TNFR-associated factor 6 (TRAF6) not only recruits TBK1/IKKε to MAVS upon virus infection but also catalyzes K63-linked polyubiquitination on substrate or itself, which is critical for NEMO-dependent and -independent TBK1/IKKε activation, leading to the production of type I IFNs. The regulation at the TRAF6 level could affect the activation of antiviral innate immunity. In this study, we demonstrate that zebrafish prmt2, a type I arginine methyltransferase, attenuates traf6-mediated antiviral response. Prmt2 binds to the C terminus of traf6 to catalyze arginine asymmetric dimethylation of traf6 at arginine 100, preventing its K63-linked autoubiquitination, which results in the suppression of traf6 activation. In addition, it seems that the N terminus of prmt2 competes with mavs for traf6 binding and prevents the recruitment of tbk1/ikkε to mavs. By zebrafish model, we show that loss of prmt2 promotes the survival ratio of zebrafish larvae after challenge with spring viremia of carp virus. Therefore, we reveal, to our knowledge, a novel function of prmt2 in the negative regulation of antiviral innate immunity by targeting traf6.

Innate immunity is the host’s first line of defense against microbial infection. Germline-encoded cellular pattern recognition receptors), such as TLRs, retinoic acid-inducible gene 1 (RIG-I)–like receptors (RLRs) and NOD-like receptors, recognize conserved microbial components called pathogen-associated molecular patterns, such as virus-derived nucleic acids, to initiate host antimicrobial response (1, 2). Viral DNAs and RNAs are mainly sensed by the cytosolic nucleic acid sensors, the DNA sensor cyclic guanosine monophosphate-adenosine monophosphate synthase (cGAS) (35), and the RNA sensors RLRs, including RIG-I and melanoma differentiation-associated gene 5 (MDA5), respectively (69). After binding to viral nucleic acids, activated sensors recruit adaptor proteins, including TIR domain-containing adaptor molecular 1 (TRIF), mitochondrial antiviral signaling protein (MAVS) (also known as CAR-DIF, IPS-1, and VISA), or stimulator of IFN genes (STING) protein, which then activates the downstream signaling molecules TBK1/IKKε, as well as IKKα/β/γ (1013). These kinases phosphorylate the transcription factor IFN regulatory factor (IRF) 3 and the inhibitor of NF-κB, leading to activation of IRF3 and NF-κB and eventual induction of type I IFNs, proinflammatory cytokines, and other downstream effector genes (1, 2). To efficiently protect the host from infections and concomitantly avoid excessive immunopathology, innate immunity needs to be tightly regulated (1, 1417) (16, 17).

Although RIG-1 and MDA5 sense distinct types of viruses (18), they share a common adaptor, MAVS. In response to RNA virus infection, MAVS serves as a key hub that links virus recognition to downstream innate antiviral immune responses (2, 1921). Upon sensing diverse cytosolic RNAs, RIG-I undergoes conformational changes, oligomerization, and exposure of the N-terminal tandem caspase activation and recruitment domains (2CARD) (2224). RIG-I 2CARD then binds to the N-terminal CARD domain of MAVS and induces a conformational change, leading to the formation of prion-like MAVS aggregates (20, 25). MAVS aggregation serves as a signaling platform to form a MAVS signalosome for activating downstream components (20, 21, 25).

TNFR-associated factors (TRAFs), as E3 ubiquitin ligases, are required for the recruitment of the downstream kinases to MAVS (26) (20, 25). Among all of the TRAFs, TRAF6 is essential and could not be replaced by other TRAF proteins, which are preassociated with TBK1/IKKε and recruited to MAVS upon virus infection. In addition, its E3 ligase activity is required for NEMO activation by attaching ubiquitin chains to NEMO for NF-κB and TBK1/IKKε activation (13, 2730). Therefore, the regulation of TRAF6 plays an important role in antiviral innate immunity.

Arginine methylation is a posttranslational modification (PTM) in histone and nonhistone proteins catalyzed by a group of nine protein arginine methyltransferases (PRMT1–9) (31). These enzymes transfer a methyl group from S-adenosyl-methionine to an arginine guanidine nitrogen, which are classified into three categories, depending on the modification they catalyze (31). Type I (PRMT1, PRMT2, PRMT3, CARM1/PRMT4, PRMT6, and PRMT8) catalyzes to form ω-NG-monomethyl arginine (MMA) and ω-NG, NG-asymmetric dimethyl arginine (ADMA); type II (PRMT5 and PRMT9) catalyzes the formation of MMA and ω-NG, N′G symmetric dimethyl arginine (SDMA); type III (PRMT7) catalyzes the formation of MMA only (31). Arginine methylation can affect numerous cellular activities, including transcription and chromatin regulation, cell signaling, DNA damage response, RNA expression, and cellular metabolism (3133). Arginine methylation also plays a critical role in inflammatory responses as well as establishment and maintenance of the lymphoid and myeloid progenitors (31, 3436). Some PRMTs have been shown to impact antimicrobial responses (3741), linking arginine methylation to the modulation of innate immunity. However, the underlying mechanisms about how arginine methylation regulates innate immunity are still largely unknown. As a type I PRMT, PRMT2 has been described as a transcriptional coactivator for nuclear receptors and its repressive function in E2F-mediated G1 to S phase cell-cycle progression and STAT3 signaling (34, 4245). PRMT2 has also been found to inhibit NF-κB signaling and is even considered as a new member of the NF-κB pathway controlling the LPS-induced inflammatory and lung responses (46, 47), implicating a role for PRMT2 in innate immunity. Recently, we have shown that prmt3 and prmt7 negatively regulate antiviral innate immunity and PRMT7 catalyzes arginine monomethylation of MAVS to control its activity, extending the role of arginine methylation in antiviral responses (38, 40, 48).

In this study, we reveal that zebrafish prmt2 negatively regulates RLR signaling both in vitro and in vivo. Prmt2 associates with traf6 to catalyze arginine methylation of traf6 at arginine residue 100 (R100), inhibiting traf6 autoubiquitination, leading to the repression of RNA virus-induced IFN activation. Moreover, it seems that the N terminus of prmt2 competes with mavs for traf6 binding and prevents tbk1/ikkε being recruited to mavs, resulting in the inhibition of tbk1/ikkε activation. Therefore, we uncover a novel, to our knowledge, function of prmt2 in RLR signaling by targeting traf6.

We cultured epithelioma papulosum cyprini (EPC) cells (derived from skin of cyprinid fathead minnow Pimephales promelas; American Type Culture Collection, Manassas, VA) supplemented with 10% FBS and that were maintained at 28°C in a humidified incubator containing 5% CO2. HEK293T cells were cultured in DMEM (HyClone Laboratories) with 10% FBS and were grown at 37°C in a humidified incubator containing 5% CO2. THP1 cells, originally obtained from American Type Culture Collection, were maintained in RPMI 1640 supplemented with 10% FBS and were grown at 37°C in a humidified incubator containing 5% CO2. We propagated spring viremia of carp virus (SVCV) in EPC cells until the cytopathic effect was complete. We collected the culture medium and stored it at −80°C until use. Sendai virus (SeV) was provided by Dr. Bo Zhong (Wuhan University, Wuhan, China), VSV-GFP was provided by Dr. Mingzhou Chen (Wuhan University, Wuhan, China). For viral injection of zebrafish, 2-mo-old zebrafish were i.p. injected with SVCV (∼2.51 × 107 50% tissue culture-infective dose [TCID50]/ml) at 10 μl/individual. An i.p. injection with cell culture medium was used as the control.

CRISPR/Cas9 was used to knockout prmt2 in zebrafish. prmt2 single guide RNA (sgRNA) was designed using an online CRISPR design tool (http://crispr.mit.edu). The zebrafish codon-optimized Cas9 plasmid was digested with XbaI, then purified and transcribed using the T7 mMessage mMachine Kit (Ambion). pUC19-gRNA vector was used for amplifying prmt2 sgRNA. The primers for amplifying prmt2 sgRNA template were as follows: 5′-TGTAATACGACTCACTATAGGAGTTCAGACGTGTGGTGGGTTTTAGAG CTAGAAATAG-3′and 5′- TGTAATACGACTCACTATAGGATTTGGGCTGT GGGACAGGTTTTAGAGCTAGAAATAG-3′. The TranscriptAid T7 High Yield Transcription Kit (Fermentas) was used to synthesize sgRNA. Zebrafish (Danio rerio) strain AB was raised, maintained, reproduced, and staged according to the standard protocol. Cas9 RNA (0.75–1.25 ng/embryo) and sgRNA (0.075 ng/embryo) were mixed and injected into embryos at the one-cell stage. The mutants were initially detected using a heteroduplex mobility assay (HMA) as previously described. If the HMA results were positive, the remaining embryos were raised to adulthood as the F0 generation and then backcrossed with wild-type (WT) zebrafish (strain AB) to generate the F1 generation, which were genotyped by HMA initially and confirmed by sequencing of target sites. Heterozygous F1s were backcrossed with WT (disallowing offspring–parent mating) to generate the F2 generation. F2 adults carrying the target mutation (+/−) were intercrossed to generate F3 offspring. The F3 generation contained WT (+/+), heterozygous (+/−), and homozygous (−/−) individuals. The zebrafish prmt2 mutants were named following the zebrafish nomenclature guidelines (http://wiki.zn.org/display/general/ ZFIN+Zebrash+Nomenclature+Guidelines). Two mutants were obtained, namely ihbp2d11 (https://zfin.org/action/feature/view/ZDB-ALT-200707-10#) (mutant 1) and ihbp2d26 (https://zfin.org/action/feature/view/ZDB-ALT-200707-11#) (mutant 2). All experiments with zebrafish were approved by the Institutional Animal Care and Use Committee of Institute of Hydrobiology, Chinese Academy of Sciences under protocol number 2017-001. Virus infection of zebrafish larvae was performed as previously described (49).

To generate PRMT2-, MAVS-, and TRAF6-knockout cell lines, double-stranded oligonucleotides corresponding to the target sequences were cloned into LentiCRISPRv2 plasmid and then cotransfected with viral packaging plasmids into HEK293T cells. Two days after transfection, the viruses were harvested, ultrafiltrated (0.22-mm filter; Millipore), and used to infect HEK293T cells in the presence of polybrene (8 μg/ml). The infected cells were selected with puromycin (1 μg/ml) for 2 wk and then pooled for further experiments. The efficiency of CRISPR/Cas9-mediated gene knockout was confirmed by Western blot analysis. The target sequences of guide RNAs are listed as the following: human PRMT2-sgRNA1, 5′-GAGGCCGGTCTCCTGCAGGA-3′; human PRMT2-sgRNA2, 5′-GCAGGAGGGAGTACAGCCAG-3′; human MAVS-sgRNA, 5′-CTGTGAGCTAGTTGATCTCG-3′; and human TRAF6-sgRNA, 5′-CTAAACTGTGAAAACAGCTG-3′.

