Visual Abstract

Tumor-associated macrophages (TAMs) play a critical role in the tumor inflammatory microenvironment and facilitate tumor growth and metastasis. Most types of tumors aberrantly express microRNAs (miRNAs), which can be transferred between cells by exosomes and can regulate gene expression in recipient cells, but it remains unclear whether tumor-derived miRNAs are transferred by exosomes and regulate the TAM phenotype. We report that mouse 4T1 breast cancer cell–derived exosomes enhanced TAM expression of IL-1β, IL-6, and TNF-α and that inhibition of 4T1-cell exosome secretion through short hairpin RNA–mediated Rab27a/b depletion repressed tumor growth and metastasis and markedly downregulated IL-1β, IL-6, and TNF-α in a 4T1 breast tumor model. Furthermore, miRNA expression profiling revealed that three miRNAs (miR-100-5p, miR-183-5p, and miR-125b-1-3p) were considerably more abundant in 4T1 cell exosomes than in mouse bone marrow–derived macrophages, indicating potential exosome-mediated transfer of the miRNAs, and, notably, miR-183-5p was found to be transferred from 4T1 cells to macrophages through exosomes. Moreover, PPP2CA was verified as an miR-183-5p target gene, and PPP2CA downregulation enhanced NF-κB signaling and promoted macrophage expression of IL-1β, IL-6, and TNF-α. Lastly, when miR-183-5p was downregulated in exosomes through miR-183-5p sponge expression in 4T1 cells, these 4T1-derived exosomes triggered diminished p65 phosphorylation and IL-1β, IL-6, and TNF-α secretion, and the miRNA downregulation also led to repression of tumor growth and metastasis in the 4T1 breast tumor model in vivo. Thus, miR-183-5p expressed in tumor cells was transferred to macrophages by exosomes and promoted the secretion of proinflammatory cytokines by inhibiting PPP2CA expression, which contributed to tumor progression in a breast cancer model.

Recent tumor research has been increasingly focused on the tumor microenvironment (TME), a complex microenvironment composed of not only tumor cells but also numerous other cells, including endothelial cells, stromal fibroblasts, and diverse bone marrow–derived cells (1). In the TME, critical roles are played by tumor-associated macrophages (TAMs). As immune cells, macrophages exhibit a strong secretory ability and can release various cytokines, such as ILs, chemokines, and growth factors, and thereby inhibit antitumor immune responses and sustain the protumor microenvironment (2, 3).

microRNAs (miRNAs) are small noncoding RNAs that are 17–25 nt long and regulate various biological processes by controlling the expression of coding genes (4). Intriguingly, miRNAs are expressed aberrantly in most types of tumors, and numerous miRNAs upregulated in tumor cells can silence tumor-suppressor genes and are commonly regarded as oncogenic miRNAs (5, 6). To investigate the functions and mechanisms of action of these miRNAs, previous studies have commonly focused on cells exhibiting differential expression of the miRNAs. However, the discovery of exosomes and exosomal miRNAs has revealed that miRNAs hold the potential to regulate the entire microenvironment through exosome-mediated delivery. In 2007, researchers in Sweden demonstrated that miRNAs were present at abundant levels in exosomes and that the exosomal miRNAs could enter recipient cells and regulate gene expression by binding to target mRNAs, which opened a new avenue of investigation into mRNAs (7). Therefore, we sought to ascertain whether the miRNAs expressed aberrantly in tumor cells can be transferred through exosomes and could regulate the TAM phenotype to promote tumor growth and metastasis.

In this study, we determined that miR-183-5p expressed in tumors could be delivered to macrophages by exosomes and could promote secretion of proinflammatory cytokines to sustain the TME. Our findings reveal a previously unrecognized mechanism of communication between cancer cells and TAMs.

The mouse breast cancer cell line 4T1 was obtained from Dr. R. A. Reisfeld (The Scripps Institute, La Jolla, CA), the human breast cancer cell lines MDA-MB-231 and MCF-7 were purchased from American Type Culture Collection (Manassas, VA), and the human breast cancer cell lines BT474, MDA-MB-453, BT20, T47D, BT549, and MDA-MB-157 were obtained from Cell Resource Center of Peking Union Medical College (Beijing, China). The 4T1, T47D, BT549, and BT474 cells were cultured in RPMI 1640 medium (SH30809.01; Hyclone) supplemented with 1% antibiotics (penicillin-streptomycin, 15140122; Thermo Fisher Scientific) and 10% FBS (1739463; Thermo Fisher Scientific). The MDA-MB-453 and MDA-MB-157 were cultured in L15 (SH30525.01; Hyclone) supplemented with 1% antibiotics and 10% FBS, and the MDA-MB-231 and MCF-7 cells were cultured in DMEM (SH30022.01B; Hyclone) supplemented with 1% antibiotics and 10% FBS.

All animal experiments were conducted in accordance with the guidelines on laboratory animals and were approved by the Institutional Review Board of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. Female BALB/c mice (6–8 wk old) were purchased from Beijing Vital River Laboratory, and 4T1 breast tumors were established by injecting 2 × 105 tumor cells in 100 μl of PBS into the fourth mammary fat pad of each 8-wk-old mouse. On day 28 after injection, the tumor in each mouse was harvested for use in flow cytometry and immunohistochemical (IHC) analyses, and the lung tissues were separated for H&E staining.

Flow cytometry was used to isolate TAMs from 4T1 breast tumors. The tumor tissue was first minced into 1-mm cubes and enzymatically digested using collagenase (C2674; Sigma-Aldrich) for 30 min in a 37°C shaking incubator (190 rpm). The digested tissues were then passed through a 70-μm cell strainer (352350; BD Falcon) and washed with PBS. RBCs were lysed using Red Cell Lysis Buffer (RT122; Tiangen). Finally, the tumor cells were stained, at 1 × 107 cells per milliliter, for 30 min with Abs (CD11b-PerCP and CD68-allophycocyanin; 101229 and 137007, respectively; BioLegend), and after washing with PBS, CD11b+CD68+ TAMs were isolated using a flow cytometer (FACS Aria III; BD Biosciences).

Briefly, the tibias and femurs were isolated from female 6- to 8-wk-old BALB/c mice. Bone marrow–derived macrophages (BMDMs) were generated from the bone marrow present in the femurs and tibias and were cultured for 6 d in RPMI 1640 medium supplemented with 1% antibiotics, 10% FBS, and 30 ng/ml recombinant mouse M-CSF (96-315-02-100; PeproTech).

