
S44
.
68
Piao
,
Z. H.
,
M. S.
Kim
,
M.
Jeong
,
S.
Yun
,
S. H.
Lee
,
H. N.
Sun
,
H. Y.
Song
,
H. W.
Suh
,
H.
Jung
,
S. R.
Yoon
, et al
.
2012
.
VDUP1 exacerbates bacteremic shock in mice infected with Pseudomonas aeruginosa.
Cell. Immunol.
280
:
1
9
.

The authors have no financial conflicts of interest.

Supplementary data