We extracted the total protein of EPC, THP1, or HEK293T cells with RIPA buffer containing 50 mM Tris (pH 7.4), 1% Nonidet P-40, 0.25% sodium deoxycholate, 1 mM EDTA (pH 8), 150 mM NaCl, 1 mM NaF, 1 mM PMSF, 1 mM Na3VO4, and a 1:100 dilution of protease inhibitor mixture (Sigma-Aldrich). Coimmunoprecipitation was performed as previously described. We used the Fujifilm LA S4000 Immunoluminescent Image Analyzer to image the blots. The following Abs were used for immunoblotting: anti–c-Myc Ab (9E10, 1:1000, sc-40; Santa Cruz Biotechnology), anti-HA Ab (1:5000, MMS-101R; Covance), Flag (1:5000, F1804-5MG; Sigma-Aldrich), Flag (Ra) (1:1000, 14793; Cell Signaling Technology), anti–β-actin Ab (1:20,000, AC026; ABclonal Technology), GAPDH (1:2000, sc-47724; Santa Cruz Biotechnology), PRMT2 (1:1000, ARP40196_T100; Aviva Systems Biology), TRAF6 for immunoblotting (1:1000, ab33915, Abcam), TRAF6 for IP (1:200, R1311-2, HUABIO).

Total RNA was extracted using RNAiso Plus (TaKaRa Bio, Beijing, China) following the protocol provided by the manufacturer. cDNAs were synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). MonAmp SYBR Green qPCR Mix (High ROX) (Monad Biotech, Shanghai, China) was used for quantitative real-time PCR (qRT-PCR) assays. The primers for qRT- PCR are listed in Supplemental Table I.

EPC cells were grown in 24-well plates and transfected with various amounts of plasmids by VigoFect (Vigorous Biotechnology, Beijing, China), as well as with CMV-Renilla used as control. After the cells were transfected for the indicated time, the luciferase activity was determined by the Dual-Luciferase Reporter Assay System (Promega). Data were normalized to Renilla luciferase. Data are representative of three independent experiments (mean ± SD)

HEK293T cells were challenged with VSV-eGFP for 12 h at a multiplicity of infection (MOI) of 1, then harvested and washed with PBS. For each condition, 10,000 cells were counted, and the analyses that followed were performed on a Beckman Coulter CytoFLEX S. The data were analyzed and generated with FlowJo software.

HEK293T cells were cotransfected with Flag-traf6 and HA-prmt2 plasmid. Cell lysate was immunoprecipitated with anti-Flag Ab-conjugated agarose beads overnight. Immunoprecipitated traf6 proteins were subjected to 8% SDS-PAGE gel, and traf6 bands were excised from the gel and analyzed by mass spectrometry at Protein Gene Biotech (Wuhan, China).

Zebrafish prmt2 Ab were generated by using a zebrafish prmt2 peptide (QRTEDMEDAWQDDEYFGN) as an Ag; traf6 site-specific arginine asymmetric dimethyl arginine Abs (anti-traf6-R100me2a) were generated by using a zebrafish traf6 asymmetric dimethyl arginine peptide (RKSI(R-me2a) DTGQK-C) as an Ag. After purifying the Abs with excess unmodified traf6 peptide (RKSIRDTGQK-C), Abs recognizing zebrafish traf6 arginine asymmetric dimethyl arginine were enriched by biotin-labeled traf6 asymmetric dimethyl arginine peptide.

For analysis of the ubiquitination of traf6 in HEK293T cells, HEK293T cells were transfected with plasmids expressing Myc-traf6, Flag-traf6, His-ubiquitin (WT), His-ubiquitin (K48 only), His-ubiquitin (K63 only), and Flag-prmt2, Ubiquitination assays with His-ubiquitin or His-ubiquitin-mutants were performed by affinity purification on Ni2+-NTA Resin (Novagen) as described previously (50). For analysis of the ubiquitination of TRAF6 in HEK293T cells, HEK293T cells were infected with SeV, then whole cells were re-extracted in NP-40 lysis buffer containing 1% SDS and denatured by heating for 5 min. The supernatants were diluted with regular lysis buffer until the concentration of SDS was decreased to 0.1%, followed by reimmunoprecipitation with the indicated Abs, and the immunoprecipitants were analyzed by immunoblotting with the ubiquitin Ab.

An unpaired Student t test and log-rank (Mantel–Cox) test were used for statistical analysis with GraphPad Prism6 Software. All data are representative of three independent experiments performed in triplicates; p < 0.05 was considered significant; *p < 0.05, **p < 0.01 and ***p < 0.001.

We have shown that zebrafish prmt3 and prmt7 are involved in the regulation of antiviral innate immunity (38, 40). To get a full picture about the function of PRMTs in innate immunity, we further examined whether zebrafish prmt2 is also involved in antiviral innate immunity. Overexpression of zebrafish prmt2 suppressed IFN stimulation response element (ISRE), and Dr-IFNφ1, Dr-IFNφ3, and EPC-IFN (38, 40, 51) reporter activity was induced by poly(I:C) transfection or SVCV infection in EPC cells (Fig. 1A). Consistently, overexpression of zebrafish prmt2 reduced the expression of ifn, a typical irf3/irf7 downstream gene, and two typical IFN-stimulated genes (isg15 and viperin) in EPC cells after being transfected with poly(I:C) or challenged with SVCV via qRT-PCR assays (51) (Fig. 1B). In agreement with this notion, overexpression of prmt2 in EPC cells caused an enhanced cytopathic effect compared with the empty vector control upon challenge with different titers of SVCV (from an MOI of 1–1000) (Fig. 1C). The copy numbers of SVCV genes, including the G gene, N gene, and P gene, were increased in prmt2-overexpressed EPC cells, as revealed by qRT-PCR assays (Fig. 1D, 1E). Of note, ectopic expression of prmt2 in cells had no overt effect on cell viability. These data suggest that zebrafish prmt2 negatively regulates the RLR signaling pathway and attenuates the antiviral responses.

FIGURE 1.

Zebrafish prmt2 negatively regulates RLR signaling. (A) Overexpression of prmt2 suppressed ISRE, zebrafish IFNφ1, IFNφ3, and EPC-IFN luciferase reporter activity induced by poly(I:C) or SVCV in EPC cells. EPC cells were transfected with each luciferase reporter (0.2 μg/well) together with Flag-empty vector or Flag-prmt2 vector (0.2 μg/well). After 24 h, the cells were transfected with poly(I:C) (1 μg/ml) or infected with SVCV (∼2.51 × 107 TCID50/ml) for 24 h, then luciferase reporter activity assays were performed. (B) Overexpression of prmt2 suppressed expression of ifn, isg15, and viperin induced by the transfection of poly(I:C) (1 μg/ml) or the infection of SVCV(∼2.51 × 107 TCID50/ml) in EPC cells. EPC cells were transfected with Flag-empty vector or Flag-prmt2 vector (0.2 μg/well). After 24 h, the cells were transfected with poly(I:C) (1 μg/ml) or treated with SVCV (∼2.51 × 107 TCID50/ml) for 24 h, then the total RNA was extracted for qRT-PCR assays. (C) Overexpression of prmt2 reduced cell survival of EPC cells infected with SVCV. EPC cells were transfected with 0.5 μg of Flag-tagged prmt2 or empty vector. At 24 h posttransfection, the cells were infected with SVCV at the dose indicated for 2 d. The cell monolayers were then fixed with 4% paraformaldehyde and stained with 1% crystal violet. (D) Overexpression of prmt2 increased virus titers in EPC cells after SVCV infection. The culture supernatant was collected from EPC cells infected with SVCV (MOI of 100), and the viral titer was measured by plaque assay. (E) Overexpression of prmt2 increased the copy number of SVCV-related genes in SVCV-infected EPC cells. EPC cells were transfected with Flag-tagged prmt2 or empty vector and infected with SVCV (MOI of 10). After 24 h, total RNA was extracted for examining expression of G, N, and P genes of SVCV by qRT-PCR analysis. Data are representative of three independent experiments; mean ± SD in (A), (B), (D), and (E). *p < 0.05, **p < 0.01, and ***p < 0.001.

FIGURE 1.

Zebrafish prmt2 negatively regulates RLR signaling. (A) Overexpression of prmt2 suppressed ISRE, zebrafish IFNφ1, IFNφ3, and EPC-IFN luciferase reporter activity induced by poly(I:C) or SVCV in EPC cells. EPC cells were transfected with each luciferase reporter (0.2 μg/well) together with Flag-empty vector or Flag-prmt2 vector (0.2 μg/well). After 24 h, the cells were transfected with poly(I:C) (1 μg/ml) or infected with SVCV (∼2.51 × 107 TCID50/ml) for 24 h, then luciferase reporter activity assays were performed. (B) Overexpression of prmt2 suppressed expression of ifn, isg15, and viperin induced by the transfection of poly(I:C) (1 μg/ml) or the infection of SVCV(∼2.51 × 107 TCID50/ml) in EPC cells. EPC cells were transfected with Flag-empty vector or Flag-prmt2 vector (0.2 μg/well). After 24 h, the cells were transfected with poly(I:C) (1 μg/ml) or treated with SVCV (∼2.51 × 107 TCID50/ml) for 24 h, then the total RNA was extracted for qRT-PCR assays. (C) Overexpression of prmt2 reduced cell survival of EPC cells infected with SVCV. EPC cells were transfected with 0.5 μg of Flag-tagged prmt2 or empty vector. At 24 h posttransfection, the cells were infected with SVCV at the dose indicated for 2 d. The cell monolayers were then fixed with 4% paraformaldehyde and stained with 1% crystal violet. (D) Overexpression of prmt2 increased virus titers in EPC cells after SVCV infection. The culture supernatant was collected from EPC cells infected with SVCV (MOI of 100), and the viral titer was measured by plaque assay. (E) Overexpression of prmt2 increased the copy number of SVCV-related genes in SVCV-infected EPC cells. EPC cells were transfected with Flag-tagged prmt2 or empty vector and infected with SVCV (MOI of 10). After 24 h, total RNA was extracted for examining expression of G, N, and P genes of SVCV by qRT-PCR analysis. Data are representative of three independent experiments; mean ± SD in (A), (B), (D), and (E). *p < 0.05, **p < 0.01, and ***p < 0.001.