IHC staining was performed using an IHC kit (PV-9001; Zsbio). Briefly, after deparaffinization and rehydration, 4T1 tumor tissue paraffin sections (4 μm) were subject to heat-induced epitope retrieval by using EDTA (ZLI-9067; Zsbio), and then the sections were treated with blocking buffer and subsequently incubated overnight (at 4°C) with primary Abs against IL-1β (A11370), IL-6 (A11114), and TNF-α (A11534) (all at 1:50; ABclonal Technology). Next, the sections were incubated with HRP-conjugated secondary Abs and then diaminobenzidine was used to visualize the immunoreaction. Nuclei were counterstained with hematoxylin (C0107; Beyotime), and IHC-staining images were captured using a microscope (Leica). The optical densities of the images were measured by Image Pro Plus 6.0 (Media Cybernetics).

For immunofluorescence labeling, BMDMs were washed with PBS, fixed with 4% formaldehyde, blocked with 2% BSA in PBS for 1 h, and then incubated overnight (at 4°C) with a primary Ab against p65 (sc-372, 1:50; Santa Cruz Biotechnology); the cells were washed, incubated with secondary Abs (A594-donkey anti-rabbit, ab150076, 1:200; Abcam), and then examined using a fluorescence microscope.

We cultured 4T1 cells for 48 h in RPMI 1640 medium containing 10% exosome-depleted FBS and then purified exosomes from the culture medium through sequential ultracentrifugation, as described previously. Briefly, the culture medium was first centrifuged at 300 × g for 10 min and the supernatant was further centrifuged at 2000 × g for 10 min and 10,000 × g for 30 min. To collect exosomes, final supernatants were centrifuged at 110,000 × g for 2 h and the pellets were washed once with PBS under the same centrifugation conditions (all steps were performed at 4°C). Exosomes were resuspended in PBS and total-protein level of exosomes was detected using the BCA assay (23227; Thermo Fisher Scientific). To detect the regulation of tumor-derived exosomes on macrophages, 20 μg of 4T1-derived exosomes were incubated with 5 × 105 BMDMs for 36 h. RNA and protein were extracted for further analysis. For exosome depletion, conditioned medium was centrifuged overnight at 110,000 × g at 4°C.

Total RNA was purified from cells and exosomes by using an miRNeasy Mini Kit (217004; Qiagen) and reverse-transcribed using TransScript First-Strand cDNA Synthesis SuperMix (AT301-03; TransGen Biotech). Quantitative PCR (qPCR) for miRNA was performed using TaqMan probes (Thermo Fisher Scientific) and for mRNA was performed using TransStart Tip Green qPCR SuperMix (AQ141-04; TransGen Biotech), according to the manufacturer’s protocol. mRNA expression is normalized to β-actin and miRNA expression is normalized to U6 small nuclear RNA.

Total RNA from BMDMs and 4T1-derived exosomes was used for miRNA sequencing. Library preparation and miRNA sequencing were performed by Ribobio. Briefly, RNAs were ligated with 3ʹRNA adapters and then with 5ʹRNA adapters, and the adapter-ligated RNAs were subject to RT-PCR and amplified using a low-cycle protocol. The PCR products were purified on PAGE gels and sequenced using an Illumina HiSeq 2500 platform. Raw data of the miRNA sequencing were further processed, and the miRNA expression level was evaluated as reads per million. The miRNA sequencing data has been submitted to Sequence Read Archive and can be viewed at: https://www.ncbi.nlm.nih.gov/sra/PRJNA636276.

To quantify BMDM secretion of IL-1β, IL-6, and TNF-α, ELISA was performed using Ready-SET-Go Kits (IL-1β, 88-7013; IL-6, 88-7064; TNF-α, 88-7324; Affymetrix), as per manufacturer instructions. Cell culture supernatants were collected after centrifugation at 300 × g for 10 min and 2000 × g for 10 min and stored at −80°C for subsequent cytokine measurement.

Total-protein extracts were prepared using Mammalian Protein Extraction Reagent (78501; Thermo Fisher Scientific), separated on Precast Bis-Tris Gels (180-8008H; Tanon), and transferred to PVDF membranes (1620177; Bio-Rad Laboratories), which were incubated (overnight at 4°C) with primary Abs against PPP2CA (13482-1-AP; Proteintech Group), Rab27a (13412-1-AP; Proteintech Group), Rab27b (13412-1-AP; Proteintech Group), p65 (sc-372; Santa Cruz Biotechnology), p-p65 (3033; CST), or β-actin (8457; CST). The membranes were next incubated (2 h, at room temperature) with secondary Abs (anti-rabbit IgG HRP, 7074; Cell Signaling Technology), and then protein bands were detected using Clarity Western ECL Substrate (1705061; Bio-Rad Laboratories). The Western blots were quantified using Image J software (National Institutes of Health).

Small RNAs, including miRNA mimics (Thermo Fisher Scientific), small interfering RNAs (siRNAs) (Thermo Fisher Scientific), and Cy3-labeled cel–miR-239b-5p (Ribobio), were transiently transfected into BMDMs by using RNAiMAX Transfection Reagent (13778075; Thermo Fisher Scientific) according to manufacturer instructions.

To generate stable Rab27a/Rab27b-knockdown 4T1 cells, Rab27a and Rab27b short hairpin RNA (shRNA) lentiviruses were designed and produced by Shanghai GenePharma. The shRNA sequences were as follows: Rab27a–shRNA-467, 5ʹ-GGCAAGTTCAACTCCAAATTC-3ʹ; Rab27b–shRNA-741, 5ʹ-GCCTTCTTCAGAGATGCCATG-3ʹ; and control-shRNA, 5ʹ-TTCTCCGAACGTGTCACGT-3ʹ. Rab27a–shRNA-467 and control-shRNA were integrated into LV2-Puro vector (Shanghai GenePharma) and Rab27b–shRNA-741 and control-shRNA were integrated into LV1-GFP vector (Shanghai GenePharma). During infection, 4T1 cells were first infected with the Rab27a-shRNA lentiviruses and then treated with 6 μg/ml puromycin, and the surviving cells were further infected with Rab27b-shRNA lentiviruses and the GFP+ cells were isolated using a flow cytometer.

To verify miRNA transfer from tumor cells to macrophages, we overexpressed an artificial miRNA, miR-X (5ʹ-UUCUCCGAACGUGUCACGU-3ʹ), in 4T1 cells by using a lentivirus (Shanghai GenePharma); the miR-X sequence was cloned into the LV2-Puro vector. After lentiviral infection, miR-X–positive cells were acquired through selection with 6 μg/ml puromycin.