Close modal

PRMT2 is evolutionarily conserved between zebrafish and mammal (Supplemental Fig. 2A); to determine whether the function of PRMT2 is also conserved between zebrafish and human, we used human cell lines and genes to perform further assays. We found that knockout of PRMT2 in HEK293T cells by CRISPR/Cas9 caused an increase of ISRE promoter activity induced by SeV infection or poly (I:C) transfection (Fig. 2A). The efficiency of PRMT2-sgRNA 1– and PRMT2-sgRNA 2–mediated knockout of PRMT2 was confirmed by Western blot assay (Supplemental Fig. 1A). Furthermore, upon SeV infection, knockout of PRMT2 enhanced expression of IFNB1, ISG56, CXCL10, and IL6 greatly (Fig. 2B). However, reconstitution of PRMT2 recovered the suppressive role of PRMT2 on IFNB1 expression (Supplemental Fig. 1B). Consistent with the induction of gene expression, knockout of PRMT2 enhanced phosphorylation of IRF3 and TBK1 in response to poly(I:C) transfection and SeV infection (Fig. 2C, 2D). As detected by flow cytometric analysis and fluoresce microscopy, knockout of PRMT2 caused a reduction of VSV-GFP+ HEK293T cells (Fig. 2E). Taken together, these data suggest that PRMT2 negatively regulates type I IFN signaling induced by RLRs.

FIGURE 2.

Knockout (KO) of PRMT2 enhances cellular antiviral responses. (A) Luciferase activity of ISRE in PRMT2-KO (PRMT2-sgRNA 1, PRMT2-sgRNA 2) and control HEK293T cells infected with SeV for 16 h and transfected with poly(I:C) (1 μg/ml) for 8 h. (B) Effects of PRMT2 deficiency on transcription of downstream genes induced by SeV. PRMT2-KO and control HEK293T cells were infected with SeV for the indicated times. (C and D) Effects of PRMT2 deficiency on SeV (C) or poly(I:C) (D) induced phosphorylation of TBK1 and IRF3. PRMT2-KO and control HEK293T cells were infected with SeV (C) or transfected with poly(I:C) (D) for the indicated times before immunoblotting analysis. (E) Flow cytometry analysis (left graphs) and microscopy imaging (right images) of the replication of VSV-GFP in PRMT2-KO (PRMT2-KO 1 and PRMT2-KO 2) and the control HEK293T cells (control) challenged with VSV-GFP (1 MOI) for 12 h. Numbers adjacent to the outlined areas indicate percentages of GFP-positive HEK293T cells. Scale bar, 500 μm. *p < 0.05, **p < 0.01 and ***p < 0.001.

FIGURE 2.

Knockout (KO) of PRMT2 enhances cellular antiviral responses. (A) Luciferase activity of ISRE in PRMT2-KO (PRMT2-sgRNA 1, PRMT2-sgRNA 2) and control HEK293T cells infected with SeV for 16 h and transfected with poly(I:C) (1 μg/ml) for 8 h. (B) Effects of PRMT2 deficiency on transcription of downstream genes induced by SeV. PRMT2-KO and control HEK293T cells were infected with SeV for the indicated times. (C and D) Effects of PRMT2 deficiency on SeV (C) or poly(I:C) (D) induced phosphorylation of TBK1 and IRF3. PRMT2-KO and control HEK293T cells were infected with SeV (C) or transfected with poly(I:C) (D) for the indicated times before immunoblotting analysis. (E) Flow cytometry analysis (left graphs) and microscopy imaging (right images) of the replication of VSV-GFP in PRMT2-KO (PRMT2-KO 1 and PRMT2-KO 2) and the control HEK293T cells (control) challenged with VSV-GFP (1 MOI) for 12 h. Numbers adjacent to the outlined areas indicate percentages of GFP-positive HEK293T cells. Scale bar, 500 μm. *p < 0.05, **p < 0.01 and ***p < 0.001.

Close modal

To determine the physiological function of prmt2 in vivo, we disrupted prmt2 in zebrafish via CRISPR/Cas9 and obtained two mutant lines (Supplemental Fig. 2B, 2C). By crossing prmt2+/−(♀) × prmt2+/−(♂), the offspring with prmt2+/+, prmt2+/−, and prmt2−/− genetic backgrounds were born at a Mendelian ratio (1:2:1), and no obvious defects in growth rate and reproduction capability were detected in prmt2−/− zebrafish under normal conditions. We challenged prmt2−/− larvae (n = 100 in total) and prmt2+/+ larvae (having WT allele of prmt2) (WT) (n = 100 in total) with high-titer SVCV and counted the number of dead larvae at different time points. The dead larvae exhibited no movement, no blood circulation, and a degenerated body (Fig. 3A). As shown in (Fig. 3B, prmt2−/− larvae had a higher survival ratio compared with the WT larvae. Consistently, the viral titer was lower, and the key antiviral genes, including ifn1, lta, and mxc were enhanced; the copy number of the G, N, and P genes of SVCV indicated by mRNA abundance was decreased in prmt2−/− larvae compared with the WT larvae after challenge with SVCV (Fig. 3C, 3D) (51, 52). Upon i.p. injection with SVCV, prmt2−/− adult zebrafish (2 mo postfertilization [mpf]) exhibited less swelling and fewer hemorrhagic symptoms in the abdomen compared with the WT adult zebrafish (2 mpf) (Fig. 3E, 3F). In agreement, the key antiviral genes, including ifn1, lta, and mxc, were enhanced, and the copy number of the G, N, and P genes of SVCV were decreased in prmt2−/− zebrafish compared with the WT zebrafish (Fig. 3G). Collectively, our finding suggests that zebrafish prmt2 negatively regulates antiviral response in vivo.

FIGURE 3.

Prmt2-null zebrafish are more resistant to SVCV infection. (A) Representative images of prmt2-null zebrafish larvae and their WT siblings (3 d postfertilization [dpf]) infected with or without SVCV for 18 h. Dead larvae exhibited lack of movement, absence of blood circulation, and body degeneration. SVCV virus (∼2.51 × 107 TCID50/ml) was added into the water containing prmt2-null larvae (n = 100, 3 dpf) or the WT (n = 100, 3 dpf), then the number of dead larvae was counted at different time points. (B) prmt2-null zebrafish were more resistant to SVCV infection compared with the WT based on the survival ratio. (C) SVCV titers were decreased in prmt2-null larvae compared with the WT larvae after SVCV infection for 18 h. (D) Induction of key antiviral genes, including ifn1, lta, and mxc by SVCV infection was more significant in prmt2-null larvae compared with the WT larvae; the copy number of the G, N, and P genes of SVCV is indicated by decreased mRNA abundance in prmt2-null larvae compared with the WT larvae. (E) prmt2-null zebrafish (prmt2−/−) (2 mpf) exhibited less swelling and fewer hemorrhagic symptoms in the abdomen compared with the WT zebrafish (prmt2+/+) (2 mpf) after SVCV infection. prmt2-null zebrafish (prmt2−/−) (2 mpf) and the WT zebrafish (prmt2+/+) (2 mpf) were i.p. injected with cell culture medium or SVCV (∼2.51 × 107 TCID50/ml) for 10 μl/individual. Scale bar, 1 cm. (F) H&E staining of liver sections from prmt2-null (prmt2−/−) (2 mpf) and the WT zebrafish (prmt2+/+) (2 mpf) i.p. injected with cell culture medium or SVCV (∼2.51 × 107 TCID50/ml) at 10 μl/individual. Cytoplasm vacuolization of hepatic cells (indicated by green arrows) are more severe in prmt2+/+ livers compared with the prmt2−/− livers infected with SVCV. Scale bar, 50 μm. (G) Induction of key antiviral genes, including ifn1, lta, and mxc by SVCV infection was more significant in prmt2-null zebrafish (prmt2−/−) (2 mpf) compared with the WT zebrafish (prmt2+/+) (2 mpf); the copy number of the G, N, and P genes of SVCV is indicated by mRNA abundance decreased in prmt2-null zebrafish (prmt2−/−) (2 mpf) compared with the WT zebrafish (prmt2+/+) (2 mpf). Data are representative of three independent experiments; mean ± SD in (C), (D) and (G). *p < 0.05, **p < 0.01 and ***p < 0.001.

FIGURE 3.

Prmt2-null zebrafish are more resistant to SVCV infection. (A) Representative images of prmt2-null zebrafish larvae and their WT siblings (3 d postfertilization [dpf]) infected with or without SVCV for 18 h. Dead larvae exhibited lack of movement, absence of blood circulation, and body degeneration. SVCV virus (∼2.51 × 107 TCID50/ml) was added into the water containing prmt2-null larvae (n = 100, 3 dpf) or the WT (n = 100, 3 dpf), then the number of dead larvae was counted at different time points. (B) prmt2-null zebrafish were more resistant to SVCV infection compared with the WT based on the survival ratio. (C) SVCV titers were decreased in prmt2-null larvae compared with the WT larvae after SVCV infection for 18 h. (D) Induction of key antiviral genes, including ifn1, lta, and mxc by SVCV infection was more significant in prmt2-null larvae compared with the WT larvae; the copy number of the G, N, and P genes of SVCV is indicated by decreased mRNA abundance in prmt2-null larvae compared with the WT larvae. (E) prmt2-null zebrafish (prmt2−/−) (2 mpf) exhibited less swelling and fewer hemorrhagic symptoms in the abdomen compared with the WT zebrafish (prmt2+/+) (2 mpf) after SVCV infection. prmt2-null zebrafish (prmt2−/−) (2 mpf) and the WT zebrafish (prmt2+/+) (2 mpf) were i.p. injected with cell culture medium or SVCV (∼2.51 × 107 TCID50/ml) for 10 μl/individual. Scale bar, 1 cm. (F) H&E staining of liver sections from prmt2-null (prmt2−/−) (2 mpf) and the WT zebrafish (prmt2+/+) (2 mpf) i.p. injected with cell culture medium or SVCV (∼2.51 × 107 TCID50/ml) at 10 μl/individual. Cytoplasm vacuolization of hepatic cells (indicated by green arrows) are more severe in prmt2+/+ livers compared with the prmt2−/− livers infected with SVCV. Scale bar, 50 μm. (G) Induction of key antiviral genes, including ifn1, lta, and mxc by SVCV infection was more significant in prmt2-null zebrafish (prmt2−/−) (2 mpf) compared with the WT zebrafish (prmt2+/+) (2 mpf); the copy number of the G, N, and P genes of SVCV is indicated by mRNA abundance decreased in prmt2-null zebrafish (prmt2−/−) (2 mpf) compared with the WT zebrafish (prmt2+/+) (2 mpf). Data are representative of three independent experiments; mean ± SD in (C), (D) and (G). *p < 0.05, **p < 0.01 and ***p < 0.001.

Close modal

To determine the mechanisms of zebrafish prmt2 in negative regulation of antiviral immunity, we examined which component in RLR signaling pathway, including rig-1, mavs, traf3, traf6, tbk1, and irf3 or irf7 could interact with prmt2. As shown in (Fig. 4A, prmt2 could only be pulled by traf6 (Fig 4A), which was further confirmed endogenously in lysate of zebrafish brain (Fig. 4B). Domain mapping indicated that the C terminus of traf6 (373–542 aa) and the N terminus of prmt2 (1–73 aa) were required for their interaction (Fig. 4C, 4D). Additionally, we confirmed that human PRMT2 interacts with human TRAF6 as well (Fig. 4E). Of note, in THP1 cells, human PRMT2 interacted with human TRAF6 endogenously with or without SeV infection (Fig. 4F), indicating a conserved behavior of PRMT2/TRAF6 interaction between zebrafish and mammal. These data suggest that prmt2 might affect RLR signaling through impacting on traf6.

FIGURE 4.

Zebrafish prmt2 interacts with traf6. (A) Immunoblotting of Flag and Myc in proteins immunoprecipitated with anti-Myc Ab-conjugated agarose beads (top) and immunoblotting of Flag and β-actin in whole cell lysates (bottom) from HEK293T cells cotransfected with Flag-prmt2 and indicated Myc-tagged plasmids for 24 h. (B) Immunoblotting of whole cell lysates and anti-IgG or anti-prmt2 immunoprecipitants derived from WT zebrafish brains (2 mpf). (C) Schematic of how traf6 (WT) and prmt2 (WT) as well as their truncated mutants interacted with each other. The extent of interaction is indicated by the number of plus (+) signs. (D) Immunoblotting of Flag and HA in proteins immunoprecipitated with anti-HA Ab-conjugated agarose beads (top) and immunoblotting of Flag, HA, and β-actin in whole cell lysates (bottom) from HEK293T cells transfected with indicated plasmids for 24 h. (E) HEK293T cells were cotransfected with Flag-PRMT2 and Myc-TRAF6 for 24 h. Anti-Flag Ab-conjugated agarose beads were used for immunoprecipitation, and the interaction was detected by immunoblotting with the indicated Abs. (F) Immunoblotting of whole cell lysates (bottom) and anti-IgG or anti-TRAF6 immunoprecipitants derived from THP1 cells left uninfected or infected with SeV for 0–8 h. Data are representative of three independent experiments.

FIGURE 4.

Zebrafish prmt2 interacts with traf6. (A) Immunoblotting of Flag and Myc in proteins immunoprecipitated with anti-Myc Ab-conjugated agarose beads (top) and immunoblotting of Flag and β-actin in whole cell lysates (bottom) from HEK293T cells cotransfected with Flag-prmt2 and indicated Myc-tagged plasmids for 24 h. (B) Immunoblotting of whole cell lysates and anti-IgG or anti-prmt2 immunoprecipitants derived from WT zebrafish brains (2 mpf). (C) Schematic of how traf6 (WT) and prmt2 (WT) as well as their truncated mutants interacted with each other. The extent of interaction is indicated by the number of plus (+) signs. (D) Immunoblotting of Flag and HA in proteins immunoprecipitated with anti-HA Ab-conjugated agarose beads (top) and immunoblotting of Flag, HA, and β-actin in whole cell lysates (bottom) from HEK293T cells transfected with indicated plasmids for 24 h. (E) HEK293T cells were cotransfected with Flag-PRMT2 and Myc-TRAF6 for 24 h. Anti-Flag Ab-conjugated agarose beads were used for immunoprecipitation, and the interaction was detected by immunoblotting with the indicated Abs. (F) Immunoblotting of whole cell lysates (bottom) and anti-IgG or anti-TRAF6 immunoprecipitants derived from THP1 cells left uninfected or infected with SeV for 0–8 h. Data are representative of three independent experiments.

Close modal

Given that Lys63-linked autoubiquitination of TRAF6 is a key activation step for TRAF6 (53), we sought to know whether prmt2 can affect Lys63-linked autoubiquitination of TRAF6. As shown in (Fig. 5A5C, overexpression of prmt2 reduced ubiquitination of traf6 with coexpression of WT ubiquitin and K63-only ubiquitin, but not with coexpression of K48-only ubiquitin. Notably, in PRMT2-knockout HEK293T cells (PRMT2−/−), endogenous Lys63-linked autoubiquitination of TRAF6 was higher than that in PRMT2-sufficient HEK293T cells (PRMT2+/+) upon SeV infection (Fig. 5D).

FIGURE 5.

Zebrafish prmt2 inhibits traf6 autoubiquitination via its arginine methyltransferase activity. (AC) Zebrafish traf6 ubiquitination in HEK293T cells transfected with Myc-tagged traf6 and Flag-tagged prmt2 in the presence of His-tagged ubiquitin WT (A), K48 only (in which all other lysine residues are mutated to alanine residues but only lysine 48 is kept) (B), or K63 only (in which all other lysine residues are mutated to alanine residues but only lysine 63 is kept) (C) mutants. At 24 h posttransfection, the cells were lysed using guanidinium chloride and precipitated with Ni2-NTA agarose. (D) Endogenous TRAF6 ubiquitination assayed from PRMT2+/+ and PRMT2−/− HEK293T cells treated with or without SeV for 8 h. (E) HEK293T cells were cotransfected with Flag-prmt2 and WT or Myc-traf6 mutant (L75H) in the presence of His-tagged ubiquitin K63-only mutant. At 24 h posttransfection, the cells were lysed using guanidinium chloride and precipitated with Ni2-NTA agarose. (F) HEK293T cells were cotransfected with Myc-traf6 and WT or Flag-prmt2 mutant (prmt2-GG), in the presence of His-tagged ubiquitin K63-only mutant. At 24 h posttransfection, the cells were lysed using guanidinium chloride, and precipitated with Ni2-NTA agarose. Data are representative of three independent experiments.

FIGURE 5.

Zebrafish prmt2 inhibits traf6 autoubiquitination via its arginine methyltransferase activity. (AC) Zebrafish traf6 ubiquitination in HEK293T cells transfected with Myc-tagged traf6 and Flag-tagged prmt2 in the presence of His-tagged ubiquitin WT (A), K48 only (in which all other lysine residues are mutated to alanine residues but only lysine 48 is kept) (B), or K63 only (in which all other lysine residues are mutated to alanine residues but only lysine 63 is kept) (C) mutants. At 24 h posttransfection, the cells were lysed using guanidinium chloride and precipitated with Ni2-NTA agarose. (D) Endogenous TRAF6 ubiquitination assayed from PRMT2+/+ and PRMT2−/− HEK293T cells treated with or without SeV for 8 h. (E) HEK293T cells were cotransfected with Flag-prmt2 and WT or Myc-traf6 mutant (L75H) in the presence of His-tagged ubiquitin K63-only mutant. At 24 h posttransfection, the cells were lysed using guanidinium chloride and precipitated with Ni2-NTA agarose. (F) HEK293T cells were cotransfected with Myc-traf6 and WT or Flag-prmt2 mutant (prmt2-GG), in the presence of His-tagged ubiquitin K63-only mutant. At 24 h posttransfection, the cells were lysed using guanidinium chloride, and precipitated with Ni2-NTA agarose. Data are representative of three independent experiments.

Close modal

As an E3 ligase, the human TRAF6 (L74H) mutant prevents interaction with E2-conjugating enzymes (28, 54); thereby, this mutant is devoid of E3 ligase activity. To evaluate whether prmt2 affects the enzymatic activity of traf6, we tested the effect of prmt2 on ubiquitination of WT traf6 and the traf6 (L75H) mutant (corresponds to human TRAF6 [L74H]) (Supplemental Fig. 3A). Overexpression of prmt2 only caused a reduction of WT traf6 ubiquitination but not of the traf6 (L75H) mutant, suggesting that prmt2 might influence the enzymatic activity of traf6 (Fig. 5E). Subsequently, we examined whether arginine methyltransferase activity of prmt2 is required for inhibiting traf6 ubiquitination. As shown in (Fig. 5F, compared with overexpression of WT prmt2, overexpression of an enzymatic-deficient mutant of prmt2 (prmt2-GG) (42) had no overt effect on the reduction of traf6 ubiquitination (Fig. 5F), indicating that the enzymatic activity of prmt2 is required for prmt2 to inhibit traf6 ubiquitination.

Taken together, these data suggest that zebrafish prmt2 inhibits traf6 autoubiquitination via its arginine methyltransferase activity.

Because arginine methyltransferase activity is required for prmt2 to inhibit traf6 ubiquitination, we next examined whether prmt2 catalyzes arginine methylation of traf6. Through mass spectrometry analysis, we identified that traf6 could be methylated at arginine 100 (R100) (Fig. 6A), which is evolutionarily conserved among human, mouse, and zebrafish (Fig. 6B). To further confirm the methylated site in zebrafish traf6, we developed a specific Ab against the asymmetric dimethylated form (two methyl groups on the same arginine guanidino nitrogen) of zebrafish traf6 arginine 100 (anti-traf6-R100me2a) and we confirmed the Ab with Western blot assay (Supplemental Fig. 3B). Overexpression of prmt2 together with traf6 induced asymmetric arginine dimethylation of traf6 (Fig. 6C). Moreover, in prmt2+/+ zebrafish, arginine dimethylation of traf6 was readily detected but not in prmt2−/− zebrafish (Fig. 6D). In response to SVCV infection, the induction ability of the methyl-mimic mutant of traf6 (traf-R100F) on ifn expression in EPC cells was much lower than that of WT traf6 (Fig. 6E), further validating that arginine methylation of traf6 mediated by prmt2 suppressed traf6 function in antiviral innate immunity. Consistently, overexpression of prmt2 inhibited K63-linked ubiquitination of WT traf6 but not of the methyl-mimic mutant of traf6 (traf6-R100F) (Fig. 6F).