The miR-183-5p sponge lentivirus was designed and produced by SyngenTech. The sponge sequence was as follows: 5ʹ-AGTGAATTCTATTAGTGCCATAAGTGAATTCACAGTGCCATAAGTGAATTCTCCTCAGTGCCATAAGTGAATCCACCAGTGCCATAAATGAATTCTACACAGTGCCATAAGTGAATTCAGCAGTGCCATCAGTGAATTGTAACCGTGCCATAGTGAATTCATCACAGTGCCATA-3ʹ. The control sponge sequences were as follows: 5ʹ-CCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAATTAAA-3ʹ. The sponge nucleotides were integrated into pHS-EGFP-Puro vector (SyngenTech), and postinfection with the sponge lentiviruses, the miR-183-5p sponge–expressing cells were selected using puromycin.

To detect the influence of miR-183-5p on the of 3′ untranslated region (3ʹUTR) of PPP2CA mRNA, the part of 3ʹUTR sequences of PPP2CA (wild-type, 5ʹ-TTGTACAGTATTGCC…GTGCCATA…CTTGTTGTGT-3ʹ; mutant, 5ʹ-TTGTACAGTATTGCC…CACGGTAT…CTTGTTGTGT-3ʹ) were cloned into psiCHECK2 plasmid (C8021; Promega). HEK293FT cells were cultured in 24-well culture plates and transfected with 300 ng of the recombinant plasmid and 50 nmol of miR-183-5p or negative-control RNA by using Lipofectamine 2000 (11668500; Thermo Fisher Scientific). After 24 h, cells were harvested, and firefly and Renilla luciferase activities were assayed using a Dual-Luciferase Reporter Assay Kit (E1910; Promega).

All statistical analyses were performed using GraphPad Prism 6 software. Quantitative data were analyzed using either t tests (for two groups) or one-way ANOVA (for multiple groups). All experiments were repeated at least thrice, and data are shown as mean ± SEM. A p value < 0.05 was considered significant.

TAMs are regulated by several factors in the TME and release diverse cytokines, chemokines, and enzymes that enhance tumor progression and metastasis. We injected 4T1 cells into the mammary fat pad of mice to establish a mouse model of breast cancer, and at day 28, we isolated CD11b+CD68+ TAMs from tumors by using flow cytometry and detected the relative expression of several vital protumor genes. All the genes that we detected were increased significantly in the TAMs (Fig. 1A). To determine how tumor cells functionally affect TAMs, we cocultured BMDMs with 4T1-conditioned medium for 36 h. qPCR analyses revealed that the expression levels of IL-1β, IL-6, TNF-α, NOS2, ARG1, CCL22, MMP9, and VEGFA were upregulated significantly in treated macrophages, which was similar to the trend observed in TAMs (Fig. 1B). The result indicated that these highly expressed genes in TAMs might be regulated, at least partly, by the tumor cells directly. The 4T1-conditioned medium contains numerous factors that could regulate macrophage functions, such as cytokines, chemokines, metabolites, and exosomes. To determine how tumor-derived exosomes regulate macrophages, we isolated exosomes from the 4T1-conditioned medium by using differential centrifugation, and we identified the exosomes by using transmission electron microscopy (Fig. 1C) and Western blotting (Fig. 1D). We treated BMDMs with 4T1 exosomes and then used qPCR to detect the genes whose expression was upregulated, which revealed that the expression of IL-1β, IL-6, TNF-α, and NOS2 was increased significantly after the exosome treatment (Fig. 1E). IL-1β, IL-6, and TNF-α are vital proinflammatory cytokines present in the tumor inflammatory microenvironment that promote tumor progression and metastasis through various pathways, and thus, we used ELISA to measure the secretion of IL-1β, IL-6, and TNF-α from BMDMs after treatment with 4T1 exosomes; the BMDM secretion of IL-1β, IL-6, and TNF-α (Fig. 1F) exhibited the same trend as the RNA expression. Furthermore, when we depleted the exosomes present in the 4T1-conditioned medium by using ultracentrifugation and then cultured BMDMs with the exosome-free conditioned medium, the upregulation of these factors by conditioned medium was reduced by the depletion of exosomes from the conditioned medium at both mRNA and protein levels (Fig. 1F, 1G). These results demonstrated that the tumor-derived exosomes promoted the secretion of proinflammatory cytokines in macrophages.

FIGURE 1.

Exosomes derived from 4T1 cells induce secretion of proinflammatory cytokines in BMDMs. (A) CD11b+CD68+ TAMs were isolated from 4T1 mouse breast cancer tissues by using flow cytometry, and the expression of cytokines in TAMs and BMDMs was detected using qPCR. (B) BMDMs were cultured with 4T1-conditioned medium, and cytokine expression was detected using qPCR. (C and D) Exosomes derived from 4T1 cells were confirmed using transmission electron microscopy (C) and Western blotting (D). (E) BMDMs were cultured with 4T1-derived exosomes, and then qPCR was used to detect cytokine expression. (F and G) BMDMs were cultured with 4T1-conditioned medium (with/without exosomes), and the expression of IL-1β, IL-6, and TNF-α was measured using ELISA (F) and qPCR (G). Data are shown as mean ± SEM from three independent experiments. **p < 0.01, ***p < 0.001.

FIGURE 1.

Exosomes derived from 4T1 cells induce secretion of proinflammatory cytokines in BMDMs. (A) CD11b+CD68+ TAMs were isolated from 4T1 mouse breast cancer tissues by using flow cytometry, and the expression of cytokines in TAMs and BMDMs was detected using qPCR. (B) BMDMs were cultured with 4T1-conditioned medium, and cytokine expression was detected using qPCR. (C and D) Exosomes derived from 4T1 cells were confirmed using transmission electron microscopy (C) and Western blotting (D). (E) BMDMs were cultured with 4T1-derived exosomes, and then qPCR was used to detect cytokine expression. (F and G) BMDMs were cultured with 4T1-conditioned medium (with/without exosomes), and the expression of IL-1β, IL-6, and TNF-α was measured using ELISA (F) and qPCR (G). Data are shown as mean ± SEM from three independent experiments. **p < 0.01, ***p < 0.001.

Close modal

To ascertain whether tumor exosomes play a role in tumor growth and metastasis, both Rab27a and Rab27b, which are crucial for exosome secretion (8, 9), were knocked down in 4T1 cells (Fig. 2A) by using shRNA-carrying lentiviruses; the secretion of exosomes by these shRab27a/b 4T1 cells (knockdown cells) was substantially downregulated (Fig. 2B). Next, we injected the shRab27a/b 4T1 cells into BALB/c mice and examined whether exosome secretion affected tumor growth (Fig. 2C–E): downregulation of exosome secretion decreased the growth and weight of tumors and inhibited lung metastasis. Furthermore, the expression of IL-1β, IL-6, and TNF-α in the tumors was markedly downregulated (Fig. 2F). These results demonstrated that tumor-derived exosomes sustained the proinflammatory TME and promoted tumor growth and metastasis.