FIGURE 6.

Arginine methylation of traf6 at R100 catalyzed by prmt2 inhibits traf6 autoubiquitination and RNA virus-induced IFN activation. (A) The methylarginine residue in traf6 identified by mass spectrometry analysis. (B) Cross-species sequence alignment of RING domain of traf6 revealed conserved methylarginine site R100. (C) Arginine methylation of traf6 in HEK293T cells transfected with Myc-prmt2 or its catalytic mutant (Myc-prmt2-GG) for 24 h. (D) Arginine methylation of traf6 in zebrafish whole body from prmt2+/+ and prmt2−/− zebrafish (1 mpf). The positive signal of target protein is marked by a red rectangle. (E) qRT-PCR analysis of ifn in EPC cells transfected with indicated plasmids for 24 h, followed by SVCV infection for 24 h. (F) HEK293T cells were cotransfected with Flag-prmt2 and WT or a methyl-mimic mutant (R100F) of Myc-traf6 in the presence of His-tagged ubiquitin K63-only mutant. (G) qRT-PCR analysis of IFNB1 in TRAF6+/+or TRAF6−/− HEK293T cells transfected with indicated plasmids for 16 h, followed by SeV infection for 8 h. (H) Phosphorylation of TBK1 and IRF3 in TRAF6+/+or TRAF6−/− HEK293T cells transfected with indicated plasmids for 16 h, followed by SeV infection for 8 h. (I) Endogenous TRAF6 ubiquitination assayed from TRAF6−/− HEK293T cells transfected with WT or a methyl-mimic mutant (R99F) of Flag-TRAF6 for 16h, followed by SeV infection for 8 h. Data are representative of three independent experiments; mean ± SD in (E) and (G). ***p < 0.001.

FIGURE 6.

Arginine methylation of traf6 at R100 catalyzed by prmt2 inhibits traf6 autoubiquitination and RNA virus-induced IFN activation. (A) The methylarginine residue in traf6 identified by mass spectrometry analysis. (B) Cross-species sequence alignment of RING domain of traf6 revealed conserved methylarginine site R100. (C) Arginine methylation of traf6 in HEK293T cells transfected with Myc-prmt2 or its catalytic mutant (Myc-prmt2-GG) for 24 h. (D) Arginine methylation of traf6 in zebrafish whole body from prmt2+/+ and prmt2−/− zebrafish (1 mpf). The positive signal of target protein is marked by a red rectangle. (E) qRT-PCR analysis of ifn in EPC cells transfected with indicated plasmids for 24 h, followed by SVCV infection for 24 h. (F) HEK293T cells were cotransfected with Flag-prmt2 and WT or a methyl-mimic mutant (R100F) of Myc-traf6 in the presence of His-tagged ubiquitin K63-only mutant. (G) qRT-PCR analysis of IFNB1 in TRAF6+/+or TRAF6−/− HEK293T cells transfected with indicated plasmids for 16 h, followed by SeV infection for 8 h. (H) Phosphorylation of TBK1 and IRF3 in TRAF6+/+or TRAF6−/− HEK293T cells transfected with indicated plasmids for 16 h, followed by SeV infection for 8 h. (I) Endogenous TRAF6 ubiquitination assayed from TRAF6−/− HEK293T cells transfected with WT or a methyl-mimic mutant (R99F) of Flag-TRAF6 for 16h, followed by SeV infection for 8 h. Data are representative of three independent experiments; mean ± SD in (E) and (G). ***p < 0.001.

Close modal

To further validate whether the function of asymmetric dimethylation of traf6 at R100 mediated by prmt2 on the suppression of antiviral immunity was evolutionarily conserved between zebrafish and mammal, we used human HEK293T cells to perform assays. Disruption of TRAF6 in HEK293T cells resulted in a significant reduction of IFNB1 expression in response to SeV infection (Fig. 6G). Similar to what was observed in EPC cells, in response to SeV infection, the induction of IFNB1 expression was much lower in TRAF6-null HEK293T cells (TRAF6−/−) reconstructed with the methyl-mimic mutant of human TRAF6 (TRAF6-R99F, corresponding to zebrafish traf-R100F) than in those with WT TRAF6 (Fig. 6G). In agreement, in response to SeV infection, disruption of TRAF6 caused a reduction in phosphorylation of TBK1 and IRF3 compared with that in WT HEK293T cells (TRAF6+/+). In addition, upon SeV infection, the induction of phosphorylation of TBK1 and IRF3 in TRAF6−/− HEK293T cells reconstructed with TRAF-R99F was lower than in those with WT TRAF6 (Fig. 6H). Consistently, in TRAF6−/− HEK293T cells, the K63-linked autoubiquitination of TRAF6 was also lower with the reconstruction of TRAF6-R99F compared with the reconstruction of WT TRAF6 (Fig. 6I). In addition, we confirmed that R100 residue of traf6 is asymmetrically dimethylated by prmt2, and the R100F mutant of traf6 still interacts with prmt2 (Supplemental Fig. 3C, 3D).

These results suggest that prmt2 catalyzes traf6 to be dimethylated at R100, which inhibits traf6 autoubiquitination and RNA virus-induced IFN activation.

As we have found that prmt2 targets traf6 and inhibits traf6 autoubiquitination via its arginine methyltransferase activity, we sought to determine whether the inhibition of RLR signaling by prmt2 is completely relying on its arginine methyltransferase activity. By ISRE promoter assays in EPC cells, we noticed that, although compared with that of WT prmt2, the inhibitory role of the enzymatic-deficient mutant of prmt2 (prmt2-GG) on ISRE promoter activity was obviously recovered, it still suppressed the ISRE promoter activity significantly in response to SVCV infection (Fig. 7A). However, the mutant with the deletion of the N terminus (SH3 domain) in prmt2-GG (prmt2-ΔSH3-GG) completely lost the suppressive role on activating ISRE promoter activity (Fig. 7A). It is known that the C terminus of TRAF6 binds to MAVS and is required for recruiting TBK1/IKKε to MAVS for activating antiviral signaling (20, 30, 55, 56). In this study, we found that the C terminus of traf6 bound to the N terminus (SH3 domain) of prmt2 (Fig. 4C, 4D). Therefore, this result suggests that prmt2 can affect antiviral signaling, depending on protein–protein interaction in addition to its enzymatic activity. Similar results were obtained by examining ifn expression in EPC cells via qRT-PCR (Fig. 7B). Consistently, overexpression of WT prmt2, as well as prmt2-GG, prevented traf6 binding to mavs, but overexpression of prmt2-ΔSH3-GG did not (Fig. 7C, 7D).

FIGURE 7.

The N terminus of PRMT2 competes with MAVS for TRAF6 binding and prevents the recruitment of TBK1/IKKε to MAVS. (A) ISRE promoter activity in EPC cells transfected with WT or Flag-prmt2 mutant for 24 h, followed by SVCV infection for 24 h. (B) qRT-PCR analysis of ifn in EPC cells transfected with WT or Flag-prmt2 mutant for 24 h, followed by SVCV infection for 24 h. (C) Immunoblotting of Flag, HA, and Myc in proteins immunoprecipitated with anti-HA Ab (top) and immunoblotting of Flag, HA, Myc, and β-actin in whole cell lysates (bottom) from HEK293T cells transfected with indicated Flag-tagged prmt2, HA-tagged traf6, and Myc-tagged mavs plasmids for 24 h. (D) Immunoblotting of HA and Myc in proteins immunoprecipitated with anti-HA Ab (top) and immunoblotting of Flag, HA, Myc, and β-actin in whole cell lysates (bottom) from HEK293T cells transfected with indicated HA-tagged traf6, Myc-tagged mavs, and WT or mutants of Flag-tagged prmt2 plasmids for 24 h. (E) qRT-PCR analysis of IFNB1 in PRMT2−/− HEK293T cells transfected with indicated plasmids for 12 h, followed by SeV infection for 0–12 h. (F) Phosphorylation of TBK1 and IRF3 in PRMT2−/− HEK293T cells transfected with indicated plasmids for 12 h, followed by SeV infection for 0–12 h. (G) Immunoprecipitation with anti-MAVS and immunoblot analysis of TBK1, MAVS, IKKε, Flag, and GAPDH in PRMT2−/− HEK293T cells transfected with indicated plasmids, followed by SeV challenge for 8 h. (H) Immunoprecipitation with anti-MAVS and immunoblot analysis of TBK1, MAVS, IKKε, and GAPDH in MAVS−/− HEK293T cells transfected with indicated plasmids, followed by SeV challenge for 8 h. Data are representative of three independent experiments; mean ± SD in (A), (B), and (E). *p < 0.05, **p < 0.01 and ***p < 0.001.

FIGURE 7.

The N terminus of PRMT2 competes with MAVS for TRAF6 binding and prevents the recruitment of TBK1/IKKε to MAVS. (A) ISRE promoter activity in EPC cells transfected with WT or Flag-prmt2 mutant for 24 h, followed by SVCV infection for 24 h. (B) qRT-PCR analysis of ifn in EPC cells transfected with WT or Flag-prmt2 mutant for 24 h, followed by SVCV infection for 24 h. (C) Immunoblotting of Flag, HA, and Myc in proteins immunoprecipitated with anti-HA Ab (top) and immunoblotting of Flag, HA, Myc, and β-actin in whole cell lysates (bottom) from HEK293T cells transfected with indicated Flag-tagged prmt2, HA-tagged traf6, and Myc-tagged mavs plasmids for 24 h. (D) Immunoblotting of HA and Myc in proteins immunoprecipitated with anti-HA Ab (top) and immunoblotting of Flag, HA, Myc, and β-actin in whole cell lysates (bottom) from HEK293T cells transfected with indicated HA-tagged traf6, Myc-tagged mavs, and WT or mutants of Flag-tagged prmt2 plasmids for 24 h. (E) qRT-PCR analysis of IFNB1 in PRMT2−/− HEK293T cells transfected with indicated plasmids for 12 h, followed by SeV infection for 0–12 h. (F) Phosphorylation of TBK1 and IRF3 in PRMT2−/− HEK293T cells transfected with indicated plasmids for 12 h, followed by SeV infection for 0–12 h. (G) Immunoprecipitation with anti-MAVS and immunoblot analysis of TBK1, MAVS, IKKε, Flag, and GAPDH in PRMT2−/− HEK293T cells transfected with indicated plasmids, followed by SeV challenge for 8 h. (H) Immunoprecipitation with anti-MAVS and immunoblot analysis of TBK1, MAVS, IKKε, and GAPDH in MAVS−/− HEK293T cells transfected with indicated plasmids, followed by SeV challenge for 8 h. Data are representative of three independent experiments; mean ± SD in (A), (B), and (E). *p < 0.05, **p < 0.01 and ***p < 0.001.

Close modal

To further validate that this behavior is evolutionarily conserved, we examined this phenomenon in human HEK293T cells. Similarly, in PRMT2−/− HEK293T cells upon SeV infection, compared with that of WT PRMT2, the inhibitory role of the enzymatic-deficient mutant of PRMT2 (PRMT2-GG), on the induction of IFNB1 expression was obviously recovered, but it still suppressed IFNB1 expression significantly in response to SeV infection (Fig. 7E). However, the mutant with the deletion of the N terminus (SH3 domain) in PRMT2-GG (PRMT2-ΔSH3-GG) completely lost the suppressive role on the induction of IFNB1 expression (Fig. 7E). In agreement with this notion, in PRMT2−/− HEK293T cells, reconstruction of WT PRMT2 (PRMT2-WT) dramatically suppressed phosphorylation of TBK1 and IRF3, but reconstruction of the enzymatic-deficient mutant of PRMT2 (PRMT2-GG) partially recovered phosphorylation of TBK1 and IRF3. Moreover, reconstruction of the mutant with the deletion of the N terminus (SH3 domain) in PRMT2-GG (prmt2-ΔSH3-GG) almost completely recovered phosphorylation of TBK1 and IRF3 (Fig. 7F).

Subsequently, we confirmed that the N terminus (SH3 domain) of PRMT2 inhibited the recruitment of TBK1 and IKKε to MAVS (Fig. 7G). Furthermore, we found that in the presence of WT MAVS, overexpression of PRMT2 caused a reduction of TBK1 and IKKε binding to MAVS, but in the presence of MAVS-d6 mutant [loss of interaction with TRAF6 (26)], overexpression of PRMT2 had no overt effect on the recruitment of TBK1 and IKKε to MAVS (Fig. 7H), further indicating that TRAF6 mediated the inhibitory role of prmt2 on the recruitment of TBK1 and IKKε to MAVS.

Consciously, given that all of above assays relied on ectopic expression of proteins, the enzyme-independent inhibitory role of prmt2 on traf6 might only represent an alternative mechanism, not a main mechanism. Of course, it might also be an overexpression artifact. Further addressing this issue by in vivo assays will get deep insights into the role and the underlying mechanism of prmt2 in antiviral immunity.

Based on the data we obtained in this study, we proposed a work model for prmt2 (Fig. 8). In general, prmt2 negatively regulates RLR signaling in both a prmt2 enzymatic activity-dependent and -independent manner. On one hand, arginine asymmetric dimethylation of traf6 catalyzed by prmt2 inhibits traf6 autoubiquitination, leading to the inactivation of the nemo-tank-tbk1/ikkε complex. On the other hand, the N terminus of prmt2 competes with mavs for traf6 binding, thereby preventing the recruitment of tbk1/ikkε to mavs mediated by traf6. By these two ways, prmt2 eventually inhibits phosphorylation of irf3/7, leading to the downregulation of type I IFNs.

FIGURE 8.

A working model of prmt2 action in RLR signaling. Prmt2 negatively regulates RLR signaling in both prmt2 enzymatic activity-dependent and -independent ways. On one hand, arginine asymmetric dimethylation of traf6 catalyzed by prmt2 inhibits traf6 autoubiquitination, thereby preventing traf6 from catalyzing the formation of K63-linked polyubiquitin chains, leading to inactivation of the nemo-tank-tbk1/ikkε complex. On the other hand, the N terminus of prmt2 competes with mavs for traf6 binding, thereby preventing the recruitment of tbk1/ikkε to mavs by traf6. Both ways finally inhibit phosphorylation of irf3/7, leading to the downregulation of type I ifns.

FIGURE 8.

A working model of prmt2 action in RLR signaling. Prmt2 negatively regulates RLR signaling in both prmt2 enzymatic activity-dependent and -independent ways. On one hand, arginine asymmetric dimethylation of traf6 catalyzed by prmt2 inhibits traf6 autoubiquitination, thereby preventing traf6 from catalyzing the formation of K63-linked polyubiquitin chains, leading to inactivation of the nemo-tank-tbk1/ikkε complex. On the other hand, the N terminus of prmt2 competes with mavs for traf6 binding, thereby preventing the recruitment of tbk1/ikkε to mavs by traf6. Both ways finally inhibit phosphorylation of irf3/7, leading to the downregulation of type I ifns.

Close modal

RLR signaling is regulated by a series of PTMs, such as phosphorylation, polyubiquitination, succinylation, and O-GlcNAcylation (11, 16, 17, 5766). Therefore, to identify PTMs of components in RLR signaling and understand their actions will give insights into the mechanisms of how RLR signaling is tightly regulated. As arginine methyltransferases for modifying histone and nonhistone proteins, PRMTs have been recently recognized to modulate antiviral signaling an enzymatic activity-dependent or -independent manner (37, 38, 40, 67). In comparison with other modifications, arginine methylation in components of RLR signaling is barely identified; therefore, the process and underlying mechanisms are still not well defined. In this study, we identify that prmt2 negatively regulates RLR signaling by catalyzing arginine asymmetric dimethylation of traf6 at R100, revealing a function of arginine methylation in antiviral innate immunity. Given that PRMT2 also negatively regulates the LPS-induced lung responses by targeting NF-κb signaling (47), PRMT2 might be involved in both bacterial and viral infection through targeting different signaling pathways.

We have previously shown that prmt3 and prmt7 could also negatively regulate RLR signaling (38, 40). Although how the mechanism of prmt3 acts in its role is still a puzzle, it is evident that prmt7 catalyzes arginine monomethylation of MAVS to play its suppressive role on RLR signaling (48). It seems that PRMTs act in their function through various mechanisms at different levels of the IRF signaling pathway. Further identifying whether other PRMTs are involved in RLR signaling and whether other molecules of RLR signaling are targeted by PRMTs will help us to get a full picture about the roles and underlying mechanisms of PRMTs in antiviral innate immunity.

As an important signaling scaffold downstream of multiple pattern recognition receptors, TRAF6 recruits IKKα/β/γ and/or TBK1 complex to adaptor proteins by attaching the K63-linked polyubiquitin chains on substrate proteins or itself (26, 30, 68). Therefore, the influences on autoubiquitination or protein stability of TRAF6 obviously affect antiviral innate immunity (69, 70). However, the effect of TRAF6 modification on antiviral innate immunity is barely understood. In this study, we find that prmt2 modifies traf6 at R100 to prevent its autoubiquitination, leading eventually to attenuation of antiviral innate immunity. It suggests that PTMs of TRAF6 might also contribute to tightly control RLR signaling as well as those of other components in the RLR signaling pathway.

By switching the zebrafish model and mammalian cell lines, we validate that the function of PRMT2 on RLR signaling is evolutionarily conserved between zebrafish and mammal. Given the sufficient tools in mammalian system, such as Abs and cell lines, further investigation of the precise process and the underlying mechanisms of PRMT2 in acting in its role will give insights in the action of PRMT2 in antiviral innate immunity.

We thank Drs. Hongbing Shu, Bo Zhong, and Mingzhou Chen for providing reagents. We thank Yan Wang at the Core Facility of the Institute of Hydrobiology for FACS.

This work was supported by the Strategic Priority Research Program of the Chinese Academy of Sciences Grant XDA24010308, the National Natural Science Foundation of China Grants 31721005, 31830101, and the National Key R & D Program of China (2018YFD0900602).

The online version of this article contains supplemental material.