FIGURE 2.

Downregulation of 4T1-derived exosome release markedly suppresses tumor growth and metastasis. (A) Efficiency of Rab27a/b knockdown in 4T1 cells was examined through Western blotting. (B) Total-protein level of exosomes in conditioned medium from 4T1 cells (shRab27a/b and control) was detected using the BCA assay (normalized to total cell numbers). (C) 4T1 cells (shRab27a/b and control) were injected into BALB/c mice (n = 7) and tumor growth curves were traced. (D) Image and weight of tumors on day 28 (n = 7). (E) Lung metastatic foci were evaluated through H&E staining (n = 7). (F) Expression of IL-1β, IL-6, and TNF-α in tumors was detected using IHC staining. Data are shown as mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 2.

Downregulation of 4T1-derived exosome release markedly suppresses tumor growth and metastasis. (A) Efficiency of Rab27a/b knockdown in 4T1 cells was examined through Western blotting. (B) Total-protein level of exosomes in conditioned medium from 4T1 cells (shRab27a/b and control) was detected using the BCA assay (normalized to total cell numbers). (C) 4T1 cells (shRab27a/b and control) were injected into BALB/c mice (n = 7) and tumor growth curves were traced. (D) Image and weight of tumors on day 28 (n = 7). (E) Lung metastatic foci were evaluated through H&E staining (n = 7). (F) Expression of IL-1β, IL-6, and TNF-α in tumors was detected using IHC staining. Data are shown as mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

Previous work has shown that miRNAs carried in exosomes can be taken up by neighboring or distant cells and can subsequently modulate recipient cells (10). Moreover, miRNA expression in tumors is recognized to be frequently dysregulated (11). However, few studies have addressed whether the aberrantly expressed miRNAs in tumors can be delivered into macrophages by exosomes and can regulate the cytokine production in macrophages. To demonstrate miRNA delivery from tumor cells to macrophages, 4T1 cells were transfected with a Cy3-labeled miR-NC (cel–miR-239b-5p) and then BMDMs were cultured with the conditioned medium from Cy3-miRNA-4T1 cells. Nearly all BMDMs presented strong red fluorescence under a fluorescence microscope (Fig. 3A), which suggested that the miRNA was intercellularly transferred from tumor cells to macrophages. By comparison, when BMDMs were cultured with exosome-free Cy3-miRNA-4T1–conditioned medium, the red fluorescence in BMDMs was substantially weaker, which indicated that the miRNA transfer was mainly mediated by exosomes. Furthermore, we overexpressed in 4T1 cells an artificial miRNA, miR-X, that is not expressed in either 4T1 cells or BMDMs (Supplemental Fig. 1A, 1B) and then cultured BMDMs with the conditioned medium; the results of qPCR analyses showed that miR-X abundance in BMDMs was increased considerably after culture with miR-X-4T1–conditioned medium (Supplemental Fig. 1C), but the abundance was substantially lower when the BMDMs were cultured with exosome-free conditioned medium. Furthermore, when we isolated exosomes from the conditioned medium and treated BMDMs with the exosomes, the abundance of miR-X was increased markedly (Supplemental Fig. 1C). These results demonstrated that tumor cells could deliver miRNAs into macrophages through exosomes.

FIGURE 3.

Exosomes derived from 4T1 cells deliver miR-183-5p to BMDMs. (A) Light and fluorescence microscopy images of BMDMs after culture with Cy3-miRNA-4T1 cell–conditioned medium (with/without exosomes). (B) Heatmap of differential miRNA expression between 4T1-derived exosomes and BMDMs. Gene expression data were obtained using next-generation sequencing on an Illumina HiSeq 2500 platform. (C) miRNA levels in BMDMs and 4T1-derived exosomes were measured using qPCR. (D and E) BMDMs were cultured with 4T1-derived exosomes, and the abundance of miRNA (D) and pri-miRNA (E) in BMDMs was determined using qPCR. (F) BMDMs were cultured with 4T1-conditioned medium (with/without exosomes), and qPCR was used to measure miR-183-5p levels. (G) Levels of miR-183-5p in BMDMs and TAMs were determined using qPCR. (H) miR-183-5p levels in human macrophages and breast cancer cells were measured using qPCR. Data are shown as mean ± SEM from three independent experiments. **p < 0.01, ***p < 0.001.

FIGURE 3.

Exosomes derived from 4T1 cells deliver miR-183-5p to BMDMs. (A) Light and fluorescence microscopy images of BMDMs after culture with Cy3-miRNA-4T1 cell–conditioned medium (with/without exosomes). (B) Heatmap of differential miRNA expression between 4T1-derived exosomes and BMDMs. Gene expression data were obtained using next-generation sequencing on an Illumina HiSeq 2500 platform. (C) miRNA levels in BMDMs and 4T1-derived exosomes were measured using qPCR. (D and E) BMDMs were cultured with 4T1-derived exosomes, and the abundance of miRNA (D) and pri-miRNA (E) in BMDMs was determined using qPCR. (F) BMDMs were cultured with 4T1-conditioned medium (with/without exosomes), and qPCR was used to measure miR-183-5p levels. (G) Levels of miR-183-5p in BMDMs and TAMs were determined using qPCR. (H) miR-183-5p levels in human macrophages and breast cancer cells were measured using qPCR. Data are shown as mean ± SEM from three independent experiments. **p < 0.01, ***p < 0.001.