Abbreviations used in this article

EPC

epithelioma papulosum cyprinid

HMA

heteroduplex mobility assay

IRF

IFN regulatory factor

ISRE

IFN stimulation response element

MAVS

mitochondrial antiviral signaling protein

MMA

monomethyl arginine

MOI

multiplicity of infection

mpf

month postfertilization

PTM

posttranslational modification

qRT-PCR

quantitative real-time PCR

RIG-I

retinoic acid-inducible gene 1

RLR

RIG-I–like receptor

SeV

Sendai virus

sgRNA

single guide RNA

SVCV

spring viremia of carp virus

TCID50

50% tissue culture-infective dose

TRAF

TNFR-associated factor

1.
Takeuchi
O.
,
S.
Akira
.
2010
.
Pattern recognition receptors and inflammation.
Cell
140
:
805
820
.
2.
Tan
X.
,
L.
Sun
,
J.
Chen
,
Z. J. J.
Chen
.
2018
.
Detection of microbial infections through innate immune sensing of nucleic acids.
Annu. Rev. Microbiol.
72
:
447
478
.
3.
Ablasser
A.
,
M.
Goldeck
,
T.
Cavlar
,
T.
Deimling
,
G.
Witte
,
I.
Röhl
,
K. P.
Hopfner
,
J.
Ludwig
,
V.
Hornung
.
2013
.
cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.
Nature
498
:
380
384
.
4.
Wu
J.
,
L.
Sun
,
X.
Chen
,
F.
Du
,
H.
Shi
,
C.
Chen
,
Z. J.
Chen
.
2013
.
Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA.
Science
339
:
826
830
.
5.
Sun
L.
,
J.
Wu
,
F.
Du
,
X.
Chen
,
Z. J.
Chen
.
2013
.
Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.
Science
339
:
786
791
.
6.
Ablasser
A.
,
F.
Bauernfeind
,
G.
Hartmann
,
E.
Latz
,
K. A.
Fitzgerald
,
V.
Hornung
.
2009
.
RIG-I-dependent sensing of poly(dA:dT) through the induction of an RNA polymerase III-transcribed RNA intermediate.
Nat. Immunol.
10
:
1065
1072
.
7.
Kato
H.
,
O.
Takeuchi
,
E.
Mikamo-Satoh
,
R.
Hirai
,
T.
Kawai
,
K.
Matsushita
,
A.
Hiiragi
,
T. S.
Dermody
,
T.
Fujita
,
S.
Akira
.
2008
.
Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5.
J. Exp. Med.
205
:
1601
1610
.
8.
Loo
Y. M.
,
M.
Gale
Jr
.
2011
.
Immune signaling by RIG-I-like receptors.
Immunity
34
:
680
692
.
9.
Goubau
D.
,
M.
Schlee
,
S.
Deddouche
,
A. J.
Pruijssers
,
T.
Zillinger
,
M.
Goldeck
,
C.
Schuberth
,
A. G.
Van der Veen
,
T.
Fujimura
,
J.
Rehwinkel
, et al
2014
.
Antiviral immunity via RIG-I-mediated recognition of RNA bearing 5'-diphosphates.
Nature
514
:
372
375
.
10.
Ishikawa
H.
,
G. N.
Barber
.
2008
.
STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling [Published erratum appears in 2008 Nature 456: 274.]
Nature
455
:
674
678
.
11.
Liu
S.
,
X.
Cai
,
J.
Wu
,
Q.
Cong
,
X.
Chen
,
T.
Li
,
F.
Du
,
J.
Ren
,
Y. T.
Wu
,
N. V.
Grishin
,
Z. J.
Chen
.
2015
.
Phosphorylation of innate immune adaptor proteins MAVS, STING, and TRIF induces IRF3 activation.
Science
347
:
aaa2630
.
12.
Seth
R. B.
,
L.
Sun
,
C. K.
Ea
,
Z. J.
Chen
.
2005
.
Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.
Cell
122
:
669
682
.
13.
Xu
L. G.
,
Y. Y.
Wang
,
K. J.
Han
,
L. Y.
Li
,
Z.
Zhai
,
H. B.
Shu
.
2005
.
VISA is an adapter protein required for virus-triggered IFN-beta signaling.
Mol. Cell
19
:
727
740
.
14.
Cao
X.
2016
.
Self-regulation and cross-regulation of pattern-recognition receptor signalling in health and disease.
Nat. Rev. Immunol.
16
:
35
50
.
15.
Kawasaki
T.
,
T.
Kawai
,
S.
Akira
.
2011
.
Recognition of nucleic acids by pattern-recognition receptors and its relevance in autoimmunity.
Immunol. Rev.
243
:
61
73
.
16.
Zhang
Z.
,
X.
Fang
,
X.
Wu
,
L.
Ling
,
F.
Chu
,
J.
Li
,
S.
Wang
,
J.
Zang
,
B.
Zhang
,
S.
Ye
, et al
2020
.
Acetylation-dependent deubiquitinase OTUD3 controls MAVS activation in innate antiviral immunity.
Mol. Cell
79
:
304
319.e7
.
17.
Dai
T.
,
L.
Wu
,
S.
Wang
,
J.
Wang
,
F.
Xie
,
Z.
Zhang
,
X.
Fang
,
J.
Li
,
P.
Fang
,
F.
Li
, et al
2018
.
FAF1 regulates antiviral immunity by inhibiting MAVS but is antagonized by phosphorylation upon viral infection.
Cell Host Microbe
24
:
776
790.e5
.
18.
Kato
H.
,
O.
Takeuchi
,
S.
Sato
,
M.
Yoneyama
,
M.
Yamamoto
,
K.
Matsui
,
S.
Uematsu
,
A.
Jung
,
T.
Kawai
,
K. J.
Ishii
, et al
2006
.
Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses.
Nature
441
:
101
105
.
19.
Cai
X.
,
J.
Chen
,
H.
Xu
,
S.
Liu
,
Q. X.
Jiang
,
R.
Halfmann
,
Z. J.
Chen
.
2014
.
Prion-like polymerization underlies signal transduction in antiviral immune defense and inflammasome activation.
Cell
156
:
1207
1222
.
20.
Hou
F.
,
L.
Sun
,
H.
Zheng
,
B.
Skaug
,
Q. X.
Jiang
,
Z. J.
Chen
.
2011
.
MAVS forms functional prion-like aggregates to activate and propagate antiviral innate immune response.
Cell
146
:
448
461
.
21.
Liu
B.
,
M.
Zhang
,
H.
Chu
,
H.
Zhang
,
H.
Wu
,
G.
Song
,
P.
Wang
,
K.
Zhao
,
J.
Hou
,
X.
Wang
, et al
2017
.
The ubiquitin E3 ligase TRIM31 promotes aggregation and activation of the signaling adaptor MAVS through Lys63-linked polyubiquitination.
Nat. Immunol.
18
:
214
224
.
22.
Luo
D.
,
S. C.
Ding
,
A.
Vela
,
A.
Kohlway
,
B. D.
Lindenbach
,
A. M.
Pyle
.
2011
.
Structural insights into RNA recognition by RIG-I.
Cell
147
:
409
422
.
23.
Kowalinski
E.
,
T.
Lunardi
,
A. A.
McCarthy
,
J.
Louber
,
J.
Brunel
,
B.
Grigorov
,
D.
Gerlier
,
S.
Cusack
.
2011
.
Structural basis for the activation of innate immune pattern-recognition receptor RIG-I by viral RNA.
Cell
147
:
423
435
.
24.
Wang
Y.
,
J.
Ludwig
,
C.
Schuberth
,
M.
Goldeck
,
M.
Schlee
,
H.
Li
,
S.
Juranek
,
G.
Sheng
,
R.
Micura
,
T.
Tuschl
, et al
2010
.
Structural and functional insights into 5'-ppp RNA pattern recognition by the innate immune receptor RIG-I.
Nat. Struct. Mol. Biol.
17
:
781
787
.
25.
Cai
X.
,
Y. H.
Chiu
,
Z. J. J.
Chen
.
2014
.
The cGAS-cGAMP-STING pathway of cytosolic DNA sensing and signaling.
Mol. Cell
54
:
289
296
.
26.
Fang
R.
,
Q.
Jiang
,
X.
Zhou
,
C.
Wang
,
Y.
Guan
,
J.
Tao
,
J.
Xi
,
J. M.
Feng
,
Z.
Jiang
.
2017
.
MAVS activates TBK1 and IKKε through TRAFs in NEMO dependent and independent manner.
PLoS Pathog.
13
:
e1006720
.
27.
Ullah
M. O.
,
M. J.
Sweet
,
A.
Mansell
,
S.
Kellie
,
B.
Kobe
.
2016
.
TRIF-dependent TLR signaling, its functions in host defense and inflammation, and its potential as a therapeutic target.
J. Leukoc. Biol.
100
:
27
45
.
28.
Strickson
S.
,
C. H.
Emmerich
,
E. T. H.
Goh
,
J.
Zhang
,
I. R.
Kelsall
,
T.
Macartney
,
C. J.
Hastie
,
A.
Knebel
,
M.
Peggie
,
F.
Marchesi
, et al
2017
.
Roles of the TRAF6 and Pellino E3 ligases in MyD88 and RANKL signaling.
Proc. Natl. Acad. Sci. USA
114
:
E3481
E3489
.
29.
Abe
T.
,
G. N.
Barber
.
2014
.
Cytosolic-DNA-mediated, STING-dependent proinflammatory gene induction necessitates canonical NF-κB activation through TBK1.
J. Virol.
88
:
5328
5341
.
30.
Deng
L.
,
C.
Wang
,
E.
Spencer
,
L.
Yang
,
A.
Braun
,
J.
You
,
C.
Slaughter
,
C.
Pickart
,
Z. J.
Chen
.
2000
.
Activation of the IkappaB kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain.
Cell
103
:
351
361
.
31.
Blanc
R. S.
,
S.
Richard
.
2017
.
Arginine methylation: the coming of age.
Mol. Cell
65
:
8
24
.
32.
Wesche
J.
,
S.
Kühn
,
B. M.
Kessler
,
M.
Salton
,
A.
Wolf
.
2017
.
Protein arginine methylation: a prominent modification and its demethylation.
Cell. Mol. Life Sci.
74
:
3305
3315
.
33.
Yang
Y.
,
M. T.
Bedford
.
2013
.
Protein arginine methyltransferases and cancer.
Nat. Rev. Cancer
13
:
37
50
.
34.
Kim
J. H.
,
B. C.
Yoo
,
W. S.
Yang
,
E.
Kim
,
S.
Hong
,
J. Y.
Cho
.
2016
.
The role of protein arginine methyltransferases in inflammatory responses.
Mediators Inflamm.
2016
:
4028353
35.
Greenblatt
S. M.
,
F.
Liu
,
S. D.
Nimer
.
2016
.
Arginine methyltransferases in normal and malignant hematopoiesis.
Exp. Hematol.
44
:
435
441
.
36.
Liu
F.
,
G.
Cheng
,
P. J.
Hamard
,
S.
Greenblatt
,
L.
Wang
,
N.
Man
,
F.
Perna
,
H.
Xu
,
M.
Tadi
,
L.
Luciani
,
S. D.
Nimer
.
2015
.
Arginine methyltransferase PRMT5 is essential for sustaining normal adult hematopoiesis.
J. Clin. Invest.
125
:
3532
3544
.
37.
Zhang
H.
,
C.
Han
,
T.
Li
,
N.
Li
,
X.
Cao
.
2019
.
The methyltransferase PRMT6 attenuates antiviral innate immunity by blocking TBK1-IRF3 signaling. [Published erratum appears in 2020 Cell. Mol. Immunol. 17: 192.]
Cell. Mol. Immunol.
16
:
800
809
.
38.
Zhu
J.
,
X.
Liu
,
X.
Cai
,
G.
Ouyang
,
S.
Fan
,
J.
Wang
,
W.
Xiao
.
2020
.
Zebrafish prmt7 negatively regulates antiviral responses by suppressing the retinoic acid-inducible gene-I-like receptor signaling.
FASEB J.
34
:
988
1000
.
39.
Zhu
J.
,
X.
Liu
,
X.
Cai
,
G.
Ouyang
,
H.
Zha
,
Z.
Zhou
,
Q.
Liao
,
J.
Wang
,
W.
Xiao
.
2020
.
Zebrafish prmt3 negatively regulates antiviral responses.
FASEB J.
34
:
10212
10227
.
40.
Wei
H.
,
B.
Wang
,
M.
Miyagi
,
Y.
She
,
B.
Gopalan
,
D. B.
Huang
,
G.
Ghosh
,
G. R.
Stark
,
T.
Lu
.
2013
.
PRMT5 dimethylates R30 of the p65 subunit to activate NF-κB.
Proc. Natl. Acad. Sci. USA
110
:
13516
13521
.
41.
Reintjes
A.
,
J. E.
Fuchs
,
L.
Kremser
,
H. H.
Lindner
,
K. R.
Liedl
,
L. A.
Huber
,
T.
Valovka
.
2016
.
Asymmetric arginine dimethylation of RelA provides a repressive mark to modulate TNFα/NF-κB response.
Proc. Natl. Acad. Sci. USA
113
:
4326
4331
.
42.
Qi
C.
,
J.
Chang
,
Y.
Zhu
,
A. V.
Yeldandi
,
S. M.
Rao
,
Y. J.
Zhu
.
2002
.
Identification of protein arginine methyltransferase 2 as a coactivator for estrogen receptor alpha.
J. Biol. Chem.
277
:
28624
28630
.
43.
Meyer
R.
,
S. S.
Wolf
,
M.
Obendorf
.
2007
.
PRMT2, a member of the protein arginine methyltransferase family, is a coactivator of the androgen receptor.
J. Steroid Biochem. Mol. Biol.
107
:
1
14
.
44.
Yoshimoto
T.
,
M.
Boehm
,
M.
Olive
,
M. F.
Crook
,
H.
San
,
T.
Langenickel
,
E. G.
Nabel
.
2006
.
The arginine methyltransferase PRMT2 binds RB and regulates E2F function.
Exp. Cell Res.
312
:
2040
2053
.
45.
Iwasaki
H.
,
J. C.
Kovacic
,
M.
Olive
,
J. K.
Beers
,
T.
Yoshimoto
,
M. F.
Crook
,
L. H.
Tonelli
,
E. G.
Nabel
.
2010
.
Disruption of protein arginine N-methyltransferase 2 regulates leptin signaling and produces leanness in vivo through loss of STAT3 methylation.
Circ. Res.
107
:
992
1001
.
46.
Ganesh
L.
,
T.
Yoshimoto
,
N. C.
Moorthy
,
W.
Akahata
,
M.
Boehm
,
E. G.
Nabel
,
G. J.
Nabel
.
2006
.
Protein methyltransferase 2 inhibits NF-kappaB function and promotes apoptosis.
Mol. Cell. Biol.
26
:
3864
3874
.
47.
Dalloneau
E.
,
P. L.
Pereira
,
V.
Brault
,
E. G.
Nabel
,
Y.
Hérault
.
2011
.
Prmt2 regulates the lipopolysaccharide-induced responses in lungs and macrophages.
J. Immunol.
187
:
4826
4834
.
48.
Zhu
J.
,
X.
Li
,
X.
Cai
,
H.
Zha
,
Z.
Zhou
,
X.
Sun
,
F.
Rong
,
J.
Tang
,
C.
Zhu
,
X.
Liu
, et al
2021
.
Arginine monomethylation by PRMT7 controls MAVS-mediated antiviral innate immunity.
Mol. Cell
81
:
3171
3186.e8
.
49.
Yu
G.
,
X.
Liu
,
J.
Tang
,
C.
Xu
,
G.
Ouyang
,
W.
Xiao
.
2019
.
Neddylation facilitates the antiviral response in zebrafish.
Front. Immunol.
10
:
1432
.
50.
Wang
J.
,
W.
Zhang
,
W.
Ji
,
X.
Liu
,
G.
Ouyang
,
W.
Xiao
.
2014
.
The von hippel-lindau protein suppresses androgen receptor activity.
Mol. Endocrinol.
28
:
239
248
.
51.
Liu
X.
,
X.
Cai
,
D.
Zhang
,
C.
Xu
,
W.
Xiao
.
2016
.
Zebrafish foxo3b negatively regulates antiviral response through suppressing the transactivity of irf3 and irf7.
J. Immunol.
197
:
4736
4749
.
52.
Du
J.
,
D.
Zhang
,
W.
Zhang
,
G.
Ouyang
,
J.
Wang
,
X.
Liu
,
S.
Li
,
W.
Ji
,
W.
Liu
,
W.
Xiao
.
2015
.
pVHL negatively regulates antiviral signaling by targeting MAVS for proteasomal degradation.
J. Immunol.
195
:
1782
1790
.
53.
Lamothe
B.
,
A.
Besse
,
A. D.
Campos
,
W. K.
Webster
,
H.
Wu
,
B. G.
Darnay
.
2007
.
Site-specific Lys-63-linked tumor necrosis factor receptor-associated factor 6 auto-ubiquitination is a critical determinant of I kappa B kinase activation.
J. Biol. Chem.
282
:
4102
4112
.
54.
Yin
Q.
,
S. C.
Lin
,
B.
Lamothe
,
M.
Lu
,
Y. C.
Lo
,
G.
Hura
,
L.
Zheng
,
R. L.
Rich
,
A. D.
Campos
,
D. G.
Myszka
, et al
2009
.
E2 interaction and dimerization in the crystal structure of TRAF6.
Nat. Struct. Mol. Biol.
16
:
658
666
.
55.
Liu
S.
,
J.
Chen
,
X.
Cai
,
J.
Wu
,
X.
Chen
,
Y. T.
Wu
,
L.
Sun
,
Z. J.
Chen
.
2013
.
MAVS recruits multiple ubiquitin E3 ligases to activate antiviral signaling cascades.
eLife
2
:
e00785
.
56.
Shi
Z.
,
Z.
Zhang
,
Z.
Zhang
,
Y.
Wang
,
C.
Li
,
X.
Wang
,
F.
He
,
L.
Sun
,
S.
Jiao
,
W.
Shi
,
Z.
Zhou
.
2015
.
Structural Insights into mitochondrial antiviral signaling protein (MAVS)-tumor necrosis factor receptor-associated factor 6 (TRAF6) signaling.
J. Biol. Chem.
290
:
26811
26820
.
57.
Zhang
W.
,
G.
Wang
,
Z. G.
Xu
,
H.
Tu
,
F.
Hu
,
J.
Dai
,
Y.
Chang
,
Y.
Chen
,
Y.
Lu
,
H.
Zeng
, et al
2019
.
Lactate Is a natural suppressor of RLR signaling by targeting MAVS.
Cell
178
:
176
189.e15
.
58.
Liu
X.
,
C.
Zhu
,
H.
Zha
,
J.
Tang
,
F.
Rong
,
X.
Chen
,
S.
Fan
,
C.
Xu
,
J.
Du
,
J.
Zhu
, et al
2020
.
SIRT5 impairs aggregation and activation of the signaling adaptor MAVS through catalyzing lysine desuccinylation.
EMBO J.
39
:
e103285
.
59.
Li
T.
,
X.
Li
,
K. S.
Attri
,
C.
Liu
,
L.
Li
,
L. E.
Herring
,
J. M.
Asara
,
Y. L.
Lei
,
P. K.
Singh
,
C.
Gao
,
H.
Wen
.
2018
.
O-GlcNAc transferase links glucose metabolism to MAVS-mediated antiviral innate immunity.
Cell Host Microbe
24
:
791
803.e6
.
60.
Zhu
W.
,
J.
Li
,
R.
Zhang
,
Y.
Cai
,
C.
Wang
,
S.
Qi
,
S.
Chen
,
X.
Liang
,
N.
Qi
,
F.
Hou
.
2019
.
TRAF3IP3 mediates the recruitment of TRAF3 to MAVS for antiviral innate immunity.
EMBO J.
38
:
e102075
.
61.
Li
S. Z.
,
Q. P.
Shu
,
Y.
Song
,
H. H.
Zhang
,
Y.
Liu
,
B. X.
Jin
,
T. Z.
Liuyu
,
C.
Li
,
X. C.
Huang
,
R. L.
Du
, et al
2019
.
Phosphorylation of MAVS/VISA by Nemo-like kinase (NLK) for degradation regulates the antiviral innate immune response.
Nat. Commun.
10
:
3233
.
62.
Song
N.
,
Q.
Qi
,
R.
Cao
,
B.
Qin
,
B.
Wang
,
Y.
Wang
,
L.
Zhao
,
W.
Li
,
X.
Du
,
F.
Liu
, et al
2019
.
MAVS O-GlcNAcylation is essential for host antiviral immunity against lethal RNA viruses.
Cell Rep.
28
:
2386
2396.e5
.
63.
Yoo
Y. S.
,
Y. Y.
Park
,
J. H.
Kim
,
H.
Cho
,
S. H.
Kim
,
H. S.
Lee
,
T. H.
Kim
,
Y.
Sun Kim
,
Y.
Lee
,
C. J.
Kim
, et al
2015
.
The mitochondrial ubiquitin ligase MARCH5 resolves MAVS aggregates during antiviral signalling.
Nat. Commun.
6
:
7910
.
64.
Yang
S.
,
A. T.
Harding
,
C.
Sweeney
,
D.
Miao
,
G.
Swan
,
C.
Zhou
,
Z.
Jiang
,
K. A.
Fitzgerald
,
G.
Hammer
,
M. O.
Bergo
, et al
2019
.
Control of antiviral innate immune response by protein geranylgeranylation.
Sci. Adv.
5
:
eaav7999
.
65.
Liu
B.
,
C.
Gao
.
2018
.
Regulation of MAVS activation through post-translational modifications.
Curr. Opin. Immunol.
50
:
75
81
.
66.
Chiang
C.
,
M. U.
Gack
.
2017
.
Post-translational control of intracellular pathogen sensing pathways.
Trends Immunol.
38
:
39
52
.
67.
Ma
D.
,
M.
Yang
,
Q.
Wang
,
C.
Sun
,
H.
Shi
,
W.
Jing
,
Y.
Bi
,
X.
Shen
,
X.
Ma
,
Z.
Qin
, et al
2021
.
Arginine methyltransferase PRMT5 negatively regulates cGAS-mediated antiviral immune response.
Sci. Adv.
7
:
eabc1834
.
68.
Heaton
S. M.
,
N. A.
Borg
,
V. M.
Dixit
.
2016
.
Ubiquitin in the activation and attenuation of innate antiviral immunity.
J. Exp. Med.
213
:
1
13
.
69.
Peng
S. J.
,
R. R.
Yao
,
S. S.
Yu
,
H. Y.
Chen
,
X.
Pang
,
Y.
Zhang
,
J.
Zhang
.
2019
.
UBL4A augments innate immunity by promoting the K63-linked ubiquitination of TRAF6.
J. Immunol.
203
:
1943
1951
.
70.
Zhang
X.
,
C.
Zhu
,
T.
Wang
,
H.
Jiang
,
Y.
Ren
,
Q.
Zhang
,
K.
Wu
,
F.
Liu
,
Y.
Liu
,
J.
Wu
.
2017
.
GP73 represses host innate immune response to promote virus replication by facilitating MAVS and TRAF6 degradation [Published erratum appears in 2018 PLoS Pathog. 14: e1006938.]
PLoS Pathog.
13
:
e1006321
.

The authors have no financial conflicts of interest.

Supplementary data