Close modal

Although several miRNAs are aberrantly expressed in tumors, not all of them can be delivered into macrophages to regulate the macrophage phenotype. Because of the small volume and limited secretion of exosomes, the amount of miRNA secreted is low; however, miRNA use represents a critical regulatory mechanism in macrophage biological processes and numerous miRNAs are expressed in macrophages. Therefore, if an miRNA is rare in tumor exosomes and abundant in macrophages, the exosomes released from the tumor cells cannot alter the distribution of this miRNA in macrophages or the phenotype of macrophages. The miRNA that is transferred from tumors to macrophages by exosomes to regulate the macrophage phenotype must be abundant in tumor-derived exosomes and rare in macrophages. Accordingly, we analyzed miRNA expression levels in BMDMs and 4T1-derived exosomes by using next-generation sequencing, and we selected the 30 miRNAs that were expressed at the highest levels in exosomes and compared these miRNAs between exosomes and BMDMs (Fig. 3B): The miRNAs that were highly expressed in exosomes were typically also abundant in BMDMs; however, four miRNAs (miR-100-5p, miR-183-5p, miR-10b-5p, and miR-125b-1-3p) clearly exhibited high expression in 4T1-derived exosomes and low expression in BMDMs. Therefore, these miRNAs were regarded as candidate regulators and selected for further investigation. We first verified the sequencing results by using qPCR (Fig. 3C); the expression levels of miR-100-5p, miR-183-5p, and miR-125b-1-3p were considerably higher in exosomes than in BMDMs, whereas miR-10b-5p was only slightly more abundant in exosomes than in BMDM. Thus, further validation was performed on the three miRNAs highly expressed in exosomes; 4T1-derived exosomes were added to BMDMs, and qPCR was used to assess the miRNA levels. Compared with exosome-free control, the abundance of miR-183-5p was markedly increased in the exosome-treated BMDMs, but that of miR-100-5p and miR-125b-1-3p was increased only slightly (Fig. 3D). Therefore, miR-183-5p was considered to hold the highest potential for being an miRNA that is transferred through exosomes. To eliminate the possibility that the increased abundance of miR-183-5p was caused by its expression in BMDMs rather than delivery into the cells, we detected the expression of the miR-183-5p precursor, pri–miR-183-5p. After treatment with 4T1 exosomes, the abundance of miR-183-5p was increased significantly, but no statistically significant difference was detected in pri–miR-183-5p levels (Fig. 3E), which indicated that the miR-183-5p level was increased because of its delivery into—and not its expression in—macrophages. Furthermore, after culturing with 4T1-conditioned medium, miR-183-5p abundance was markedly increased in BMDMs, whereas the abundance was decreased after culturing the cells with exosome-free 4T1-conditioned medium (Fig. 3F). Moreover, in the 4T1 breast cancer model, miR-183-5p abundance was again increased significantly in TAMs (Fig. 3G). According to previous reports, miR-183-5p is a widely recognized oncogenic miRNA that can modulate the expression of FOXO1, PDCD4, EGR1, and PPP2CA and promote tumor growth and metastasis (1216). We found that in several human breast cancer cell lines, miR-183-5p was expressed at high levels (Fig. 3H). These results collectively suggested that tumor cells could transfer miR-183-5p into macrophages through exosomes.

Considering the proinflammatory regulation of 4T1-derived exosomes, we sought to determine whether miR-183-5p can regulate the secretion of proinflammatory cytokines in BMDMs. We transferred miR-183-5p into BMDMs and examined the expression and secretion of IL-1β, IL-6, and TNF-α by using qPCR and ELISA. The expression of IL-1β, IL-6, and TNF-α was substantially increased at both RNA and protein levels (Fig. 4A, 4B). The NF-κB pathway is one of the most critical inflammatory pathways and this signaling pathway regulates the expression of many inflammatory cytokines, including IL-1β, IL-6, and TNF-α. Therefore, we tested whether 4T1 exosomes activate the NF-κB pathway; our Western blotting and immunofluorescence-labeling results showed that after treatment with 4T1-conditioned medium or exosomes, p65 phosphorylation was markedly increased (Fig. 4C, 4D), which demonstrated that the exosomes could activate the NF-κB pathway. Previous studies have reported that the gene-encoding PPP2CA, a vital constituent of PP2A, is a target gene of miR-183 (16), and that PPP2CA can dephosphorylate p65 directly (17, 18). Accordingly, we verified that PPP2CA was a target gene of miR-183-5p by performing Western blotting analyses (Fig. 4E) and dual-luciferase reporter assays (Fig. 4F). As shown in Fig. 4F, the relative luciferase activity of PPP2CA wild-type 3′UTR contained reporter vector was significantly reduced after cotransfecting with miR-183-5p, whereas mutating the miR-183-5p binding sequence resulted in recovery of luciferase activity. Moreover, our results showed that siRNA-mediated downregulation of PPP2CA expression increased p65 phosphorylation (Fig. 4G) and strongly promoted the expression of IL-1β, IL-6, and TNF-α in BMDMs (Fig. 4H, 4I). These results demonstrated that tumor exosomal miR-183-5p can activate the NF-κB signaling pathway by repressing PPP2CA expression.

FIGURE 4.

Overexpression of miR-183-5p increases p65 phosphorylation and secretion of IL-1β, IL-6, and TNF-α through suppression of PPP2CA. (A and B) miR-183-5p mimic was transfected into BMDMs, and the expression and secretion of IL-1β, IL-6, and TNF-α were detected using qPCR (A) and ELISA (B). BMDMs were cultured with 4T1-conditioned medium or 4T1-derived exosomes, and then p65 nuclear translocation in BMDMs was detected using immunofluorescence labeling (C) and p65 phosphorylation was detected by means of Western blotting (D). (E) miR-183-5p mimic was transfected into BMDMs and then PPP2CA expression in the cells was assessed through Western blotting. (F) HEK293FT cells were cotransfected with the miR-183-3p mimic and a psiCHECK2 reporter plasmid carrying the PPP2CA 3ʹUTR. Luciferase activity was measured at 24 h after transfection. y-axis: relative luciferase activity. (GI) PPP2CA siRNA was transfected into BMDMs and then p65 phosphorylation was detected through Western blotting (G) and the expression of IL-1β, IL-6, and TNF-α was assessed using qPCR (H) and ELISA (I). Data are shown as mean ± SEM from three independent experiments. **p < 0.01, ***p < 0.001.

FIGURE 4.

Overexpression of miR-183-5p increases p65 phosphorylation and secretion of IL-1β, IL-6, and TNF-α through suppression of PPP2CA. (A and B) miR-183-5p mimic was transfected into BMDMs, and the expression and secretion of IL-1β, IL-6, and TNF-α were detected using qPCR (A) and ELISA (B). BMDMs were cultured with 4T1-conditioned medium or 4T1-derived exosomes, and then p65 nuclear translocation in BMDMs was detected using immunofluorescence labeling (C) and p65 phosphorylation was detected by means of Western blotting (D). (E) miR-183-5p mimic was transfected into BMDMs and then PPP2CA expression in the cells was assessed through Western blotting. (F) HEK293FT cells were cotransfected with the miR-183-3p mimic and a psiCHECK2 reporter plasmid carrying the PPP2CA 3ʹUTR. Luciferase activity was measured at 24 h after transfection. y-axis: relative luciferase activity. (GI) PPP2CA siRNA was transfected into BMDMs and then p65 phosphorylation was detected through Western blotting (G) and the expression of IL-1β, IL-6, and TNF-α was assessed using qPCR (H) and ELISA (I). Data are shown as mean ± SEM from three independent experiments. **p < 0.01, ***p < 0.001.

Close modal

To further validate the function of miR-183-5p in exosomes, we downregulated miR-183-5p levels in exosomes by expressing an miR-183-5p sponge in 4T1 cells; in exosomes derived from these knockdown cells (miR-183KD-4T1 cells), the relative expression of miR-183-5p was decreased substantially (Fig. 5A). We next treated BMDMs with the miR-183KD exosomes or control exosomes and then measured p65 phosphorylation and secretion of IL-1β, IL-6, and TNF-α (Fig. 5B–E); a reduction of the miR-183-5p level in exosomes not only diminished miR-183-5p abundance considerably in BMDMs (Fig. 5B) but also restrained the phosphorylation of p65 (Fig. 5C) and the secretion of IL-1β, IL-6, and TNF-α (Fig. 5D, 5E) induced by tumor exosomes. These results suggested that the miR-183-5p carried in exosomes played a critical role in promoting secretion of proinflammatory cytokines from macrophages.

FIGURE 5.

miR-183-5p knockdown in 4T1-derived exosomes reduces proinflammatory effects on BMDMs. (A) miR-183-5p was knocked down in 4T1 cells by using lentivirus infection, and the miR-183-5p level in exosomes was detected using qPCR. (BE) BMDMs were cultured with 4T1 miR-183-knockdown (KD) exosomes or control exosomes. (B) miR-183-5p levels in BMDMs were measured using qPCR. (C) PPP2CA expression and p65 phosphorylation in BMDMs were determined through Western blotting, and the expression and secretion of IL-1β, IL-6, and TNF-α were assessed using qPCR (D) and ELISA (E). Data are shown as mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 5.

miR-183-5p knockdown in 4T1-derived exosomes reduces proinflammatory effects on BMDMs. (A) miR-183-5p was knocked down in 4T1 cells by using lentivirus infection, and the miR-183-5p level in exosomes was detected using qPCR. (BE) BMDMs were cultured with 4T1 miR-183-knockdown (KD) exosomes or control exosomes. (B) miR-183-5p levels in BMDMs were measured using qPCR. (C) PPP2CA expression and p65 phosphorylation in BMDMs were determined through Western blotting, and the expression and secretion of IL-1β, IL-6, and TNF-α were assessed using qPCR (D) and ELISA (E). Data are shown as mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

To validate the effect of exosomal miR-183-5p on tumors in vivo, we injected the miR-183KD-4T1 cells into BALB/c mice to establish a breast cancer model. Following the injection of these cells, tumor volume and weight were significantly decreased relative to control (Fig. 6A, 6B), lung metastasis was inhibited (Fig. 6C), and the expression of IL-1β, IL-6, and TNF-α was markedly downregulated (Fig. 6D). There were no significant differences of the accumulation of macrophage in tumor and the expression of CD206 and MHC class II between these two groups (Supplemental Fig. 2A, 2B). Accordingly, exosomes derived from the tumors delivered miR-183-5p into BMDMs and repressed PPP2CA expression to enhance p65 phosphorylation, which promoted the secretion of IL-1β, IL-6, and TNF-α and sustained the tumor inflammatory microenvironment (Fig. 6D). Collectively, our findings indicate that tumor cell–derived exosomes transfer miR-183-5p to macrophages and suppress the target gene PPP2CA and thereby promote activation of the NF-κB pathway and secretion of IL-1β, IL-6, and TNF-α (Fig. 6E).

FIGURE 6.

miR-183-5p knockdown in 4T1 exosomes potently suppresses tumor growth and metastasis. (A) 4T1 cells (miR-183 KD or Control) were injected into BALB/c mice (n = 7) and tumor growth curves were traced. (B) Image and weight of tumors on day 28 (n = 7). (C) Lung metastatic foci were evaluated through H&E staining (n = 7). (D) IHC analysis of IL-1β, IL-6, and TNF-α expression in tumors. (E) Schematic illustrating that exosome-mediated transfer of miR-183-5p from tumor cells to macrophages regulates the proinflammatory cytokine secretion from macrophages. Data are shown as mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 6.

miR-183-5p knockdown in 4T1 exosomes potently suppresses tumor growth and metastasis. (A) 4T1 cells (miR-183 KD or Control) were injected into BALB/c mice (n = 7) and tumor growth curves were traced. (B) Image and weight of tumors on day 28 (n = 7). (C) Lung metastatic foci were evaluated through H&E staining (n = 7). (D) IHC analysis of IL-1β, IL-6, and TNF-α expression in tumors. (E) Schematic illustrating that exosome-mediated transfer of miR-183-5p from tumor cells to macrophages regulates the proinflammatory cytokine secretion from macrophages. Data are shown as mean ± SEM from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

This study, to our knowledge, has reported a previously undescribed method by which macrophages can be regulated by tumor cells. In addition to producing effects through cytokines, chemokines, metabolites, and ligands (19), tumor cells can regulate the production of proinflammatory cytokines of macrophages by means of exosome-mediated miRNA transfer. To date, several studies have reported that exosomes in the TME mediate the exchange of miRNAs between tumor cells and tumor-supporting cells (20). And in the case of macrophages, tumor-derived exosomes have been reported to regulate the phenotype of these cells, such as by transferring either a protein receptor (gp130) that triggers IL-6 secretion (21), or miRNA ligands that activate TLRs (22). However, few studies have described the mechanism by which tumor cells regulate macrophages through exosome-mediated miRNA transfer. Our study provides evidence that tumor-derived miR-183-5p can be delivered into macrophages to modulate the expression of PPP2CA; this has revealed, to our knowledge, a previously unrecognized method of regulation of the macrophage cytokine production by tumor exosomal miRNAs.

Exosomes play a crucial role in intercellular communication in the TME (23). Although tumor cells contain numerous abnormally expressed miRNAs, not all of these miRNAs can be transferred into and change the miRNA distribution in recipient cells. In previous studies, candidate miRNAs were commonly selected by focusing on the miRNA abundance in exosomes. However, the miRNA expression level in recipient cells is also critical. Because the cargo capacity of exosomes is limited, only those exosomal miRNAs that are expressed at low levels in recipient cells hold the potential to strongly modulate target mRNAs. In this study, we developed a novel, to our knowledge, strategy to screen for candidate miRNAs, and by using this strategy, we determined that miR-183-5p could be transferred from tumor cells to macrophages by exosomes and could regulate cytokine secretion in macrophages.

Inflammation has long been regarded as a characteristic of tumors (24, 25). TAMs represent one type of the most abundant immune cells in the TME that exhibit a strong ability to secrete inflammatory cytokines (26). In macrophages, the NF-κB signaling pathway plays a key role in cancer-related inflammation and malignant progression, and inhibition of NF-κB signaling specifically in TAMs was found to promote the regression of advanced tumors in vivo (27). The TME contains many mediators that regulate NF-κB signaling (28, 29). In this study, we demonstrated that tumor-derived exosomal miR-183 could inhibit the expression of PPP2CA and alter p65 phosphorylation. Our study supplements what is known regarding the mechanism of action of the proinflammatory TME and provides evidence supporting tumor-derived exosomes as a target in tumor therapies.

Exosomes constitute a specific subtype of secreted membrane vesicles containing numerous proteins, lipids, and nucleic acids, all of which are bioactive molecules that can potentially regulate recipient cells. Therefore, the effects that exosomes produce on recipient cells represent the combined result of the action of multiple factors. Our results showed that the exosomes in which miR-183-5p abundance was markedly downregulated could still activate the NF-κB pathway, which is because certain other molecules present in the exosomes could also activate this pathway. For example, Hsp70 presented on the surface of tumor exosomes was shown to activate the NF-κB pathway through TLR2 in mesenchymal stem cells (30). Therefore, the proinflammatory effect of exosomes results from the combined action of multiple factors, and miR-183-5p plays a crucial role in this process.

miR-183-5p is expressed highly in a variety of tumor cells and promotes tumor proliferation, invasion, and metastasis by targeting critical genes such as FOXO1, PDCD4, PTEN, EGR1, and PPP2CA (1216). Owing to its low expression in normal cells, miR-183-5p has previously been studied with a focus on tumor cells only. Recently, miR-183-5p has been shown to be present in high levels in tumor-derived exosomes, allowing it to be delivered to and regulate normal cells (31, 32). For example, the colorectal cancer cell line HT29 can deliver miR-183-5p to human microvascular endothelial cells through exosomes, promoting angiogenesis by downregulating FOXO1 (31). In this study, we show that tumor-derived miR-183-5p can have effects on macrophages via exosomal delivery.

In conclusion, our study revealed that miR-183-5p expressed in tumor cells was transferred to macrophages by exosomes and promoted the secretion of IL-1β, IL-6, and TNF-α from macrophages by inhibiting the expression of PPP2CA. Although limited to a murine model, our results provide evidence indicating the role of exosomes in crosstalk between tumor cells and macrophages. Moreover, we developed and validated a (to our knowledge) new strategy to screen for candidate miRNAs, which could provide new insights relevant to research on exosome-mediated miRNA transfer. Overall, this study further enhances our understanding of exosomal miRNAs in TME interactions.

We thank Ralph R. Reisfeld (Department of Immunology, The Scripps Research Institute) for advice on this project.

This work was supported by the National Natural Science Foundation of China (NSFC; 81672914 and 81472654) (to Y.L.), the National Basic Research Program (973) of China (2013CB967202) (to Y.L.), the Fundamental Research Funds for the Central Universities (3332020033) (to Z.D.), and the NSFC (81601374) (to Z.D.).

The sequences presented in this article have been submitted to the Sequence Read Archive (https://www.ncbi.nlm.nih.gov/sra/PRJNA636276) under accession number PRJNA636276.

The online version of this article contains supplemental material.

Abbreviations used in this article:

BMDM

bone marrow–derived macrophage

IHC

immunohistochemical

miRNA

microRNA

qPCR

quantitative PCR

shRNA

short hairpin RNA

siRNA

small interfering RNA

TAM

tumor-associated macrophage

TME

tumor microenvironment

3′UTR

3′ untranslated region.

1
Joyce
,
J. A.
,
J. W.
Pollard
.
2009
.
Microenvironmental regulation of metastasis.
Nat. Rev. Cancer
9
:
239
252
.
2
Mantovani
,
A.
,
F.
Marchesi
,
A.
Malesci
,
L.
Laghi
,
P.
Allavena
.
2017
.
Tumour-associated macrophages as treatment targets in oncology.
Nat. Rev. Clin. Oncol.
14
:
399
416
.
3
Ostuni
,
R.
,
F.
Kratochvill
,
P. J.
Murray
,
G.
Natoli
.
2015
.
Macrophages and cancer: from mechanisms to therapeutic implications.
Trends Immunol.
36
:
229
239
.
4
Couzin
,
J.
2008
.
MicroRNAs make big impression in disease after disease.
Science
319
:
1782
1784
.
5
Ji
,
W.
,
B.
Sun
,
C.
Su
.
2017
.
Targeting microRNAs in cancer gene therapy.
Genes (Basel)
8
:
21
.
6
Garzon
,
R.
,
G.
Marcucci
,
C. M.
Croce
.
2010
.
Targeting microRNAs in cancer: rationale, strategies and challenges.
Nat. Rev. Drug Discov.
9
:
775
789
.
7
Valadi
,
H.
,
K.
Ekström
,
A.
Bossios
,
M.
Sjöstrand
,
J. J.
Lee
,
J. O.
Lötvall
.
2007
.
Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells.
Nat. Cell Biol.
9
:
654
659
.
8
Ostrowski
,
M.
,
N. B.
Carmo
,
S.
Krumeich
,
I.
Fanget
,
G.
Raposo
,
A.
Savina
,
C. F.
Moita
,
K.
Schauer
,
A. N.
Hume
,
R. P.
Freitas
, et al
.
2010
.
Rab27a and Rab27b control different steps of the exosome secretion pathway.
Nat. Cell Biol.
12
:
19
30, 1–13
.
9
Zhang
,
L.
,
S.
Zhang
,
J.
Yao
,
F. J.
Lowery
,
Q.
Zhang
,
W. C.
Huang
,
P.
Li
,
M.
Li
,
X.
Wang
,
C.
Zhang
, et al
.
2015
.
Microenvironment-induced PTEN loss by exosomal microRNA primes brain metastasis outgrowth.
Nature
527
:
100
104
.
10
Zhang
,
J.
,
S.
Li
,
L.
Li
,
M.
Li
,
C.
Guo
,
J.
Yao
,
S.
Mi
.
2015
.
Exosome and exosomal microRNA: trafficking, sorting, and function.
Genomics Proteomics Bioinformatics
13
:
17
24
.
11
Rupaimoole
,
R.
,
G. A.
Calin
,
G.
Lopez-Berestein
,
A. K.
Sood
.
2016
.
miRNA deregulation in cancer cells and the tumor microenvironment.
Cancer Discov.
6
:
235
246
.
12
Myatt
,
S. S.
,
J.
Wang
,
L. J.
Monteiro
,
M.
Christian
,
K. K.
Ho
,
L.
Fusi
,
R. E.
Dina
,
J. J.
Brosens
,
S.
Ghaem-Maghami
,
E. W.
Lam
.
2010
.
Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer.
Cancer Res.
70
:
367
377
.
13
Ren
,
L. H.
,
W. X.
Chen
,
S.
Li
,
X. Y.
He
,
Z. M.
Zhang
,
M.
Li
,
R. S.
Cao
,
B.
Hao
,
H. J.
Zhang
,
H. Q.
Qiu
,
R. H.
Shi
.
2014
.
MicroRNA-183 promotes proliferation and invasion in oesophageal squamous cell carcinoma by targeting programmed cell death 4.
Br. J. Cancer
111
:
2003
2013
.
14
Gu
,
W.
,
T.
Gao
,
J.
Shen
,
Y.
Sun
,
X.
Zheng
,
J.
Wang
,
J.
Ma
,
X. Y.
Hu
,
J.
Li
,
M. J.
Hu
.
2014
.
MicroRNA-183 inhibits apoptosis and promotes proliferation and invasion of gastric cancer cells by targeting PDCD4.
Int. J. Clin. Exp. Med.
7
:
2519
2529
.
15
Sarver
,
A. L.
,
L.
Li
,
S.
Subramanian
.
2010
.
MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration.
Cancer Res.
70
:
9570
9580
.
16
Qiu
,
M.
,
L.
Liu
,
L.
Chen
,
G.
Tan
,
Z.
Liang
,
K.
Wang
,
J.
Liu
,
H.
Chen
.
2014
.
microRNA-183 plays as oncogenes by increasing cell proliferation, migration and invasion via targeting protein phosphatase 2A in renal cancer cells.
Biochem. Biophys. Res. Commun.
452
:
163
169
.
17
Sun
,
L.
,
T. T.
Pham
,
T. T.
Cornell
,
K. L.
McDonough
,
W. M.
McHugh
,
N. B.
Blatt
,
M. K.
Dahmer
,
T. P.
Shanley
.
2017
.
Myeloid-specific gene deletion of protein phosphatase 2A magnifies MyD88- and TRIF-dependent inflammation following endotoxin challenge.
J. Immunol.
198
:
404
416
.
18
Yang
,
J.
,
G. H.
Fan
,
B. E.
Wadzinski
,
H.
Sakurai
,
A.
Richmond
.
2001
.
Protein phosphatase 2A interacts with and directly dephosphorylates RelA.
J. Biol. Chem.
276
:
47828
47833
.
19
Liu
,
Y.
,
X.
Cao
.
2015
.
The origin and function of tumor-associated macrophages.
Cell. Mol. Immunol.
12
:
1
4
.
20
Yin
,
Y.
,
X.
Cai
,
X.
Chen
,
H.
Liang
,
Y.
Zhang
,
J.
Li
,
Z.
Wang
,
X.
Chen
,
W.
Zhang
,
S.
Yokoyama
, et al
.
2014
.
Tumor-secreted miR-214 induces regulatory T cells: a major link between immune evasion and tumor growth.
Cell Res.
24
:
1164
1180
.
21
Ham
,
S.
,
L. G.
Lima
,
E. P. Z.
Chai
,
A.
Muller
,
R. J.
Lobb
,
S.
Krumeich
,
S. W.
Wen
,
A. P.
Wiegmans
,
A.
Möller
.
2018
.
Breast cancer-derived exosomes alter macrophage polarization via gp130/STAT3 signaling.
Front. Immunol.
9
:
871
.
22
Fabbri
,
M.
,
A.
Paone
,
F.
Calore
,
R.
Galli
,
E.
Gaudio
,
R.
Santhanam
,
F.
Lovat
,
P.
Fadda
,
C.
Mao
,
G. J.
Nuovo
, et al
.
2012
.
MicroRNAs bind to toll-like receptors to induce prometastatic inflammatory response.
Proc. Natl. Acad. Sci. USA
109
:
E2110
E2116
.
23
Hu
,
C.
,
M.
Chen
,
R.
Jiang
,
Y.
Guo
,
M.
Wu
,
X.
Zhang
.
2018
.
Exosome-related tumor microenvironment.
J. Cancer
9
:
3084
3092
.
24
Grivennikov
,
S. I.
,
F. R.
Greten
,
M.
Karin
.
2010
.
Immunity, inflammation, and cancer.
Cell
140
:
883
899
.
25
Murata
,
M.
2018
.
Inflammation and cancer.
Environ. Health Prev. Med.
23
:
50
.
26
Sawa-Wejksza
,
K.
,
M.
Kandefer-Szerszeń
.
2018
.
Tumor-associated macrophages as target for antitumor therapy.
Arch. Immunol. Ther. Exp. (Warsz.)
66
:
97
111
.
27
Hagemann
,
T.
,
T.
Lawrence
,
I.
McNeish
,
K. A.
Charles
,
H.
Kulbe
,
R. G.
Thompson
,
S. C.
Robinson
,
F. R.
Balkwill
.
2008
.
“Re-educating” tumor-associated macrophages by targeting NF-kappaB.
J. Exp. Med.
205
:
1261
1268
.
28
Hagemann
,
T.
,
S. K.
Biswas
,
T.
Lawrence
,
A.
Sica
,
C. E.
Lewis
.
2009
.
Regulation of macrophage function in tumors: the multifaceted role of NF-kappaB.
Blood
113
:
3139
3146
.
29
Szebeni
,
G. J.
,
C.
Vizler
,
K.
Kitajka
,
L. G.
Puskas
.
2017
.
Inflammation and cancer: extra- and intracellular determinants of tumor-associated macrophages as tumor promoters.
Mediators Inflamm.
2017
: 9294018.
30
Li
,
X.
,
S.
Wang
,
R.
Zhu
,
H.
Li
,
Q.
Han
,
R. C.
Zhao
.
2016
.
Lung tumor exosomes induce a pro-inflammatory phenotype in mesenchymal stem cells via NFκB-TLR signaling pathway.
J. Hematol. Oncol.
9
:
42
.
31
Shang
,
A.
,
X.
Wang
,
C.
Gu
,
W.
Liu
,
J.
Sun
,
B.
Zeng
,
C.
Chen
,
P.
Ji
,
J.
Wu
,
W.
Quan
, et al
.
2020
.
Exosomal miR-183-5p promotes angiogenesis in colorectal cancer by regulation of FOXO1.
Aging (Albany NY)
12
:
8352
8371
.
32
Feng
,
Y.
,
W.
Hang
,
Z.
Sang
,
S.
Li
,
W.
Xu
,
Y.
Miao
,
X.
Xi
,
Q.
Huang
.
2019
.
Identification of exosomal and non-exosomal microRNAs associated with the drug resistance of ovarian cancer.
Mol. Med. Rep.
19
:
3376
3392
.

The authors have no financial conflicts of interest.

Supplementary data